Ligazy. Zastosowanie ligazy w inżynierii genetycznej:

Wielkość: px
Rozpocząć pokaz od strony:

Download "Ligazy. Zastosowanie ligazy w inżynierii genetycznej:"

Transkrypt

1 Ligazy Katalizują tworzenie wiązań fosfodiestrowych między sąsiednimi grupami 3 OH i 5 PO 4 w kwasach nukleinowych DNA lub RNA. W reakcji tworzą się wysokoenergetyczne pośredniki z udziałem NAD + lub ATP w zależności od typu ligazy. Funkcja in vivo: udział w replikacji opóźnionego pasma DNA, rekombinacja genetyczna, naprawa DNA Zastosowanie ligazy w inżynierii genetycznej: Rekombinacja DNA in vitro łączenie cząsteczek kwasów nukleinowych lepkich lub tępych końców oraz szereg innych bardzo specyficznych zastosowań.

2 Własności ligaz używanych w rekombinacji in vitro Ligazy Substraty kofaktory temperatura lepkie tępe końce DNA-RNA RNA-RNA E. coli tak tak* nie nie NAD + Mg 2+ (1-3 mm) C T4 faga tak tak* tak* tak* ATP Mg 2+ (10 mm) 4 C C Bakterii termofilnych tak nie nie nie NAD + Mg 2+ (10 mm) C Ligacja tępych końców jest znacznie mniej efektywna Bakteryjna ligaza jest zależna od NAD + Fagowe i eukariotyczne ligazy są zależne od ATP

3 Fosfataza alkaliczna Usuwa 5 -fosforan z ssdna, dsdna i RNA, rntp i dntp. Metaloenzym (Zn II) Bakteryjna fosfataza alkaliczna (BAP) najbardziej efektywna, ale jest oporna na ogrzewanie i detergenty. Z tego powodu trudno zakończyć reakcję defosforylacji. Peryplazmatyczny enzym, działa w buforze Tris ph w obecności niskich stężeń Zn +2 (poniżej 1 mm). Alkaliczna fosfataza cielęca (CIAP calf intestinal alkaline phosphatase) mniejsza aktywność niż BAP, ale łatwiejsza do usunięcia (ogrzewanie 65 C 30 min lub 75 C 10 min) w obecności 10 mm EDTA. Alkaliczna fosfataza z arktycznych krewetek (SAP shrimp alkaline phosphatase) aktywność podobna do CIAP, ale inaktywacja 65 C 15 min (zalecane 70 C 20 min).

4 Zastosowanie fosfatazy alkalicznej w inżynierii genetycznej: defosforylacja tj. usuwanie 5 fosforanów z wektorów trawionych enzymami restrykcyjnymi jeżeli DNA wektora zostało strawione jednym enzymem restrykcyjnym defosforylacja zapobiega jego zamykaniu się (autoligacji) wektora bez wstawki traktowanie DNA fosfatazą zmniejsza niestety wydajność klonowania

5 Polimerazy DNA Polimerazy są enzymami, których główną funkcją jest kataliza tworzenia polimerów kwasów nukleinowych RNA i DNA na matrycy istniejących jednoniciowych DNA lub RNA. Proces ten to polimeryzacja. Polimeraza I polimeraza Kornberga (m. cz. 109 kd) Odkryta w 1958 r. Kodowana przez gen pola. Funkcja in vivo: enzym naprawczy Średnia szybkość polimeryzacji 20 nukleotydów/sec, Struktura krystaliczna Taq DNA polimerazy niska procesywność nukleotydów, 400 cząstek na komórkę. 1. Aktywność: 5 3 polimeryzacja DNA Substrat: jednoniciowe DNA i starter z wolną grupą 3 OH. Reakcja: DNA OH DNA- ( p dn) n +PP Wymagania: Mg +2 datp, dttp, dgtp, dctp

6 2. Aktywność: 3 5 egzonukleolityczna-sprawdzająca Substrat: dsdna lub ssdna z wolnym 3 OH końcem. Degraduje DNA od 3 OH. Ta aktywność na dsdna jest blokowana przez aktywność polimeryzacyjną 5 3. Reakcja: dsdna lub ssdna 5 p dn OH Wymagania: Mg Aktywność: 5 3 egzonukleolityczna Substrat: dsdna lub RNA-DNA hybrydy. Degraduje dsdna od 5 końca; degraduje RNA w hybrydzie z DNA - aktywność RNAzy H Wymagania: Mg +2

7 Zasosowanie polimerazy I (holoenzymu) 1. Znakowanie DNA przez przesunięcie przerwy (ang. nick-translation). Tylko ta polimeraza może przeprowadzać tę reakcję ze względu na aktywność egzonukleazy 5 3

8 Fragment Klenowa DNA polimerazy I polimeraza I pozbawiona N-końcowej domeny stanowi tzw. fragment Klenowa. Polimeraza 3 5 egzo- 5 3 egzo (46 kd) nukleaza (22 KD) nukleaza C N Fragment Klenowa (605 aa)

9 Zastosowanie polimerazy Klenowa: 1. Synteza dsdna na matrycy ssdna: Warunki reakcji: matryca ssdna, startery - oligonukleotydy 6-20 n komplementarne do określonego fragmentu DNA z wolną grupą OH, bufor, dntps, Reakcja może z powodzeniem służyć do znakowania sond molekularnych, jeśli do buforu reakcyjnego doda się nukleotydów radioaktywnych lub znakowanych innymi markerami.

10 2. Wypełnianie cofniętych 3 - końców we fragmentach DNA (fill-in reaction): Stosuje się w celu tworzenia tępych końców we fragmentach powstałych po trawieniu enzymami restrykcyjnymi tworzącymi 5 -wystające końce. 3 Reakcja może z powodzeniem służyć do znakowania sond molekularnych, jeśli do buforu reakcyjnego doda się nukleotydów radioaktywnych lub znakowanych innymi markerami.

11 3. Wytrawianie wystających 3 końców: Stosuje się również w celu tworzenia tępych końców we fragmentach powstałych po trawieniu enzymami restrykcyjnymi tworzącymi 3 -wystające końce. Aktywność egzonukleazowa 3 5 polimerazy Klenowa wytrawia wystające nadmierności.

12 DNA polimeraza bakteriofaga T7 zawiera dwie podjednostki, o aktywnościach takich samych jak polimeraza Klenowa. Szczególnie użyteczna ponieważ charakteryzuje się znacznie większą procesywnością i wysoką wiernością (~1000 x większą niż polimeraza Klenowa). Używana jest do sekwencjonowania DNA metodą Sangera, także pod nazwą Sequenase lub Sequenase 2.0 (bez aktywności 3 5 egzonukleolitycznej)

13 DNA-zależna polimeraza DNA Termostabilne DNA polimerazy - mają podobne aktywności jak polimeraza I, ale maksymalną aktywność katalityczną wykazują w C (Taq polimeraza ma tylko 10% maks. aktywności w 37 C). -szybkość reakcji w optymalnej temp. 150 dntp/sec/cząsteczkę enzymu. Polimeraza 3 5 egzo- Żródło i własności nukleaza Taq nie Termus aquaticus. Okres półtrwania 95 C h; wierność 1x x10 5 ; procesywność: 42 n Pfu tak Pyrococcus furiosus. Największa wierność: 1.5x10-6 Vent tak Thermococcus litoralis. Okres półtrwania 95 C - 7 h; wierność pośrednia Zastosowanie polimeraz: Łańcuchowa reakcja polimerazy (PCR) w różnych odmianach.

14 Odwrotna transkryptaza RNA-zależna polimeraza DNA Obecna w retrowirusach, gdzie kopiuje wirusowe RNA przed integracją do genomu. Ma dwie aktywności: -RNA zależnej DNA polimerazy w warunkach laboratoryjnych syntetyzuje DNA na matrycy ssrna i ssdna z jednakową wydajnością. W obu przypadkach wymaga startera RNA lub DNA. Nie ma aktywności 3 5 egzonukleazy (1/500 n jest błędny). - Rnazy H - jest rybonukleazą, która degraduje RNA z RNA-DNA hybrydów. Funkcjonuje zarówno jako endo- i egzonukleaza. Najczęściej wykorzystuje się dwa różne enzymy najczęściej otrzymywane jako białka rekombinowane w E. coli. z wirusa mysiej białaczki Moloneya z wirusa ptasiej mieloblastozy

15 Zastosowanie odwrotnej transkryptazy: 1. Kopiowanie RNA na DNA: szczególnie przydatna podczas przepisywania eukariotycznych transkryptów mrna eukariotycznych genów na tzw. cdna (komplementarne DNA). Funkcję starterów pełnią wówczas krótkie n polimery (oligo dt), komplementarne z ogonkami polia mrna. 2. Tworzenie kopii cdna z mrna przed amplifikacją PCR, w reakcji zwanej RT-PCR, w której używa się starterów komplementarnych do sekwencji kodującej mrna

16 Bakteriofagowe polimerazy RNA Są to RNA polimerazy zależne od DNA. Są używane do transkrypcji in vitro w celu syntezy RNA komplementarnych do jednego z pasm DNA sklonowanego w wektorze do transkrypcji in vitro, z udziałem silnego promotora. Syntetyzowane RNA może być znakowane np. radioaktywnie Komercyjnie dostępne RNA polimerazy: T7 (fag E. coli) rozpoznaje promotor TAATACGACTCACTATAGGG T3 (fag E. coli) rozpoznaje promotor AATTAACCCTCACTAAAGGG SP6 (fag Salmonella typhimurium) rozpoznaje protmotor AATTTAGGTGACACTATAGAA Wiele wektorów przeznaczonych do klonowania DNA ma wbudowane promotory dla różnych polimeraz RNA w sąsiedztwie miejsca wielokrotnego klonowania (MCS). To pozwala na syntezę RNA w sensownej i antysensownej orientacji ze sklonowanej wstawki

17 2. System transkrypcji faga T7 jest używany do ekspresji sklonowanych genów w bakteriach (UWAGA!!! Polimeraza RNA T7 jest tutaj wykorzystywana in vivo) Do bakterii z wbudowanym do chromosomu genem dla T7 polimerazy RNA (pod indukcyjnym promotorem lac) wprowadza się badany gen (sklonowany na wektorze plazmidowym) pod promotorem faga T7. Indukcja systemu następuje po dodaniu IPTG

18 Terminalna transferaza Katalizuje dodawanie nukleotydów dntp do 3 OH końca DNA. Działa na ssdna, dsdna z wystającymi końcami (preferuje wystający koniec 3 ), jest mniej efektywna w przypadku cząsteczek z tępymi końcami. Jest to jedyna polimeraza DNA, która nie wymaga matrycy. Niezbędny jest kobalt jako kofaktor w reakcji dodawania pirymidyn lub Mg +2 w dodawaniu puryn. W odpowiednich warunkach terminalna transferaza może dodać wiele tysięcy dntp lub tylko jeden nukleotyd jeśli jest odpowiednio zmodyfikowany np. ddntp 3 3 Zastosowanie: 1. Znakowanie 3 końców DNA np. znacznikami radioaktywnymi (takie fragmenty DNA wyznakowane tylko na końcach są często wykorzystywane w technice pozwalającej na wizualizację oddziaływania DNA białko technika EMSA)

19 2. Dodawanie homopolimerowych ogonków do DNA: Stosowany np. do rekombinowania i klonowania cdna w wktorach plazmidowych Terminalna transferaza pozwala na tworzenie homopolimerowych ogonków komplementarnych do siebie w liniowych fragmentach DNA.

20 Kinaza polinukleotydowa (PNK) PNK jest enzymem, który katalizuje przeniesienie - fosforanu z ATP na 5 koniec DNA lub RNA. Najczęściej stosuje się rekombinowany enzym faga T4 nadprodukowany w E. coli. Zwykle są stosowane dwa typy reakcji : forward - w której - fosforan z ATP jest przenoszony na 5 koniec defosforylowanego DNA. W reakcji wymiany exchange, w obecności nadmiaru ADP, PNK przenosi terminalny fosforan z ufosforylowanego DNA na ADP i ponownie przenosi radioaktywny - fosforan z [ - 32 P] ATP. Reakcja typu wymiany jest mniej wydajna. Zastosowanie: głównie znakowanie np. radioaktywne cząsteczek DNA używanych jako sond w hybrydyzacji oraz w technice EMSA

21 Nukleazy (inne niż ER) DNazy i RNazy Dzielą się na endo- i egzonukleazy. Ich specyficzność substratowa zależy wyłącznie od stężenia enzymu im większe stężenie tym niższa specyficzność. Dnazy 1. DNaza I - endonukleaza, tnie dsdna i ssdna preferencyjnie w sąsiedztwie C lub T tworząc 5 -fosforylowane di-, tri-, i tetranukleotydy. Nie trawi RNA Zastosowanie: 1. Usuwanie DNA z preparatów RNA; 2. Analiza interakcji DNA-białko (tzw. footprinting); 3. Nadtrawianie DNA w reakcji przesunięcia przerwy 2. Egzonukleaza III (E. coli) - usuwa nukleotydy z 3 końca dsdna - najlepiej działa na DNA z tępymi końcami i 5 wystającymi. Nie działa na ssdna. - używana w tworzeniu określonych delecji liniowych fragmentów DNA.

22 3. Nukleaza Mung Bean endonukleaza specyficzna dla ssdna które trawi do 5 - fosforylowanych mono- i oligonukleotydów. Zastosowanie: usuwanie jednoniciowych końcówek i konwersja na tępe końce 4. Nukleaza BAL 31 egzonukleaza, która trawi 3 -końce ssdna i dsdna zarówno tępych jak i lepkich. Działa też jak endonukleaza na ssdna. Kombinacja tych dwóch aktywności umożliwia progresywne skracanie DNA z obu końców- np. do usuwania zbędnych fragmentów przed klonowaniem. Nukleaza S1 (Aspergillus) - W niskich stężeniach trawi ssdna lub RNA; w wyższych stężeniach trawi dsdna i dsrna oraz DNA:RNA. RNazy 1. Rybonukleaza A endorybonukleaza, trawi ssrnaw 3 końcu reszty pirymidynowej Degraduje RNA do 3 ufosforylowanych mono- i oligonukleotydów Zastosowanie rybonukleaz: 1. Usuwanie kontaminacji RNA w preparatach plazmidowego DNA 2. Mapowanie mutacji w DNA lub RNA przez cięcie niedopasowanych nukleotydów (mismatch cleavage).

Najważniejsze z nich to: enzymy restrykcyjne wektory DNA inne enzymy np. ligazy, fosfatazy, polimerazy, kinazy, nukleazy

Najważniejsze z nich to: enzymy restrykcyjne wektory DNA inne enzymy np. ligazy, fosfatazy, polimerazy, kinazy, nukleazy Aby manipulować genami niezbędne są odpowiednie narzędzia molekularne, które pozwalają uzyskać tzw. zrekombinowane DNA (umożliwiają rekombinację materiału genetycznego in vitro czyli w próbówce) Najważniejsze

Bardziej szczegółowo

2015-11-18. DNA i RNA ENZYMY MODYFIKUJĄCE KOŃCE CZĄSTECZEK. DNA i RNA. DNA i RNA

2015-11-18. DNA i RNA ENZYMY MODYFIKUJĄCE KOŃCE CZĄSTECZEK. DNA i RNA. DNA i RNA Fosfataza alkaliczna CIP Calf Intestine Phosphatase- pochodzenie: jelito cielęce BAP Bacterial Alcaline Phosphatase- pochodzenie: E. coli SAP Shrimp Alcaline Phosphatase- pochodzenie: krewetki Pandalus

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ===============================================================================================

Bardziej szczegółowo

Jaka jest lokalizacja genu na chromosomie? Jakie jest jego sąsiedztwo?

Jaka jest lokalizacja genu na chromosomie? Jakie jest jego sąsiedztwo? Jaka jest lokalizacja genu na chromosomie? Jakie jest jego sąsiedztwo? Hybrydyzacja - powstawanie stabilnych struktur dwuniciowych z cząsteczek jednoniciowych o komplementarnych sekwencjach nukleotydów

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie. Prowadzący: mgr Anna Pawlik i mgr Maciej Dylewski. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie. Prowadzący: mgr Anna Pawlik i mgr Maciej Dylewski. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Biologia i Biologia Medyczna II rok Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią ===============================================================================================

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu DNA) Jest to reakcja powielania (replikacji)

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA DNA 28SRNA 18/16S RNA 5SRNA mrna Ilościowa analiza mrna aktywność genów w zależności od wybranych czynników: o rodzaju tkanki o rodzaju czynnika zewnętrznego o rodzaju upośledzenia szlaku metabolicznego

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

O trawieniu restrykcyjnym

O trawieniu restrykcyjnym O trawieniu restrykcyjnym Enzymy II klasy, Mg 2+, dsdna z rozpoznawaną sekwencją, tępe, lepkie (kohezyjne) końce, warunki reakcji bufor o różnym stężeniu NaCl i określonym ph BSA -stabilizator 37 o C /lub

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

Hybrydyzacja kwasów nukleinowych metodą Southerna

Hybrydyzacja kwasów nukleinowych metodą Southerna Hybrydyzacja kwasów nukleinowych metodą Southerna ENZYMY SŁUŻĄCE DO MANIPULACJI DNA KATEGORIA FUNKCJA CHARAKTERYSTYKA PRZYKŁADY POLIMERAZY synteza nowych polinukleotydów komplementarnych do istniejącej

Bardziej szczegółowo

Mieszanina trójfosforanów deoksyrybonukleotydów (dntp: datp, dgtp, dctp, dttp) Bufor reakcyjny zapewniający odpowiednie warunki reakcji

Mieszanina trójfosforanów deoksyrybonukleotydów (dntp: datp, dgtp, dctp, dttp) Bufor reakcyjny zapewniający odpowiednie warunki reakcji Uniwersytet Gdański, Wydział Biologii Biologia i Biologia medyczna II rok Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią =================================================================

Bardziej szczegółowo

dr hab. Beata Krawczyk Katedra Mikrobiologii PG

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Metody amplifikacji kwasów nukleinowych dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej pj j w ramach Europejskiego Funduszu Społecznego Amplifikacja

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

Endonukleazy restrykcyjne molekularne nożyczki

Endonukleazy restrykcyjne molekularne nożyczki Endonukleazy restrykcyjne molekularne nożyczki Inżynieria genetyczna nauka o technikach badawczych pozwalających na ingerencję w materiał genetyczny organizmów w celu wyizolowania i charakterystyki określonych

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo

Badanie funkcji genu

Badanie funkcji genu Badanie funkcji genu Funkcję genu można zbadać różnymi sposobami Przypadkowa analizy funkcji genu MUTACJA FENOTYP GEN Strategia ukierunkowanej analizy funkcji genu GEN 1. wprowadzenie mutacji w genie 2.

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

Screening, klonowanie, ekspresja i oczyszczanie białek

Screening, klonowanie, ekspresja i oczyszczanie białek Screening, klonowanie, ekspresja i oczyszczanie białek Kiedy gen jest znany Dostępna sekwencja DNA sekwencjonowanie genomu, biblioteki Dostępna sekwencja białka sekwencjonowanie białka Techniki pozyskania

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

TRANSKRYPCJA - I etap ekspresji genów

TRANSKRYPCJA - I etap ekspresji genów Eksparesja genów TRANSKRYPCJA - I etap ekspresji genów Przepisywanie informacji genetycznej z makrocząsteczki DNA na mniejsze i bardziej funkcjonalne cząsteczki pre-mrna Polimeraza RNA ETAP I Inicjacja

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA.

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SPIS TREŚCI: 1. Wprowadzenie. 2. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. 3. Karty pracy. 1. Karta

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

Transformacja pośrednia składa się z trzech etapów:

Transformacja pośrednia składa się z trzech etapów: Transformacja pośrednia składa się z trzech etapów: 1. Otrzymanie pożądanego odcinka DNA z materiału genetycznego dawcy 2. Wprowadzenie obcego DNA do wektora 3. Wprowadzenie wektora, niosącego w sobie

Bardziej szczegółowo

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka Inżynieria genetyczna- 6 ECTS Część I Badanie ekspresji genów Podstawy klonowania i różnicowania transformantów Kolokwium (14pkt) Część II Klonowanie ekspresyjne Od genu do białka Kolokwium (26pkt) EGZAMIN

Bardziej szczegółowo

Klonowanie i transgeneza. dr n.med. Katarzyna Wicher

Klonowanie i transgeneza. dr n.med. Katarzyna Wicher Klonowanie i transgeneza dr n.med. Katarzyna Wicher Klonowanie proces tworzenia idealnej kopii z oryginału oznacza powstawanie lub otrzymywanie genetycznie identycznych: cząsteczek DNA komórek organizmów

Bardziej szczegółowo

Nowoczesne systemy ekspresji genów

Nowoczesne systemy ekspresji genów Nowoczesne systemy ekspresji genów Ekspresja genów w organizmach żywych GEN - pojęcia podstawowe promotor sekwencja kodująca RNA terminator gen Gen - odcinek DNA zawierający zakodowaną informację wystarczającą

Bardziej szczegółowo

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość*

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość* Poznao, 6 lutego 2012 r. Zapytanie ofertowe nr 001 /2012 dotyczące zakupu odczynników chemicznych do izolacji DNA i reakcji PCR GENESIS Polska Sp. z o.o Ul. Za Cytadelą 19, 61-659 Poznao NIP 778 13 56

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

Inżynieria genetyczna Ćwiczenie 3

Inżynieria genetyczna Ćwiczenie 3 Inżynieria genetyczna Ćwiczenie 3 Metoda PCR została opracowana w 1987 r. przez grupę Naukowców z Cetus Corporation w USA. Firma Roche odkupiła od Cetus Corp. prawa do PCR za 300 mln $ Autor K. Mullis

Bardziej szczegółowo

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów Zawartość 139585 Wstęp 1. Historia wirusologii 2. Klasyfikacja wirusów 3. Struktura cząstek wirusowych 3.1. Metody określania struktury cząstek wirusowych 3.2. Budowa cząstek wirusowych o strukturze helikalnej

Bardziej szczegółowo

Podstawy inżynierii genetycznej

Podstawy inżynierii genetycznej Metody bioinformatyki Podstawy inżynierii genetycznej prof. dr hab. Jan Mulawka Czym jest inżynieria genetyczna Zbiór technik rekombinowania i klonowania DNA Wydzielanie i charakteryzowanie pojedyńczych

Bardziej szczegółowo

Biologia molekularna ćwiczenia Zakład Wirusologii

Biologia molekularna ćwiczenia Zakład Wirusologii Biologia molekularna ćwiczenia Zakład Wirusologii Warszawa 2012 Zakład Wirusologii Instytut Mikrobiologii p. 440 A tel. 55-41-419 lub 55-41-421 Prowadzący: ćwiczenie 1 dr Monika Radlińska ćwiczenie 2 dr

Bardziej szczegółowo

Biochemia: Ćw. 11 Metoda RT-PCR

Biochemia: Ćw. 11 Metoda RT-PCR Ćwiczenie 11 METODA RT-PCR Wyciąg z kart charakterystyki substancji niebezpiecznych: bromek etydyny T+ EDTA Xi etanol, 96% F kwas octowy, 96% C -merkaptoetanol N, T Tris Xi UWAGI WSTĘPNE Praca z kwasami

Bardziej szczegółowo

Replikacja DNA. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Replikacja DNA. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Replikacja DNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Replikacja DNA jest bardzo złożonym procesem, w którym biorą udział setki

Bardziej szczegółowo

Markery klasy II -Polimorfizm fragmentów DNA (na ogół niekodujących): - RFLP - VNTR - RAPD

Markery klasy II -Polimorfizm fragmentów DNA (na ogół niekodujących): - RFLP - VNTR - RAPD Marker genetyczny- polimorficzna cecha jakościowa organizmu, którą charakteryzuje proste dziedziczenie (mendlowskie) oraz którą można dokładnie identyfikować metodami analitycznymi. Markery klasy I - Antygeny

Bardziej szczegółowo

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7.2. Metody biologii molekularnej (technika PCR, sekwencjonowanie DNA) wykorzystywane w taksonomii roślin Autor: Magdalena Dudek

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

Biologia molekularna ćwiczenia Zakład Wirusologii

Biologia molekularna ćwiczenia Zakład Wirusologii Biologia molekularna ćwiczenia Zakład Wirusologii Zakład Wirusologii Instytut Mikrobiologii p. 440 A tel. 55-41-419 lub 55-41-421 Prowadzący: ćwiczenie 1 dr Monika Radlińska ćwiczenie 2 dr Agnieszka Kwiatek

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy PIWet Zakład Chorób Ryb Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy łososiowatych o (VHS), wirusa zakaźnej a martwicy układu krwiotwórczego (IHN)

Bardziej szczegółowo

biologia molekularna CLONTECH

biologia molekularna CLONTECH biologia molekularna CLONTECH Clontech Laboratoires to najnowszy członek Takara Bio Group, która jest światowym liderem w produkcji rozwiązań dedykowanych technikom molekularnym. Dostarczając odczynniki,

Bardziej szczegółowo

IZOLACJA KWASÓW NUKLEINOWYCH WARUNKI ZALICZENIA PRZEDMIOTU- 7 ECTS PRZEDMIOT PROGOWY!!!

IZOLACJA KWASÓW NUKLEINOWYCH WARUNKI ZALICZENIA PRZEDMIOTU- 7 ECTS PRZEDMIOT PROGOWY!!! WARUNKI ZALICZENIA PRZEDMIOTU- 7 ECTS PRZEDMIOT PROGOWY!!! W1-4p W2-4p W3-4p W4-4p W5-4p W6-4p W7-4p W8-4p W9-4p W10-4p min 21p wyjściówka I 40p wyjściówka II 40p egzamin I egzamin II min 21p 60p 60p min

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo

Techniki biologii molekularnej Kod przedmiotu

Techniki biologii molekularnej Kod przedmiotu Techniki biologii molekularnej - opis przedmiotu Informacje ogólne Nazwa przedmiotu Techniki biologii molekularnej Kod przedmiotu 13.9-WB-BMD-TBM-W-S14_pNadGenI2Q8V Wydział Kierunek Wydział Nauk Biologicznych

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz.

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. 1 ROZDZIAŁ 1. KOMÓRKI WPROWADZENIE 1 Jedność i różnorodność komórek 1

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

PCR PCR. Model replikacji semikonserwatywnej

PCR PCR. Model replikacji semikonserwatywnej PCR Łańcuchowa reakcja polimerazy (Polymerase Chain Reaction) amplifikacja (namnożenie wielu kopii cząsteczki kwasu nukleinowego) w pierwotnej wersji wykorzystująca model replikacji semikonserwatywnej

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

Rekombinacja in vitro i wprowadzanie zrekombinowanego DNA do komórek

Rekombinacja in vitro i wprowadzanie zrekombinowanego DNA do komórek Rekombinacja in vitro i wprowadzanie zrekombinowanego DNA do komórek 5. Selekcja i analiza transformantów (screening) Jak otrzymać zrekombinowane DNA-schemat klonownia molekularnego Schemat doświadczenia

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

PODSTAWY BIOTECHNOLOGII Piotr Solarczyk

PODSTAWY BIOTECHNOLOGII Piotr Solarczyk PODSTAWY BIOTECHNOLOGII Piotr Solarczyk EFEKT KOŃCOWY Po zakończeniu seminarium powinieneś umieć: wyjaśnić pojęcia plazmid, fag, wektor, wektor ekspresyjny i czółenkowy, klonowanie, transfekcja, transformacja,

Bardziej szczegółowo

MATERIAŁY DO BLOKU INŻYNIERIA GENETYCZNA

MATERIAŁY DO BLOKU INŻYNIERIA GENETYCZNA MATERIAŁY DO BLOKU INŻYNIERIA GENETYCZNA 1. AMPLIFIKACJA FRAGMENTU DNA METODĄ PCR Otrzymywanie dużej liczby kopii określonego fragmentu DNA możliwe jest przy zastosowaniu procedur klonowania lub znacznie

Bardziej szczegółowo

4. DNA podporządkowany człowiekowi manipulacje DNA

4. DNA podporządkowany człowiekowi manipulacje DNA . DN podporządkowany człowiekowi manipulacje DN Poznanie mechanizmów replikacji, transkrypcji i translacji oraz rozwój biochemii, genetyki i informatyki doprowadziły do wynalezienia metod pozwalających

Bardziej szczegółowo

Kwasy Nukleinowe. Rys. 1 Struktura typowego dinukleotydu

Kwasy Nukleinowe. Rys. 1 Struktura typowego dinukleotydu Kwasy Nukleinowe Kwasy nukleinowe są biopolimerami występującymi w komórkach wszystkich organizmów. Wyróżnia się dwa główne typy kwasów nukleinowych: Kwas deoksyrybonukleinowy (DNA) Kwasy rybonukleinowe

Bardziej szczegółowo

DNA musi współdziałać z białkami!

DNA musi współdziałać z białkami! DNA musi współdziałać z białkami! Specyficzność oddziaływań między DNA a białkami wiążącymi DNA zależy od: zmian konformacyjnych wzdłuż cząsteczki DNA zróżnicowania struktury DNA wynikającego z sekwencji

Bardziej szczegółowo

Biotechnologia współczesna

Biotechnologia współczesna Biotechnologia współczesna Co to jest biotechnologia? Jest to interdyscyplinarna dziedzina nauki, integrująca nauki przyrodnicze i inżynieryjne w celu osiągnięcia zastosowao organizmów, komórek lub ich

Bardziej szczegółowo

Transkrypcja katalizowanego rybozymu na rybozym aktywny.

Transkrypcja katalizowanego rybozymu na rybozym aktywny. Transkrypcja katalizowanego rybozymu na rybozym aktywny. Aniela Wochner, James Attwater, Alan Coulson, Philipp Holliger [Tłumaczenie z angielskiego: Damian Kosiorowski] Uważa się, że decydującym wydarzeniem

Bardziej szczegółowo

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI

Bardziej szczegółowo

BIAŁKA KATALITYCZNE ENZYMY ENZYMOLOGIA

BIAŁKA KATALITYCZNE ENZYMY ENZYMOLOGIA BIAŁKA KATALITYCZNE ENZYMY ENZYMOLOGIA dr hab. prof. AWF Agnieszka Zembroń-Łacny Zamiejscowy Wydział Kultury Fizycznej w Gorzowie Wlkp. Akademii Wychowania Fizycznego w Poznaniu ROBACZKI ŚWIĘTOJAŃSKIE

Bardziej szczegółowo

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3 Księgarnia PWN: Terry A. Brown - Genomy Przedmowa Przedmowa do drugiego wydania polskiego Wstęp Spis rozdziałów Skróty V VI VII XI XIX Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy

Bardziej szczegółowo

Prof. UG, dr hab. Uniwersytet Gdański, Wydział Chemii, Wita Stwosza 63, Gdańsk tel ,

Prof. UG, dr hab. Uniwersytet Gdański, Wydział Chemii, Wita Stwosza 63, Gdańsk tel , Prof. UG, dr hab. Uniwersytet Gdański, Wydział Chemii, Wita Stwosza 63, Gdańsk 80-308 Piotr Mucha tel. 0585235432, e-mail: piotr.mucha@ug.edu.pl Gdańsk, 17.10.2015r. Recenzja pracy doktorskiej mgr Ireneusza

Bardziej szczegółowo

Wprowadzenie do biologii molekularnej.

Wprowadzenie do biologii molekularnej. Wprowadzenie do biologii molekularnej. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Biologia molekularna zajmuje się badaniem biologicznych

Bardziej szczegółowo

Laboratorium z biochemii

Laboratorium z biochemii Laboratorium z biochemii DLA STUDENTÓW BIOLOGII, BIOTECHNOLOGII I OCHRONY ŚRODOWISKA Praca zbiorowa pod redakcją Antoniego Polanowskiego Poprawki do wydania III wprowadzone pod redakcją Justyny Ciuraszkiewicz

Bardziej szczegółowo

ENZYMY RESTRYKCYJNE ENZYMY RESTRYKCYJNE CZYM RÓŻNIĄ SIĘ POSZCZEGÓLNE ENZYMY? nazewnictwo: EcoRV

ENZYMY RESTRYKCYJNE ENZYMY RESTRYKCYJNE CZYM RÓŻNIĄ SIĘ POSZCZEGÓLNE ENZYMY? nazewnictwo: EcoRV ENZYMY RESTRYKCYJNE Enzymy z klasy endonukleaz (hydrolaz), wykazujące powinowactwo do specyficznych fragmentów dwuniciowych cząsteczek DNA i hydrolizujące wiązania fosfodiestrowe w obu niciach Naturalnie

Bardziej szczegółowo

Elektroforeza kwasów nukleinowych

Elektroforeza kwasów nukleinowych Elektroforeza kwasów nukleinowych Elektroforeza jest podstawową techniką wizualizacji kwasów nukleinowych pozwala bezpośrednio identyfikować cząsteczki DNA i jest stosunkowo czuła (po odpowiednim wybarwieniu

Bardziej szczegółowo

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

Peptydowe kwasy nukleinowe (PNA)

Peptydowe kwasy nukleinowe (PNA) Peptydowe kwasy nukleinowe (PNA) Normalny przekaz informacji genetycznej w komórce następuje według ogólnie przyjętego schematu: informacja zawarta w DNA jest przepisywana na informacyjne RNA (proces transkrypcji)

Bardziej szczegółowo

Wprowadzanie zrekombinowanego DNA do komórek bakterii. Sposoby wprowadzania DNA do innych (niż bakterie) typów komórek

Wprowadzanie zrekombinowanego DNA do komórek bakterii. Sposoby wprowadzania DNA do innych (niż bakterie) typów komórek Ligacja DNA - rekombinacja in vitro Wprowadzanie zrekombinowanego DNA do komórek bakterii Sposoby wprowadzania DNA do innych (niż bakterie) typów komórek Jak otrzymać zrekombinowane DNA? Schemat doświadczenia

Bardziej szczegółowo

Biologia molekularna wirusów. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Biologia molekularna wirusów. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Biologia molekularna wirusów Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Co to jest wirus? Cząsteczka złożona z kwasu nukleinowego (DNA

Bardziej szczegółowo

Elektroforeza kwasów nukleinowych

Elektroforeza kwasów nukleinowych Elektroforeza kwasów nukleinowych Elektroforeza jest podstawową techniką wizualizacji kwasów nukleinowych pozwala bezpośrednio identyfikować cząsteczki DNA i jest stosunkowo czuła (po odpowiednim wybarwieniu

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

Znaczenie genetyki. Opracował A. Podgórski

Znaczenie genetyki. Opracował A. Podgórski Znaczenie genetyki Opracował A. Podgórski InŜynieria genetyczna InŜynieria genetyczna ingerencja w materiał genetyczny organizmów, w celu zmiany ich właściwości dziedzicznych. Istota inŝynierii genetycznej

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ www.cytogen.com.pl ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ 3 Spis treści 4 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 22 22 Stabilność technologii TAG Specifikacja qpcr Mix-ów Kompatybilność kitów qpcr

Bardziej szczegółowo

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją).

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Czym jest życie? metabolizm + informacja (replikacja) 2 Cząsteczki organiczne mog y powstać w atmosferze pierwotnej

Bardziej szczegółowo

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu Protokół pochodzi ze strony molekularnie.wordpress.com Kopiowanie i rozpowszechnianie wyłącznie w całości, z zachowaniem praw autorskich zgodnie z zasadami licencji GNU Dziękuję za uszanowanie mojej pracy,

Bardziej szczegółowo

AmpliTest TBEV (Real Time PCR)

AmpliTest TBEV (Real Time PCR) AmpliTest TBEV (Real Time PCR) Zestaw do wykrywania sekwencji RNA specyficznych dla TBEV (Tick-borne encephalitis virus) techniką Real Time PCR Nr kat.: RV03-50 Wielkość zestawu: 50 oznaczeń Objętość pojedynczej

Bardziej szczegółowo

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7 Poznań, dnia 28.04.2014 r. BioVentures Institute Spółka z ograniczoną odpowiedzialnością ul. Promienista 83 60 141 Poznań Zapytanie ofertowe nr 01/2014 Projekt Nowa technologia wytwarzania szczepionek

Bardziej szczegółowo

BUDOWA I FUNKCJA GENOMU LUDZKIEGO

BUDOWA I FUNKCJA GENOMU LUDZKIEGO BUDOWA I FUNKCJA GENOMU LUDZKIEGO Magdalena Mayer Katedra i Zakład Genetyki Medycznej UM w Poznaniu 1. Projekt poznania genomu człowieka: Cele programu: - skonstruowanie szczegółowych map fizycznych i

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

Organizacja genomu człowieka i sekwencjonowanie DNA

Organizacja genomu człowieka i sekwencjonowanie DNA Organizacja genomu człowieka i sekwencjonowanie DNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Organizacja genów na ludzkim chromosomie.

Bardziej szczegółowo

ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ

ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ Paweł Bortkiewicz UAM bortpa@amu.edu.pl INŻYNIERIA GENETYCZNA (REKOMBINACJA DNA IN VITRO) zespół technik pozwalających na zamierzone, kontrolowane, przewidziane przez

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) 1 Budowa i funkcje

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) I. Od genu do cechy Budowa i funkcje kwasów

Bardziej szczegółowo