Nowoczesne systemy ekspresji genów

Wielkość: px
Rozpocząć pokaz od strony:

Download "Nowoczesne systemy ekspresji genów"

Transkrypt

1 Nowoczesne systemy ekspresji genów

2 Ekspresja genów w organizmach żywych

3 GEN - pojęcia podstawowe promotor sekwencja kodująca RNA terminator gen Gen - odcinek DNA zawierający zakodowaną informację wystarczającą do wytworzenia jednego rodzaju białka (definicja jest prawdziwa w odniesieniu do większości genów komórki, ale istnieją też geny, które kodują na przykład cząsteczki rrna i trna) Cistron - sekwencja kodująca RNA, której ekspresja prowadzi do powstania pojedynczego łańcucha polipeptydowego

4 GEN - pojęcia podstawowe Promotor Część genu, do której przyłączają się czynniki transkrypcyjne i polimeraza RNA. Jest jedną z części regulatorowych genu. Od przyłączenia polimerazy RNA do promotora rozpoczyna się transkrypcja Terminator Odcinek genu, na którym kończy się transkrypcja

5 GEN - pojęcia podstawowe Sekwencje regulatorowe części genu, które nie zawierają informacji genetycznej, ale kierują jej odczytywaniem wzmacniacze ekspresji (Wz) wygaszacze ekspresji (Wy) inne - niezwiązane z działaniem czynników transkrypcyjnych, np. sekwencje liderowe DNA

6 Ekspresja genów Ekspresja genów może zachodzić z różną wydajnością w zależności od środowiska i warunków gen a gen b A A A A A A B

7 Ekspresja genów w organizmach prokariotycznych i eukariotycznych Prokariota Transkrypcja Transkrypcja jest połączona z translacją Geny transkrybowane są przez jeden rodzaj polimerazy RNA Pod kontrolą jednego promotora może znajdować się więcej niż jeden cistron taką jednostkę ekspresyjną nazywamy operonem Eukariota Transkrypcja Transkrypcja jest rozdzielona od translacji Geny są transkrybowane przez trzy różne polimerazy RNA Pod kontrolą jednego promotora znajduje się jeden cistron

8 Systemy ekspresji (nadekspresji) genów

9 Nadekspresja białek - sens zastosowania Eksperyment badanie represora lac 10 cząstek białka w jednej komórce 1 μmol cząsteczek potrzebny do badań biochemicznych 1 μmol = 6x10 17 cząsteczek białka Czyli do eksperymentu potrzeba 6x10 16 komórek 1 litr hodowli E. coli w fazie stacjonarnej zawiera ~4x10 11 komórek Czyli (zakładając 100% wydajność procesu oczyszczania) 1 μmol represora lac = litrów hodowli E. coli

10 Zastosowanie Badania podstawowe: określenie struktury białek (NMR, krystalografia) enzymologia manipulacje genetyczne (mutageneza) badanie oddziaływań międzycząsteczkowych Zastosowania terapeutyczne i komercyjne: medycyna diagnostyka przemysł chemiczny przemysł spożywczy

11 Schemat postępowania Klonowanie eukariotycznego cdna lub genu prokariotycznego (Przeklonowanie sekwencji do wektora ekspresyjnego) Przeniesienie konstruktu do komórek gospodarza/komórek Charakterystyka produktu (białka): oczyszczanie testy enzymatyczne

12 Przygotowanie do eksperymentu Wybór gospodarza systemy in vivo (przykłady) Escherichia coli Saccharomyces cerevisiae Pichia pastoris hodowla tkankowa komórek ssaczych organizmy transgeniczne wyspecjalizowane systemy in vitro

13 Przygotowanie do eksperymentu Wybór wektora wydajność sposób oczyszczania modyfikacje potranslacyjne konieczność przeprowadzenia modyfikacji genu/cdna koszt stopień trudności

14

15

16 Przygotowanie do eksperymentu wybór protokołu klonowania/ekspresji rodzaj białka rozpuszczalność i stabilność białka miejsce produkcji białka (cytoplazma, pożywka) sposób oczyszczania białka

17 Etap I poszukiwanie informacji

18 Źródła informacji gdy sekwencja genu jest znana 1. Publikacje naukowe zawierają informacje o systemach ekspresyjnych użytych do ekspresji danego genu powinny zawierać odnośnik do sekwencji genu w postaci tzw. Accession No. dla wybranej bazy danych dostępnej w internecie np. NCBI (www.ncbi.nih.gov)

19 Źródła informacji gdy sekwencja genu jest znana 2. Bazy sekwencji nukleotydowych NCBI: National Centre for Biotechnology Information (Rockville Pike, Bethesda) Dostęp do sekwencji genów można uzyskiwać poprzez: podanie accession no. uzyskany z publikacji (Vonakis et al. J. Biol. Chem. 272 (38), (1997)) Accession No: AF000301

20

21

22 Jak zdobyć informacje o genie jeśli sekwencja jego nie jest znana ale znana jest sekwencja białka lub jej fragmenty Sekwencję białka mozna poznać dysponując jego czystym preparatem dzięki ograniczonej proteolizie i sekwencjonowaniu uzyskanych peptydów

23

24 Jak zdobyć informacje o genie jeśli jego sekwencja nie jest znana W oparciu o sekwencje białka można zaprojektować zdegenerowane startery, które użyjemy w reakcji PCR i uzyskamy: Który prążek wybrać do sekwencjonowania??? Należy oprzeć się o przybliżenie: 1 kd białka 333 par zasad DNA i znaną masę białka (w kd)

25 Jak zdobyć informacje o genie jeśli sekwencja jego nie jest znana i nie jest znana sekwencja białka ale: Znamy właściwości fizykochemiczne białka, przede wszystkim jego Mw: W przypadku Prokariota możemy stworzyć bibliotekę DNA genomowego w celu uzyskania sekwencji W przypadku Eukariota możemy stworzyć bibliotekę DNA genomowego w celu uzyskania sekwencji

26 Jak zdobyć informacje o genie jeśli nie jest znana jego sekwencja, ani sekwencja kodowanego przez niego białka Wykorzystując dane uzyskane z bibliotek cdna możemy uzyskać sekwencję genów interesujących nas białek

27 Jak zdobyć informacje o genie, jeśli znamy tylko jego źródło? Istnieje możliwość zastosowania zasady genomiki porównawczej: Odnalezienie informacji o dostępności sekwencji analogicznych genów z najbliższych taksonomicznie krewnych Porównanie sekwencji nukleotydowych wybranych genów z organizmów pokrewnych do organizmu źródłowego

28 Programy komputerowe Gene doc

29

30 Programy komputerowe VectorNTI (INVITROGEN) Contig Express AlignX

31 AlignX (1) MfAJ (1) McAY (1) MeAJ (1) rubrumaj (1) Consensus (1) ATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCC TCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCC ATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCC ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCNGGCCG--GAGGCTGGCCCCCCACGAT---A TCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCC (255) MfAJ252337(222) CGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCG---AGCAACGCAAAT McAY213657(245) CGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCG---AGCAACGCAAAT MeAJ252330(222) CGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCG---AGCAACGCAAAT rubrumaj270808(219) CGCCCGCCGGAGGACAGACACCAAGAAAAAATTCTCTGAAGAGCTGTCAGTCTGAGCGTTTAGCAAGCACAAT Consensus(255) CGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCG AGCAACGCAAAT

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe Promotory genu Promotor bliski leży w odległości do 40 pz od miejsca startu transkrypcji, zawiera kasetę TATA. Kaseta TATA to silnie konserwowana sekwencja TATAAAA, występująca w większości promotorów

Bardziej szczegółowo

TRANSKRYPCJA - I etap ekspresji genów

TRANSKRYPCJA - I etap ekspresji genów Eksparesja genów TRANSKRYPCJA - I etap ekspresji genów Przepisywanie informacji genetycznej z makrocząsteczki DNA na mniejsze i bardziej funkcjonalne cząsteczki pre-mrna Polimeraza RNA ETAP I Inicjacja

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

The Role of Maf1 Protein in trna Processing and Stabilization / Rola białka Maf1 w dojrzewaniu i kontroli stabilności trna

The Role of Maf1 Protein in trna Processing and Stabilization / Rola białka Maf1 w dojrzewaniu i kontroli stabilności trna Streszczenie rozprawy doktorskiej pt. The Role of Maf1 Protein in trna Processing and Stabilization / Rola białka Maf1 w dojrzewaniu i kontroli stabilności trna mgr Tomasz Turowski, promotor prof. dr hab.

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo

Badanie funkcji genu

Badanie funkcji genu Badanie funkcji genu Funkcję genu można zbadać różnymi sposobami Przypadkowa analizy funkcji genu MUTACJA FENOTYP GEN Strategia ukierunkowanej analizy funkcji genu GEN 1. wprowadzenie mutacji w genie 2.

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

1. Biotechnologia i inżynieria genetyczna zagadnienia wstępne 13

1. Biotechnologia i inżynieria genetyczna zagadnienia wstępne 13 Spis treści Przedmowa 11 1. Biotechnologia i inżynieria genetyczna zagadnienia wstępne 13 1.1. Wprowadzenie 13 1.2. Biotechnologia żywności znaczenie gospodarcze i społeczne 13 1.3. Produkty modyfikowane

Bardziej szczegółowo

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów Zawartość 139585 Wstęp 1. Historia wirusologii 2. Klasyfikacja wirusów 3. Struktura cząstek wirusowych 3.1. Metody określania struktury cząstek wirusowych 3.2. Budowa cząstek wirusowych o strukturze helikalnej

Bardziej szczegółowo

Escherichia coli. System pbad

Escherichia coli. System pbad Escherichia coli System pbad System pbad System pbad został skonstruowany w oparciu o elementy regulacji transkrypcji operonu arabinozowego E. coli Elementy regulacji transkrypcji operonu arabinozowego

Bardziej szczegółowo

SCENARIUSZ LEKCJI. TEMAT LEKCJI: Podstawowe techniki inżynierii genetycznej. Streszczenie

SCENARIUSZ LEKCJI. TEMAT LEKCJI: Podstawowe techniki inżynierii genetycznej. Streszczenie SCENARIUSZ LEKCJI OPRACOWANY W RAMACH PROJEKTU: INFORMATYKA MÓJ SPOSÓB NA POZNANIE I OPISANIE ŚWIATA. PROGRAM NAUCZANIA INFORMATYKI Z ELEMENTAMI PRZEDMIOTÓW MATEMATYCZNO-PRZYRODNICZYCH Autorzy scenariusza:

Bardziej szczegółowo

SYLABUS. Wydział Biologiczno-Rolniczy. Katedra Biochemii i Biologii Komórki

SYLABUS. Wydział Biologiczno-Rolniczy. Katedra Biochemii i Biologii Komórki SYLABUS 1.1. PODSTAWOWE INFORMACJE O PRZEDMIOCIE/MODULE Nazwa przedmiotu/ modułu Biologia molekularna Kod przedmiotu/ modułu* Wydział (nazwa jednostki prowadzącej kierunek) Nazwa jednostki realizującej

Bardziej szczegółowo

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz.

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. 1 ROZDZIAŁ 1. KOMÓRKI WPROWADZENIE 1 Jedność i różnorodność komórek 1

Bardziej szczegółowo

Drożdże piekarskie jako organizm modelowy w genetyce

Drożdże piekarskie jako organizm modelowy w genetyce Drożdże piekarskie jako organizm modelowy w genetyce W dobie nowoczesnych, szybko rozwijających się metod sekwencjonowania DNA, naukowcy bez problemu potrafią zidentyfikować kolejność par nukleotydowych

Bardziej szczegółowo

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP WYNALAZKI BIOTECHNOLOGICZNE W POLSCE Ewa Waszkowska ekspert UPRP Źródła informacji w biotechnologii projekt SLING Warszawa, 9-10.12.2010 PLAN WYSTĄPIENIA Umocowania prawne Wynalazki biotechnologiczne Statystyka

Bardziej szczegółowo

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA DNA 28SRNA 18/16S RNA 5SRNA mrna Ilościowa analiza mrna aktywność genów w zależności od wybranych czynników: o rodzaju tkanki o rodzaju czynnika zewnętrznego o rodzaju upośledzenia szlaku metabolicznego

Bardziej szczegółowo

Prokaryotyczne i eukaryotyczne systemy nadekspresji bia lek.

Prokaryotyczne i eukaryotyczne systemy nadekspresji bia lek. Prokaryotyczne i eukaryotyczne systemy nadekspresji bia lek. Czyli jak produkować dużo, latwo i tanio dr ebiewski Zak lad Biotechnologii, Wydzia l Biologii i Nauk o Ziemi, Uniwersytet Miko laja Kopernika,

Bardziej szczegółowo

Ekspresja białek w komórkach ssaczych

Ekspresja białek w komórkach ssaczych Ekspresja białek w komórkach ssaczych Ekspresja białek w komórkach ssaczych Używane powszechnie w laboratoriach ssacze linie komórkowe są zmodyfikowane w celu pełnienia roli gospodarza ekspresji białek

Bardziej szczegółowo

Sesja sponsorowana przez Polską Sieć Biologii Molekularnej SESJA 1 ORGANIZACJA MATERIAŁU GENETYCZNEGO WYKŁADY

Sesja sponsorowana przez Polską Sieć Biologii Molekularnej SESJA 1 ORGANIZACJA MATERIAŁU GENETYCZNEGO WYKŁADY Sesja sponsorowana przez Polską Sieć Biologii Molekularnej SESJA 1 ORGANIZACJA MATERIAŁU GENETYCZNEGO WYKŁADY 12 SESJA 1 WYKŁADY W01-01 ORGANIZACJA GENOMU BAKTERIOFAGA P1, IMPLIKACJE DLA PROCESU PROPAGACJI

Bardziej szczegółowo

Pytania Egzamin Licencjacki. 1. Wyjaśnij pojęcie: szybkość reakcji enzymatycznej. Omów metodę wyznaczenia szybkości reakcji enzymatycznej.

Pytania Egzamin Licencjacki. 1. Wyjaśnij pojęcie: szybkość reakcji enzymatycznej. Omów metodę wyznaczenia szybkości reakcji enzymatycznej. Pytania Egzamin Licencjacki Międzyuczelniany Wydział Biotechnologii UG i GUMed 1. Wyjaśnij pojęcie: szybkość reakcji enzymatycznej. Omów metodę wyznaczenia szybkości reakcji enzymatycznej. 2. Wyjaśnij

Bardziej szczegółowo

Drożdżowe systemy ekspresyjne

Drożdżowe systemy ekspresyjne Drożdże Drożdżowe systemy ekspresyjne Zalety: możliwość uzyskania dużej biomasy modyfikacje postranslacyjne eksprymowanych białek transport eksprymowanych białek do pożywki Duża biomasa W przypadku hodowli

Bardziej szczegółowo

Ekspresja genów heterogenicznych w drożdżach Pichia pastoris

Ekspresja genów heterogenicznych w drożdżach Pichia pastoris Ekspresja genów heterogenicznych w drożdżach Pichia pastoris Ekspresja genów heterogenicznych w drożdżach Pichia pastoris Drożdże Pichia pastoris należą do drożdży metanolotroficznych tj. zdolnych do wykorzystywania

Bardziej szczegółowo

Sylabus Biologia molekularna

Sylabus Biologia molekularna Sylabus Biologia molekularna 1. Metryczka Nazwa Wydziału Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej Program kształcenia Farmacja, jednolite studia magisterskie, forma studiów: stacjonarne

Bardziej szczegółowo

Techniki biologii molekularnej Kod przedmiotu

Techniki biologii molekularnej Kod przedmiotu Techniki biologii molekularnej - opis przedmiotu Informacje ogólne Nazwa przedmiotu Techniki biologii molekularnej Kod przedmiotu 13.9-WB-BMD-TBM-W-S14_pNadGenI2Q8V Wydział Kierunek Wydział Nauk Biologicznych

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ===============================================================================================

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

Transkrypcja i obróbka RNA. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Transkrypcja i obróbka RNA. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Transkrypcja i obróbka RNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Centralny dogmat biologii molekularnej: sekwencja DNA zostaje

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

Biologia molekularna

Biologia molekularna Biologia molekularna 1. Metryczka Nazwa Wydziału Program kształcenia Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej Analityka Medyczna, studia jednolite magisterskie, studia stacjonarne i niestacjonarne

Bardziej szczegółowo

Rozkład materiału z biologii dla klasy III AD. 7 godz / tyg rok szkolny 2016/17

Rozkład materiału z biologii dla klasy III AD. 7 godz / tyg rok szkolny 2016/17 Rozkład materiału z biologii dla klasy III AD zakres rozszerzony LO 7 godz / tyg rok szkolny 2016/17 Biologia na czasie 2 zakres rozszerzony nr dopuszczenia 564/2/2012 Biologia na czasie 3 zakres rozszerzony

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

Wybór systemu ekspresyjnego

Wybór systemu ekspresyjnego Wybór systemu ekspresyjnego Bakterie Escherichia coli Zalety: wysoki poziom ekspresji (do 500 mg/l hodowli) dobrze poznany system proste technologie niskie koszty Wady: brak modyfikacji potranslacyjnych

Bardziej szczegółowo

Wprowadzenie do biologii molekularnej.

Wprowadzenie do biologii molekularnej. Wprowadzenie do biologii molekularnej. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Biologia molekularna zajmuje się badaniem biologicznych

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka Inżynieria genetyczna- 6 ECTS Część I Badanie ekspresji genów Podstawy klonowania i różnicowania transformantów Kolokwium (14pkt) Część II Klonowanie ekspresyjne Od genu do białka Kolokwium (26pkt) EGZAMIN

Bardziej szczegółowo

BUDOWA I FUNKCJA GENOMU LUDZKIEGO

BUDOWA I FUNKCJA GENOMU LUDZKIEGO BUDOWA I FUNKCJA GENOMU LUDZKIEGO Magdalena Mayer Katedra i Zakład Genetyki Medycznej UM w Poznaniu 1. Projekt poznania genomu człowieka: Cele programu: - skonstruowanie szczegółowych map fizycznych i

Bardziej szczegółowo

Zgodnie z tzw. modelem interpunkcji trna, cząsteczki mt-trna wyznaczają miejsca

Zgodnie z tzw. modelem interpunkcji trna, cząsteczki mt-trna wyznaczają miejsca Tytuł pracy: Autor: Promotor rozprawy: Recenzenci: Funkcje białek ELAC2 i SUV3 u ssaków i ryb Danio rerio. Praca doktorska wykonana w Instytucie Genetyki i Biotechnologii, Wydział Biologii UW Lien Brzeźniak

Bardziej szczegółowo

DOTACJE NA INNOWACJE. Uzyskanie ochrony patentowej aptamerów RNA jako inhibitorów rybonukleazy Dicer Projekt nr: POIG.01.03.

DOTACJE NA INNOWACJE. Uzyskanie ochrony patentowej aptamerów RNA jako inhibitorów rybonukleazy Dicer Projekt nr: POIG.01.03. Uzyskanie ochrony patentowej aptamerów RNA jako inhibitorów rybonukleazy Dicer Projekt nr: POIG.01.03.02-00-007/08 Kierownik projektu: prof. dr hab. M. Figlerowicz Wartość dofinansowania: 68 300,00 zł

Bardziej szczegółowo

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3 Księgarnia PWN: Terry A. Brown - Genomy Przedmowa Przedmowa do drugiego wydania polskiego Wstęp Spis rozdziałów Skróty V VI VII XI XIX Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy

Bardziej szczegółowo

Genetyka. Krótkie wykłady H. Fletcher, I. Hickey, P. Winter,

Genetyka. Krótkie wykłady H. Fletcher, I. Hickey, P. Winter, Genetyka. Krótkie wykłady H. Fletcher, I. Hickey, P. Winter, Wydanie trzecie, zmienione, Wydawnictwo Naukowe PWN 2011 Genetyka ogólna. Skrypt do ćwiczeń dla studentów biologii A. Sadakierska-Chudy, G.

Bardziej szczegółowo

Krakowska Akademia im. Andrzeja Frycza Modrzewskiego. Karta przedmiotu. obowiązuje studentów, którzy rozpoczęli studia w roku akademickim 2013/2014

Krakowska Akademia im. Andrzeja Frycza Modrzewskiego. Karta przedmiotu. obowiązuje studentów, którzy rozpoczęli studia w roku akademickim 2013/2014 Krakowska Akademia im. Andrzeja Frycza Modrzewskiego Karta przedmiotu WydziałZdrowia i Nauk Medycznych obowiązuje studentów, którzy rozpoczęli studia w roku akademickim 013/01 Kierunek studiów: Kosmetologia

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier.

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier. ID Testu: F5679R8 Imię i nazwisko ucznia Klasa Data 1. Na indywidualne cechy danego osobnika ma (maja) wpływ A. wyłacznie czynniki środowiskowe. B. czynniki środowiskowe i materiał genetyczny. C. wyłacznie

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 4 Jak działają geny?

Bardziej szczegółowo

Patentowanie wynalazków z dziedziny biotechnologii

Patentowanie wynalazków z dziedziny biotechnologii chroń swoje pomysły 3 Kongres Świata Przemysłu Farmaceutycznego Poznań, 16-17 czerwca 2011 Patentowanie wynalazków z dziedziny biotechnologii dr Izabela Milczarek Czym jest biotechnologia? Biotechnologia,

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI

PODSTAWY BIOINFORMATYKI PODSTAWY BIOINFORMATYKI Prowadzący: JOANNA SZYDA ADRIAN DROśDś WSTĘP 1. Katedra Genetyki badania bioinformatyczne 2. Tematyka przedmiotu 3. Charakterystyka wykładów 4. Charakterystyka ćwiczeń 5. Informacje

Bardziej szczegółowo

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7 Poznań, dnia 28.04.2014 r. BioVentures Institute Spółka z ograniczoną odpowiedzialnością ul. Promienista 83 60 141 Poznań Zapytanie ofertowe nr 01/2014 Projekt Nowa technologia wytwarzania szczepionek

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

Bioinformatyka. Michał Przyłuski

Bioinformatyka. Michał Przyłuski Bioinformatyka Michał Przyłuski Plan prezentacji Wstęp biologiczny Biologia molekularna genetyka Bioinformatyka Przykłady zastosowań: sekwencjonowanie mikromacierze filogenetyka Czemu wstęp biologiczny?

Bardziej szczegółowo

Numer pytania Numer pytania

Numer pytania Numer pytania KONKURS BIOLOGICZNY ZMAGANIA Z GENETYKĄ 2016/2017 ELIMINACJE SZKOLNE I SESJA GENETYKA MOLEKULARNA KOD UCZNIA. IMIĘ i NAZWISKO. DATA... GODZINA.. Test, który otrzymałeś zawiera 20 pytań zamkniętych. W każdym

Bardziej szczegółowo

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI

Bardziej szczegółowo

Jajko czy kura? czyli gdzie dwóch się bije, tam trzeci korzysta

Jajko czy kura? czyli gdzie dwóch się bije, tam trzeci korzysta Jajko czy kura? czyli gdzie dwóch się bije, tam trzeci korzysta Jacek Śmietański IIMK UJ 21.10.2015 Jajko czy kura Pytanie tytułowe Co było na początku? Jajko czy kura? Rother M., 2012 Pytanie tytułowe

Bardziej szczegółowo

ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ

ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ Paweł Bortkiewicz UAM bortpa@amu.edu.pl INŻYNIERIA GENETYCZNA (REKOMBINACJA DNA IN VITRO) zespół technik pozwalających na zamierzone, kontrolowane, przewidziane przez

Bardziej szczegółowo

Definicje. Białka rekombinowane (ang. recombinant proteins, r-proteins) Ukierunkowana mutageneza (ang. site-directed/site-specific mutagenesis)

Definicje. Białka rekombinowane (ang. recombinant proteins, r-proteins) Ukierunkowana mutageneza (ang. site-directed/site-specific mutagenesis) Definicje Białka rekombinowane (ang. recombinant proteins, r-proteins) Białka, które powstały w żywych organizmach (lub liniach komórkowych) w wyniku ekspresji rekombinowanego DNA. Rekombinowany DNA jest

Bardziej szczegółowo

białka wiążące specyficzne sekwencje DNA czynniki transkrypcyjne

białka wiążące specyficzne sekwencje DNA czynniki transkrypcyjne białka wiążące specyficzne sekwencje DNA czynniki transkrypcyjne http://www.umass.edu/molvis/bme3d/materials/jtat_080510/exploringdna/ch_flex/chapter.htm czynniki transkrypcyjne (aktywatory/represory)

Bardziej szczegółowo

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej Wprowadzenie do Informatyki Biomedycznej Wykład 1: Podstawy bioinformatyki Wydział Informatyki PB Podstawy biologiczne - komórki Wszystkie organizmy zbudowane są z komórek komórka jest skomplikowanym systemem

Bardziej szczegółowo

Metody bioinformatyki. Ekspresja genów. prof. dr hab. Jan Mulawka

Metody bioinformatyki. Ekspresja genów. prof. dr hab. Jan Mulawka Metody bioinformatyki Ekspresja genów prof. dr hab. Jan Mulawka Genetyczny skład prawie wszystkich komórek somatycznych organizmów wielokomórkowych jest identyczny. Fenotyp (swoistość tkankowa lub komórkowa)

Bardziej szczegółowo

Wykład 5. Remodeling chromatyny

Wykład 5. Remodeling chromatyny Wykład 5 Remodeling chromatyny 1 Plan wykładu: 1. Przebudowa chromatyny 2. Struktura, funkcje oraz mechanizm działania kompleksów remodelujących chromatynę 3. Charakterystyka kompleksów typu SWI/SNF 4.

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE

PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE WSTĘP 1. Mikromacierze ekspresyjne tworzenie macierzy przykłady zastosowań 2. Mikromacierze SNP tworzenie macierzy przykłady zastosowań MIKROMACIERZE EKSPRESYJNE

Bardziej szczegółowo

Wybrane zastosowania metod inżynierii genetycznej

Wybrane zastosowania metod inżynierii genetycznej Wybrane zastosowania metod inżynierii genetycznej Inżynieria genetyczna to inaczej ingerencja w materiał genetyczny organizmów, w celu zmiany ich właściwości dziedzicznych. Polega ona na wprowadzaniu do

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie. Prowadzący: mgr Anna Pawlik i mgr Maciej Dylewski. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie. Prowadzący: mgr Anna Pawlik i mgr Maciej Dylewski. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Biologia i Biologia Medyczna II rok Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią ===============================================================================================

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

Ryc 1. Budowa operonu laktozowego.

Ryc 1. Budowa operonu laktozowego. Uniwersytet Gdański, Wydział Biologii Biologia i Biologia medyczna II rok Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią =================================================================

Bardziej szczegółowo

Geny, a funkcjonowanie organizmu

Geny, a funkcjonowanie organizmu Geny, a funkcjonowanie organizmu Wprowadzenie do genów letalnych Geny kodują Białka Kwasy rybonukleinowe 1 Geny Występują zwykle w 2 kopiach Kopia pochodząca od matki Kopia pochodząca od ojca Ekspresji

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2102334. (96) Data i numer zgłoszenia patentu europejskiego: 02.11.2007 07819547.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2102334. (96) Data i numer zgłoszenia patentu europejskiego: 02.11.2007 07819547. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2102334 (96) Data i numer zgłoszenia patentu europejskiego: 02.11.2007 07819547.6 (13) (51) T3 Int.Cl. C12N 9/16 (2006.01)

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) I. Od genu do cechy Budowa i funkcje kwasów

Bardziej szczegółowo

Regulacja ekspresji genów. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Regulacja ekspresji genów. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Regulacja ekspresji genów Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Problem: jak sprawić aby z jednej komórki powstał wielokomórkowy

Bardziej szczegółowo

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 ALEKSANDRA ŚWIERCZ Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 Ekspresja genów http://genome.wellcome.ac.uk/doc_wtd020757.html A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH

Bardziej szczegółowo

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań dopuszczający

Bardziej szczegółowo

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność Wersja 1.05 Wprowadzenie do Informatyki Biomedycznej Wykład 3: Wyszukiwanie w bazach sekwencji Przewidywanie genów Wydział Informatyki PB Marek Krętowski pokój 206 e-mail: m.kretowski@pb.edu.pl http://aragorn.pb.bialystok.pl/~mkret

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) 1 Budowa i funkcje

Bardziej szczegółowo

Genetyka w nowej podstawie programowej

Genetyka w nowej podstawie programowej Genetyka w nowej podstawie programowej Dział Genetyka - III etap edukacyjny Rzetelna realizacja tego działu w gimnazjum jest kluczowa ze względu na to, że biotechnologia i inżynieria genetyczna jest omawiana

Bardziej szczegółowo

Przeciwciała poliklonalne przeciwko białkom Helicobacter pylori oraz sposób ich wytwarzania. (74) Pełnomocnik:

Przeciwciała poliklonalne przeciwko białkom Helicobacter pylori oraz sposób ich wytwarzania. (74) Pełnomocnik: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 201982 (21) Numer zgłoszenia: 361069 (22) Data zgłoszenia: 03.07.2003 (13) B1 (51) Int.Cl. A61K 39/40 (2006.01)

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

GENOM I JEGO STRUKTURA

GENOM I JEGO STRUKTURA GENOM I JEGO STRUKTURA GENOM Ogół materiału genetycznego (kwasu nukleinowego niosącego informację genetyczną) zawartego w pojedynczej części składowej (komórce, cząstce wirusa) organizmu 1 Genom eukariotyczny

Bardziej szczegółowo

Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO

Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań konieczny (K) dopuszczający podstawowy (P) dostateczny rozszerzający (R) dobry

Bardziej szczegółowo

Biotechnologia i inżynieria genetyczna

Biotechnologia i inżynieria genetyczna Wersja A Test podsumowujący rozdział II i inżynieria genetyczna..................................... Imię i nazwisko.............................. Data Klasa oniższy test składa się z 16 zadań. rzy każdym

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE- Biologia w medycynie

WYMAGANIA EDUKACYJNE- Biologia w medycynie WYMAGANIA EDUKACYJNE- Biologia w medycynie Dział programu Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) dopuszczający K dostateczny P+K dobry P+K+R bardzo dobry

Bardziej szczegółowo

Proteomika. 1. Definicja proteomiki i techniki stosowane w proteomice

Proteomika. 1. Definicja proteomiki i techniki stosowane w proteomice Proteomika 1. Definicja proteomiki i techniki stosowane w proteomice Przepływ informacji, złożoność, *mika DNA RNA Białko Funkcja Genomika Transkryptomika Proteomika Metabolomika Liczba obiektów ~+ ++

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA.

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SPIS TREŚCI: 1. Wprowadzenie. 2. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. 3. Karty pracy. 1. Karta

Bardziej szczegółowo

Laboratorium Pomorskiego Parku Naukowo-Technologicznego Gdynia.

Laboratorium Pomorskiego Parku Naukowo-Technologicznego Gdynia. Laboratorium Pomorskiego Parku Naukowo-Technologicznego Gdynia www.ppnt.pl/laboratorium Laboratorium jest częścią modułu biotechnologicznego Pomorskiego Parku Naukowo Technologicznego Gdynia. poprzez:

Bardziej szczegółowo

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Bioinformatyka Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl 1 Bazy danych biologicznych Bazy danych sekwencji nukleotydowych Pierwotne bazy danych (ang. primary database) Wykorzystywane do zbierania

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

Skąd się wzięła biologia syntetyczna? Co to są standardowe części biologiczne?

Skąd się wzięła biologia syntetyczna? Co to są standardowe części biologiczne? Skąd się wzięła biologia syntetyczna? Mało kto zdaje sobie sprawę z tego, że termin "biologia syntetyczna" został ukuty w 1974 roku przez polskiego genetyka i biochemika Wacława Szybalskiego. Biologia

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: , PCT/EP00/03259 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: , PCT/EP00/03259 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 201818 (21) Numer zgłoszenia: 356055 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 12.04.2000 (86) Data i numer zgłoszenia

Bardziej szczegółowo

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka Wstęp do obsługi biologicznych baz danych i analizy porównawczej białek i genów Katedra Fizjologii i Biotechnologii Roślin Pok. 113 CB jan.jastrzebski@uwm.edu.pl bioinformatyka@gmail.com www.ebiology.net

Bardziej szczegółowo

Metody inżynierii genetycznej SYLABUS A. Informacje ogólne

Metody inżynierii genetycznej SYLABUS A. Informacje ogólne Metody inżynierii genetycznej A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod Rodzaj Rok studiów /semestr

Bardziej szczegółowo