Screening, klonowanie, ekspresja i oczyszczanie białek

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "Screening, klonowanie, ekspresja i oczyszczanie białek"

Transkrypt

1 Screening, klonowanie, ekspresja i oczyszczanie białek

2 Kiedy gen jest znany Dostępna sekwencja DNA sekwencjonowanie genomu, biblioteki Dostępna sekwencja białka sekwencjonowanie białka

3 Techniki pozyskania genu PCR amplifikacja z użyciem specyficznych Starterów Zalety: szybkość, ułatwiona procedura klonowania, duża specyficzność Wady: błędy polimerazy DNA w trakcie amplifikacji wymagane sekwencjonowanie, wymagana dostępność materiału DNA lub cdna

4 Techniki pozyskania genu Tworzenie bibliotek i screening aktywności Zalety: uzyskanie pełnej struktury operonu, bezpośrednia ekspresja poszukiwanego białka Wady: długotrwała procedura, wymagana łatwa kontrola aktywności białka, wymagana zdolność ekspresji białka w komórkach gospodarza Screening aktywności beta-galaktozydazy

5 Techniki pozyskania genu Synteza chemiczna genu Zalety: możliwość uzyskania struktury genu na podstawie sekwencji białka, dobór optymalnych kodonów codon usage dla ekspresji w danym gospodarzu, możliwość modyfikacji struktury Synteza z użyciem techniki PCR Wady: stosunkowo długotrwała i kosztowna procedura, możliwe zaburzenia struktury drugorzędowej DNA, która może być ważna dla aktywności genu, wymagane sekwencjonwanie utworzonego konstruktu Synteza z użyciem ligacji oligonukleotydów

6 Technika PCR Reduktaza ksylozowa Candida tropicalis Docelowy gospodarz S. cerevisiae BclI (155) BseBI (509) MvaI (509) DV XR full BglII (600) PvuII (621) PspPI (720) SseBI (756) Ec o147i (756) BsuRI (756) BshFI (756) SspI (863) 0a (100.0%) HpaI (920) H incii (920) NcoI (993) Ec ori (1018) M S I K L N S G Y ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CTTTATAAAT TAATAGAGTT ACAATGTCAA TCAAGTTAAA TTCAGGTTAT GAAATATTTA ATTATCTCAA TGTTACAGTT AGTTCAATTT AAGTCCAATA DV X R Full 1093 bp EcoRI ~~~~~~~ W D T K N R I P I F Y ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1001 GGGATACTA AGAACAGAAT TCCAATTTTC TACTGAGTAG CTGGTGTAAT TGGGTTGTT CCCTATGAT TCTTGTCTTA AGGTTAAAAG ATGACTCATC GACCACATTA ACCCAACAA

7 Technika PCR Starter - koniec 5 M S I K L N S G Y ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CTTTATAAAT TAATAGAGTT ACAATGTCAA TCAAGTTAAA TTCAGGTTAT GAAATATTTA ATTATCTCAA TGTTACAGTT AGTTCAATTT AAGTCCAATA BcuI ~~~~~~~ M A I K L N S G ~~~~~~~~~~~~~~~~~~~~~~~~~ 1 GCGGCGACTA GTCCATGGCA ATCAAGTTAA ATTCAGG CGCCGCTGAT CAGGTACCGT TAGTTCAATT TAAGTCC Natywny gen Starter 5 Silne wiązanie z matrycą kooca 3 startera Unikalne miejsce rozpoznania dla enzymu restrykcyjnego Modyfikacja inicjacji translacji dla drożdży sekwencja Kozaka Dodatkowe nukleotydy ułatwienie trawienia enzymem restrykcyjnym na koocach fragmentu DNA

8 Technika PCR Starter 3 EcoRI ~~~~~~~ W D T K N R I P I F Y ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1001 GGGATACTA AGAACAGAAT TCCAATTTTC TACTGAGTAG CTGGTGTAAT TGGGTTGTT CCCTATGAT TCTTGTCTTA AGGTTAAAAG ATGACTCATC GACCACATTA ACCCAACAA Natywny gen SalI ~~~~~~ EcoRI AluI HincII ~~~~~~ ~~~~ ~~~~~~ W D T K N R I P I F Y * TGGG ATACTAAGAA CAGAATTCCA ATTTTCTACT AAGTAGCTGG TGTAATTGGG GTCGACGGCG GC ACCC TATGATTCTT GTCTTAAGGT TAAAAGATGA TTCATCGACC ACATTAACCC CAGCTGCCGC CG Starter 3 Dodatkowe nukleotydy Unikalne miejsce rozpoznania dla enzymu restrykcyjnego Modyfikacja kodonu STOP na optymalny dla S. cerevisiae Palindrom - niebezpieczeostwo tworzenia struktury II-rzędowej przez starter

9 Technika PCR Amplifikacja z użyciem starterów z wiszącymi końcami 5 Ta=50 C 5-7 cykli Annealing 50 C Ta=65 C cykli Annealing 65 C

10 Technika PCR Oczyszczanie produktu PCR - Clean-Up lub Gel-Out Trawienie produktu PCR - zwiększona liczba jednostek restryktazy - Dobór uniwersalnego buforu dla podwójnego trawienia lub trawienie kolejno w 2 buforach - Oczyszczanie produktu PCR z użyciem Clean-Up po każdym użyciu enzymów BcuI SalI

11 Clean Up

12 Gel-Out

13 Przygotowanie wektora GDP prom BcuI (662) ColE1 SalI (713) CYC ter Amp Sach p bp 1. Trawienie enzymami BcuI i SalI procedura tak jak wypadku produktu PCR 2. Oczyszczanie przez Clean Up Trp 2µ

14 Klonowanie do wektora drożdżowego BcuI (8) DV XR full SalI (997) GDP prom DV X R Full P CR 1007 bp GDP prom BcuI (1) BcuI (662) DV XR ColE1 SalI (713) SalI (990) CYC ter ColE1 Amp Sach p bp Ligacja DV XR in p bp Trp Amp Trp 2µ 2µ

15 Transformacja do E. coli selekcja i amplifikacja klonu GDP prom BcuI (1) DV XR SalI (990) Szczep TOP10F Wysoka zdolnośd do transformacji ColE1 DV XR in p bp Amp Trp 2µ Selekcja kolonii na stałym podłozu LB w obecności ampicyliny

16 Hodowla rekombinantów i izolacja plazmidowego DNA LB + ampicylina 24 h Procedura izolacji DNA z użyciem lizy alkalicznej i kolumn wiążących DNA

17 ColE1 Ekspresja w S. cerevisiae GDP prom BcuI (1) DV XR SalI (990) Transformacja - chemiczna - eletroporacja - sferoplasty S. cerevisiae Trp- DV XR in p bp Amp Trp 2µ Podłoże syntetyczne YNB bez tryptofanu Wyrastają kolonie zawierające niezmutowany gen Trp+

18 Technika PCR Indukcja ekspresji białka w obecności galaktozy na podłożu YNB wydajny promotor galaktozowy od 2 do 5 dni GDP prom BcuI (1) DV XR SalI (990) ColE1 DV XR in p bp GDP prom BcuI (1) DV XR SalI (990) Amp Trp ColE1 2µ GDP prom BcuI (1) DV XR SalI (990) DV XR in p bp ColE1 Amp Trp DV XR in p bp 2µ Amp Trp 2µ

19 Liza komórek drożdżowych w celu uwolnienia białka - Chitynaza liza enzymatyczna - Prasa francuska metoda mechaniczna - Rozcieranie z Al2O3 w ciekłym azocie metoda mechaniczna

20 Technika PCR Oczyszczanie białka 1. Separacja białek rozpuszczalnych i nierozpuszczalnych 2. Badanie aktywności szukanego białka 3. Białka rozpuszczalne - kolejno - Chromatografia jonowymienna, hydrofobowa, sączenie molekularne 4. Białka nierozpuszczalne rozpuszczanie w moczniku, chromatografia jonowymienna, hydrofobowa i sączenie molekularne w obecności z mocznika

21 Biblioteki DNA/cDNA Wymagania : - znana aktywność enzymu - łatwe badanie aktywności prosty test Przykłady białek: - Beta- galaktozydaza - Chitynaza - Amylaza - Proteaza - Ksylanaza - Celulaza

22 Biblioteki DNA/cDNA Izolacja RNA wolnego od DNA w celu syntezy cdna - Wymagane zastosowanie DNAzy wolnej od RNaz

23 Biblioteki DNA/cDNA Synteza cdna technika SMART

24 Biblioteki DNA Technika SMART mrna z komórek eukariotycznych zawiera oligo A na koncu 3 miejsce przyłączenia startera 5 AAAAAAAAAAAAAAAA 3 XbaI

25 Biblioteki DNA Technika SMART Synteza cdna z użyciem odwrotnej transkryptazy 5 AAAAAAAAAAAAAAAA 3 XbaI

26 Biblioteki DNA Technika SMART Przyłączenie linkera do końca 5 RNA AAAAAAAAAAAAAAAA 3 XbaI

27 Biblioteki DNA Technika SMART Dalsze wydłużenie cdna na matrycy linkera AAAAAAAAAAAAAAAA 3 XbaI

28 Biblioteki DNA Technika SMART Amplifikacja PCR puli cdna z udziałem starterów AAAAAAAAAAAAAAAA cykli XbaI EcoRI XbaI EcoRI XbaI EcoRI XbaI

29 Biblioteki DNA/cDNA Technika SMART Separacja puli fragmentów cdna na żelu i ekstrakcja Gel Out Spodziewany zakres długości poszukiwanego genu Białko : 990 AA 3pz / kodonx990 = 2970 pz

30 Biblioteki DNA/cDNA Technika SMART Klonowanie wyizolowanej puli cdna EcoRI XbaI EcoRI XbaI EcoRI XbaI

31 Biblioteki DNA/cDNA Technika SMART Transformacja do E. coli ekspresja z promotora T7 w obecności polimerazy RNA faga T7 i induktora IPTG

32 Gen syntetyczny Technika jest stosowana gdy: 1. Znana jest jedynie sekwencja białka 2. Oryginalne źródło genu jest nieosiągalne lub unikalne 3. Potrzebne są modyfikacje genu i badanie różnych jego wariantów 4. Potrzebna jest optymalizacja kodonów

33 Gen syntetyczny Technika składania genu ze starterów i amplifikacji - gen jest tworzony z komplementarnych oligonukleotydów PCR od 50 do 100 cykli Polimeraza DNA Pfu

34 Gen syntetyczny PCR 2 z użyciem starterów flankujących

35 Gen syntetyczny Przykład składania genu metodą amplifikacji Gen: proteinaza K Długość: 1200 pz Ilość oligonukleotydów: 1200 pz x 2 nici / 40 pz długość oligonukleotydu = 60 oligonukleotydów Wektor: puc19 Promotor plac indukowany IPTG Wyniki klonowania : na 145 analizowanych klonów tylko 2 wykazywały aktywność proteinazy K Wniosek : Wysoki poziom błędów w trakcie amplifikacji

36 Gen syntetyczny Technika składania genu z ufosforylowanych oligonukleotydów i termofilnej ligazy z P. furiosus zależnej od ATP Ligacja Technika ta eliminuje powstawanie błędów

37 Gen syntetyczny Codon usage DataBase

38 Gen syntetyczny Gen ze Streptomyces do gospodarza Bacillus Genom bogaty w pary GC Genom bogaty w pary AT Np. Kodon UUU występuje 4 razy na kodonów w genomie Streptomyces W Bacillus kodon UUU występuje 307 razy na kodonów Wniosek: wymagana zmiana kodonów synteza genu

39 Gen syntetyczny Zastosowania w klonowaniu: - Szczepionki białkowe np. wirus grypy możliwość szybkich zmian (wymiana pojedynczych oligonukleotydów) - Modyfikacja białek o znaczeniu farmaceutycznym np. lepsze wiązanie z receptorem

40 Kiedy gen nie jest znany Poszukiwany: enzym endo-1,4-beta ksylanaza Organizm producenta: pleśń

41 Kiedy gen jest nieznany 1. Izolacja homogennej hodowli organizmu producenta

42 Nasza pleśń wykazuje nawiększe podobieńtwo do Aspergillus Kiedy gen jest nieznany Molekularna charakterystyka pleśni - Co to jest? Badanie sekwencji 18s rdna, 26 rdna, ITS1, ITS2, 5S.

43 Kiedy gen jest nieznany Poszukujemy genów kodujących ksylanazy u bliskich krewnych naszej pleśni i porównujemy sekwencje aminokwasowe (101) A. awamori (71) SASGSSSYLAVYGWVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTVTVANHFNFWAQHGFG A. usammi (86) SASSSSSYLAVYGWVNSPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNAPSITGTSTFTQYFSVRESTRTSGTVTIANHFNFWAQHGFG A. niger (86) SASSSSSYLAVYGWVNSPQAEYYIVEDYGNYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNAPSITGTSTFTQYFSVRESTRTSGTVTVANHFNFWAQHGFG A. oryzae (98) ESN-SNSYVSLYGWTQNPLVEYYIVDKYGDYDPSTG--ATELGTVESDGGTYKIYKTTRENAPSIEGTSTFNQYWSVRQSGRVGGTITAQNHFDAWANVGLQ A. tubingensis (86) SASGSASYLAVYGWVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTVTVANHFNFWAHHGFG A. sulfureus (86) SASGSSSYLAVYGWVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTVTVANHFNFWAQHGFG P. purpurogenum (82) SAS-GGSYLAVYGWVNSPQAEYHVVEAYGNYNPCSSGSATNLGTVSSDGGTYQVCTDTRVNQPSITGTSTFTQFFSVRQGSRTSGTVTIANHFNFWAKHGFG Consensus(101) SAS SSSYLAVYGWVN PQAEYYIVEDYGDYNPCSS ATSLGTVYSDGSTYQVCTDTRTN PSITGTSTFTQYFSVRESTRTSGTVTVANHFNFWAQHGFG

44 Kiedy gen jest nieznany Porównanie sekwencji aminokwasowych A. awamori (0.0127) A. usammi (0.0094) A. niger (0.0143) P. purpurogenum (0.1193) A. tubingensis (0.0178) A. sulfureus (0.0154) A. oryzae (0.4748)

45 Kiedy gen jest nieznany Motywy zakonserwowane (84) A. awamori (54) A. usammi (69) A. niger (69) A. oryzae (81) A. tubingensis (69) A. sulfureus (69). purpurogenum (65) Consensus (84) LGWTTGSSNAITYSAEYSASGSSSYLAVYGWVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTV LGWTTGSSKSITYSAQYSASSSSSYLAVYGWVNSPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNAPSITGTSTFTQYFSVRESTRTSGTV LGWTTGSSKSITYSAQYSASSSSSYLAVYGWVNSPQAEYYIVEDYGNYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNAPSITGTSTFTQYFSVRESTRTSGTV KGWNPGSAKTVTYSGEWESN-SNSYVSLYGWTQNPLVEYYIVDKYGDYDPSTG--ATELGTVESDGGTYKIYKTTRENAPSIEGTSTFNQYWSVRQSGRVGGTI LGWTTGSSNAITYSAEYSASGSASYLAVYGWVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTV LGWTTGSSNPITYSADYSASGSSSYLAVYGWVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTV LGRSTGSSNPITYSASYSAS-GGSYLAVYGWVNSPQAEYHVVEAYGNYNPCSSGSATNLGTVSSDGGTYQVCTDTRVNQPSITGTSTFTQFFSVRQGSRTSGTV LGWTTGSSNAITYSAEYSAS SSSYLAVYGWVN PQAEYYIVEDYGDYNPCSS ATSLGTVYSDGSTYQVCTDTRTN PSITGTSTFTQYFSVRESTRTSGTV A B Motyw A: LGTVYSDG Motyw B: PSITGTSTF

46 Kiedy gen jest nieznany Sekwencja DNA na podstawie motywów Motyw A Motyw B Wybór konkretnej sekwencji DNA na podstawie najmniejsze liczby degeneracji i braku degeneracji na koocach

47 Kiedy gen jest nieznany Stopień degeneracji DNA motywów powinien być zbliżony Motyw A: GGNACNGTNTAYWSNGAYGG Degeneracja: 4 x 4 x 4 x 2 x2x4x2 = 2048 Motyw B: ACNGGNACNWSNACNTT Degeneracja 4 x 4 x 4 x2x2x4x4 = 4096

48 Kiedy gen jest nieznany Zamiana motywów na startery do PCR: Motyw A: GGNACNGTNTAYWSNGAYGG - Bez zmian koniec 5 fragmentu genu Starter A Motyw B: ACNGGNACNWSNACNTT - Sekwencja komplementarna Starter B-koniec 3 fragmentu genu AANGTNSWNGTNCCNGT

49 Kiedy gen jest nieznany Badanie temperatury annealingu dla starterów: Starter A : 49 C długość 20 nt Starter B: 42 C długość 17 nt Stosunkowo duża różnica temperatur- eliminacja fragmentu 5 sekwencji startera A 5 GGNACNGTNTAYWSNGAYGG 3 Zatem starter A po modyfikacji: 40 C długość 17 nt

50 Kiedy gen jest nieznany Spodziewana wielkość produktu PCR (84) A. awamori (54) A. usammi (69) A. niger (69) A. oryzae (81) A. tubingensis (69) A. sulfureus (69). purpurogenum (65) Consensus (84) LGWTTGSSNAITYSAEYSASGSSSYLAVYGWVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTV LGWTTGSSKSITYSAQYSASSSSSYLAVYGWVNSPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNAPSITGTSTFTQYFSVRESTRTSGTV LGWTTGSSKSITYSAQYSASSSSSYLAVYGWVNSPQAEYYIVEDYGNYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNAPSITGTSTFTQYFSVRESTRTSGTV KGWNPGSAKTVTYSGEWESN-SNSYVSLYGWTQNPLVEYYIVDKYGDYDPSTG--ATELGTVESDGGTYKIYKTTRENAPSIEGTSTFNQYWSVRQSGRVGGTI LGWTTGSSNAITYSAEYSASGSASYLAVYGWVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTV LGWTTGSSNPITYSADYSASGSSSYLAVYGWVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTV LGRSTGSSNPITYSASYSAS-GGSYLAVYGWVNSPQAEYHVVEAYGNYNPCSSGSATNLGTVSSDGGTYQVCTDTRVNQPSITGTSTFTQFFSVRQGSRTSGTV LGWTTGSSNAITYSAEYSAS SSSYLAVYGWVN PQAEYYIVEDYGDYNPCSS ATSLGTVYSDGSTYQVCTDTRTN PSITGTSTFTQYFSVRESTRTSGTV 31 AA = 3 pz/aa x 31=93 pz Ale uwaga!!! Mamy organizm eukariotyczny więc może występowad intron

51 Kiedy gen jest nieznany Ustalanie warunków reakcji PCR touch-down - Stopniowe obniżanie temperatury annealingu z cyklu na cykl zaczynamy od 52 C a kończymy na 42 C - Stosunek ilościowy starterów ze względu na degenerację Starter A: Starter B 1:2 - Stężenie starterów w reakcji PCR 10 µm - Czas wydłużania produktu 30 sec - Czas annealingu 1 min (dopasowanie startera do matrycy)

52 Kiedy gen jest nieznany Obecność intronu DNA cdna M 250 pz Produkt właściwy100 pz

53 Kiedy gen jest nieznany Izolacja mrna w celu przygotowania cdna zawierającego poszukiwany gen musi być wykonana z hodowli organizmu uzyskanej w określonych warunkach Np. Ekspresja genu kodującego ksylanazę (mrna) zachodzi w obecności ksylanu w hodowli organizmu

54 Kiedy gen jest nieznany Określenie sekwencji DNA fragmentu genu pozwala na określenie sekwnecji białka

55 Kiedy gen jest nieznany Porównanie sekwencji aminokwasowej znalezionego fragmentu (114) A. awamori (84) WVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTVTVANH A. usammi (99) WVNSPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNAPSITGTSTFTQYFSVRESTRTSGTVTIANH A. niger (99) WVNSPQAEYYIVEDYGNYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNAPSITGTSTFTQYFSVRESTRTSGTVTVANH A. oryzae(110) WTQNPLVEYYIVDKYGDYDPSTG--ATELGTVESDGGTYKIYKTTRENAPSIEGTSTFNQYWSVRQSGRVGGTITAQNH A. tubingensis (99) WVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTVTVANH A. sulfureus (99) WVNYPQAEYYIVEDYGDYNPCSS--ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTVTVANH P. purpurogenum (94) WVNSPQAEYHVVEAYGNYNPCSSGSATNLGTVSSDGGTYQVCTDTRVNQPSITGTSTFTQFFSVRQGSRTSGTVTIANH Fragment AB (1) TVYSDGSTYQVCTDTRTNEPSITGTST Consensus(114) WVN PQAEYYIVEDYGDYNPCSS ATSLGTVYSDGSTYQVCTDTRTNEPSITGTSTFTQYFSVRESTRTSGTVTVANH

56 Kiedy gen jest nieznany Konstrukcja wewnętrznych specyficznych starterów

57 Kiedy gen jest nieznany Izolacja mrna Konstrukcja cdna z użyciem techniki SMART Wyodrębnienie genu z użyciem starterów specyficznych For i Rev oraz starterów SMART

58 Kiedy gen jest nieznany cdna uzyskane techniką SMART AAAAAAAAAAAAAAAA cykli SMARTrev

59 Kiedy gen jest nieznany 2 niezależne amplifikacje na mieszaninie cdna (1) SMARTfor / StarterRev (2) SMARTrev/ StarterFor

60 Kiedy gen jest nieznany PCR 1 PCR 2

61 Kiedy gen jest nieznany Izolacja obu produktów PCR z żelu, wymieszanie i ponowna amplifikacja z udziałem starterów SMARTfor i SMARTrev

62 Kiedy gen jest nieznany Annealing i wydłużenie produktów PCR 1 i 2 Amplifikacja z udziałem starterów SMART

63 Kiedy gen jest nieznany Analiza na żelu agarozowym 1 fragment PCR 1 3 fragment PCR fragment po amplifikacji całego genu

64 Kiedy gen jest nieznany Klonowanie całego genu do wektora

65 Kiedy gen nie jest znany Kompletna sekwencja cdna poszukiwanego genu

66 Kiedy gen nie jest znany Translacja uzyskanej sekwencji cdna pozwala na weryfikację uzyskanego genu tj. Czy koduje on ksylanazę? NASZA KSYLANAZA (0.0000) Fragment AB (0.0000) P. purpurogenum (0.0908) A. usammi (0.0000) A. niger (0.0000) A. sulfureus (0.0000) A. awamori (0.0000) A. tubingensis (0.0000) N. crassa (0.2743) A. oryzae (0.1651)

67 Kiedy gen nie jest znany Ekspresja ksylanazy w E. coli - Badanie obecności hydrofobowej sekwencji sygnalnej (sekwencje sygnalne obniżają znacząco ekspresję w E. coli)

68 Kiedy gen nie jest znany Sekwencja Sygnalna Aminokwasy 3-24 Wykres analizy hydrofobowości sekwencji aminokwasowej badanego białka

69 Kiedy gen nie jest znany Zaprojektowanie starterów do klonowania z użyciem systemu LIC w celu ekspresji ksylanazy w postaci białka fuzyjnego w E. coli Ekspresja i oczyszczanie z użyciem chromatografii metalopowinowactwa

70 Kiedy gen nie jest znany

71 Kiedy gen nie jest znany Startery LIC dla ksylanazy koniec 5 Starter For Na niebiesko oznaczono sekwencję sygnalną 5 GAC GAC GAC AAG Sekwencja LIC 5 GTGTCGCGAAGTGCTGG 3 Sekwencja komplementarna do matrycy

72 Kiedy gen nie jest znany Starter LIC dla ksylanazy koniec 3 5 GA GGA GAA GCC CGG Sekwencja LIC 3 TCACCGTTCCAGATGTGCGCGT 3 Sekwencja komplementarna do matrycy

73 Kiedy gen nie jest znany Dwustopniowy PCR - Matryca : cdna lub wcześniej uzyskany klon całego genu cykli w temperaturze optymalnej dla przyłączenia starterów w części komplementarnej do matrycy - Pozostałe 23 do 25 cykli w temperaturze o 6 do 10 C wyższej

74 Kiedy gen nie jest znany Produkt PCR oczyszczany z żelu lub Clean-UP i traktowany polimetazą DNA faga T4 w obecności datp Tak przygotowany produkt jest mieszany z wektorem i użyty do transformacji komórek E. coli TOP10F

75 Kiedy gen nie jest znany Miejsce insercji genu ksylanazy

76 Kiedy gen nie jest znany Kodowane białko fuzyjne będzie zawierało następujące domeny: - 6xHis domena wiązania do złoża Ni2+ IDA - S*Taq domena w celu specyficznej detekcji białka na żelu - Miejsce cięcia dla specyficznej proteazy trombiny oraz enterokinazy

77 Kiedy gen nie jest znany Transformacja plazmidu ekspresyjnego do E. coli BL21(DE3)pLysS

78 Kiedy gen nie jest znany Ekspresja białka następuje po dodaniu do hodowli w logarytmicznej fazie wzrostu induktora IPTG Liza komórek z użyciem lizozymu jaja kurzego w obecności detergentów niejonowych oraz EDTA Rozbicie chromosomalnego DNA z użyciem sonifikatora

79 Kiedy gen nie jest znany Rozdzielenie białek na frakcje rozpuszczalną i nierozpuszczalną oraz zbadanie aktywności ksylanazy w obu frakcjach

80 Kiedy gen nie jest znany Oczyszczanie białka z użyciem chromatografii metalopowinowactwa

81 Kiedy gen nie jest znany Chromatografia IMAC

82 Kiedy gen nie jest znany Badanie czystości białka z użyciem SDS-PAGE 1 lizat przed indukcją 2- lizat pod indukcji białka po 4 h 3 oczyszczony preparat białka z użyciem Ni2+IDA

83 Kiedy gen nie jest znany Badanie aktywności i charakterystyka białka rekombinantowego - Optymalne ph - Optymalna temperatura - Termostabilność - Badania kinetyki reakcji - Badania strukturalne

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Nowoczesne systemy ekspresji genów

Nowoczesne systemy ekspresji genów Nowoczesne systemy ekspresji genów Ekspresja genów w organizmach żywych GEN - pojęcia podstawowe promotor sekwencja kodująca RNA terminator gen Gen - odcinek DNA zawierający zakodowaną informację wystarczającą

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ===============================================================================================

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

Dr. habil. Anna Salek International Bio-Consulting 1 Germany

Dr. habil. Anna Salek International Bio-Consulting 1 Germany 1 2 3 Drożdże są najprostszymi Eukariontami 4 Eucaryota Procaryota 5 6 Informacja genetyczna dla każdej komórki drożdży jest identyczna A zatem każda komórka koduje w DNA wszystkie swoje substancje 7 Przy

Bardziej szczegółowo

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA DNA 28SRNA 18/16S RNA 5SRNA mrna Ilościowa analiza mrna aktywność genów w zależności od wybranych czynników: o rodzaju tkanki o rodzaju czynnika zewnętrznego o rodzaju upośledzenia szlaku metabolicznego

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

Definicje. Białka rekombinowane (ang. recombinant proteins, r-proteins) Ukierunkowana mutageneza (ang. site-directed/site-specific mutagenesis)

Definicje. Białka rekombinowane (ang. recombinant proteins, r-proteins) Ukierunkowana mutageneza (ang. site-directed/site-specific mutagenesis) Definicje Białka rekombinowane (ang. recombinant proteins, r-proteins) Białka, które powstały w żywych organizmach (lub liniach komórkowych) w wyniku ekspresji rekombinowanego DNA. Rekombinowany DNA jest

Bardziej szczegółowo

Drożdżowe systemy ekspresyjne

Drożdżowe systemy ekspresyjne Drożdże Drożdżowe systemy ekspresyjne Zalety: możliwość uzyskania dużej biomasy modyfikacje postranslacyjne eksprymowanych białek transport eksprymowanych białek do pożywki Duża biomasa W przypadku hodowli

Bardziej szczegółowo

ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków)

ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków) ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków) Celem ćwiczenia jest wprowadzenie mutacji punktowej do genu

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

Biologia Molekularna z Biotechnologią ===============================================================================================

Biologia Molekularna z Biotechnologią =============================================================================================== Uniwersytet Gdański, Wydział Biologii Biologia i Biologia Medyczna II rok Katedra Genetyki Molekularnej Bakterii Katedra Biologii i Genetyki Medycznej Przedmiot: Katedra Biologii Molekularnej Biologia

Bardziej szczegółowo

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II 10 października 2013: Elementarz biologii molekularnej www.bioalgorithms.info Wykład nr 2 BIOINFORMATYKA rok II Komórka: strukturalna i funkcjonalne jednostka organizmu żywego Jądro komórkowe: chroniona

Bardziej szczegółowo

Przeglądanie bibliotek

Przeglądanie bibliotek Przeglądanie bibliotek Czyli jak złapać (i sklonować) ciekawy gen? Klonowanie genów w oparciu o identyczność lub podobieństwo ich sekwencji do znanego już DNA Sonda homologiczna (komplementarna w 100%)

Bardziej szczegółowo

Ekspresja genów heterogenicznych w drożdżach Pichia pastoris

Ekspresja genów heterogenicznych w drożdżach Pichia pastoris Ekspresja genów heterogenicznych w drożdżach Pichia pastoris Ekspresja genów heterogenicznych w drożdżach Pichia pastoris Drożdże Pichia pastoris należą do drożdży metanolotroficznych tj. zdolnych do wykorzystywania

Bardziej szczegółowo

Najważniejsze z nich to: enzymy restrykcyjne wektory DNA inne enzymy np. ligazy, fosfatazy, polimerazy, kinazy, nukleazy

Najważniejsze z nich to: enzymy restrykcyjne wektory DNA inne enzymy np. ligazy, fosfatazy, polimerazy, kinazy, nukleazy Aby manipulować genami niezbędne są odpowiednie narzędzia molekularne, które pozwalają uzyskać tzw. zrekombinowane DNA (umożliwiają rekombinację materiału genetycznego in vitro czyli w próbówce) Najważniejsze

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie. Prowadzący: mgr Anna Pawlik i mgr Maciej Dylewski. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie. Prowadzący: mgr Anna Pawlik i mgr Maciej Dylewski. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Biologia i Biologia Medyczna II rok Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią ===============================================================================================

Bardziej szczegółowo

SYLABUS. Wydział Biologiczno-Rolniczy. Katedra Biochemii i Biologii Komórki

SYLABUS. Wydział Biologiczno-Rolniczy. Katedra Biochemii i Biologii Komórki SYLABUS 1.1. PODSTAWOWE INFORMACJE O PRZEDMIOCIE/MODULE Nazwa przedmiotu/ modułu Biologia molekularna z elementami inżynierii genetycznej Kod przedmiotu/ modułu* Wydział (nazwa jednostki prowadzącej kierunek)

Bardziej szczegółowo

Inżynieria genetyczna

Inżynieria genetyczna Inżynieria genetyczna i technologia rekombinowanego DNA Dr n. biol. Urszula Wasik Zakład Biologii Medycznej Inżynieria genetyczna świadoma, celowa, kontrolowana ingerencja w materiał genetyczny organizmów

Bardziej szczegółowo

Ligazy. Zastosowanie ligazy w inżynierii genetycznej:

Ligazy. Zastosowanie ligazy w inżynierii genetycznej: Ligazy Katalizują tworzenie wiązań fosfodiestrowych między sąsiednimi grupami 3 OH i 5 PO 4 w kwasach nukleinowych DNA lub RNA. W reakcji tworzą się wysokoenergetyczne pośredniki z udziałem NAD + lub ATP

Bardziej szczegółowo

SYLABUS. Wydział Biologiczno-Rolniczy. Katedra Biochemii i Biologii Komórki

SYLABUS. Wydział Biologiczno-Rolniczy. Katedra Biochemii i Biologii Komórki SYLABUS 1.1. PODSTAWOWE INFORMACJE O PRZEDMIOCIE/MODULE Nazwa przedmiotu/ modułu Biologia molekularna Kod przedmiotu/ modułu* Wydział (nazwa jednostki prowadzącej kierunek) Nazwa jednostki realizującej

Bardziej szczegółowo

Polimeraza Taq (1U/ l) 1-2 U 1 polimeraza Taq jako ostatni składniki mieszaniny końcowa objętość

Polimeraza Taq (1U/ l) 1-2 U 1 polimeraza Taq jako ostatni składniki mieszaniny końcowa objętość Ćwiczenie 6 Technika PCR Celem ćwiczenia jest zastosowanie techniki PCR do amplifikacji fragmentu DNA z bakterii R. leguminosarum bv. trifolii TA1 (RtTA1). Studenci przygotowują reakcję PCR wykorzystując

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ 1. Gen to odcinek DNA odpowiedzialny

Bardziej szczegółowo

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe Promotory genu Promotor bliski leży w odległości do 40 pz od miejsca startu transkrypcji, zawiera kasetę TATA. Kaseta TATA to silnie konserwowana sekwencja TATAAAA, występująca w większości promotorów

Bardziej szczegółowo

Zestawy do izolacji DNA i RNA

Zestawy do izolacji DNA i RNA Syngen kolumienki.pl Gotowe zestawy do izolacji i oczyszczania kwasów nukleinowych Zestawy do izolacji DNA i RNA Katalog produktów 2012-13 kolumienki.pl Syngen Biotech Sp. z o.o., 54-116 Wrocław, ul. Ostródzka

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

Escherichia coli. System pbad

Escherichia coli. System pbad Escherichia coli System pbad System pbad System pbad został skonstruowany w oparciu o elementy regulacji transkrypcji operonu arabinozowego E. coli Elementy regulacji transkrypcji operonu arabinozowego

Bardziej szczegółowo

Hybrydyzacja kwasów nukleinowych

Hybrydyzacja kwasów nukleinowych Hybrydyzacja kwasów nukleinowych Jaka jest lokalizacja tego genu na chromosomie? Jakie jest jego sąsiedztwo? Hybrydyzacja - powstawanie stabilnych struktur dwuniciowych z cząsteczek jednoniciowych o komplementarnych

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 4 Jak działają geny?

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

WPROWADZENIE DO GENETYKI MOLEKULARNEJ

WPROWADZENIE DO GENETYKI MOLEKULARNEJ WPROWADZENIE DO GENETYKI MOLEKULARNEJ Replikacja organizacja widełek replikacyjnych Transkrypcja i biosynteza białek Operon regulacja ekspresji genów Prowadzący wykład: prof. dr hab. Jarosław Burczyk REPLIKACJA

Bardziej szczegółowo

RT31-020, RT , MgCl 2. , random heksamerów X 6

RT31-020, RT , MgCl 2. , random heksamerów X 6 RT31-020, RT31-100 RT31-020, RT31-100 Zestaw TRANSCRIPTME RNA zawiera wszystkie niezbędne składniki do przeprowadzenia syntezy pierwszej nici cdna na matrycy mrna lub całkowitego RNA. Uzyskany jednoniciowy

Bardziej szczegółowo

TRANSKRYPCJA - I etap ekspresji genów

TRANSKRYPCJA - I etap ekspresji genów Eksparesja genów TRANSKRYPCJA - I etap ekspresji genów Przepisywanie informacji genetycznej z makrocząsteczki DNA na mniejsze i bardziej funkcjonalne cząsteczki pre-mrna Polimeraza RNA ETAP I Inicjacja

Bardziej szczegółowo

Transformacja pośrednia składa się z trzech etapów:

Transformacja pośrednia składa się z trzech etapów: Transformacja pośrednia składa się z trzech etapów: 1. Otrzymanie pożądanego odcinka DNA z materiału genetycznego dawcy 2. Wprowadzenie obcego DNA do wektora 3. Wprowadzenie wektora, niosącego w sobie

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7 Poznań, dnia 28.04.2014 r. BioVentures Institute Spółka z ograniczoną odpowiedzialnością ul. Promienista 83 60 141 Poznań Zapytanie ofertowe nr 01/2014 Projekt Nowa technologia wytwarzania szczepionek

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo

Mieszanina trójfosforanów deoksyrybonukleotydów (dntp: datp, dgtp, dctp, dttp) Bufor reakcyjny zapewniający odpowiednie warunki reakcji

Mieszanina trójfosforanów deoksyrybonukleotydów (dntp: datp, dgtp, dctp, dttp) Bufor reakcyjny zapewniający odpowiednie warunki reakcji Uniwersytet Gdański, Wydział Biologii Biologia i Biologia medyczna II rok Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią =================================================================

Bardziej szczegółowo

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka Inżynieria genetyczna- 6 ECTS Część I Badanie ekspresji genów Podstawy klonowania i różnicowania transformantów Kolokwium (14pkt) Część II Klonowanie ekspresyjne Od genu do białka Kolokwium (26pkt) EGZAMIN

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

Metody: PCR, MLPA, Sekwencjonowanie, PCR-RLFP, PCR-Multiplex, PCR-ASO

Metody: PCR, MLPA, Sekwencjonowanie, PCR-RLFP, PCR-Multiplex, PCR-ASO Diagnostyka molekularna Dr n.biol. Anna Wawrocka Strategia diagnostyki genetycznej: Aberracje chromosomowe: Metody:Analiza kariotypu, FISH, acgh, MLPA, QF-PCR Gen(y) znany Metody: PCR, MLPA, Sekwencjonowanie,

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

PCR łańcuchowa reakcja polimerazy

PCR łańcuchowa reakcja polimerazy PCR łańcuchowa reakcja polimerazy PCR - ang. polymerase chain reaction Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość*

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość* Poznao, 6 lutego 2012 r. Zapytanie ofertowe nr 001 /2012 dotyczące zakupu odczynników chemicznych do izolacji DNA i reakcji PCR GENESIS Polska Sp. z o.o Ul. Za Cytadelą 19, 61-659 Poznao NIP 778 13 56

Bardziej szczegółowo

Techniki biologii molekularnej Kod przedmiotu

Techniki biologii molekularnej Kod przedmiotu Techniki biologii molekularnej - opis przedmiotu Informacje ogólne Nazwa przedmiotu Techniki biologii molekularnej Kod przedmiotu 13.9-WB-BMD-TBM-W-S14_pNadGenI2Q8V Wydział Kierunek Wydział Nauk Biologicznych

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

Dr Anna Linkiewicz Instytut Hodowli i Aklimatyzacji Roślin - PIB LAB-GMO Maj 2015

Dr Anna Linkiewicz Instytut Hodowli i Aklimatyzacji Roślin - PIB LAB-GMO Maj 2015 Genetycznie modyfikowana żywność i pasze Streszczenie zajęć Blisko 50 różnych GMO jest dopuszczonych do stosowania w Unii Europejskiej jako żywność lub pasza. Podczas zajęć wyizolowane zostanie DNA z produktów

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Biologia molekularna z genetyką

Biologia molekularna z genetyką Biologia molekularna z genetyką P. Golik i M. Koper Konwersatorium 3: Analiza genetyczna eukariontów Saccharomyces cerevisiae Makrokierunek: Bioinformatyka i Biologia Systemów; 2016 Opracowano na podstawie

Bardziej szczegółowo

Jaka jest lokalizacja genu na chromosomie? Jakie jest jego sąsiedztwo?

Jaka jest lokalizacja genu na chromosomie? Jakie jest jego sąsiedztwo? Jaka jest lokalizacja genu na chromosomie? Jakie jest jego sąsiedztwo? Hybrydyzacja - powstawanie stabilnych struktur dwuniciowych z cząsteczek jednoniciowych o komplementarnych sekwencjach nukleotydów

Bardziej szczegółowo

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów Zawartość 139585 Wstęp 1. Historia wirusologii 2. Klasyfikacja wirusów 3. Struktura cząstek wirusowych 3.1. Metody określania struktury cząstek wirusowych 3.2. Budowa cząstek wirusowych o strukturze helikalnej

Bardziej szczegółowo

TRANSLACJA II etap ekspresji genów

TRANSLACJA II etap ekspresji genów TRANSLACJA II etap ekspresji genów Tłumaczenie informacji genetycznej zawartej w mrna (po transkrypcji z DNA) na aminokwasy budujące konkretne białko. trna Operon (wg. Jacob i Monod) Zgrupowane w jednym

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Budowa rybosomu Translacja

Bardziej szczegółowo

Regulacja ekspresji operonu ksylozowego

Regulacja ekspresji operonu ksylozowego Bacillus spp. Bacillus spp. A - komórka Bacillus megaterium pod mikroskopem B zdjęcie komórek B.megaterium rosnących w postaci długich łańcuszków. Mikroskopia skaningowa. (Visuals Unlimited) C kolonie

Bardziej szczegółowo

Ćwiczenie 3 PCR i trawienie DNA enzymami restrykcyjnymi

Ćwiczenie 3 PCR i trawienie DNA enzymami restrykcyjnymi Uniwersytet Gdański, Wydział Biologii Katedra Genetyki Molekularnej Bakterii Katedra Biologii i Genetyki Medycznej Katedra Biologii Molekularnej Biologia i Biologia Medyczna II rok Przedmiot: Biologia

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

Przeciwciała poliklonalne przeciwko białkom Helicobacter pylori oraz sposób ich wytwarzania. (74) Pełnomocnik:

Przeciwciała poliklonalne przeciwko białkom Helicobacter pylori oraz sposób ich wytwarzania. (74) Pełnomocnik: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 201982 (21) Numer zgłoszenia: 361069 (22) Data zgłoszenia: 03.07.2003 (13) B1 (51) Int.Cl. A61K 39/40 (2006.01)

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

Spis treści. Aparatura

Spis treści. Aparatura Spis treści Aparatura I. Podstawowe wyposażenie laboratoryjne... 13 I.I. Probówki i naczynia laboratoryjne... 13 I.II. Pipety... 17 I.II.I. Rodzaje pipet automatycznych... 17 I.II.II. Techniki pipetowania...

Bardziej szczegółowo

Program ćwiczeń z inżynierii genetycznej KP-III rok Biologii

Program ćwiczeń z inżynierii genetycznej KP-III rok Biologii Program ćwiczeń z inżynierii genetycznej KP-III rok Biologii Ćwiczenie 1 i 2: Metody izolacji, oczyszczania DNA kolokwium wstępne: sprawdzenie podstawowych wiadomości z zakresu genetyki, i biologii molekularnej

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP WYNALAZKI BIOTECHNOLOGICZNE W POLSCE Ewa Waszkowska ekspert UPRP Źródła informacji w biotechnologii projekt SLING Warszawa, 9-10.12.2010 PLAN WYSTĄPIENIA Umocowania prawne Wynalazki biotechnologiczne Statystyka

Bardziej szczegółowo

(12) O PIS PATENTOWY (19) PL (11) (13) B1

(12) O PIS PATENTOWY (19) PL (11) (13) B1 RZECZPOSPOLITA POLSKA (12) O PIS PATENTOWY (19) PL (11) 159844 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 273721 ( 2) Data zgłoszenia: 14.07.1988 (51) IntCl.5: C12N 15/51

Bardziej szczegółowo

Biologia molekularna

Biologia molekularna Biologia molekularna 1. Metryczka Nazwa Wydziału Program kształcenia Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej Analityka Medyczna, studia jednolite magisterskie, studia stacjonarne i niestacjonarne

Bardziej szczegółowo

Mikroorganizmy Zmodyfikowane Genetycznie

Mikroorganizmy Zmodyfikowane Genetycznie Mikroorganizmy Zmodyfikowane Genetycznie DEFINICJA Mikroorganizm (drobnoustrój) to organizm niewidoczny gołym okiem. Pojęcie to nie jest zbyt precyzyjne lecz z pewnością mikroorganizmami są: bakterie,

Bardziej szczegółowo

Wybór systemu ekspresyjnego

Wybór systemu ekspresyjnego Wybór systemu ekspresyjnego Bakterie Escherichia coli Zalety: wysoki poziom ekspresji (do 500 mg/l hodowli) dobrze poznany system proste technologie niskie koszty Wady: brak modyfikacji potranslacyjnych

Bardziej szczegółowo

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją).

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Czym jest życie? metabolizm + informacja (replikacja) 2 Cząsteczki organiczne mog y powstać w atmosferze pierwotnej

Bardziej szczegółowo

Adam Dawidowski Klasa III b. mgr Beata Ulczyńska

Adam Dawidowski Klasa III b. mgr Beata Ulczyńska Adam Dawidowski Klasa III b (autor) mgr Beata Ulczyńska (opiekun) BADANIE WPŁYWU GENU orf654 Z OPERONU mboii NA ZJAWISKO PRZESUNIĘCIA RAMKI ODCZYTU TRANSLACJI -1 W ZMUTOWANYM GENIE mboiim2δ I Akademickie

Bardziej szczegółowo

DNA musi współdziałać z białkami!

DNA musi współdziałać z białkami! DNA musi współdziałać z białkami! Specyficzność oddziaływań między DNA a białkami wiążącymi DNA zależy od: zmian konformacyjnych wzdłuż cząsteczki DNA zróżnicowania struktury DNA wynikającego z sekwencji

Bardziej szczegółowo

OPTYMALNY POZIOM SPOŻYCIA BIAŁKA ZALECANY CZŁOWIEKOWI JANUSZ KELLER STUDIUM PODYPLOMOWE 2011

OPTYMALNY POZIOM SPOŻYCIA BIAŁKA ZALECANY CZŁOWIEKOWI JANUSZ KELLER STUDIUM PODYPLOMOWE 2011 OPTYMALNY POZIOM SPOŻYCIA BIAŁKA ZALECANY CZŁOWIEKOWI JANUSZ KELLER STUDIUM PODYPLOMOWE 2011 DLACZEGO DOROSŁY CZŁOWIEK (O STAŁEJ MASIE BIAŁKOWEJ CIAŁA) MUSI SPOŻYWAĆ BIAŁKO? NIEUSTAJĄCA WYMIANA BIAŁEK

Bardziej szczegółowo

Novabeads Food DNA Kit

Novabeads Food DNA Kit Novabeads Food DNA Kit Novabeads Food DNA Kit jest nowej generacji narzędziem w technikach biologii molekularnej, umożliwiającym izolację DNA z produktów spożywczych wysoko przetworzonych. Metoda oparta

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

Ekspresja białek w komórkach ssaczych

Ekspresja białek w komórkach ssaczych Ekspresja białek w komórkach ssaczych Ekspresja białek w komórkach ssaczych Używane powszechnie w laboratoriach ssacze linie komórkowe są zmodyfikowane w celu pełnienia roli gospodarza ekspresji białek

Bardziej szczegółowo

Skąd się wzięła biologia syntetyczna? Co to są standardowe części biologiczne?

Skąd się wzięła biologia syntetyczna? Co to są standardowe części biologiczne? Skąd się wzięła biologia syntetyczna? Mało kto zdaje sobie sprawę z tego, że termin "biologia syntetyczna" został ukuty w 1974 roku przez polskiego genetyka i biochemika Wacława Szybalskiego. Biologia

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

Autor: dr Mirosława Staniaszek

Autor: dr Mirosława Staniaszek Zakład Hodowli Roślin Ogrodniczych Pracownia Genetyki i Hodowli Roślin Warzywnych Fot. J. Sobolewski Procedura identyfikacji genu Frl warunkującego odporność pomidora na Fusarium oxysporum f.sp. radicis-lycopersici

Bardziej szczegółowo

Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii

Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii 1. Technologia rekombinowanego DNA jest podstawą uzyskiwania genetycznie zmodyfikowanych organizmów 2. Medycyna i ochrona zdrowia

Bardziej szczegółowo

Podstawy inżynierii genetycznej

Podstawy inżynierii genetycznej Metody bioinformatyki Podstawy inżynierii genetycznej prof. dr hab. Jan Mulawka Czym jest inżynieria genetyczna Zbiór technik rekombinowania i klonowania DNA Wydzielanie i charakteryzowanie pojedyńczych

Bardziej szczegółowo

ĆWICZENIA Z BIOCHEMII

ĆWICZENIA Z BIOCHEMII ĆWICZENIA Z BIOCHEMII D U STUDENTfiW WYDZIAŁU LEKARSKIEGO Pod redakcją Piotra Laidlera, Barbary Piekarskiej, Marii Wróbel WYDAWNICTWO UNIWERSYTETU JAGIELLOŃSKIEGO ĆWICZENIA Z BIOCHEMII DLA STUDENTÓW WYDZIAŁU

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

Prokariota i Eukariota

Prokariota i Eukariota Prokariota i Eukariota W komórkach organizmów żywych ilość DNA jest zazwyczaj stała i charakterystyczna dla danego gatunku. ILOŚĆ DNA PRZYPADAJĄCA NA APARAT GENETYCZNY WZRASTA WRAZ Z BARDZIEJ FILOGENETYCZNIE

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu DNA) Jest to reakcja powielania (replikacji)

Bardziej szczegółowo

O trawieniu restrykcyjnym

O trawieniu restrykcyjnym O trawieniu restrykcyjnym Enzymy II klasy, Mg 2+, dsdna z rozpoznawaną sekwencją, tępe, lepkie (kohezyjne) końce, warunki reakcji bufor o różnym stężeniu NaCl i określonym ph BSA -stabilizator 37 o C /lub

Bardziej szczegółowo

Projektowanie reakcji multiplex- PCR

Projektowanie reakcji multiplex- PCR Projektowanie reakcji multiplex- PCR Dzięki nowoczesnym, wydajnym zestawom do PCR, amplifikacja DNA nie jest już takim wyzwaniem, jak w latach 80-tych i 90-tych. Wraz z poprawą metodyki, pojawiły się ciekawe

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

Badanie funkcji genu

Badanie funkcji genu Badanie funkcji genu Funkcję genu można zbadać różnymi sposobami Przypadkowa analizy funkcji genu MUTACJA FENOTYP GEN Strategia ukierunkowanej analizy funkcji genu GEN 1. wprowadzenie mutacji w genie 2.

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo