ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków)

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków)"

Transkrypt

1 ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków) Celem ćwiczenia jest wprowadzenie mutacji punktowej do genu blgb: zamiana kodonu dla waliny (Val) w pozycji 92 na fenyloalaninę (Phe) oraz wprowadzenie miejsc cięcia dla enzymów restrykcyjnych: Nde I i Kpn I, odpowiednio na początku i końcu genu. Schemat reakcji OE-PCR (ang. overlap extension PCR). 1

2 Materiały: Wektor: blgb_pma-t (2,8 kbp) wektor zawierający niezmodyfikowany gen blgb (matryca do reakcji PCR) Startery: blgb V92F FOR (50 μm) blgb V92F REV (50 μm) blgb NdeI FOR (50 μm) blgb KpnI REV (50 μm) Odczynniki: termostablina polimeraza Pfu dntp (mix, 10 mm) mieszanina deoksynukleotydów sterylna woda destylowana standard do elektroforezy DNA GeneRuler 100 bp Plus DNA Ladder (Thermo Scientific) bufor obciążający do elektroforezy DNA (0.25% błękit bromofenolowy, 30% glicerol) agaroza Basica LE (Prona) Wykonanie ćwiczenia: 1. przygotować mieszaniny do dwóch reakcji PCR: PCR 1 i PCR 2: reakcja PCR 1 woda destylowana 36,0 μl matryca DNA (blgb_pma-t) (100 ng/ μl) blgb NdeI FOR (50 μm) blgb V92F REV (50 μm) dntp (10 mm, mix) polimeraza Pfu (2,5 U/μl) reakcja PCR 2 woda destylowana 36,0 μl matryca DNA (blgb_pma-t) (100 ng/ μl) blgb V92F FOR (50 μm) blgb KpnI REV (50 μm) dntp (10 mm, mix) polimeraza Pfu (2,5 U/μl) 2

3 2. zaprogramować termocykler T100 (Bio-Rad) według poniższego schematu: a. denaturacja wstępna 95 C 3 min. 1 cykl; b. denaturacja 95 C 30 s c. hybrydyzacja starterów 45 C 30 s 25 cykli d. wydłużanie 72 C 30 s e. zakończenie 72 C 5 min. f. inkubacja 4 C - 3. przygotować żel agarozowy do rozdziału elektroforetycznego produktów PCR: 2 g agarozy rozpuścić w 100 ml buforu 1 x TAE (0.04 M Tris HCl ph 8.0, 0.04 M kwas octowy 99,9% (lodowaty), 1 mm EDTA) w mikrofalówce, ostudzić, wylać, dodać 3.0 μl Midori Green DNA Stain (NIPPON Genetics EUROPE GmbH), wymieszać i pozostawić do zastygnięcia; 4. po zakończonym PCR, do każdej z próbek dodać 10 μl buforu obciążającego do elektroforezy DNA, wymieszać i nałożyć na żel. Nałożyć również standard DNA (5 μl) GeneRuler 100 bp Plus DNA Ladder; włączyć zasilacz, usatwić napięcie 90V; prowadzić elektroforezę przez ok. 30 min.; 5. w trakcie trwania elektroforezy DNA włączyć termoblok, ustawić na temperaturę grzania 60 C; 6. po zakończonej elektroforezie zrobić zdjęcie żelu, zidentyfikować właściwe produkty PCR, a następnie korzystając z transiluminatora wyciąć odpowiednie prążki; 7. wycięte prążki zawierające produkty PCR umieścić w 1.5 ml probówkach i przeprowadzić izolację DNA z żelu agarozowego za pomocą zestawu GeneElute Gel Extraction Kit (Sigma- Aldrich) na podstawie instrukcji dostarczonej przez prowadzącego; 8. po zakończonej izolacji probówki z oczyszczonymi produktami PCR podpisać i zamrozić; ciąg dalszy nastąpi na ćwiczeniu nr 2; 9. przygotować mieszaninę do trzeciej reakcji PCR (PCR 3): reakcja PCR 3 woda destylowana x μl produkt PCR 1 (V92F-KpnI) x μl produkt PCR 2 (NdeI-V92F) x μl blgb NdeI FOR (50 μm) blgb KpnI REV (50 μm) dntp (10 mm, mix) polimeraza Pfu (2,5 U/μl) 10. przeprowadzić PCR wg programu z punktu 2; 11. rozdzielić produkty PCR na żelu agarozowym (patrz pkt. 3, 4); 12. wyizolować produkty PCR analogicznie jak na ćw. nr 1; po izolacji produkty PCR zamrozić na kolejne ćwiczenia. 3

4 W sprawozdaniu (sprawozdanie będzie obejmować materiał z ćwiczeń 1, 2, 3): A) proszę zaprojektować startery umożliwiające wprowadzenie mutacji (zamiana aminokwasu waliny w pozycji 92 na fenyloalaninę) oraz miejsc cięcia dla enzymów restrykcyjnych (dla enzymu Nde I na początku genu oraz Kpn I na końcu genu wołowej beta-laktoglobuliny), proszę podać sekwencje starterów, ich długość, procentową zawartość par GC oraz temperaturę topnienia. Jeżeli przy projektowaniu starterów zostanie wykorzystana jakaś literatura lub programy komputerowe, proszę wymienić je w bibliografii. Przy projektowaniu starterów można skorzystać z materiałów pomocniczych załączonych do sprawozdania. B) proszę zamieścić właściwie opisane zdjęcia produktów PCR i zaznaczyć, które prążki odpowiadały właściwym produktom PCR; C) proszę wymienić i krótko opisać czynniki mające wpływ na szybkość rozdziału DNA w żelach agarozowych. UWAGA! Sprawozdanie powinno zostać oddane po ćwiczeniu nr 3 Sprawozdanie powinno zawierać: krótko sformułowany cel ćwiczenia; właściwie opisane wyniki eksperymentów; odpowiedzi na zagadnienia odnoszące się do danego ćwiczenia. Proszę nie umieszczać w sprawozdaniu: wstępu teoretycznego; opisu wykonania ćwiczenia. 4

5 MATERIAŁY POMOCNICZE SCHEMAT WEKTORA EKSPRESYJNEGO petduet-1 5

6 SEKWENCJA NUKLEOTYDOWA GENU blgb ATGCTGATTGTTACCCAGACCATGAAAGGTCTGGATATTCAGAAAGTTGCAGGCACCT GGTATAGCCTGGCAATGGCAGCAAGCGATATTAGCCTGCTGGATGCACAGAGCGCACC GCTGCGTGTTTATG TTGAAGAACT GAAACCGACA CCGGAAGGTGATCTG GAAAT TCTGCTGCAGAAATGGGAAA ATGGTGAATG TGCCCAGAAA AAAATCATTG CCGAAAAAAC CAAAATTCCGGCAGTGTTTA AAATCGATGC CCTGAATGAAAACAA AGTTCTGGTTCTGGACACCGATTACAAAAAATACC TGCTGTTCTG CATGGAAAAT AGCGCAGAAC CGGAACAGAG CCTGGCATGTCAGTGTCTGG TTCGTACACCGGAA GTTGAT GATGAAGCAC TGGAAAAATT CGACAAAGCACTGAAAGCCCTGCATGCC GA TATTCGTCTG AGCTTTAATC CGACCCAGCT GGAAGAACAGTGCCATATCTAA GTT- kodon kodujący walinę w pozycji 92 ATG i TAA kodony start i stop SEKWENCJE ROZPOZNAWANE PRZEZ ENZYMY RESTRYKCYJNE Nde I 5`-CA^TATG-3` Kpn I 5`-GGTAC^C-3` 6

7 TABELA KODU GENETYCZNEGO 7

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu Protokół pochodzi ze strony molekularnie.wordpress.com Kopiowanie i rozpowszechnianie wyłącznie w całości, z zachowaniem praw autorskich zgodnie z zasadami licencji GNU Dziękuję za uszanowanie mojej pracy,

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Ampli-LAMP Babesia canis

Ampli-LAMP Babesia canis Novazym Products Zestaw do identyfikacji materiału genetycznego pierwotniaka Babesia canis canis techniką Loop-mediated Isothermal AMPlification (LAMP) Numery katalogowe produktu: AML-Bc-200 AML-Bc-400

Bardziej szczegółowo

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO Ćwiczenie numer 6 Analiza próbek spożywczych na obecność markerów GMO 1. Informacje wstępne -screening GMO -metoda CTAB -qpcr 2. Izolacja DNA z soi metodą CTAB 3. Oznaczenie ilościowe i jakościowe DNA

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

Biochemia: Ćw. 11 Metoda RT-PCR

Biochemia: Ćw. 11 Metoda RT-PCR Ćwiczenie 11 METODA RT-PCR Wyciąg z kart charakterystyki substancji niebezpiecznych: bromek etydyny T+ EDTA Xi etanol, 96% F kwas octowy, 96% C -merkaptoetanol N, T Tris Xi UWAGI WSTĘPNE Praca z kwasami

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Zestaw do izolacji DNA z żeli agarozowych. Nr kat. EM08 Wersja zestawu:

Zestaw do izolacji DNA z żeli agarozowych. Nr kat. EM08 Wersja zestawu: Zestaw do izolacji DNA z żeli agarozowych Nr kat. EM08 Wersja zestawu: 1.2012 www.dnagdansk.com Nr kat. EM08 I. PRZEZNACZENIE ZESTAWU Zestaw EXTRACTME DNA GEL OUT przeznaczony jest do szybkiej i wydajnej

Bardziej szczegółowo

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość*

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość* Poznao, 6 lutego 2012 r. Zapytanie ofertowe nr 001 /2012 dotyczące zakupu odczynników chemicznych do izolacji DNA i reakcji PCR GENESIS Polska Sp. z o.o Ul. Za Cytadelą 19, 61-659 Poznao NIP 778 13 56

Bardziej szczegółowo

Novabeads Food DNA Kit

Novabeads Food DNA Kit Novabeads Food DNA Kit Novabeads Food DNA Kit jest nowej generacji narzędziem w technikach biologii molekularnej, umożliwiającym izolację DNA z produktów spożywczych wysoko przetworzonych. Metoda oparta

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

Zestaw do oczyszczania DNA po reakcjach enzymatycznych. Nr kat. EM03 Wersja zestawu:

Zestaw do oczyszczania DNA po reakcjach enzymatycznych. Nr kat. EM03 Wersja zestawu: Zestaw do oczyszczania DNA po reakcjach enzymatycznych Nr kat. EM03 Wersja zestawu: 1.2012 I. PRZEZNACZENIE ZESTAWU Zestaw EXTRACTME DNA CLEAN-UP przeznaczony jest do szybkiego i wydajnego oczyszczania

Bardziej szczegółowo

ĆWICZENIE 3 DGGE- ELEKTROFOREZA W ŻELU Z GRADIENTEM CZYNNIKA DENATURUJĄCEGO

ĆWICZENIE 3 DGGE- ELEKTROFOREZA W ŻELU Z GRADIENTEM CZYNNIKA DENATURUJĄCEGO ĆWICZENIE 3 DGGE- ELEKTROFOREZA W ŻELU Z GRADIENTEM CZYNNIKA DENATURUJĄCEGO CZĘŚĆ TEORETYCZNA Metody badań i cechy w oparciu o które przeprowadzana jest klasyfikacja i identyfikacja mikroorganizmówh Struktura

Bardziej szczegółowo

Zakład Biologii Molekularnej, Wydział Farmaceutyczny, WUM.

Zakład Biologii Molekularnej, Wydział Farmaceutyczny, WUM. Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: TERAPIA GENOWA Plan ćwiczeń Ćwiczenie 1: Przygotowanie warsztatu terapii genowej 1. Kontrola jakościowa preparatów plazmidowych paav/lacz,

Bardziej szczegółowo

Syngen Gel/PCR Mini Kit

Syngen Gel/PCR Mini Kit Syngen Gel/PCR Mini Kit Syngen Gel/PCR ME Mini Kit Zestawy do oczyszczania DNA: - z żelu agarozowego - po reakcji PCR i innych reakcjach enzymatycznych - z żelu agarozowego z małą objętością elucji - po

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

INSTYTUT GENETYKI i HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK ul. POSTĘPU 36A, JASTRZĘBIEC, 05-552 Magdalenka

INSTYTUT GENETYKI i HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK ul. POSTĘPU 36A, JASTRZĘBIEC, 05-552 Magdalenka Jastrzębiec, 12. 03. 2014 r. Dotyczy przetargu DAZ-2401/ 7 / 14 na dostawę odczynników laboratoryjnych. Do zamawiającego wpłynęły następujące pytania na które odpowiedzi publikuje poniŝej: Dotyczy części

Bardziej szczegółowo

IZOLACJA GENOMOWEGO DNA Z DROŻDŻY PIEKARNICZYCH SACCHAROMYCES CEREVISIAE Z WYKORZYSTANIEM ELEKTROFOREZY W ŻELU AGAROZOWYM W CELU WIZUALIZACJI WYNIKÓW

IZOLACJA GENOMOWEGO DNA Z DROŻDŻY PIEKARNICZYCH SACCHAROMYCES CEREVISIAE Z WYKORZYSTANIEM ELEKTROFOREZY W ŻELU AGAROZOWYM W CELU WIZUALIZACJI WYNIKÓW 44 IZOLACJA GENOMOWEGO DNA Z DROŻDŻY PIEKARNICZYCH SACCHAROMYCES CEREVISIAE Z WYKORZYSTANIEM ELEKTROFOREZY W ŻELU AGAROZOWYM W CELU WIZUALIZACJI WYNIKÓW Autorzy: Sylwia Czyjt, Gabriela Jasińska, Katarzyna

Bardziej szczegółowo

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7 Poznań, dnia 28.04.2014 r. BioVentures Institute Spółka z ograniczoną odpowiedzialnością ul. Promienista 83 60 141 Poznań Zapytanie ofertowe nr 01/2014 Projekt Nowa technologia wytwarzania szczepionek

Bardziej szczegółowo

Ampli-LAMP Salmonella species

Ampli-LAMP Salmonella species Novazym Products Novazym Polska ul. Żywokostowa 23, 61-680 Poznań, tel. +48 0 61 610 39 10, fax +48 0 61 610 39 11, email info@novazym.com Zestaw do identyfikacji materiału genetycznego bakterii z rodzaju

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU ELEKTROFOREZA

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU ELEKTROFOREZA SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU ELEKTROFOREZA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika Spis treści 1. Zawartość 2 1.1 Składniki zestawu 2 2. Opis produktu 2 2.1 Założenia metody 2 2.2 Instrukcja 2 2.3 Specyfikacja

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

AmpliTest Salmonella spp. (Real Time PCR)

AmpliTest Salmonella spp. (Real Time PCR) AmpliTest Salmonella spp. (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzaju Salmonella techniką Real Time PCR Nr kat.: BAC01-50 Wielkość zestawu: 50 oznaczeń Objętość

Bardziej szczegółowo

PAŃSTWOWY INSTYTUT WETERYNARYJNY

PAŃSTWOWY INSTYTUT WETERYNARYJNY PAŃSTWOWY INSTYTUT WETERYNARYJNY - PAŃSTWOWY INSTYTUT BADAWCZY DYREKTOR dr Krzysztof Niemczuk Uczestnicy postępowania o udzielenie zamówienia publicznego na sukcesywną dostawę odczynników do biologii molekularnej

Bardziej szczegółowo

ĆWICZENIA Z BIOLOGII MOLEKULARNEJ

ĆWICZENIA Z BIOLOGII MOLEKULARNEJ UNIWERSYTET MARII CURIE-SKŁODOWSKIEJ WYDZIAŁ BIOLOGII I BIOTECHNOLOGII ZAKŁAD BIOLOGII MOLEKULARNEJ ĆWICZENIA Z BIOLOGII MOLEKULARNEJ dla studentów II roku biologii medycznej UMCS LUBLIN 2015 Wersja 1.0

Bardziej szczegółowo

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa Nazwa Nazwa w j. ang. Wybrane problemy biologii molekularnej kwasy nukleinowe Selected problems of molecular biology

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ===============================================================================================

Bardziej szczegółowo

Zestaw do izolacji DNA z krwi świeżej i mrożonej

Zestaw do izolacji DNA z krwi świeżej i mrożonej DNA BLOOD KIT Nr kat. EM05 Wersja zestawu: 1.2012 Zestaw do izolacji DNA z krwi świeżej i mrożonej DNA BLOOD KIT www.dnagdansk.com Nr kat. EM05 I. PRZEZNACZENIE ZESTAWU Zestaw EXTRACTME DNA BLOOD przeznaczony

Bardziej szczegółowo

Załacznik nr 1, znak sprawy DZ-2501/18/16/1 FORMULARZ OPISU PRZEDMIOTU ZAMÓWIENIA - FORMULARZ CENOWY

Załacznik nr 1, znak sprawy DZ-2501/18/16/1 FORMULARZ OPISU PRZEDMIOTU ZAMÓWIENIA - FORMULARZ CENOWY Załacznik nr 1, znak sprawy DZ-2501/18/16/1 FORMULARZ OPISU PRZEDMIOTU ZAMÓWIENIA - FORMULARZ CENOWY lp. nazwa jedn. miary Maks. ilość Min. ilość Zadanie 12.1.3 Startery/sondy oligonukleotydowe Vysis lub

Bardziej szczegółowo

Izolowanie i amplifikacja kwasów nukleinowych

Izolowanie i amplifikacja kwasów nukleinowych ROZDZIAŁ 4 Izolowanie i amplifikacja kwasów nukleinowych Wojciech Garczorz Diagnostyka molekularna jest obecnie najszybciej rozwijającym się działem diagnostyki medycznej. W wielu dziedzinach medycyny

Bardziej szczegółowo

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7.2. Metody biologii molekularnej (technika PCR, sekwencjonowanie DNA) wykorzystywane w taksonomii roślin Autor: Magdalena Dudek

Bardziej szczegółowo

SCENARIUSZ LEKCJI. TEMAT LEKCJI: Podstawowe techniki inżynierii genetycznej. Streszczenie

SCENARIUSZ LEKCJI. TEMAT LEKCJI: Podstawowe techniki inżynierii genetycznej. Streszczenie SCENARIUSZ LEKCJI OPRACOWANY W RAMACH PROJEKTU: INFORMATYKA MÓJ SPOSÓB NA POZNANIE I OPISANIE ŚWIATA. PROGRAM NAUCZANIA INFORMATYKI Z ELEMENTAMI PRZEDMIOTÓW MATEMATYCZNO-PRZYRODNICZYCH Autorzy scenariusza:

Bardziej szczegółowo

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ www.cytogen.com.pl ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ 3 Spis treści 4 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 22 22 Stabilność technologii TAG Specifikacja qpcr Mix-ów Kompatybilność kitów qpcr

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa Ćwiczenie 3 Izolacja i rozdział

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

MATERIAŁY SZKOLENIOWE DLA ZAKŁADÓW HIGIENY WETERYNARYJNEJ W ZAKRESIE LABORATORYJNEJ DIAGNOSTYKI AFRYKAŃSKIEGO POMORU ŚWIŃ

MATERIAŁY SZKOLENIOWE DLA ZAKŁADÓW HIGIENY WETERYNARYJNEJ W ZAKRESIE LABORATORYJNEJ DIAGNOSTYKI AFRYKAŃSKIEGO POMORU ŚWIŃ MATERIAŁY SZKOLENIOWE DLA ZAKŁADÓW HIGIENY WETERYNARYJNEJ W ZAKRESIE LABORATORYJNEJ DIAGNOSTYKI AFRYKAŃSKIEGO POMORU ŚWIŃ Puławy 2013 Opracowanie: Prof. dr hab. Iwona Markowska-Daniel, mgr inż. Kinga Urbaniak,

Bardziej szczegółowo

ĆWICZENIA Z BIOCHEMII

ĆWICZENIA Z BIOCHEMII ĆWICZENIA Z BIOCHEMII D U STUDENTfiW WYDZIAŁU LEKARSKIEGO Pod redakcją Piotra Laidlera, Barbary Piekarskiej, Marii Wróbel WYDAWNICTWO UNIWERSYTETU JAGIELLOŃSKIEGO ĆWICZENIA Z BIOCHEMII DLA STUDENTÓW WYDZIAŁU

Bardziej szczegółowo

Techniki molekularne ćw. 1 1 z 6

Techniki molekularne ćw. 1 1 z 6 Techniki molekularne ćw. 1 1 z 6 Instrukcja do ćwiczeń Nr 1. Temat: Izolacja całkowitego DNA z tkanki ssaczej metodą wiązania DNA do kolumny krzemionkowej oraz spektrofotometryczna ocena jego czystości

Bardziej szczegółowo

DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7

DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7 DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7 Instrukcja używania zestawu kontroli ujemnej przy typowaniu antygenów zgodności tkankowej HLA SSPGo TM

Bardziej szczegółowo

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 100 ml, 250 ml, 500 ml Nr kat. 038-100, 038-250, 038-500 Nietosyczny roztwór wodny do przechowywania i zabezpieczania różnego rodzaju tkanek

Bardziej szczegółowo

KOMETA DNA. Zestaw do elektroforezy horyzontalnej typu Commet assay (na 10 lub 20 preparatów) Instrukcja Obsługi

KOMETA DNA. Zestaw do elektroforezy horyzontalnej typu Commet assay (na 10 lub 20 preparatów) Instrukcja Obsługi KOMETA DNA Zestaw do elektroforezy horyzontalnej typu Commet assay (na 10 lub 20 preparatów) Instrukcja Obsługi Numer katalogowy: 134-190 (10 preparatów) 134-196 (20 preparatów) Aby uzys k ać pomoc techniczną

Bardziej szczegółowo

Biologia Molekularna ĆWICZENIE I PREPARATYKA RNA

Biologia Molekularna ĆWICZENIE I PREPARATYKA RNA Biologia Molekularna ĆWICZENIE I PREPARATYKA RNA ĆWICZENIE I (RNA) W komórkach występują trzy główne rodzaje RNA: mrna, trna, rrna. Największą pulę RNA stanowi rrna kodujące podjednostki rybosomów (u Eukariota

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu DNA) Jest to reakcja powielania (replikacji)

Bardziej szczegółowo

Laboratorium z biochemii

Laboratorium z biochemii Laboratorium z biochemii DLA STUDENTÓW BIOLOGII, BIOTECHNOLOGII I OCHRONY ŚRODOWISKA Praca zbiorowa pod redakcją Antoniego Polanowskiego Poprawki do wydania III wprowadzone pod redakcją Justyny Ciuraszkiewicz

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA.

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SPIS TREŚCI: 1. Wprowadzenie. 2. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. 3. Karty pracy. 1. Karta

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

Techniki molekularne w biologii SYLABUS A. Informacje ogólne

Techniki molekularne w biologii SYLABUS A. Informacje ogólne Techniki molekularne w biologii SYLABUS A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod przedmiotu

Bardziej szczegółowo

AmpliTest Panel odkleszczowy (Real Time PCR)

AmpliTest Panel odkleszczowy (Real Time PCR) AmpliTest Panel odkleszczowy (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii Borrelia burgdorferi, Anaplasma, Ehrlichia oraz pierwotniaków rodzaju Babesia (B. canis, B. gibsoni,

Bardziej szczegółowo

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Załącznik nr 1 do SIWZ Nazwa i adres Wykonawcy Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Przedmiot zamówienia; automatyczny system do diagnostyki molekularnej:

Bardziej szczegółowo

Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616

Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616 Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616 10 izolacji Nr kat. 995-10 Pojemność kolumny do oczyszczania DNA wynosi 500 µg 1 Skład zestawu Składnik Ilość Temp. Przechowywania Kolumny

Bardziej szczegółowo

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208956 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 381219 (22) Data zgłoszenia: 05.12.2006 (51) Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

Łódź: ZP/21/2014 Dostawa odczynników diagnostycznych oraz sprzętu laboratoryjnego dla Instytutu CZMP

Łódź: ZP/21/2014 Dostawa odczynników diagnostycznych oraz sprzętu laboratoryjnego dla Instytutu CZMP 1 z 9 2014-02-13 13:44 Adres strony internetowej, na której Zamawiający udostępnia Specyfikację Istotnych Warunków Zamówienia: www.iczmp.edu.pl Łódź: ZP/21/2014 Dostawa odczynników diagnostycznych oraz

Bardziej szczegółowo

ANALIZA TŁUSZCZÓW WŁAŚCIWYCH CZ II

ANALIZA TŁUSZCZÓW WŁAŚCIWYCH CZ II KATEDRA BIOCHEMII Wydział Biologii i Ochrony Środowiska ANALIZA TŁUSZCZÓW WŁAŚCIWYCH CZ II ĆWICZENIE 8 ZADANIE 1 HYDROLIZA LIPIDÓW MLEKA ZA POMOCĄ LIPAZY TRZUSTKOWEJ Lipazy (EC 3.1) to enzymy należące

Bardziej szczegółowo

Zestaw do izolacji DNA z krwi świeżej i mrożonej

Zestaw do izolacji DNA z krwi świeżej i mrożonej Nr kat. EM05 Wersja zestawu: 1.2014 Zestaw do izolacji DNA z krwi świeżej i mrożonej EXTRACTME jest zastrzeżonym znakiem towarowym firmy BLIRT S.A. www.dnagdansk.com Nr kat. EM05 I. PRZEZNACZENIE ZESTAWU

Bardziej szczegółowo

Plasmid Mini. 50 izolacji, 250 izolacji. Zestaw do izolacji plazmidów wysokokopijnych wersja Nr kat ,

Plasmid Mini. 50 izolacji, 250 izolacji. Zestaw do izolacji plazmidów wysokokopijnych wersja Nr kat , Plasmid Mini Zestaw do izolacji plazmidów wysokokopijnych wersja 1016 50 izolacji, 250 izolacji Nr kat. 020-50, 020-250 Pojemność kolumny do oczyszczania DNA wynosi 20 µg. 1 Skład zestawu Składnik 50 izolacji

Bardziej szczegółowo

Część I Zakup zestawów diagnostycznych do GMO.

Część I Zakup zestawów diagnostycznych do GMO. Załącznik 4a Część I Zakup zestawów diagnostycznych do GMO. NAZWA WIELKOŚC OPAKNIA RAZEM WARTOŚĆ 1 2 3 4 5 6 7 8=4*7 9 10 11 1. Zestaw do izolacji DNA - zestaw służący do izolacji DNA z surowego materiału

Bardziej szczegółowo

Instrukcję użytkowania

Instrukcję użytkowania Instrukcję użytkowania Amplifikacja metodą PCR i sekwencjonowanie loci HLA klasy I i II Nr wersji: 13.0 Data wydania Lipiec 2013 r. EC REP Conexio Genomics Pty Ltd Qarad bvba 8/31 Pakenham St Cipalstraat

Bardziej szczegółowo

Elektroforeza kwasów nukleinowych

Elektroforeza kwasów nukleinowych Elektroforeza kwasów nukleinowych Elektroforeza jest podstawową techniką wizualizacji kwasów nukleinowych pozwala bezpośrednio identyfikować cząsteczki DNA i jest stosunkowo czuła (po odpowiednim wybarwieniu

Bardziej szczegółowo

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku Warszawski Uniwersytet Medyczny Wydział Farmaceutyczny Oddział Analityki Medycznej Justyna Krystyna Ciepły Nr albumu 41624 Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008

Bardziej szczegółowo

Zestaw do izolacji DNA z wymazów oraz nasienia. Nr kat. EM06 Wersja zestawu: 1.2012

Zestaw do izolacji DNA z wymazów oraz nasienia. Nr kat. EM06 Wersja zestawu: 1.2012 Zestaw do izolacji DNA z wymazów oraz nasienia Nr kat. EM06 Wersja zestawu: 1.2012 www.dnagdansk.com Nr kat. EM06 I. PRZEZNACZENIE ZESTAWU Zestaw EXTRACTME DNA SWAB & SEMEN przeznaczony jest do szybkiej

Bardziej szczegółowo

Właściwości białek. 1. Cele lekcji. 2. Metoda i forma pracy. a) Wiadomości. b) Umiejętności. c) Postawy

Właściwości białek. 1. Cele lekcji. 2. Metoda i forma pracy. a) Wiadomości. b) Umiejętności. c) Postawy Właściwości białek 1. Cele lekcji a) Wiadomości Uczeń: zna pojęcia: peptyd, wiązanie peptydowe, białko, wysalanie, koagulacja, peptyzacja, denaturacja, roztwór koloidalny, zol, żel. wie, jakie czynniki

Bardziej szczegółowo

Elektroforeza kwasów nukleinowych

Elektroforeza kwasów nukleinowych Elektroforeza kwasów nukleinowych Elektroforeza jest podstawową techniką wizualizacji kwasów nukleinowych pozwala bezpośrednio identyfikować cząsteczki DNA i jest stosunkowo czuła (po odpowiednim wybarwieniu

Bardziej szczegółowo

Genomic Midi AX Direct zestaw do izolacji genomowego DNA (procedura bez precypitacji) wersja 1215

Genomic Midi AX Direct zestaw do izolacji genomowego DNA (procedura bez precypitacji) wersja 1215 Genomic Midi AX Direct zestaw do izolacji genomowego DNA (procedura bez precypitacji) wersja 1215 20 izolacji Nr kat. 895-20D Pojemność kolumny do oczyszczania DNA wynosi 100 µg 1 Skład zestawu Składnik

Bardziej szczegółowo

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy PIWet Zakład Chorób Ryb Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy łososiowatych o (VHS), wirusa zakaźnej a martwicy układu krwiotwórczego (IHN)

Bardziej szczegółowo

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego Wk Wykrywanie polimorfizmów i mutacji Badania przesiewowe mutacji Wykrywanie znanych mutacji punktowych dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej

Bardziej szczegółowo

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS Nowiny Lekarskie 2006, 75, 5, 486 490 ALINA LICZBAŃSKA, ANNA WOŹNIAK, ANNA WAWROCKA, MACIEJ R. KRAWCZYŃSKI TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR

Bardziej szczegółowo

KINETYKA HYDROLIZY SACHAROZY (REAKCJA ENZYMATYCZNA I CHEMICZNA)

KINETYKA HYDROLIZY SACHAROZY (REAKCJA ENZYMATYCZNA I CHEMICZNA) Ćwiczenie nr 2 KINETYKA HYDROLIZY SACHAROZY (REAKCJA ENZYMATYCZNA I CHEMICZNA) ĆWICZENIE PRAKTYCZNE I. Kinetyka hydrolizy sacharozy reakcja chemiczna Zasada: Sacharoza w środowisku kwaśnym ulega hydrolizie

Bardziej szczegółowo

ĆWICZENIA Z BIOLOGII MOLEKULARNEJ

ĆWICZENIA Z BIOLOGII MOLEKULARNEJ UNIWERSYTET MARII CURIE-SKŁODOWSKIEJ WYDZIAŁ BIOLOGII I BIOTECHNOLOGII ZAKŁAD BIOLOGII MOLEKULARNEJ ĆWICZENIA Z BIOLOGII MOLEKULARNEJ (załącznik do ćwiczeń) dla studentów II roku biologii oraz III roku

Bardziej szczegółowo

Numer katalogowy Cena jedn. netto VAT

Numer katalogowy Cena jedn. netto VAT ZADANIE 3 4 5 6 7 8 9 załącznik nr - formularz cenowy DG-50/583/53/0 katalogu Sigma lub równowaŝne oxidase test biochemika nr kat 70439, op/50krąŝków Arabinose Disks biochemika nr kat 8037, op/0x5 krąŝków

Bardziej szczegółowo

Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna SSPGo TM HLA Typing Kits)

Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna SSPGo TM HLA Typing Kits) DOT115v08: Instrukcje użytkowania dla Biofortuna SSPGoTM HLA zestawów. Wersja 5 CE Strona 1 z 12 Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System Załącznik nr 1A do SIWZ. PARAMETRY TECHNICZNE PRZEDMIOTU ZAMÓWIENIA Zadanie nr 1. TERMOSTAT CYRKULACYJNY Termostat cyrkulacyjny Z grzaniem i chłodzeniem Zakres temperatury roboczej 25 o C do + 200 o C

Bardziej szczegółowo

Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9

Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9 Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9 Instrukcja używania testów do wykrywania kontaminacji na powierzchniach roboczych ( wipe test ) przy typowaniu

Bardziej szczegółowo

Przynieść kalkulator, jeden na osobę (nie w telefonie!)

Przynieść kalkulator, jeden na osobę (nie w telefonie!) Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ======================================================== Ćwiczenie 2

Bardziej szczegółowo

PathogenFree RNA Isolation Kit Zestaw do izolacji RNA

PathogenFree RNA Isolation Kit Zestaw do izolacji RNA PathogenFree RNA Isolation Kit Zestaw do izolacji RNA Instrukcja użytkownika Spis treści 1. Zawartość 2 1.1 Składniki zestawu 2 2. Opis produktu 2 2.1 Założenia metody 2 2.2 Specyfikacja zestawu 2 2.3

Bardziej szczegółowo

WPolsce wirus wścieklizny występuje

WPolsce wirus wścieklizny występuje Wykorzystanie RT-PCR i Real-Time PCR jako metod uzupełniających rutynową diagnostykę wścieklizny The use of RT-PCR and Real-Time PCR to complement routine rabies diagnostic methods Mucha B., Rymer-Zamecka

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: MOLEKULARNE PODSTAWY BIOTECHNOLOGII

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: MOLEKULARNE PODSTAWY BIOTECHNOLOGII Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa ĆWICZENIE 1 IZOLACJA raav Z KOMÓREK PAKUJĄCYCH AAV293

Bardziej szczegółowo

Część I Zakup zestawów diagnostycznych do GMO.

Część I Zakup zestawów diagnostycznych do GMO. Załącznik 4a Część I Zakup zestawów diagnostycznych do GMO. NAZWA WIELKOŚC OPAKOWANIA JEDNOSTK OWA VAT % RAZEM WARTOŚĆ 1 2 3 4 5 6 7 8=4*7 9 10 11 1. Zestaw do izolacji DNA - zestaw służący do izolacji

Bardziej szczegółowo

HYDROLIZA SOLI. ROZTWORY BUFOROWE

HYDROLIZA SOLI. ROZTWORY BUFOROWE Ćwiczenie 9 semestr 2 HYDROLIZA SOLI. ROZTWORY BUFOROWE Obowiązujące zagadnienia: Hydroliza soli-anionowa, kationowa, teoria jonowa Arrheniusa, moc kwasów i zasad, równania hydrolizy soli, hydroliza wieloetapowa,

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo

MINIPOL 2. Zestaw do minielektroforezy płytowej w jednym lub dwóch żelach poliakrylamidowych. Instrukcja Obsługi. Numer katalogowy:

MINIPOL 2. Zestaw do minielektroforezy płytowej w jednym lub dwóch żelach poliakrylamidowych. Instrukcja Obsługi. Numer katalogowy: MINIPOL 2 Zestaw do minielektroforezy płytowej w jednym lub dwóch żelach poliakrylamidowych Instrukcja Obsługi Numer katalogowy: 103-100 Aby uzys k ać pomoc techniczną : T 22 668 71 47 Spis treści 1. Informacje

Bardziej szczegółowo

Badamy DNA. Agata Rogowska, Jakub Urbański. Opracowanie merytoryczne treści zestawu:

Badamy DNA. Agata Rogowska, Jakub Urbański. Opracowanie merytoryczne treści zestawu: Badamy DNA Agata Rogowska, Jakub Urbański Opracowanie merytoryczne treści zestawu: Agata Rogowska, Jakub Urbański Ilustracje: Dean Madden Korekta: Joanna Lilpop Zestaw opracowany w ramach projektu Science

Bardziej szczegółowo

Adres strony internetowej, na której Zamawiający udostępnia Specyfikację Istotnych Warunków Zamówienia: www.imp.sosnowiec.pl

Adres strony internetowej, na której Zamawiający udostępnia Specyfikację Istotnych Warunków Zamówienia: www.imp.sosnowiec.pl Strona 1 z 7 Adres strony internetowej, na której Zamawiający udostępnia Specyfikację Istotnych Warunków Zamówienia: www.imp.sosnowiec.pl Sosnowiec: Sukcesywna dostawa odczynników dla Instytutu Medycyny

Bardziej szczegółowo

Inżynieria genetyczna Ćwiczenie 3

Inżynieria genetyczna Ćwiczenie 3 Inżynieria genetyczna Ćwiczenie 3 Metoda PCR została opracowana w 1987 r. przez grupę Naukowców z Cetus Corporation w USA. Firma Roche odkupiła od Cetus Corp. prawa do PCR za 300 mln $ Autor K. Mullis

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

Izolacja i oczyszczanie DNA jest kluczowym etapem większości. procedur stosowanych w biologii molekularnej, diagnostyce i innych

Izolacja i oczyszczanie DNA jest kluczowym etapem większości. procedur stosowanych w biologii molekularnej, diagnostyce i innych izolacja DNA Izolacja i oczyszczanie DNA jest kluczowym etapem większości procedur stosowanych w biologii molekularnej, diagnostyce i innych badaniach. Głównym celem tego etapu badań jest uzyskanie wysokiej

Bardziej szczegółowo

d[a] = dt gdzie: [A] - stężenie aspiryny [OH - ] - stężenie jonów hydroksylowych - ] K[A][OH

d[a] = dt gdzie: [A] - stężenie aspiryny [OH - ] - stężenie jonów hydroksylowych - ] K[A][OH 1 Ćwiczenie 7. Wyznaczanie stałej szybkości oraz parametrów termodynamicznych reakcji hydrolizy aspiryny. Chemiczna stabilność leków jest ważnym terapeutycznym problemem W przypadku chemicznej niestabilności

Bardziej szczegółowo