Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Wielkość: px
Rozpocząć pokaz od strony:

Download "Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV"


1 Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności w genie ccr5. Wstęp teoretyczny Gen ccr5, zlokalizowany na 3 chromosomie, występuje w populacji ludzkiej w 2 odmianach (allelach) - ccr5 i ccr5δ32. Allel ccr5 odpowiada za syntezę białka receptorowego CCR5, znajdującego się na powierzchni m. in. makrofagów, monocytów, limfocytów T. Białko to jest jednym z koreceptorów wirusa HIV. Obecność koreceptora CCR5 na powierzchni limfocytu pomocniczego jest konieczna, aby HIV mógł wniknąć do wnętrza komórki i wywołać infekcję. Allel ccr5δ32 jest uszkodzonym wariantem genu ccr5 i różni się od niego delecją (ubytkiem) 32 par zasad. Wynikiem takiej delecji jest zniesienie syntezy białka ko-receptorowego CCR5. Badanie polega na oznaczeniu tzw. genotypu CCR5 i pozwala na określenie czy u osoby badanej występuje genetycznie uwarunkowana oporność na zakażenie wirusem HIV-1. Osoby będące homozygotami typu ccr5δ32 są oporne na zakażenie wirusem HIV-1. Nosicielem takiej mutacji jest tylko ok. 1-2% przedstawicieli rasy białej. Osoby z jedną kopią genu zmutowaną i jedną kopią prawidłową tzw. heterozygoty charakteryzują się zmniejszonym ryzkiem zakażenia wirusem HIV. W przypadku zakażenia postęp choroby u takich osób będzie wolniejszy. Polimorfizm pod względem CCR5 nie objawia się fenotypowo, nie zaobserwowano też, aby zabezpieczał przed innymi chorobami zakaźnymi. Wykazywane w wielu badaniach różnice częstości występowania allelu ccr5δ32 tłumaczyć można ich zmiennym rozkładem w poszczególnych grupach etnicznych. I tak stwierdzono, że częstość allelu ccr5δ32 jest znacznie większa w północnej Europie (15,8% w Finlandii, 14,2% w Szwecji, 14,7% w Irlandii, 11,1% w Wielkiej Brytanii) niż w południowej (5,5% we Włoszech, 2,4% w Grecji, 4,2% na Cyprze), podczas gdy w populacjach pozaeuropejskich polimorfizm ten jest nieobecny lub bardzo rzadki.

2 Amplifikacja fragmentu genu ccr5 przy użyciu jednej pary starterów, pozwala na uzyskanie fragment o długości 183 pz swoistego dla prawidłowego genu ccr5 i fragmentu 151 pz swoistego dla genu zmutowanego ccr5δ3. Interpretacja możliwych wyników przedstawiona jest w tabeli Genotyp ccr5 oznaczany za pomocą reakcji PCR Produkt PCR Oporność na zakażenie wirusem HIV-1 Homozygota typu ccr5 183 pz nie Tabela.1 Heterozygota 183 i 151 pz zmniejszone ryzyko rozwoju choroby Homozygota typu ccr5δ pz tak Piśmiennictwo 1. Carrington M, Dean M, Martin MP, O'Brien SJ, Genetics of HIV-1 infection: chemokine receptor CCR5 polymorphism and its consequences, Hum Mol Genet. 1999;8(10): Wąsik TJ, Smoleń J, Kruszyński P, Bratosiewicz-Wąsik J, Beniowski M, Rola polimorficznych alleli CCR5-Δ32, CCR2-64I i SDF-1-3 w zakażeniu ludzkim wirusem upośledzenia odporności typu 1 (HIV 1 ) w populacji polskiej, Wiadomości Lekarskie, 2005, LVIII, Materiały Zestaw do izolacji DNA z wymazówek, postępować zgodnie z procedurą producenta DNA kontrolne typu dzikiego (K1+), DNA kontrolne zawierające zmutowaną formę genu ccr5δ32 (K2+) 10x stężony bufor do reakcji PCR Shark, 20 mm roztwór MgCl 2, 8 mm mieszanina dntps startery CCR51 (CTTCATTACACCTGCAGCTCT) i CCR52 (CACAGCCCTGTCCCTCTTCTTC) polimeraza DNA termostabilna Pwo Hypernova [2 U/µl] (DNA Gdańsk) woda jałowa, agaroza, bufor 1xTAE, termocykler, aparat do elektroforezy poziomej, transilluminator, zimny blok, statywy do probówek

3 Wykonanie 1. Przeprowadzić izolację DNA z własnych komórek pobranych w formie wymazów ze śluzówki policzka z wykorzystaniem zestawu do izolacji DNA zgodnie z instrukcją postępowania dostarczoną przez producenta. 2. Przygotować 4 probówki 0,2 ml i opisać je symbolami wg tabeli 10.2, uwzględniając kontrole dodatnie i ujemne. 3. W probówce 1,5 ml przygotować mieszaninę Master MIX, zawierającą wszystkie składniki z wyjątkiem matrycy DNA, wymieszać i rozporcjować po 24 µl. Skład mieszaniny reakcyjnej i profil temperaturowo czasowy reakcji PCR Skłąd mieszaniny reakcyjnej Skład Ilość [µl] Temperatura x1 Master 1 K1+ K2+ K- [ C] MIX (x 5) Woda 14,2 Tabela.2 Profil temperaturowo czasowy 10 x bufor Shark 2, MgCl 2 [20 mm] 2, dntps [8 mm] 2, CCR51 [10 µm] 1, CCR52 [10 µm] 1, Polimeraza Pwo [2 U/µl] 0, DNA 1,0 X 1,0 1,0 1,0 1,0 [H 2 O] Objetość całkowita Do próbki 1 dodać 1µl wyizolowanego DNA z wymazówek, do próbki K1+ dodać DNA osobnika z homoalleliczną formę genu ccr5 typu dzikiego, do próbki K2+ dodać DNA zawierające zmutowaną formę genu ccr5δ32 (układ heteroalleliczny), do kontroli ujemnej K- dodać wody jałowej. 5. Umieścić probówki w termocyklerze. Przeprowadzić reakcję PCR zgodnie z profilem temperaturowo czasowym, przedstawionym w tabeli Produkty PCR rozdzielać w żelu agarozowym 2% z dodatkiem bromku etydyny (0,5 mg/ml), w buforze 1xTAE przy napięciu ok. 7 V/cm długości żelu. Żel analizować w świetle UV. Czas [s] Liczba cykli 40

4 Wyniki i wnioski Wklej i opisz zdjęcie przedstawiające elektroforetyczny rozdział produktów PCR, zaznacz marker wielkości DNA, próbę z własnego DNA, kontrole dodatnie oraz kontrolę ujemną. Zaznacz wielkości otrzymanych produktów PCR. W oparciu o wyniki amplifikacji określ czy jesteś osobnikiem homozygotycznym czy heterozygotycznym pod względem genu ccr5 oraz czy masz genetycznie uwarunkowaną oporność na wirusa HIV-1.


Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

Ampli-LAMP Babesia canis

Ampli-LAMP Babesia canis Novazym Products Zestaw do identyfikacji materiału genetycznego pierwotniaka Babesia canis canis techniką Loop-mediated Isothermal AMPlification (LAMP) Numery katalogowe produktu: AML-Bc-200 AML-Bc-400

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu Protokół pochodzi ze strony molekularnie.wordpress.com Kopiowanie i rozpowszechnianie wyłącznie w całości, z zachowaniem praw autorskich zgodnie z zasadami licencji GNU Dziękuję za uszanowanie mojej pracy,

Bardziej szczegółowo

Ampli-LAMP Salmonella species

Ampli-LAMP Salmonella species Novazym Products Novazym Polska ul. Żywokostowa 23, 61-680 Poznań, tel. +48 0 61 610 39 10, fax +48 0 61 610 39 11, email info@novazym.com Zestaw do identyfikacji materiału genetycznego bakterii z rodzaju

Bardziej szczegółowo

Charakterystyka molekularna bakterii z rodzaju Enterococcus

Charakterystyka molekularna bakterii z rodzaju Enterococcus Charakterystyka molekularna bakterii z rodzaju Enterococcus Literatura: 1. Szewczyk Eligia M (red.), Diagnostyka mikrobiologiczna, Wydawnictwo Naukowe PWN, Warszawa 2006, str. 37. 2. Śledzińska A., Samet

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

Różnorodność genetyczna człowieka

Różnorodność genetyczna człowieka Różnorodność genetyczna człowieka Zmienność genetyczna człowieka Różnorodność genetyczna człowieka Projekt 1000 genomów poszukiwanie różnic w genomach różnych ludzi (2500 osób) Projekt 1000 genomów Różnorodność

Bardziej szczegółowo

Składniki jądrowego genomu człowieka

Składniki jądrowego genomu człowieka Składniki jądrowego genomu człowieka Genom człowieka 3 000 Mpz (3x10 9, 100 cm) Geny i sekwencje związane z genami (900 Mpz, 30% g. jądrowego) DNA pozagenowy (2100 Mpz, 70%) DNA kodujący (90 Mpz ~ ok.

Bardziej szczegółowo


INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Załącznik nr 1 do SIWZ Nazwa i adres Wykonawcy Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Przedmiot zamówienia; automatyczny system do diagnostyki molekularnej:

Bardziej szczegółowo

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku Warszawski Uniwersytet Medyczny Wydział Farmaceutyczny Oddział Analityki Medycznej Justyna Krystyna Ciepły Nr albumu 41624 Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten proces. Na schemacie przedstawiono etapy przekazywania

Bardziej szczegółowo

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A...

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A... 1. Zadanie (0 2 p. ) Porównaj mitozę i mejozę, wpisując do tabeli podane określenia oraz cyfry. ta sama co w komórce macierzystej, o połowę mniejsza niż w komórce macierzystej, gamety, komórki budujące

Bardziej szczegółowo

AmpliTest Salmonella spp. (Real Time PCR)

AmpliTest Salmonella spp. (Real Time PCR) AmpliTest Salmonella spp. (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzaju Salmonella techniką Real Time PCR Nr kat.: BAC01-50 Wielkość zestawu: 50 oznaczeń Objętość

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo



Bardziej szczegółowo

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków.

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Katarzyna Mazur-Kominek Współautorzy Tomasz Romanowski, Krzysztof P. Bielawski, Bogumiła Kiełbratowska, Magdalena Słomińska-

Bardziej szczegółowo

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI Fot. W. Wołkow Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt POPULACJA Zbiór organizmów żywych, które łączy

Bardziej szczegółowo

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO Ćwiczenie numer 6 Analiza próbek spożywczych na obecność markerów GMO 1. Informacje wstępne -screening GMO -metoda CTAB -qpcr 2. Izolacja DNA z soi metodą CTAB 3. Oznaczenie ilościowe i jakościowe DNA

Bardziej szczegółowo

Genetyka Populacji http://ggoralski.com

Genetyka Populacji http://ggoralski.com Genetyka Populacji http://ggoralski.com Frekwencje genotypów i alleli Frekwencja genotypów Frekwencje genotypów i alleli Zadania P AA = 250/500 = 0,5 P Aa = 100/500 = 0,2 P aa = 150/500 = 0,3 = 1 Frekwencje

Bardziej szczegółowo

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość*

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość* Poznao, 6 lutego 2012 r. Zapytanie ofertowe nr 001 /2012 dotyczące zakupu odczynników chemicznych do izolacji DNA i reakcji PCR GENESIS Polska Sp. z o.o Ul. Za Cytadelą 19, 61-659 Poznao NIP 778 13 56

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo


MARKERY MIKROSATELITARNE MARKERY MIKROSATELITARNE Badania laboratoryjne prowadzone w Katedrze Genetyki i Ogólnej Hodowli Zwierząt SGGW w ramach monitoringu genetycznego wykorzystują analizę genetyczną markerów mikrosatelitarnych.

Bardziej szczegółowo

Zadania maturalne z biologii - 7

Zadania maturalne z biologii - 7 Koło Biologiczne Liceum Ogólnokształcące nr II w Gliwicach 2015-2016 Zadania maturalne z biologii - 7 Zadania: Zad.1 (Jesika Stępień, Natalia Świetlak, Daniela Schwedka 3D) Przeczytaj tekst i na jego podstawie

Bardziej szczegółowo

Bliskie Spotkanie z Biologią. Genetyka populacji

Bliskie Spotkanie z Biologią. Genetyka populacji Bliskie Spotkanie z Biologią Genetyka populacji Plan wykładu 1) Częstości alleli i genotypów w populacji 2) Prawo Hardy ego-weinberga 3) Dryf genetyczny 4) Efekt założyciela i efekt wąskiego gardła 5)

Bardziej szczegółowo

Zakład Biologii Molekularnej, Wydział Farmaceutyczny, WUM.

Zakład Biologii Molekularnej, Wydział Farmaceutyczny, WUM. Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: TERAPIA GENOWA Plan ćwiczeń Ćwiczenie 1: Przygotowanie warsztatu terapii genowej 1. Kontrola jakościowa preparatów plazmidowych paav/lacz,

Bardziej szczegółowo

Analiza mutacji p.d36n i p.n318s oraz polimorfizmu p.s474x genu lipazy lipoproteinowej u chorych z hipercholesterolemią rodzinną.

Analiza mutacji p.d36n i p.n318s oraz polimorfizmu p.s474x genu lipazy lipoproteinowej u chorych z hipercholesterolemią rodzinną. Analiza mutacji p.d36n i p.n318s oraz polimorfizmu p.s474x genu lipazy lipoproteinowej u chorych z hipercholesterolemią rodzinną. Monika śuk opiekun: prof. dr hab. n. med. Janusz Limon Katedra i Zakład

Bardziej szczegółowo

a) Zapisz genotyp tego mężczyzny... oraz zaznacz poniżej (A, B, C lub D), jaki procent gamet tego mężczyzny będzie miało genotyp ax b.

a) Zapisz genotyp tego mężczyzny... oraz zaznacz poniżej (A, B, C lub D), jaki procent gamet tego mężczyzny będzie miało genotyp ax b. W tomie 2 zbioru zadań z biologii z powodu nieprawidłowego wprowadzenia komendy przenoszenia spójników i przyimków do następnej linii wystąpiła zamiana samotnych dużych liter (A, I, W, U) na małe litery.

Bardziej szczegółowo

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym mgr Magdalena Brzeskwiniewicz Promotor: Prof. dr hab. n. med. Janusz Limon Katedra i Zakład Biologii i Genetyki Gdański Uniwersytet Medyczny

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo

AmpliTest Panel odkleszczowy (Real Time PCR)

AmpliTest Panel odkleszczowy (Real Time PCR) AmpliTest Panel odkleszczowy (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii Borrelia burgdorferi, Anaplasma, Ehrlichia oraz pierwotniaków rodzaju Babesia (B. canis, B. gibsoni,

Bardziej szczegółowo

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Praca wykonana pod kierunkiem dr hab. Tomasza Grzybowskiego w Katedrze Medycyny Sądowej w Zakładzie Genetyki Molekularnej

Bardziej szczegółowo

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP ARCH. MED. SĄD. KRYMINOL., 2010, LX, 243-247 PRACE ORYGINALNE / ORIGINALS Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski Analiza danych populacyjnych loci ministr: D10S1248,

Bardziej szczegółowo

Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9

Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9 Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9 Instrukcja używania testów do wykrywania kontaminacji na powierzchniach roboczych ( wipe test ) przy typowaniu

Bardziej szczegółowo



Bardziej szczegółowo

Atrakcyjna i Innowacyjna Biotechnologia - ATRINBIOTECH Priorytet IV POKL Szkolnictwo wyższe i nauka

Atrakcyjna i Innowacyjna Biotechnologia - ATRINBIOTECH Priorytet IV POKL Szkolnictwo wyższe i nauka Metoda TILLING (Targeting Induced Local Lesions IN Genomes) to metoda odwrotnej genetyki oparta na wykorzystaniu enzymu CEL I (endonukleazy wizolowanej z selera naciowego Apium graveolens), który wykrywa

Bardziej szczegółowo

[ IMIĘ I NAZWISKO:. KLASA NR.. ] Zadania genetyczne

[ IMIĘ I NAZWISKO:. KLASA NR.. ] Zadania genetyczne Zadanie 1. (2 pkt). Ciemnooki mężczyzna, którego ojciec miał oczy piwne a matka niebieskie, poślubił ciemnooką kobietę. Syn tej pary jest niebieskooki. Przyjmując oznaczenia: allel dominujący (barwnik

Bardziej szczegółowo

Załącznik nr 4 Metodyka pobrania materiału przedstawiona jest w osobnym Instrukcja PZH

Załącznik nr 4 Metodyka pobrania materiału przedstawiona jest w osobnym Instrukcja PZH Załącznik nr 4 Metodyka pobrania materiału przedstawiona jest w osobnym Instrukcja PZH 1. Rodzaj materiału klinicznego w zależności od kierunku i metodyki badań wykonywanych przez PZH Poz. Badanie Rodzaj

Bardziej szczegółowo

Znaczenie genetyki. Opracował A. Podgórski

Znaczenie genetyki. Opracował A. Podgórski Znaczenie genetyki Opracował A. Podgórski InŜynieria genetyczna InŜynieria genetyczna ingerencja w materiał genetyczny organizmów, w celu zmiany ich właściwości dziedzicznych. Istota inŝynierii genetycznej

Bardziej szczegółowo



Bardziej szczegółowo

Podstawy genetyki człowieka. Cechy wieloczynnikowe

Podstawy genetyki człowieka. Cechy wieloczynnikowe Podstawy genetyki człowieka Cechy wieloczynnikowe Dziedziczenie Mendlowskie - jeden gen = jedna cecha np. allele jednego genu decydują o barwie kwiatów groszku Bardziej złożone - interakcje kilku genów

Bardziej szczegółowo


DETEKCJA PATOGENÓW DRÓG MOCZOWO-PŁCIOWYCH DETEKCJA PATOGENÓW DRÓG MOCZOWO-PŁCIOWYCH Detekcja i identyfikacja 7 patogenów dróg moczowo-płciowych Detekcja Neisseria gonorrhoeae i Chlamydia trachomatis Detekcja Trichomonas vaginalis i Mycoplasma

Bardziej szczegółowo


Kurs pt.  MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII Warszawa, 6 lutego 2011 r. Szanowna Pani! Szanowny Panie! Niniejszym uprzejmie informuję, że organizowany jest Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII " Kurs odbędzie się w dniach

Bardziej szczegółowo

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego Wk Wykrywanie polimorfizmów i mutacji Badania przesiewowe mutacji Wykrywanie znanych mutacji punktowych dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej

Bardziej szczegółowo

Imię i nazwisko...kl...

Imię i nazwisko...kl... Gimnazjum nr 4 im. Ojca Świętego Jana Pawła II we Wrocławiu SPRAWDZIAN GENETYKA GR. A Imię i nazwisko...kl.... 1. Nauka o regułach i mechanizmach dziedziczenia to: (0-1pkt) a) cytologia b) biochemia c)

Bardziej szczegółowo

Biochemia: Ćw. 11 Metoda RT-PCR

Biochemia: Ćw. 11 Metoda RT-PCR Ćwiczenie 11 METODA RT-PCR Wyciąg z kart charakterystyki substancji niebezpiecznych: bromek etydyny T+ EDTA Xi etanol, 96% F kwas octowy, 96% C -merkaptoetanol N, T Tris Xi UWAGI WSTĘPNE Praca z kwasami

Bardziej szczegółowo


INSTYTUT MATKI I DZIECKA ZAKŁAD GENETYKI MEDYCZNEJ INSTYTUT MATKI I DZIECKA ZAKŁAD GENETYKI MEDYCZNEJ Kierownik: prof. dr hab. n. med. Tadeusz Mazurczak ul. Kasprzaka 17a, 01-211 Warszawa Tel: (022) 632-96-57; Tel/fax: (022) 632 62 24 e-mail: genetyka@imid.med.pl

Bardziej szczegółowo

Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616

Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616 Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616 10 izolacji Nr kat. 995-10 Pojemność kolumny do oczyszczania DNA wynosi 500 µg 1 Skład zestawu Składnik Ilość Temp. Przechowywania Kolumny

Bardziej szczegółowo


TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA DNA 28SRNA 18/16S RNA 5SRNA mrna Ilościowa analiza mrna aktywność genów w zależności od wybranych czynników: o rodzaju tkanki o rodzaju czynnika zewnętrznego o rodzaju upośledzenia szlaku metabolicznego

Bardziej szczegółowo

Zestaw do izolacji DNA z żeli agarozowych. Nr kat. EM08 Wersja zestawu:

Zestaw do izolacji DNA z żeli agarozowych. Nr kat. EM08 Wersja zestawu: Zestaw do izolacji DNA z żeli agarozowych Nr kat. EM08 Wersja zestawu: 1.2012 www.dnagdansk.com Nr kat. EM08 I. PRZEZNACZENIE ZESTAWU Zestaw EXTRACTME DNA GEL OUT przeznaczony jest do szybkiej i wydajnej

Bardziej szczegółowo

Genetyka populacyjna

Genetyka populacyjna Genetyka populacyjna analizuje strukturę genetyczną całych populacji oraz wyniki kojarzeń wewnątrz populacji lub pomiędzy różnymi populacjami, opiera się na modelach matematycznych Prawo równowagi Hardy

Bardziej szczegółowo

DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7

DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7 DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7 Instrukcja używania zestawu kontroli ujemnej przy typowaniu antygenów zgodności tkankowej HLA SSPGo TM

Bardziej szczegółowo


CENNIK DIAGNOSTYKA NIEPŁODNOŚCI MĘSKIEJ CENNIK DIAGNOSTYKA NIEPŁODNOŚCI MĘSKIEJ AZOOSPERMIA badanie wykrywa delecje w regionie długiego ramienia chromosomu Y w fragmencie zwanym AZF, będące często przyczyną azoospermii lub oligospermii o podłożu

Bardziej szczegółowo

Techniki molekularne w biologii SYLABUS A. Informacje ogólne

Techniki molekularne w biologii SYLABUS A. Informacje ogólne Techniki molekularne w biologii SYLABUS A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod przedmiotu

Bardziej szczegółowo



Bardziej szczegółowo

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki Klub Młodego Wynalazcy - Laboratoria i wyposażenie Zadbaliśmy o to, żeby wyposażenie w Klubie Młodego Wynalazcy było w pełni profesjonalne. Ważne jest, aby dzieci i młodzież, wykonując doświadczenia korzystały

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo



Bardziej szczegółowo

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System Załącznik nr 1A do SIWZ. PARAMETRY TECHNICZNE PRZEDMIOTU ZAMÓWIENIA Zadanie nr 1. TERMOSTAT CYRKULACYJNY Termostat cyrkulacyjny Z grzaniem i chłodzeniem Zakres temperatury roboczej 25 o C do + 200 o C

Bardziej szczegółowo

Organizacja genomu człowieka i sekwencjonowanie DNA

Organizacja genomu człowieka i sekwencjonowanie DNA Organizacja genomu człowieka i sekwencjonowanie DNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Organizacja genów na ludzkim chromosomie.

Bardziej szczegółowo

Biotechnika rozrodu ryb jesiotrowatych. Dr inż. Dorota Fopp-Bayat Katedra Ichtiologii UW-M w Olsztynie

Biotechnika rozrodu ryb jesiotrowatych. Dr inż. Dorota Fopp-Bayat Katedra Ichtiologii UW-M w Olsztynie Biotechnika rozrodu ryb jesiotrowatych Dr inż. Dorota Fopp-Bayat Katedra Ichtiologii UW-M w Olsztynie Stanowisko systematyczne (Nelson 1994) gromada: ACTINOPTERYGII RYBY PROMIENIOPŁETWE podgromada: CHONDROSTEI

Bardziej szczegółowo

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 100 ml, 250 ml, 500 ml Nr kat. 038-100, 038-250, 038-500 Nietosyczny roztwór wodny do przechowywania i zabezpieczania różnego rodzaju tkanek

Bardziej szczegółowo

Genetyka populacyjna. Populacja

Genetyka populacyjna. Populacja Genetyka populacyjna Populacja 1 Populacja Populacja jest to zbiór osobników jednego gatunku żyjących na danym terytorium w danym czasie. Genetykę populacyjną interesuje tzw. populacja panmiktyczna (mendlowska),

Bardziej szczegółowo



Bardziej szczegółowo

Człowiek mendlowski? Genetyka człowieka w XX i XXI w.

Człowiek mendlowski? Genetyka człowieka w XX i XXI w. Człowiek mendlowski? Genetyka człowieka w XX i XXI w. Informacje Kontakt: Paweł Golik Instytut Genetyki i Biotechnologii, Pawińskiego 5A pgolik@igib.uw.edu.pl Informacje, materiały: http://www.igib.uw.edu.pl/

Bardziej szczegółowo

Światowy Dzień Pamięci o Zmarłych na AIDS

Światowy Dzień Pamięci o Zmarłych na AIDS Światowy Dzień Pamięci o Zmarłych na AIDS Przypada w dniu 17 maja każdego roku Warszawa, 2013 HIV- ludzki wirus niedoboru odporności powoduje AIDS- zespół nabytego niedoboru odporności Z kart historii

Bardziej szczegółowo

Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne cereal mosaic virus, SBCMV)

Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne cereal mosaic virus, SBCMV) Małgorzata Jeżewska Zakład Wirusologii i Bakteriologii, Instytut Ochrony Roślin Państwowy Instytut Badawczy, Poznań Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937 (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.0 (13) (51) T3 Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

Novabeads Food DNA Kit

Novabeads Food DNA Kit Novabeads Food DNA Kit Novabeads Food DNA Kit jest nowej generacji narzędziem w technikach biologii molekularnej, umożliwiającym izolację DNA z produktów spożywczych wysoko przetworzonych. Metoda oparta

Bardziej szczegółowo

Fizjologiczne i molekularne markery tolerancji buraka cukrowego na suszę. Dr Danuta Chołuj

Fizjologiczne i molekularne markery tolerancji buraka cukrowego na suszę. Dr Danuta Chołuj Fizjologiczne i molekularne markery tolerancji buraka cukrowego na suszę Dr Danuta Chołuj Szacunkowe straty plonu buraków cukrowych w Europie na skutek suszy kształtują się pomiędzy 5 a 30 % W jakiej fazie

Bardziej szczegółowo

Streszczenie. Summary. Katarzyna Zwolińska. Postepy Hig Med Dosw. (online), 2009; 63: e-issn Słowa kluczowe:

Streszczenie. Summary. Katarzyna Zwolińska. Postepy Hig Med Dosw. (online), 2009; 63: e-issn Słowa kluczowe: Postepy Hig Med Dosw. (online), 2009; 63: 73-91 e-issn 1732-2693 www.phmd.pl Review Received: 2008.10.22 Accepted: 2009.02.09 Published: 2009.02.24 Czynniki genetyczne związane z podatnością na zakażenie

Bardziej szczegółowo

Przykładowe zadania. przygotowujące do egzaminu maturalnego

Przykładowe zadania. przygotowujące do egzaminu maturalnego Przykładowe zadania z BIOLOGii przygotowujące do egzaminu maturalnego Prezentowane zadania są zgodne z podstawą programową kształcenia ogólnego w zakresie rozszerzonym i podstawowym. Prócz zadań, które

Bardziej szczegółowo



Bardziej szczegółowo

Poniższe wytyczne dotyczą wszystkich rodzajów materiału klinicznego.

Poniższe wytyczne dotyczą wszystkich rodzajów materiału klinicznego. Strona 1 z 5 Wytyczne dotyczące zlecania, pobierania, oznakowania, przechowywania, transportowania i rejestrowania próbek materiału klinicznego do badań w Pracowni PCR Niżej przedstawione wytyczne dotyczące

Bardziej szczegółowo


CZEŚĆ III OPIS PRZZEDMIOTU ZAMÓWIENIA (OPZ) INSTYTUT IMMUNOLOGII I TERAPII DOŚWIADCZALNEJ im. Ludwika Hirszfelda Polska Akademia Nauk ul. Rudolfa Weigla 12, 53-114 Wrocław tel. / fax. (4871) 37-09-997, http://www.iitd.pan.wroc.pl NIP: 896-000-56-96;

Bardziej szczegółowo

Jednostka chorobowa. 3mc 1260. Czas analizy [dni roboczych] Literatura Gen. Cena [PLN] Badany Gen. Materiał biologiczny. Chorobowa OMIM TM.

Jednostka chorobowa. 3mc 1260. Czas analizy [dni roboczych] Literatura Gen. Cena [PLN] Badany Gen. Materiał biologiczny. Chorobowa OMIM TM. Jednostka chorobowa Jednostka Oznaczenie Chorobowa OMIM TM testu Badany Gen Literatura Gen OMIM TM Opis/cel badania Zakres analizy Materiał biologiczny Czas analizy [dni roboczych] Cena [PLN] HEMOFILIA

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo



Bardziej szczegółowo


DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH Detekcja enterowirusów Detekcja sześciu typów ludzkich herpeswirusów (HHV) Detekcja pięciu bakterii Seeplex Detekcja patogenów powodujących

Bardziej szczegółowo

144010 HCR-APOB Analiza. Wykrycie charakterystycznych mutacji genu APOB warunkujących występowanie hipercholesterolemii rodzinnej.

144010 HCR-APOB Analiza. Wykrycie charakterystycznych mutacji genu APOB warunkujących występowanie hipercholesterolemii rodzinnej. Badany Gen Literatura OMIM TM Gen Jednostka chorobowa Literatura OMIM TM Jednostka chorobowa Oznaczenie testu Opis/cel badania Zakres analizy Czas analizy Materiał [dni biologiczny roboczy ch] APOB 7730

Bardziej szczegółowo


GIMNAZJUM SPRAWDZIANY SUKCES W NAUCE GIMNAZJUM SPRAWDZIANY BIOLOGIA klasa III SUKCES W NAUCE II GENETYKA CZŁOWIEKA Zadanie 1. Cechy organizmu są warunkowane przez allele dominujące i recesywne. Uzupełnij tabelę, wykorzystując poniższe określenia,

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

Materiał i metody. Wyniki

Materiał i metody. Wyniki Abstract in Polish Wprowadzenie Selen jest pierwiastkiem śladowym niezbędnym do prawidłowego funkcjonowania organizmu. Selen jest wbudowywany do białek w postaci selenocysteiny tworząc selenobiałka (selenoproteiny).

Bardziej szczegółowo

Mieszanina trójfosforanów deoksyrybonukleotydów (dntp: datp, dgtp, dctp, dttp) Bufor reakcyjny zapewniający odpowiednie warunki reakcji

Mieszanina trójfosforanów deoksyrybonukleotydów (dntp: datp, dgtp, dctp, dttp) Bufor reakcyjny zapewniający odpowiednie warunki reakcji Uniwersytet Gdański, Wydział Biologii Biologia i Biologia medyczna II rok Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią =================================================================

Bardziej szczegółowo

Wykrywanie, identyfikacja i ilościowe oznaczanie GMO w materiale siewnym wyzwania analityczne i interpretacja wyników.

Wykrywanie, identyfikacja i ilościowe oznaczanie GMO w materiale siewnym wyzwania analityczne i interpretacja wyników. Wykrywanie, identyfikacja i ilościowe oznaczanie GMO w materiale siewnym wyzwania analityczne i interpretacja wyników. Magdalena Żurawska-Zajfert Laboratorium Kontroli GMO IHAR-PIB Testowanie partii nasion

Bardziej szczegółowo

Podstawy genetyki populacji. Populacje o skończonej liczebności. Dryf. Modele wielogenowe.

Podstawy genetyki populacji. Populacje o skończonej liczebności. Dryf. Modele wielogenowe. Podstawy genetyki populacji Populacje o skończonej liczebności. Dryf. Modele wielogenowe. Dryf genetyczny a ewolucja } Dobór naturalny nie jest jedynym mechanizmem kształtującym zmiany ewolucyjne } Losowe

Bardziej szczegółowo



Bardziej szczegółowo

Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych

Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych Dr n. med. Joanna Walczak- Sztulpa Katedra i Zakład Genetyki Medycznej Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Diagnostyka

Bardziej szczegółowo

Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna SSPGo TM HLA Typing Kits)

Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna SSPGo TM HLA Typing Kits) DOT115v08: Instrukcje użytkowania dla Biofortuna SSPGoTM HLA zestawów. Wersja 5 CE Strona 1 z 12 Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna

Bardziej szczegółowo

Dr hab.n.med. Renata Jacewicz

Dr hab.n.med. Renata Jacewicz GENOM CZŁOWIEKA >99 % 0,05%(100MtDNA) 65% Dr hab.n.med. Renata Jacewicz Kierownik Pracowni Genetyki Medycznej i Sądowej 3% 32% 2013 Pracownia Genetyki Medycznej i Sądowej ZMS Dojrzałe erytrocyty, trzony

Bardziej szczegółowo