Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Wielkość: px
Rozpocząć pokaz od strony:

Download "Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV"

Transkrypt

1 Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności w genie ccr5. Wstęp teoretyczny Gen ccr5, zlokalizowany na 3 chromosomie, występuje w populacji ludzkiej w 2 odmianach (allelach) - ccr5 i ccr5δ32. Allel ccr5 odpowiada za syntezę białka receptorowego CCR5, znajdującego się na powierzchni m. in. makrofagów, monocytów, limfocytów T. Białko to jest jednym z koreceptorów wirusa HIV. Obecność koreceptora CCR5 na powierzchni limfocytu pomocniczego jest konieczna, aby HIV mógł wniknąć do wnętrza komórki i wywołać infekcję. Allel ccr5δ32 jest uszkodzonym wariantem genu ccr5 i różni się od niego delecją (ubytkiem) 32 par zasad. Wynikiem takiej delecji jest zniesienie syntezy białka ko-receptorowego CCR5. Badanie polega na oznaczeniu tzw. genotypu CCR5 i pozwala na określenie czy u osoby badanej występuje genetycznie uwarunkowana oporność na zakażenie wirusem HIV-1. Osoby będące homozygotami typu ccr5δ32 są oporne na zakażenie wirusem HIV-1. Nosicielem takiej mutacji jest tylko ok. 1-2% przedstawicieli rasy białej. Osoby z jedną kopią genu zmutowaną i jedną kopią prawidłową tzw. heterozygoty charakteryzują się zmniejszonym ryzkiem zakażenia wirusem HIV. W przypadku zakażenia postęp choroby u takich osób będzie wolniejszy. Polimorfizm pod względem CCR5 nie objawia się fenotypowo, nie zaobserwowano też, aby zabezpieczał przed innymi chorobami zakaźnymi. Wykazywane w wielu badaniach różnice częstości występowania allelu ccr5δ32 tłumaczyć można ich zmiennym rozkładem w poszczególnych grupach etnicznych. I tak stwierdzono, że częstość allelu ccr5δ32 jest znacznie większa w północnej Europie (15,8% w Finlandii, 14,2% w Szwecji, 14,7% w Irlandii, 11,1% w Wielkiej Brytanii) niż w południowej (5,5% we Włoszech, 2,4% w Grecji, 4,2% na Cyprze), podczas gdy w populacjach pozaeuropejskich polimorfizm ten jest nieobecny lub bardzo rzadki.

2 Amplifikacja fragmentu genu ccr5 przy użyciu jednej pary starterów, pozwala na uzyskanie fragment o długości 183 pz swoistego dla prawidłowego genu ccr5 i fragmentu 151 pz swoistego dla genu zmutowanego ccr5δ3. Interpretacja możliwych wyników przedstawiona jest w tabeli Genotyp ccr5 oznaczany za pomocą reakcji PCR Produkt PCR Oporność na zakażenie wirusem HIV-1 Homozygota typu ccr5 183 pz nie Tabela.1 Heterozygota 183 i 151 pz zmniejszone ryzyko rozwoju choroby Homozygota typu ccr5δ pz tak Piśmiennictwo 1. Carrington M, Dean M, Martin MP, O'Brien SJ, Genetics of HIV-1 infection: chemokine receptor CCR5 polymorphism and its consequences, Hum Mol Genet. 1999;8(10): Wąsik TJ, Smoleń J, Kruszyński P, Bratosiewicz-Wąsik J, Beniowski M, Rola polimorficznych alleli CCR5-Δ32, CCR2-64I i SDF-1-3 w zakażeniu ludzkim wirusem upośledzenia odporności typu 1 (HIV 1 ) w populacji polskiej, Wiadomości Lekarskie, 2005, LVIII, Materiały Zestaw do izolacji DNA z wymazówek, postępować zgodnie z procedurą producenta DNA kontrolne typu dzikiego (K1+), DNA kontrolne zawierające zmutowaną formę genu ccr5δ32 (K2+) 10x stężony bufor do reakcji PCR Shark, 20 mm roztwór MgCl 2, 8 mm mieszanina dntps startery CCR51 (CTTCATTACACCTGCAGCTCT) i CCR52 (CACAGCCCTGTCCCTCTTCTTC) polimeraza DNA termostabilna Pwo Hypernova [2 U/µl] (DNA Gdańsk) woda jałowa, agaroza, bufor 1xTAE, termocykler, aparat do elektroforezy poziomej, transilluminator, zimny blok, statywy do probówek

3 Wykonanie 1. Przeprowadzić izolację DNA z własnych komórek pobranych w formie wymazów ze śluzówki policzka z wykorzystaniem zestawu do izolacji DNA zgodnie z instrukcją postępowania dostarczoną przez producenta. 2. Przygotować 4 probówki 0,2 ml i opisać je symbolami wg tabeli 10.2, uwzględniając kontrole dodatnie i ujemne. 3. W probówce 1,5 ml przygotować mieszaninę Master MIX, zawierającą wszystkie składniki z wyjątkiem matrycy DNA, wymieszać i rozporcjować po 24 µl. Skład mieszaniny reakcyjnej i profil temperaturowo czasowy reakcji PCR Skłąd mieszaniny reakcyjnej Skład Ilość [µl] Temperatura x1 Master 1 K1+ K2+ K- [ C] MIX (x 5) Woda 14,2 Tabela.2 Profil temperaturowo czasowy 10 x bufor Shark 2, MgCl 2 [20 mm] 2, dntps [8 mm] 2, CCR51 [10 µm] 1, CCR52 [10 µm] 1, Polimeraza Pwo [2 U/µl] 0, DNA 1,0 X 1,0 1,0 1,0 1,0 [H 2 O] Objetość całkowita Do próbki 1 dodać 1µl wyizolowanego DNA z wymazówek, do próbki K1+ dodać DNA osobnika z homoalleliczną formę genu ccr5 typu dzikiego, do próbki K2+ dodać DNA zawierające zmutowaną formę genu ccr5δ32 (układ heteroalleliczny), do kontroli ujemnej K- dodać wody jałowej. 5. Umieścić probówki w termocyklerze. Przeprowadzić reakcję PCR zgodnie z profilem temperaturowo czasowym, przedstawionym w tabeli Produkty PCR rozdzielać w żelu agarozowym 2% z dodatkiem bromku etydyny (0,5 mg/ml), w buforze 1xTAE przy napięciu ok. 7 V/cm długości żelu. Żel analizować w świetle UV. Czas [s] Liczba cykli 40

4 Wyniki i wnioski Wklej i opisz zdjęcie przedstawiające elektroforetyczny rozdział produktów PCR, zaznacz marker wielkości DNA, próbę z własnego DNA, kontrole dodatnie oraz kontrolę ujemną. Zaznacz wielkości otrzymanych produktów PCR. W oparciu o wyniki amplifikacji określ czy jesteś osobnikiem homozygotycznym czy heterozygotycznym pod względem genu ccr5 oraz czy masz genetycznie uwarunkowaną oporność na wirusa HIV-1.

5

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu Protokół pochodzi ze strony molekularnie.wordpress.com Kopiowanie i rozpowszechnianie wyłącznie w całości, z zachowaniem praw autorskich zgodnie z zasadami licencji GNU Dziękuję za uszanowanie mojej pracy,

Bardziej szczegółowo

Charakterystyka molekularna bakterii z rodzaju Enterococcus

Charakterystyka molekularna bakterii z rodzaju Enterococcus Charakterystyka molekularna bakterii z rodzaju Enterococcus Literatura: 1. Szewczyk Eligia M (red.), Diagnostyka mikrobiologiczna, Wydawnictwo Naukowe PWN, Warszawa 2006, str. 37. 2. Śledzińska A., Samet

Bardziej szczegółowo

Ampli-LAMP Salmonella species

Ampli-LAMP Salmonella species Novazym Products Novazym Polska ul. Żywokostowa 23, 61-680 Poznań, tel. +48 0 61 610 39 10, fax +48 0 61 610 39 11, email info@novazym.com Zestaw do identyfikacji materiału genetycznego bakterii z rodzaju

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

Różnorodność genetyczna człowieka

Różnorodność genetyczna człowieka Różnorodność genetyczna człowieka Zmienność genetyczna człowieka Różnorodność genetyczna człowieka Projekt 1000 genomów poszukiwanie różnic w genomach różnych ludzi (2500 osób) Projekt 1000 genomów Różnorodność

Bardziej szczegółowo

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Załącznik nr 1 do SIWZ Nazwa i adres Wykonawcy Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Przedmiot zamówienia; automatyczny system do diagnostyki molekularnej:

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI Fot. W. Wołkow Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt POPULACJA Zbiór organizmów żywych, które łączy

Bardziej szczegółowo

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku Warszawski Uniwersytet Medyczny Wydział Farmaceutyczny Oddział Analityki Medycznej Justyna Krystyna Ciepły Nr albumu 41624 Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008

Bardziej szczegółowo

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A...

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A... 1. Zadanie (0 2 p. ) Porównaj mitozę i mejozę, wpisując do tabeli podane określenia oraz cyfry. ta sama co w komórce macierzystej, o połowę mniejsza niż w komórce macierzystej, gamety, komórki budujące

Bardziej szczegółowo

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków.

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Katarzyna Mazur-Kominek Współautorzy Tomasz Romanowski, Krzysztof P. Bielawski, Bogumiła Kiełbratowska, Magdalena Słomińska-

Bardziej szczegółowo

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość*

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość* Poznao, 6 lutego 2012 r. Zapytanie ofertowe nr 001 /2012 dotyczące zakupu odczynników chemicznych do izolacji DNA i reakcji PCR GENESIS Polska Sp. z o.o Ul. Za Cytadelą 19, 61-659 Poznao NIP 778 13 56

Bardziej szczegółowo

AmpliTest Salmonella spp. (Real Time PCR)

AmpliTest Salmonella spp. (Real Time PCR) AmpliTest Salmonella spp. (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzaju Salmonella techniką Real Time PCR Nr kat.: BAC01-50 Wielkość zestawu: 50 oznaczeń Objętość

Bardziej szczegółowo

MATERIAŁY SZKOLENIOWE DLA ZAKŁADÓW HIGIENY WETERYNARYJNEJ W ZAKRESIE LABORATORYJNEJ DIAGNOSTYKI AFRYKAŃSKIEGO POMORU ŚWIŃ

MATERIAŁY SZKOLENIOWE DLA ZAKŁADÓW HIGIENY WETERYNARYJNEJ W ZAKRESIE LABORATORYJNEJ DIAGNOSTYKI AFRYKAŃSKIEGO POMORU ŚWIŃ MATERIAŁY SZKOLENIOWE DLA ZAKŁADÓW HIGIENY WETERYNARYJNEJ W ZAKRESIE LABORATORYJNEJ DIAGNOSTYKI AFRYKAŃSKIEGO POMORU ŚWIŃ Puławy 2013 Opracowanie: Prof. dr hab. Iwona Markowska-Daniel, mgr inż. Kinga Urbaniak,

Bardziej szczegółowo

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO Ćwiczenie numer 6 Analiza próbek spożywczych na obecność markerów GMO 1. Informacje wstępne -screening GMO -metoda CTAB -qpcr 2. Izolacja DNA z soi metodą CTAB 3. Oznaczenie ilościowe i jakościowe DNA

Bardziej szczegółowo

Genetyka Populacji http://ggoralski.com

Genetyka Populacji http://ggoralski.com Genetyka Populacji http://ggoralski.com Frekwencje genotypów i alleli Frekwencja genotypów Frekwencje genotypów i alleli Zadania P AA = 250/500 = 0,5 P Aa = 100/500 = 0,2 P aa = 150/500 = 0,3 = 1 Frekwencje

Bardziej szczegółowo

MARKERY MIKROSATELITARNE

MARKERY MIKROSATELITARNE MARKERY MIKROSATELITARNE Badania laboratoryjne prowadzone w Katedrze Genetyki i Ogólnej Hodowli Zwierząt SGGW w ramach monitoringu genetycznego wykorzystują analizę genetyczną markerów mikrosatelitarnych.

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

Załącznik nr 4 Metodyka pobrania materiału przedstawiona jest w osobnym Instrukcja PZH

Załącznik nr 4 Metodyka pobrania materiału przedstawiona jest w osobnym Instrukcja PZH Załącznik nr 4 Metodyka pobrania materiału przedstawiona jest w osobnym Instrukcja PZH 1. Rodzaj materiału klinicznego w zależności od kierunku i metodyki badań wykonywanych przez PZH Poz. Badanie Rodzaj

Bardziej szczegółowo

Analiza mutacji p.d36n i p.n318s oraz polimorfizmu p.s474x genu lipazy lipoproteinowej u chorych z hipercholesterolemią rodzinną.

Analiza mutacji p.d36n i p.n318s oraz polimorfizmu p.s474x genu lipazy lipoproteinowej u chorych z hipercholesterolemią rodzinną. Analiza mutacji p.d36n i p.n318s oraz polimorfizmu p.s474x genu lipazy lipoproteinowej u chorych z hipercholesterolemią rodzinną. Monika śuk opiekun: prof. dr hab. n. med. Janusz Limon Katedra i Zakład

Bardziej szczegółowo

Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9

Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9 Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9 Instrukcja używania testów do wykrywania kontaminacji na powierzchniach roboczych ( wipe test ) przy typowaniu

Bardziej szczegółowo

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP ARCH. MED. SĄD. KRYMINOL., 2010, LX, 243-247 PRACE ORYGINALNE / ORIGINALS Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski Analiza danych populacyjnych loci ministr: D10S1248,

Bardziej szczegółowo

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Praca wykonana pod kierunkiem dr hab. Tomasza Grzybowskiego w Katedrze Medycyny Sądowej w Zakładzie Genetyki Molekularnej

Bardziej szczegółowo

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym mgr Magdalena Brzeskwiniewicz Promotor: Prof. dr hab. n. med. Janusz Limon Katedra i Zakład Biologii i Genetyki Gdański Uniwersytet Medyczny

Bardziej szczegółowo

Atrakcyjna i Innowacyjna Biotechnologia - ATRINBIOTECH Priorytet IV POKL Szkolnictwo wyższe i nauka

Atrakcyjna i Innowacyjna Biotechnologia - ATRINBIOTECH Priorytet IV POKL Szkolnictwo wyższe i nauka Metoda TILLING (Targeting Induced Local Lesions IN Genomes) to metoda odwrotnej genetyki oparta na wykorzystaniu enzymu CEL I (endonukleazy wizolowanej z selera naciowego Apium graveolens), który wykrywa

Bardziej szczegółowo

Bliskie Spotkanie z Biologią. Genetyka populacji

Bliskie Spotkanie z Biologią. Genetyka populacji Bliskie Spotkanie z Biologią Genetyka populacji Plan wykładu 1) Częstości alleli i genotypów w populacji 2) Prawo Hardy ego-weinberga 3) Dryf genetyczny 4) Efekt założyciela i efekt wąskiego gardła 5)

Bardziej szczegółowo

[ IMIĘ I NAZWISKO:. KLASA NR.. ] Zadania genetyczne

[ IMIĘ I NAZWISKO:. KLASA NR.. ] Zadania genetyczne Zadanie 1. (2 pkt). Ciemnooki mężczyzna, którego ojciec miał oczy piwne a matka niebieskie, poślubił ciemnooką kobietę. Syn tej pary jest niebieskooki. Przyjmując oznaczenia: allel dominujący (barwnik

Bardziej szczegółowo

2. CZYNNIKI ZABURZAJĄCE RÓWNOWAGĘ GENETYCZNĄ

2. CZYNNIKI ZABURZAJĄCE RÓWNOWAGĘ GENETYCZNĄ ZARZĄDZANIE POPULACJAMI ZWIERZĄT 2. CZYNNIKI ZABURZAJĄCE RÓWNOWAGĘ GENETYCZNĄ POPULACJI Fot. W. Wołkow Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt MIGRACJE Zmiana frekwencji

Bardziej szczegółowo

Podstawy genetyki człowieka. Cechy wieloczynnikowe

Podstawy genetyki człowieka. Cechy wieloczynnikowe Podstawy genetyki człowieka Cechy wieloczynnikowe Dziedziczenie Mendlowskie - jeden gen = jedna cecha np. allele jednego genu decydują o barwie kwiatów groszku Bardziej złożone - interakcje kilku genów

Bardziej szczegółowo

DETEKCJA PATOGENÓW DRÓG MOCZOWO-PŁCIOWYCH

DETEKCJA PATOGENÓW DRÓG MOCZOWO-PŁCIOWYCH DETEKCJA PATOGENÓW DRÓG MOCZOWO-PŁCIOWYCH Detekcja i identyfikacja 7 patogenów dróg moczowo-płciowych Detekcja Neisseria gonorrhoeae i Chlamydia trachomatis Detekcja Trichomonas vaginalis i Mycoplasma

Bardziej szczegółowo

Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII "

Kurs pt.  MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII Warszawa, 6 lutego 2011 r. Szanowna Pani! Szanowny Panie! Niniejszym uprzejmie informuję, że organizowany jest Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII " Kurs odbędzie się w dniach

Bardziej szczegółowo

CENNIK PRODUKTÓW DNA-GDAŃSK 2013

CENNIK PRODUKTÓW DNA-GDAŃSK 2013 CENNIK PRODUKTÓW DNA-GDAŃSK 2013 ZESTAWY DO IZOLACJI I OCZYSZCZANIA DNA I RNA EXTRACTME PLASMID DNA KIT Nowość! izolacja plazmidowego DNA EXTRACTME DNA BACTERIA KIT Nowość! izolacja genomowego DNA z bakterii

Bardziej szczegółowo

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego Wk Wykrywanie polimorfizmów i mutacji Badania przesiewowe mutacji Wykrywanie znanych mutacji punktowych dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej

Bardziej szczegółowo

Biochemia: Ćw. 11 Metoda RT-PCR

Biochemia: Ćw. 11 Metoda RT-PCR Ćwiczenie 11 METODA RT-PCR Wyciąg z kart charakterystyki substancji niebezpiecznych: bromek etydyny T+ EDTA Xi etanol, 96% F kwas octowy, 96% C -merkaptoetanol N, T Tris Xi UWAGI WSTĘPNE Praca z kwasami

Bardziej szczegółowo

Imię i nazwisko...kl...

Imię i nazwisko...kl... Gimnazjum nr 4 im. Ojca Świętego Jana Pawła II we Wrocławiu SPRAWDZIAN GENETYKA GR. A Imię i nazwisko...kl.... 1. Nauka o regułach i mechanizmach dziedziczenia to: (0-1pkt) a) cytologia b) biochemia c)

Bardziej szczegółowo

INSTYTUT MATKI I DZIECKA ZAKŁAD GENETYKI MEDYCZNEJ

INSTYTUT MATKI I DZIECKA ZAKŁAD GENETYKI MEDYCZNEJ INSTYTUT MATKI I DZIECKA ZAKŁAD GENETYKI MEDYCZNEJ Kierownik: prof. dr hab. n. med. Tadeusz Mazurczak ul. Kasprzaka 17a, 01-211 Warszawa Tel: (022) 632-96-57; Tel/fax: (022) 632 62 24 e-mail: genetyka@imid.med.pl

Bardziej szczegółowo

Znaczenie genetyki. Opracował A. Podgórski

Znaczenie genetyki. Opracował A. Podgórski Znaczenie genetyki Opracował A. Podgórski InŜynieria genetyczna InŜynieria genetyczna ingerencja w materiał genetyczny organizmów, w celu zmiany ich właściwości dziedzicznych. Istota inŝynierii genetycznej

Bardziej szczegółowo

DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7

DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7 DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7 Instrukcja używania zestawu kontroli ujemnej przy typowaniu antygenów zgodności tkankowej HLA SSPGo TM

Bardziej szczegółowo

Genetyka populacyjna

Genetyka populacyjna Genetyka populacyjna analizuje strukturę genetyczną całych populacji oraz wyniki kojarzeń wewnątrz populacji lub pomiędzy różnymi populacjami, opiera się na modelach matematycznych Prawo równowagi Hardy

Bardziej szczegółowo

CENNIK DIAGNOSTYKA NIEPŁODNOŚCI MĘSKIEJ

CENNIK DIAGNOSTYKA NIEPŁODNOŚCI MĘSKIEJ CENNIK DIAGNOSTYKA NIEPŁODNOŚCI MĘSKIEJ AZOOSPERMIA badanie wykrywa delecje w regionie długiego ramienia chromosomu Y w fragmencie zwanym AZF, będące często przyczyną azoospermii lub oligospermii o podłożu

Bardziej szczegółowo

GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ

GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ ZMIENNOŚĆ - występowanie dziedzicznych i niedziedzicznych różnic między osobnikami należącymi do tej samej

Bardziej szczegółowo

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System Załącznik nr 1A do SIWZ. PARAMETRY TECHNICZNE PRZEDMIOTU ZAMÓWIENIA Zadanie nr 1. TERMOSTAT CYRKULACYJNY Termostat cyrkulacyjny Z grzaniem i chłodzeniem Zakres temperatury roboczej 25 o C do + 200 o C

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo

Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne cereal mosaic virus, SBCMV)

Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne cereal mosaic virus, SBCMV) Małgorzata Jeżewska Zakład Wirusologii i Bakteriologii, Instytut Ochrony Roślin Państwowy Instytut Badawczy, Poznań Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne

Bardziej szczegółowo

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki Klub Młodego Wynalazcy - Laboratoria i wyposażenie Zadbaliśmy o to, żeby wyposażenie w Klubie Młodego Wynalazcy było w pełni profesjonalne. Ważne jest, aby dzieci i młodzież, wykonując doświadczenia korzystały

Bardziej szczegółowo

Organizacja genomu człowieka i sekwencjonowanie DNA

Organizacja genomu człowieka i sekwencjonowanie DNA Organizacja genomu człowieka i sekwencjonowanie DNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Organizacja genów na ludzkim chromosomie.

Bardziej szczegółowo

PROFILAKTYKA HIV/AIDS. NOWOśCI

PROFILAKTYKA HIV/AIDS. NOWOśCI PROFILAKTYKA HIV/AIDS STATYSTYKI LOKALNE DZIAłANIA OZ I PZ PSSE W ROKU 2012 NOWOśCI CIEKAWOSTKI STATYSTYKI HIV i AIDS w Polsce dane od początku epidemii (1985 r.) do 30 czerwca 2012 roku 15 724 zakażonych

Bardziej szczegółowo

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 100 ml, 250 ml, 500 ml Nr kat. 038-100, 038-250, 038-500 Nietosyczny roztwór wodny do przechowywania i zabezpieczania różnego rodzaju tkanek

Bardziej szczegółowo

144010 HCR-APOB Analiza. Wykrycie charakterystycznych mutacji genu APOB warunkujących występowanie hipercholesterolemii rodzinnej.

144010 HCR-APOB Analiza. Wykrycie charakterystycznych mutacji genu APOB warunkujących występowanie hipercholesterolemii rodzinnej. Badany Gen Literatura OMIM TM Gen Jednostka chorobowa Literatura OMIM TM Jednostka chorobowa Oznaczenie testu Opis/cel badania Zakres analizy Czas analizy Materiał [dni biologiczny roboczy ch] APOB 7730

Bardziej szczegółowo

Genetyka populacyjna. Populacja

Genetyka populacyjna. Populacja Genetyka populacyjna Populacja 1 Populacja Populacja jest to zbiór osobników jednego gatunku żyjących na danym terytorium w danym czasie. Genetykę populacyjną interesuje tzw. populacja panmiktyczna (mendlowska),

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937 (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.0 (13) (51) T3 Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

Światowy Dzień Pamięci o Zmarłych na AIDS

Światowy Dzień Pamięci o Zmarłych na AIDS Światowy Dzień Pamięci o Zmarłych na AIDS Przypada w dniu 17 maja każdego roku Warszawa, 2013 HIV- ludzki wirus niedoboru odporności powoduje AIDS- zespół nabytego niedoboru odporności Z kart historii

Bardziej szczegółowo

CZEŚĆ III OPIS PRZZEDMIOTU ZAMÓWIENIA (OPZ)

CZEŚĆ III OPIS PRZZEDMIOTU ZAMÓWIENIA (OPZ) INSTYTUT IMMUNOLOGII I TERAPII DOŚWIADCZALNEJ im. Ludwika Hirszfelda Polska Akademia Nauk ul. Rudolfa Weigla 12, 53-114 Wrocław tel. / fax. (4871) 37-09-997, http://www.iitd.pan.wroc.pl NIP: 896-000-56-96;

Bardziej szczegółowo

ĆWICZENIE 3 DGGE- ELEKTROFOREZA W ŻELU Z GRADIENTEM CZYNNIKA DENATURUJĄCEGO

ĆWICZENIE 3 DGGE- ELEKTROFOREZA W ŻELU Z GRADIENTEM CZYNNIKA DENATURUJĄCEGO ĆWICZENIE 3 DGGE- ELEKTROFOREZA W ŻELU Z GRADIENTEM CZYNNIKA DENATURUJĄCEGO CZĘŚĆ TEORETYCZNA Metody badań i cechy w oparciu o które przeprowadzana jest klasyfikacja i identyfikacja mikroorganizmówh Struktura

Bardziej szczegółowo

Jednostka chorobowa. 3mc 1260. Czas analizy [dni roboczych] Literatura Gen. Cena [PLN] Badany Gen. Materiał biologiczny. Chorobowa OMIM TM.

Jednostka chorobowa. 3mc 1260. Czas analizy [dni roboczych] Literatura Gen. Cena [PLN] Badany Gen. Materiał biologiczny. Chorobowa OMIM TM. Jednostka chorobowa Jednostka Oznaczenie Chorobowa OMIM TM testu Badany Gen Literatura Gen OMIM TM Opis/cel badania Zakres analizy Materiał biologiczny Czas analizy [dni roboczych] Cena [PLN] HEMOFILIA

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Przykładowe zadania. przygotowujące do egzaminu maturalnego

Przykładowe zadania. przygotowujące do egzaminu maturalnego Przykładowe zadania z BIOLOGii przygotowujące do egzaminu maturalnego Prezentowane zadania są zgodne z podstawą programową kształcenia ogólnego w zakresie rozszerzonym i podstawowym. Prócz zadań, które

Bardziej szczegółowo

DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH

DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH Detekcja enterowirusów Detekcja sześciu typów ludzkich herpeswirusów (HHV) Detekcja pięciu bakterii Seeplex Detekcja patogenów powodujących

Bardziej szczegółowo

Syngen Gel/PCR Mini Kit

Syngen Gel/PCR Mini Kit Syngen Gel/PCR Mini Kit Syngen Gel/PCR ME Mini Kit Zestawy do oczyszczania DNA: - z żelu agarozowego - po reakcji PCR i innych reakcjach enzymatycznych - z żelu agarozowego z małą objętością elucji - po

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

Materiał i metody. Wyniki

Materiał i metody. Wyniki Abstract in Polish Wprowadzenie Selen jest pierwiastkiem śladowym niezbędnym do prawidłowego funkcjonowania organizmu. Selen jest wbudowywany do białek w postaci selenocysteiny tworząc selenobiałka (selenoproteiny).

Bardziej szczegółowo

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy PIWet Zakład Chorób Ryb Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy łososiowatych o (VHS), wirusa zakaźnej a martwicy układu krwiotwórczego (IHN)

Bardziej szczegółowo

Człowiek mendlowski? Genetyka człowieka w XX i XXI w.

Człowiek mendlowski? Genetyka człowieka w XX i XXI w. Człowiek mendlowski? Genetyka człowieka w XX i XXI w. Informacje Kontakt: Paweł Golik Instytut Genetyki i Biotechnologii, Pawińskiego 5A pgolik@igib.uw.edu.pl Informacje, materiały: http://www.igib.uw.edu.pl/

Bardziej szczegółowo

WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH UŻYWANYCH W PROGRAMACH HODOWLANYCH JABŁONI.

WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH UŻYWANYCH W PROGRAMACH HODOWLANYCH JABŁONI. Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) MAŁGORZATA KORBIN, SYLWIA KELLER-PRZYBYŁKOWICZ, EDWARD ŻURAWICZ WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH

Bardziej szczegółowo

Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna SSPGo TM HLA Typing Kits)

Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna SSPGo TM HLA Typing Kits) DOT115v08: Instrukcje użytkowania dla Biofortuna SSPGoTM HLA zestawów. Wersja 5 CE Strona 1 z 12 Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna

Bardziej szczegółowo

Identyfikacja mutacji C295G genu T u psów rasy polski owczarek nizinny

Identyfikacja mutacji C295G genu T u psów rasy polski owczarek nizinny Roczniki Naukowe Polskiego Towarzystwa Zootechnicznego, t. 9 (2013), nr 4, 9-16 Identyfikacja mutacji C295G genu T u psów rasy polski owczarek nizinny Joanna Gruszczyńska, Aleksandra Haska, Beata Grzegrzółka

Bardziej szczegółowo

LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA

LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA ANNALES ACADEMIAE MEDICAE STETINENSIS ROCZNIKI POMORSKIEJ AKADEMII MEDYCZNEJ W SZCZECINIE 2007, 53, SUPPL. 2, 170174 LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA Badanie

Bardziej szczegółowo

Podstawy genetyki populacji. Populacje o skończonej liczebności. Dryf. Modele wielogenowe.

Podstawy genetyki populacji. Populacje o skończonej liczebności. Dryf. Modele wielogenowe. Podstawy genetyki populacji Populacje o skończonej liczebności. Dryf. Modele wielogenowe. Dryf genetyczny a ewolucja } Dobór naturalny nie jest jedynym mechanizmem kształtującym zmiany ewolucyjne } Losowe

Bardziej szczegółowo

Zmodyfikowane wg Kadowaki T in.: J Clin Invest. 2006;116(7):1784-92

Zmodyfikowane wg Kadowaki T in.: J Clin Invest. 2006;116(7):1784-92 Magdalena Szopa Związek pomiędzy polimorfizmami w genie adiponektyny a wybranymi wyznacznikami zespołu metabolicznego ROZPRAWA DOKTORSKA Promotor: Prof. zw. dr hab. med. Aldona Dembińska-Kieć Kierownik

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU ELEKTROFOREZA

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU ELEKTROFOREZA SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU ELEKTROFOREZA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

1 Genetykapopulacyjna

1 Genetykapopulacyjna 1 Genetykapopulacyjna Genetyka populacyjna zajmuje się badaniem częstości występowania poszczególnych alleli oraz genotypów w populacji. Bada także zmiany tych częstości spowodowane doborem naturalnym

Bardziej szczegółowo

Wybrane czynniki genetyczne warunkujące podatność na stwardnienie rozsiane i przebieg choroby

Wybrane czynniki genetyczne warunkujące podatność na stwardnienie rozsiane i przebieg choroby Wybrane czynniki genetyczne warunkujące podatność na stwardnienie rozsiane i przebieg choroby Stwardnienie rozsiane (MS, ang. multiple sclerosis) jest przewlekłą chorobą ośrodkowego układu nerwowego, która

Bardziej szczegółowo

AmpliTest TBEV (Real Time PCR)

AmpliTest TBEV (Real Time PCR) AmpliTest TBEV (Real Time PCR) Zestaw do wykrywania sekwencji RNA specyficznych dla TBEV (Tick-borne encephalitis virus) techniką Real Time PCR Nr kat.: RV03-50 Wielkość zestawu: 50 oznaczeń Objętość pojedynczej

Bardziej szczegółowo

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS Nowiny Lekarskie 2006, 75, 5, 486 490 ALINA LICZBAŃSKA, ANNA WOŹNIAK, ANNA WAWROCKA, MACIEJ R. KRAWCZYŃSKI TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR

Bardziej szczegółowo

Załącznik nr 1 do Zapytania ofertowego... /miejscowość, data/

Załącznik nr 1 do Zapytania ofertowego... /miejscowość, data/ Załącznik nr 1 do Zapytania ofertowego... FORMULARZ OFERTOWY W odpowiedzi na zapytanie ofertowe z dnia.. złożone przez Biowet Puławy Sp. z o.o. Ja/my niżej podpisany/i (Imiona i nazwiska osób upoważnionych

Bardziej szczegółowo

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7.2. Metody biologii molekularnej (technika PCR, sekwencjonowanie DNA) wykorzystywane w taksonomii roślin Autor: Magdalena Dudek

Bardziej szczegółowo

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10.

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10. Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016 Ćwiczenie nr 1 (06-07.10.2015) Temat: Wprowadzenie 1. Omówienie regulaminu zajęć Temat: Wprowadzenie

Bardziej szczegółowo

ELIMINACJA ODRY/RÓŻYCZKI

ELIMINACJA ODRY/RÓŻYCZKI PAŃSTWOWY ZAKŁAD HIGIENY INSTYTUT NAUKOWO-BADAWCZY ELIMINACJA ODRY/RÓŻYCZKI PROGRAM WHO REALIZACJA W POLSCE - ZASADY - INSTRUKCJE ZAKŁAD WIRUSOLOGII UL. CHOCIMSKA 24 00-791 WARSZAWA PROGRAM ELIMINACJI

Bardziej szczegółowo

PathogenFree RNA Isolation Kit Zestaw do izolacji RNA

PathogenFree RNA Isolation Kit Zestaw do izolacji RNA PathogenFree RNA Isolation Kit Zestaw do izolacji RNA Instrukcja użytkownika Spis treści 1. Zawartość 2 1.1 Składniki zestawu 2 2. Opis produktu 2 2.1 Założenia metody 2 2.2 Specyfikacja zestawu 2 2.3

Bardziej szczegółowo

Badanie predyspozycji do łysienia androgenowego u kobiet (AGA)

Badanie predyspozycji do łysienia androgenowego u kobiet (AGA) Badanie predyspozycji do łysienia androgenowego u kobiet (AGA) RAPORT GENETYCZNY Wyniki testu dla Pacjent Testowy Pacjent Pacjent Testowy ID pacjenta 0999900004112 Imię i nazwisko pacjenta Pacjent Testowy

Bardziej szczegółowo

Podstawy genetyki. ESPZiWP 2010

Podstawy genetyki. ESPZiWP 2010 Podstawy genetyki ESPZiWP 2010 Genetyka - nauka o dziedziczności i zmienności organizmów, wyjaśniająca prawa rządzące podobieństwami i różnicami pomiędzy osobnikami spokrewnionymi przez wspólnego przodka

Bardziej szczegółowo

Polimorfizm genetyczny wybranych alleli cytochromu CYP2D6 u pacjentów z kardiomiopatią rozstrzeniową i zapaleniem mięśnia sercowego* 1

Polimorfizm genetyczny wybranych alleli cytochromu CYP2D6 u pacjentów z kardiomiopatią rozstrzeniową i zapaleniem mięśnia sercowego* 1 PRACA ORYGINALNA Polimorfizm genetyczny wybranych alleli cytochromu CYP2D6 u pacjentów z kardiomiopatią rozstrzeniową i zapaleniem mięśnia sercowego* 1 Genetical polymporphism of chosen CYP2D6 alleles

Bardziej szczegółowo

Izolowanie i amplifikacja kwasów nukleinowych

Izolowanie i amplifikacja kwasów nukleinowych ROZDZIAŁ 4 Izolowanie i amplifikacja kwasów nukleinowych Wojciech Garczorz Diagnostyka molekularna jest obecnie najszybciej rozwijającym się działem diagnostyki medycznej. W wielu dziedzinach medycyny

Bardziej szczegółowo

INSPEKCJA WETERYNARYJNA

INSPEKCJA WETERYNARYJNA Poznań, dnia 17 kwietnia 2015 r. INSPEKCJA WETERYNARYJNA WIELKOPOLSKI WOJEWÓDZKI LEKARZ WETERYNARII Lesław Szabłoński do wszystkich wykonawców, którym przekazano SIWZ Nasz znak: AD-O.272.6.2015 Dot. sprawy

Bardziej szczegółowo

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ www.cytogen.com.pl ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ 3 Spis treści 4 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 22 22 Stabilność technologii TAG Specifikacja qpcr Mix-ów Kompatybilność kitów qpcr

Bardziej szczegółowo

INSTYTUT GENETYKI i HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK ul. POSTĘPU 36A, JASTRZĘBIEC, 05-552 Magdalenka

INSTYTUT GENETYKI i HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK ul. POSTĘPU 36A, JASTRZĘBIEC, 05-552 Magdalenka Jastrzębiec, 12. 03. 2014 r. Dotyczy przetargu DAZ-2401/ 7 / 14 na dostawę odczynników laboratoryjnych. Do zamawiającego wpłynęły następujące pytania na które odpowiedzi publikuje poniŝej: Dotyczy części

Bardziej szczegółowo

Spis treści. Aparatura

Spis treści. Aparatura Spis treści Aparatura I. Podstawowe wyposażenie laboratoryjne... 13 I.I. Probówki i naczynia laboratoryjne... 13 I.II. Pipety... 17 I.II.I. Rodzaje pipet automatycznych... 17 I.II.II. Techniki pipetowania...

Bardziej szczegółowo

Zestaw 1 Genetyka. Zadanie 2.(1pkt) Schemat przedstawia rodowód genetyczny pewnej rodziny. Kółko oznacza kobietę, kwadrat oznacza mężczyznę.

Zestaw 1 Genetyka. Zadanie 2.(1pkt) Schemat przedstawia rodowód genetyczny pewnej rodziny. Kółko oznacza kobietę, kwadrat oznacza mężczyznę. Zestaw 1 Genetyka Zadanie 1. (3pkt) Praworęczność i leworęczność są cechami dziedzicznymi, przy czym tendencja do używania prawej ręki jest cechą dominującą. Gen warunkujący tę cechę jest zlokalizowany

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

Statystyki zachorowań

Statystyki zachorowań I AIDS Informacje ogólne Budowa wirusa HIV Statystyki zachorowań Światowy dzień HIV/AIDS Aktywność fizyczna Zapobieganie HIV HIV u kobiet Możliwości z HIV Przeciwskazania Ciąża Ludzie młodzi HIV u dzieci

Bardziej szczegółowo

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika Spis treści 1. Zawartość 2 1.1 Składniki zestawu 2 2. Opis produktu 2 2.1 Założenia metody 2 2.2 Instrukcja 2 2.3 Specyfikacja

Bardziej szczegółowo

LAMP. szybka i specyficzna detekcja patogenów

LAMP. szybka i specyficzna detekcja patogenów LABORATORIUM 5-6/2014 DIAGNOSTYKA LABORATORYJNA LAMP szybka i specyficzna detekcja patogenów STRESZCZENIE W obecnych czasach istnieje potrzeba opracowywania szybkich, tanich i skutecznych metod diagnostycznych

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Choroby genetyczne o złożonym

Bardziej szczegółowo