Ćwiczenie 2. Identyfikacja płci z wykorzystaniem genu amelogeniny (AMGXY)

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "Ćwiczenie 2. Identyfikacja płci z wykorzystaniem genu amelogeniny (AMGXY)"

Transkrypt

1 Ćwiczenie 2. Identyfikacja płci z wykorzystaniem genu amelogeniny (AMGXY) Cel ćwiczenia Amplifikacja fragmentu genu amelogeniny, znajdującego się na chromosomach X i Y, jako celu molekularnego przydatnego w identyfikacji płci. Wstęp teoretyczny Amelogenina (AMGXY) jest głównym białkiem macierzy pozakomórkowej w zawiązku zęba. Ludzkie sekwencje kodujące amelogeninę obecne są na krótkim ramieniu chromosomu X (AMG; Xp) oraz blisko centromeru na chromosomie Y (ang. AMGL - amelogenin like sequence). Homologia sekwencji genu amelogeniny na obu chromosomach płci X i Y wynosi ok. 90%. Amplifikacja fragmentu genu amelogeniny przy użyciu jednej pary starterów pozwala na uzyskanie fragmentu o długości 505pz swoistego dla chromosomu Y i fragmentu o wielkości 158 pz swoistego dla chromosomu X. Stosując drugą parę starterów otrzymamy wielkości 977 pz i 788 pz. Interpretacja możliwych wyników przedstawiona jest w tabeli 9.1. Dzięki prostocie i czułości analizy reakcja została z powodzeniem wykorzystana do ustalania płci w badaniach śladów biologicznychi identyfikacji osobniczej. Genotyp AMGXY oznaczany za pomocą reakcji PCR Produkty PCR Produkty PCR układ 1 (startery AMY1 i AMY2) układ 2 (startery AMGF i AMGR) Płeć Tabela 1. XX 158 pz 977 pz kobieta XY 158 i 505pz 977 i 788 pz mężczyzna Piśmiennictwo 1. Herrot S., Ivorra J.L., Garcia-Sogo M., Martinez-Corina C., Biochemistry and Molecular Biology Techniques for Person Characterization, Biochemistry and Molecular Biology Education, 2008, vol. 36, No. 5, p Lattanzi W., Di Giacomo M.C., Lenato G.M., Chimienti G., Voglino G., Resta N., Pepe G., Guanti G., A large interstitial deletion encompassing the amelogenin gene on the short arm of the Y chromosome,hum Genet, 2005, 116: Nakahori Y, Takenaka O, Nakagome Y., A human X-Y homologous region encodes amelogenin", Genomics, 1991, 9 (2):

2 4. Thangaraj K, Reddy AG, Singh L., Is the amelogenin gene reliable for gender identification in forensic casework and prenatal diagnosis?, Int J Legal Med, 2002, 116 (2): Materiały: zestaw do izolacji DNA z wymazówek; postępować zgodnie z procedurą producenta kontrolne DNA kobiety (K1+), kontrolne DNA mężczyzny (K2+) 10x stężony bufor do reakcji PCR Shark, 20 mm roztwór MgCl 2, 8 mm mieszanina dntps startery: AMY1 (TTCTGATTTGGTACAGCTGGGG) i AMY2 (GCACTTTCTCTGGAGACCTTTCAAG) startery: AMGF (CTGATGGTTGGCCTCAAGCCTGTG) i AMGR (TAAAGAGATTCATTAACTTGACTG) polimeraza DNA termostabilna Pwo Hypernova [2U/µl] (DNA Gdańsk) woda jałowa, agaroza, bufor 1xTEA, termocykler, aparat do elektroforezy poziomej, transilluminator, zimny blok, statywy do probówek Wykonanie 1. Przeprowadzić izolację DNA z własnych komórek pobranych w formie wymazów ze śluzówki policzka z wykorzystaniem zestawu do izolacji DNA zgodnie z instrukcją postępowania dostarczoną przez producenta. 2. Przygotować 4 probówki 0,2 ml i opisać je symbolami wg tabeli 9.2, uwzględniając kontrole dodatnie i ujemne. 3. W probówce 1,5 ml przygotować mieszaninę Master MIX zależnie od wybranego układu (tabele 2 i 3), zawierającą wszystkie składniki z wyjątkiem matrycy DNA, wymieszać i rozporcjować po 24 µl.

3 Tabela 2 Skład mieszaniny reakcyjnej i profil temperaturowo czasowy reakcji PCR dla układu 1 Skłąd mieszaniny reakcyjnej Profil temperaturowo- czasowy Skład Ilość [µl] Temperatura x1 Master 1 K1+ K2+ K- [ C] MIX (x 5) Woda 14, x bufor Shark 2, MgCl 2 [20 mm] 2, dntps [8 mm] 2, AMY1 [10µM] 1, AMY2 [10µM] 1, Polimeraza Pwo [2U/µl] 0, DNA 1,0 X 1,0 1,0 1,0 - Objętość całkowita Czas [s] Liczba cykli Tabela 3 Skład mieszaniny reakcyjnej i profil temperaturowo czasowy reakcji PCR dla układu 2 Skłąd mieszaniny reakcyjnej Skład Ilość [µl] Temperatura x1 Master 1 K1+ K2+ K- [ C] MIX (x 5) Woda Profil temperaturowo- czasowy 10 x bufor Shark 2, MgCl 2 [20 mm] 2, dntps [8 mm] 2, AMGF [10µM] 1, AMGR [10µM] 1, Polimeraza Pwo [2U/µl] 0, DNA 1,0 X 1,0 1,0 1,0 - Objętość całkowita Czas [s] Liczba cykli

4 4. Do próbki oznaczonej nr 1 dodać 1 μl wyizolowanego DNA z wymazów, do próbki oznaczonej K1+ dodać 1 μl kontrolnego DNA kobiety, do próbki oznaczonej K2+ dodać 1 μl kontrolnego DNA mężczyzny, do kontroli ujemnej K- zamiast DNA dodać wodę. 5. Umieścić probówki w termocyklerze. Przeprowadzić reakcję PCR zgodnie z profilem temperaturowo czasowym, przedstawionym w tabeli 9.2 lub 9.3 (w zależności od wybranego układu). 6. Produkty PCR rozdzielać w żelu agarozowym 1,5% z dodatkiem bromku etydyny (0,5 mg/ml), w buforze 1xTAE przy napięciu ok. 7 V/cm długości żelu. Żel analizować w świetle UV. Wyniki i wnioski Wklej i opisz zdjęcie przedstawiające elektroforetyczny rozdział produktów PCR, zaznacz marker wielkości DNA, próbę z własnego DNA, kontrole dodatnie oraz kontrolę ujemną. Zaznacz wielkości otrzymanych produktów PCR. W oparciu o wyniki amplifikacji określ płeć próbki badanej.

5

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

Ampli-LAMP Babesia canis

Ampli-LAMP Babesia canis Novazym Products Zestaw do identyfikacji materiału genetycznego pierwotniaka Babesia canis canis techniką Loop-mediated Isothermal AMPlification (LAMP) Numery katalogowe produktu: AML-Bc-200 AML-Bc-400

Bardziej szczegółowo

Charakterystyka molekularna bakterii z rodzaju Enterococcus

Charakterystyka molekularna bakterii z rodzaju Enterococcus Charakterystyka molekularna bakterii z rodzaju Enterococcus Literatura: 1. Szewczyk Eligia M (red.), Diagnostyka mikrobiologiczna, Wydawnictwo Naukowe PWN, Warszawa 2006, str. 37. 2. Śledzińska A., Samet

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu Protokół pochodzi ze strony molekularnie.wordpress.com Kopiowanie i rozpowszechnianie wyłącznie w całości, z zachowaniem praw autorskich zgodnie z zasadami licencji GNU Dziękuję za uszanowanie mojej pracy,

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

Ampli-LAMP Salmonella species

Ampli-LAMP Salmonella species Novazym Products Novazym Polska ul. Żywokostowa 23, 61-680 Poznań, tel. +48 0 61 610 39 10, fax +48 0 61 610 39 11, email info@novazym.com Zestaw do identyfikacji materiału genetycznego bakterii z rodzaju

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Załącznik nr 1 do SIWZ Nazwa i adres Wykonawcy Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Przedmiot zamówienia; automatyczny system do diagnostyki molekularnej:

Bardziej szczegółowo

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO Ćwiczenie numer 6 Analiza próbek spożywczych na obecność markerów GMO 1. Informacje wstępne -screening GMO -metoda CTAB -qpcr 2. Izolacja DNA z soi metodą CTAB 3. Oznaczenie ilościowe i jakościowe DNA

Bardziej szczegółowo

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość*

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość* Poznao, 6 lutego 2012 r. Zapytanie ofertowe nr 001 /2012 dotyczące zakupu odczynników chemicznych do izolacji DNA i reakcji PCR GENESIS Polska Sp. z o.o Ul. Za Cytadelą 19, 61-659 Poznao NIP 778 13 56

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

AmpliTest Salmonella spp. (Real Time PCR)

AmpliTest Salmonella spp. (Real Time PCR) AmpliTest Salmonella spp. (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzaju Salmonella techniką Real Time PCR Nr kat.: BAC01-50 Wielkość zestawu: 50 oznaczeń Objętość

Bardziej szczegółowo

MATERIAŁY SZKOLENIOWE DLA ZAKŁADÓW HIGIENY WETERYNARYJNEJ W ZAKRESIE LABORATORYJNEJ DIAGNOSTYKI AFRYKAŃSKIEGO POMORU ŚWIŃ

MATERIAŁY SZKOLENIOWE DLA ZAKŁADÓW HIGIENY WETERYNARYJNEJ W ZAKRESIE LABORATORYJNEJ DIAGNOSTYKI AFRYKAŃSKIEGO POMORU ŚWIŃ MATERIAŁY SZKOLENIOWE DLA ZAKŁADÓW HIGIENY WETERYNARYJNEJ W ZAKRESIE LABORATORYJNEJ DIAGNOSTYKI AFRYKAŃSKIEGO POMORU ŚWIŃ Puławy 2013 Opracowanie: Prof. dr hab. Iwona Markowska-Daniel, mgr inż. Kinga Urbaniak,

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

Zakład Biologii Molekularnej, Wydział Farmaceutyczny, WUM.

Zakład Biologii Molekularnej, Wydział Farmaceutyczny, WUM. Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: TERAPIA GENOWA Plan ćwiczeń Ćwiczenie 1: Przygotowanie warsztatu terapii genowej 1. Kontrola jakościowa preparatów plazmidowych paav/lacz,

Bardziej szczegółowo

Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9

Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9 Dot154v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strona 1 z 9 Instrukcja używania testów do wykrywania kontaminacji na powierzchniach roboczych ( wipe test ) przy typowaniu

Bardziej szczegółowo

AmpliTest Panel odkleszczowy (Real Time PCR)

AmpliTest Panel odkleszczowy (Real Time PCR) AmpliTest Panel odkleszczowy (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii Borrelia burgdorferi, Anaplasma, Ehrlichia oraz pierwotniaków rodzaju Babesia (B. canis, B. gibsoni,

Bardziej szczegółowo

Biochemia: Ćw. 11 Metoda RT-PCR

Biochemia: Ćw. 11 Metoda RT-PCR Ćwiczenie 11 METODA RT-PCR Wyciąg z kart charakterystyki substancji niebezpiecznych: bromek etydyny T+ EDTA Xi etanol, 96% F kwas octowy, 96% C -merkaptoetanol N, T Tris Xi UWAGI WSTĘPNE Praca z kwasami

Bardziej szczegółowo

CENNIK PRODUKTÓW DNA-GDAŃSK 2013

CENNIK PRODUKTÓW DNA-GDAŃSK 2013 CENNIK PRODUKTÓW DNA-GDAŃSK 2013 ZESTAWY DO IZOLACJI I OCZYSZCZANIA DNA I RNA EXTRACTME PLASMID DNA KIT Nowość! izolacja plazmidowego DNA EXTRACTME DNA BACTERIA KIT Nowość! izolacja genomowego DNA z bakterii

Bardziej szczegółowo

SPRAWOZDANIE Z BADAŃ DNA W KIERUNKU USTALENIA POKREWIEŃSTWA BIOLOGICZNEGO DO CELÓW PRYWATNYCH

SPRAWOZDANIE Z BADAŃ DNA W KIERUNKU USTALENIA POKREWIEŃSTWA BIOLOGICZNEGO DO CELÓW PRYWATNYCH SPRAWOZDANIE Z BADAŃ DNA W KIERUNKU USTALENIA POKREWIEŃSTWA BIOLOGICZNEGO DO CELÓW PRYWATNYCH ul. Bocheńskiego 38 a, 40-859 Katowice REGON: 243413225, NIP: 6342822748, KRS: 0000485925 tel. + 48 796 644

Bardziej szczegółowo

NIPT Nieinwazyjny Test Prenatalny (ang. Non-Invasive Prenatal Test)

NIPT Nieinwazyjny Test Prenatalny (ang. Non-Invasive Prenatal Test) NIPT Nieinwazyjny Test Prenatalny (ang. Non-Invasive Prenatal Test) Nieinwazyjne badanie krwi kobiety ciężarnej w kierunku wykluczenia najczęstszych trisomii u płodu Cel testu NIPT Celem testu NIPT jest

Bardziej szczegółowo

Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII "

Kurs pt.  MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII Warszawa, 6 lutego 2011 r. Szanowna Pani! Szanowny Panie! Niniejszym uprzejmie informuję, że organizowany jest Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII " Kurs odbędzie się w dniach

Bardziej szczegółowo

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa Nazwa Nazwa w j. ang. Wybrane problemy biologii molekularnej kwasy nukleinowe Selected problems of molecular biology

Bardziej szczegółowo

Zestaw do izolacji DNA z żeli agarozowych. Nr kat. EM08 Wersja zestawu:

Zestaw do izolacji DNA z żeli agarozowych. Nr kat. EM08 Wersja zestawu: Zestaw do izolacji DNA z żeli agarozowych Nr kat. EM08 Wersja zestawu: 1.2012 www.dnagdansk.com Nr kat. EM08 I. PRZEZNACZENIE ZESTAWU Zestaw EXTRACTME DNA GEL OUT przeznaczony jest do szybkiej i wydajnej

Bardziej szczegółowo

DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7

DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7 DOT138v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Strona 1 z 7 Instrukcja używania zestawu kontroli ujemnej przy typowaniu antygenów zgodności tkankowej HLA SSPGo TM

Bardziej szczegółowo

SPRAWOZDANIE Z BADAŃ DNA W KIERUNKU USTALENIA POKREWIEŃSTWA BIOLOGICZNEGO DO CELÓW PRYWATNYCH

SPRAWOZDANIE Z BADAŃ DNA W KIERUNKU USTALENIA POKREWIEŃSTWA BIOLOGICZNEGO DO CELÓW PRYWATNYCH SPRAWOZDANIE Z BADAŃ DNA W KIERUNKU USTALENIA POKREWIEŃSTWA BIOLOGICZNEGO DO CELÓW PRYWATNYCH testdna Laboratorium Sp. z o.o. ul. Bocheńskiego 38A, 40-859 Katowice tel. (32) 445 34 26, kom. 665 761 161

Bardziej szczegółowo

Novabeads Food DNA Kit

Novabeads Food DNA Kit Novabeads Food DNA Kit Novabeads Food DNA Kit jest nowej generacji narzędziem w technikach biologii molekularnej, umożliwiającym izolację DNA z produktów spożywczych wysoko przetworzonych. Metoda oparta

Bardziej szczegółowo

DETEKCJA PATOGENÓW DRÓG MOCZOWO-PŁCIOWYCH

DETEKCJA PATOGENÓW DRÓG MOCZOWO-PŁCIOWYCH DETEKCJA PATOGENÓW DRÓG MOCZOWO-PŁCIOWYCH Detekcja i identyfikacja 7 patogenów dróg moczowo-płciowych Detekcja Neisseria gonorrhoeae i Chlamydia trachomatis Detekcja Trichomonas vaginalis i Mycoplasma

Bardziej szczegółowo

Atrakcyjna i Innowacyjna Biotechnologia - ATRINBIOTECH Priorytet IV POKL Szkolnictwo wyższe i nauka

Atrakcyjna i Innowacyjna Biotechnologia - ATRINBIOTECH Priorytet IV POKL Szkolnictwo wyższe i nauka Metoda TILLING (Targeting Induced Local Lesions IN Genomes) to metoda odwrotnej genetyki oparta na wykorzystaniu enzymu CEL I (endonukleazy wizolowanej z selera naciowego Apium graveolens), który wykrywa

Bardziej szczegółowo

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System Załącznik nr 1A do SIWZ. PARAMETRY TECHNICZNE PRZEDMIOTU ZAMÓWIENIA Zadanie nr 1. TERMOSTAT CYRKULACYJNY Termostat cyrkulacyjny Z grzaniem i chłodzeniem Zakres temperatury roboczej 25 o C do + 200 o C

Bardziej szczegółowo

Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616

Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616 Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616 10 izolacji Nr kat. 995-10 Pojemność kolumny do oczyszczania DNA wynosi 500 µg 1 Skład zestawu Składnik Ilość Temp. Przechowywania Kolumny

Bardziej szczegółowo

Techniki molekularne w biologii SYLABUS A. Informacje ogólne

Techniki molekularne w biologii SYLABUS A. Informacje ogólne Techniki molekularne w biologii SYLABUS A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod przedmiotu

Bardziej szczegółowo

ĆWICZENIE 3 DGGE- ELEKTROFOREZA W ŻELU Z GRADIENTEM CZYNNIKA DENATURUJĄCEGO

ĆWICZENIE 3 DGGE- ELEKTROFOREZA W ŻELU Z GRADIENTEM CZYNNIKA DENATURUJĄCEGO ĆWICZENIE 3 DGGE- ELEKTROFOREZA W ŻELU Z GRADIENTEM CZYNNIKA DENATURUJĄCEGO CZĘŚĆ TEORETYCZNA Metody badań i cechy w oparciu o które przeprowadzana jest klasyfikacja i identyfikacja mikroorganizmówh Struktura

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ www.cytogen.com.pl ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ 3 Spis treści 4 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 22 22 Stabilność technologii TAG Specifikacja qpcr Mix-ów Kompatybilność kitów qpcr

Bardziej szczegółowo

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7.2. Metody biologii molekularnej (technika PCR, sekwencjonowanie DNA) wykorzystywane w taksonomii roślin Autor: Magdalena Dudek

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

Adres strony internetowej, na której Zamawiający udostępnia Specyfikację Istotnych Warunków Zamówienia: www.imp.sosnowiec.pl

Adres strony internetowej, na której Zamawiający udostępnia Specyfikację Istotnych Warunków Zamówienia: www.imp.sosnowiec.pl Strona 1 z 7 Adres strony internetowej, na której Zamawiający udostępnia Specyfikację Istotnych Warunków Zamówienia: www.imp.sosnowiec.pl Sosnowiec: Sukcesywna dostawa odczynników dla Instytutu Medycyny

Bardziej szczegółowo

IZOLACJA GENOMOWEGO DNA Z DROŻDŻY PIEKARNICZYCH SACCHAROMYCES CEREVISIAE Z WYKORZYSTANIEM ELEKTROFOREZY W ŻELU AGAROZOWYM W CELU WIZUALIZACJI WYNIKÓW

IZOLACJA GENOMOWEGO DNA Z DROŻDŻY PIEKARNICZYCH SACCHAROMYCES CEREVISIAE Z WYKORZYSTANIEM ELEKTROFOREZY W ŻELU AGAROZOWYM W CELU WIZUALIZACJI WYNIKÓW 44 IZOLACJA GENOMOWEGO DNA Z DROŻDŻY PIEKARNICZYCH SACCHAROMYCES CEREVISIAE Z WYKORZYSTANIEM ELEKTROFOREZY W ŻELU AGAROZOWYM W CELU WIZUALIZACJI WYNIKÓW Autorzy: Sylwia Czyjt, Gabriela Jasińska, Katarzyna

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

Dr hab.n.med. Renata Jacewicz

Dr hab.n.med. Renata Jacewicz GENOM CZŁOWIEKA >99 % 0,05%(100MtDNA) 65% Dr hab.n.med. Renata Jacewicz Kierownik Pracowni Genetyki Medycznej i Sądowej 3% 32% 2013 Pracownia Genetyki Medycznej i Sądowej ZMS Dojrzałe erytrocyty, trzony

Bardziej szczegółowo

Zestaw do oczyszczania DNA po reakcjach enzymatycznych. Nr kat. EM03 Wersja zestawu:

Zestaw do oczyszczania DNA po reakcjach enzymatycznych. Nr kat. EM03 Wersja zestawu: Zestaw do oczyszczania DNA po reakcjach enzymatycznych Nr kat. EM03 Wersja zestawu: 1.2012 I. PRZEZNACZENIE ZESTAWU Zestaw EXTRACTME DNA CLEAN-UP przeznaczony jest do szybkiego i wydajnego oczyszczania

Bardziej szczegółowo

INSTYTUT GENETYKI i HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK ul. POSTĘPU 36A, JASTRZĘBIEC, 05-552 Magdalenka

INSTYTUT GENETYKI i HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK ul. POSTĘPU 36A, JASTRZĘBIEC, 05-552 Magdalenka Jastrzębiec, 12. 03. 2014 r. Dotyczy przetargu DAZ-2401/ 7 / 14 na dostawę odczynników laboratoryjnych. Do zamawiającego wpłynęły następujące pytania na które odpowiedzi publikuje poniŝej: Dotyczy części

Bardziej szczegółowo

Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne cereal mosaic virus, SBCMV)

Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne cereal mosaic virus, SBCMV) Małgorzata Jeżewska Zakład Wirusologii i Bakteriologii, Instytut Ochrony Roślin Państwowy Instytut Badawczy, Poznań Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 100 ml, 250 ml, 500 ml Nr kat. 038-100, 038-250, 038-500 Nietosyczny roztwór wodny do przechowywania i zabezpieczania różnego rodzaju tkanek

Bardziej szczegółowo

CENNIK PRODUKTÓW BIOLINE 2013

CENNIK PRODUKTÓW BIOLINE 2013 CENNIK PRODUKTÓW BIOLINE 2013 MASTER MIXY REAL-TIME PCR MASTER MIXY REAL-TIME PCR Najnowszej Generacji SensiFAST SYBR No-ROX m.in. SmartCycler (Cepheid), Rotor-Gene (Qiagen), Eco (Illumina), Opticon TM,

Bardziej szczegółowo

Część I Zakup zestawów diagnostycznych do GMO.

Część I Zakup zestawów diagnostycznych do GMO. Załącznik 4a Część I Zakup zestawów diagnostycznych do GMO. NAZWA WIELKOŚC OPAKNIA RAZEM WARTOŚĆ 1 2 3 4 5 6 7 8=4*7 9 10 11 1. Zestaw do izolacji DNA - zestaw służący do izolacji DNA z surowego materiału

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

Techniki molekularne ćw. 1 1 z 6

Techniki molekularne ćw. 1 1 z 6 Techniki molekularne ćw. 1 1 z 6 Instrukcja do ćwiczeń Nr 1. Temat: Izolacja całkowitego DNA z tkanki ssaczej metodą wiązania DNA do kolumny krzemionkowej oraz spektrofotometryczna ocena jego czystości

Bardziej szczegółowo

Rocz. Nauk. Zoot., T. 37, z. 2 (2010) 145 149. Identyfikacja sekwencji genu kodującego dehydrogenazę NADH 1 u sarny

Rocz. Nauk. Zoot., T. 37, z. 2 (2010) 145 149. Identyfikacja sekwencji genu kodującego dehydrogenazę NADH 1 u sarny Rocz. Nauk. Zoot., T. 37, z. 2 (2010) 145 149 Identyfikacja sekwencji genu kodującego dehydrogenazę NADH 1 u sarny M a ł g o r z a t a N a t o n e k - W i ś n i e w s k a, E w a S ł o t a Instytut Zootechniki

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki Klub Młodego Wynalazcy - Laboratoria i wyposażenie Zadbaliśmy o to, żeby wyposażenie w Klubie Młodego Wynalazcy było w pełni profesjonalne. Ważne jest, aby dzieci i młodzież, wykonując doświadczenia korzystały

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU ELEKTROFOREZA

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU ELEKTROFOREZA SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU ELEKTROFOREZA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

BADANIE WŁASNOŚCI KOENZYMÓW OKSYDOREDUKTAZ

BADANIE WŁASNOŚCI KOENZYMÓW OKSYDOREDUKTAZ KATEDRA BIOCHEMII Wydział Biologii i Ochrony Środowiska BADANIE WŁASNOŚCI KOENZYMÓW OKSYDOREDUKTAZ ĆWICZENIE 2 Nukleotydy pirydynowe (NAD +, NADP + ) pełnią funkcję koenzymów dehydrogenaz przenosząc jony

Bardziej szczegółowo

CENNIK PRODUKTÓW DNA-GDAŃSK 2014-2015

CENNIK PRODUKTÓW DNA-GDAŃSK 2014-2015 CENNIK PRODUKTÓW DNA-GDAŃSK 2014-2015 ZESTAWY DO IZOLACJI I OCZYSZCZANIA DNA I RNA - PROMOCJA 30%!!! PLAZMIDOWE DNA SKALA MINI EXTRACTME PLASMID DNA KIT izolacja plazmidowego DNA w małej skali (0,5-5 ml

Bardziej szczegółowo

WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH UŻYWANYCH W PROGRAMACH HODOWLANYCH JABŁONI.

WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH UŻYWANYCH W PROGRAMACH HODOWLANYCH JABŁONI. Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) MAŁGORZATA KORBIN, SYLWIA KELLER-PRZYBYŁKOWICZ, EDWARD ŻURAWICZ WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH

Bardziej szczegółowo

Organizacja genomu człowieka i sekwencjonowanie DNA

Organizacja genomu człowieka i sekwencjonowanie DNA Organizacja genomu człowieka i sekwencjonowanie DNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Organizacja genów na ludzkim chromosomie.

Bardziej szczegółowo

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika Spis treści 1. Zawartość 2 1.1 Składniki zestawu 2 2. Opis produktu 2 2.1 Założenia metody 2 2.2 Instrukcja 2 2.3 Specyfikacja

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA.

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SPIS TREŚCI: 1. Wprowadzenie. 2. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. 3. Karty pracy. 1. Karta

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

CENNIK PRODUKTÓW DNA-GDAŃSK 2015

CENNIK PRODUKTÓW DNA-GDAŃSK 2015 CENNIK PRODUKTÓW DNA-GDAŃSK 2015 ZESTAWY DO IZOLACJI I OCZYSZCZANIA DNA I RNA - PROMOCJA!!! PLAZMIDOWE DNA SKALA MINI EXTRACTME PLASMID DNA KIT izolacja plazmidowego DNA w małej skali (0,5-5 ml hodowli);

Bardziej szczegółowo

Syngen Gel/PCR Mini Kit

Syngen Gel/PCR Mini Kit Syngen Gel/PCR Mini Kit Syngen Gel/PCR ME Mini Kit Zestawy do oczyszczania DNA: - z żelu agarozowego - po reakcji PCR i innych reakcjach enzymatycznych - z żelu agarozowego z małą objętością elucji - po

Bardziej szczegółowo

innovating life science

innovating life science innovating life science Cennik produktów 2016 Jeśli mają Państwo jakiekolwiek pytania chętnie na nie odpowiemy. Służymy również pomocą przy wyborze naszych produktów, tak aby optymalnie odpowiadały one

Bardziej szczegółowo

Część I Zakup zestawów diagnostycznych do GMO.

Część I Zakup zestawów diagnostycznych do GMO. Załącznik 4a Część I Zakup zestawów diagnostycznych do GMO. NAZWA WIELKOŚC OPAKOWANIA JEDNOSTK OWA VAT % RAZEM WARTOŚĆ 1 2 3 4 5 6 7 8=4*7 9 10 11 1. Zestaw do izolacji DNA - zestaw służący do izolacji

Bardziej szczegółowo

Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna SSPGo TM HLA Typing Kits)

Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna SSPGo TM HLA Typing Kits) DOT115v08: Instrukcje użytkowania dla Biofortuna SSPGoTM HLA zestawów. Wersja 5 CE Strona 1 z 12 Instrukcja używania zestawów do typowania antygenów zgodności tkankowej HLA SSPGo TM firmy Biofortuna (Biofortuna

Bardziej szczegółowo

Plasmid Mini. 50 izolacji, 250 izolacji. Zestaw do izolacji plazmidów wysokokopijnych wersja Nr kat ,

Plasmid Mini. 50 izolacji, 250 izolacji. Zestaw do izolacji plazmidów wysokokopijnych wersja Nr kat , Plasmid Mini Zestaw do izolacji plazmidów wysokokopijnych wersja 1016 50 izolacji, 250 izolacji Nr kat. 020-50, 020-250 Pojemność kolumny do oczyszczania DNA wynosi 20 µg. 1 Skład zestawu Składnik 50 izolacji

Bardziej szczegółowo

AmpliTest TBEV (Real Time PCR)

AmpliTest TBEV (Real Time PCR) AmpliTest TBEV (Real Time PCR) Zestaw do wykrywania sekwencji RNA specyficznych dla TBEV (Tick-borne encephalitis virus) techniką Real Time PCR Nr kat.: RV03-50 Wielkość zestawu: 50 oznaczeń Objętość pojedynczej

Bardziej szczegółowo

Instrukcję użytkowania

Instrukcję użytkowania Instrukcję użytkowania Amplifikacja metodą PCR i sekwencjonowanie loci HLA klasy I i II Nr wersji: 13.0 Data wydania Lipiec 2013 r. EC REP Conexio Genomics Pty Ltd Qarad bvba 8/31 Pakenham St Cipalstraat

Bardziej szczegółowo

Biotechnika rozrodu ryb jesiotrowatych. Dr inż. Dorota Fopp-Bayat Katedra Ichtiologii UW-M w Olsztynie

Biotechnika rozrodu ryb jesiotrowatych. Dr inż. Dorota Fopp-Bayat Katedra Ichtiologii UW-M w Olsztynie Biotechnika rozrodu ryb jesiotrowatych Dr inż. Dorota Fopp-Bayat Katedra Ichtiologii UW-M w Olsztynie Stanowisko systematyczne (Nelson 1994) gromada: ACTINOPTERYGII RYBY PROMIENIOPŁETWE podgromada: CHONDROSTEI

Bardziej szczegółowo

DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH

DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH Detekcja enterowirusów Detekcja sześciu typów ludzkich herpeswirusów (HHV) Detekcja pięciu bakterii Seeplex Detekcja patogenów powodujących

Bardziej szczegółowo

BioTe21, Pracownia Kryminalistyki i Badań Ojcostwa.

BioTe21, Pracownia Kryminalistyki i Badań Ojcostwa. Bio Kraków, dnia... EKSPERTYZA Z BADAŃ GENETYCZNYCH POKREWIEŃSTWA Nr ekspertyzy:... Badania wykonano w: Bio, Ojcostwa. Na zlecenie:... Typ wybranego testu: TIG3-16 Zlecenie z dnia:... Data otrzymania mat.

Bardziej szczegółowo

Załącznik nr 4 Metodyka pobrania materiału przedstawiona jest w osobnym Instrukcja PZH

Załącznik nr 4 Metodyka pobrania materiału przedstawiona jest w osobnym Instrukcja PZH Załącznik nr 4 Metodyka pobrania materiału przedstawiona jest w osobnym Instrukcja PZH 1. Rodzaj materiału klinicznego w zależności od kierunku i metodyki badań wykonywanych przez PZH Poz. Badanie Rodzaj

Bardziej szczegółowo

CENNIK PRODUKTÓW DNA-GDAŃSK 2015-2016

CENNIK PRODUKTÓW DNA-GDAŃSK 2015-2016 CENNIK PRODUKTÓW DNA-GDAŃSK 2015-2016 ZESTAWY DO IZOLACJI I OCZYSZCZANIA DNA I RNA - PROMOCJA!!! PLAZMIDOWE DNA SKALA MINI EXTRACTME PLASMID DNA KIT izolacja plazmidowego DNA w małej skali (0,5-5 ml hodowli);

Bardziej szczegółowo

Zestaw do izolacji DNA z wymazów oraz nasienia

Zestaw do izolacji DNA z wymazów oraz nasienia Nr kat. EM06 Wersja zestawu: 1.2014 Zestaw do izolacji DNA z wymazów oraz nasienia EXTRACTME jest zastrzeżonym znakiem towarowym firmy BLIRT S.A. www.dnagdansk.com Nr kat. EM06 I. PRZEZNACZENIE ZESTAWU

Bardziej szczegółowo

PathogenFree RNA Isolation Kit Zestaw do izolacji RNA

PathogenFree RNA Isolation Kit Zestaw do izolacji RNA PathogenFree RNA Isolation Kit Zestaw do izolacji RNA Instrukcja użytkownika Spis treści 1. Zawartość 2 1.1 Składniki zestawu 2 2. Opis produktu 2 2.1 Założenia metody 2 2.2 Specyfikacja zestawu 2 2.3

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa Ćwiczenie 3 Izolacja i rozdział

Bardziej szczegółowo

KOMETA DNA. Zestaw do elektroforezy horyzontalnej typu Commet assay (na 10 lub 20 preparatów) Instrukcja Obsługi

KOMETA DNA. Zestaw do elektroforezy horyzontalnej typu Commet assay (na 10 lub 20 preparatów) Instrukcja Obsługi KOMETA DNA Zestaw do elektroforezy horyzontalnej typu Commet assay (na 10 lub 20 preparatów) Instrukcja Obsługi Numer katalogowy: 134-190 (10 preparatów) 134-196 (20 preparatów) Aby uzys k ać pomoc techniczną

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

Numer sprawy DP/2310/143/11 ZAŁĄCZNIK NR 2 OPIS PRZEDMIOTU ZAMÓWIENIA

Numer sprawy DP/2310/143/11 ZAŁĄCZNIK NR 2 OPIS PRZEDMIOTU ZAMÓWIENIA Numer sprawy DP/2310/143/11 ZAŁĄCZNIK NR 2 dla części I wirówki uniwersalne 2 szt. OPIS PRZEDMIOTU ZAMÓWIENIA 1. Wirówka stołowa nr 1, chłodzona, szybkoobrotowa do prędkości maks. 30000 rpm, RCF > 65000xg,

Bardziej szczegółowo

NOWOŚĆ W OFERCIE IGS: DNA IMAGING

NOWOŚĆ W OFERCIE IGS: DNA IMAGING NOWOŚĆ W OFERCIE IGS: DNA IMAGING Zapraszamy do zapoznania się z ofertą innowacyjnych testów opracowanych w ramach technologii DNA IMAGING Opracowano w ramach projektu badawczego pod nazwą Badania nad

Bardziej szczegółowo

Biologia Molekularna ĆWICZENIE I PREPARATYKA RNA

Biologia Molekularna ĆWICZENIE I PREPARATYKA RNA Biologia Molekularna ĆWICZENIE I PREPARATYKA RNA ĆWICZENIE I (RNA) W komórkach występują trzy główne rodzaje RNA: mrna, trna, rrna. Największą pulę RNA stanowi rrna kodujące podjednostki rybosomów (u Eukariota

Bardziej szczegółowo

LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA

LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA ANNALES ACADEMIAE MEDICAE STETINENSIS ROCZNIKI POMORSKIEJ AKADEMII MEDYCZNEJ W SZCZECINIE 2007, 53, SUPPL. 2, 170174 LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA Badanie

Bardziej szczegółowo

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy PIWet Zakład Chorób Ryb Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy łososiowatych o (VHS), wirusa zakaźnej a martwicy układu krwiotwórczego (IHN)

Bardziej szczegółowo

Załącznik nr 1 do Zapytania ofertowego... /miejscowość, data/

Załącznik nr 1 do Zapytania ofertowego... /miejscowość, data/ Załącznik nr 1 do Zapytania ofertowego... FORMULARZ OFERTOWY W odpowiedzi na zapytanie ofertowe z dnia.. złożone przez Biowet Puławy Sp. z o.o. Ja/my niżej podpisany/i (Imiona i nazwiska osób upoważnionych

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu DNA) Jest to reakcja powielania (replikacji)

Bardziej szczegółowo

GENOMIKA. MAPOWANIE GENOMÓW MAPY GENOMICZNE

GENOMIKA. MAPOWANIE GENOMÓW MAPY GENOMICZNE GENOMIKA. MAPOWANIE GENOMÓW MAPY GENOMICZNE Bioinformatyka, wykład 3 (21.X.2008) krzysztof_pawlowski@sggw.waw.pl tydzień temu Gen??? Biologiczne bazy danych historia Biologiczne bazy danych najważniejsze

Bardziej szczegółowo

Oznaczanie mocznika w płynach ustrojowych metodą hydrolizy enzymatycznej

Oznaczanie mocznika w płynach ustrojowych metodą hydrolizy enzymatycznej Oznaczanie mocznika w płynach ustrojowych metodą hydrolizy enzymatycznej Wprowadzenie: Większość lądowych organizmów kręgowych część jonów amonowych NH + 4, produktu rozpadu białek, wykorzystuje w biosyntezie

Bardziej szczegółowo

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP ARCH. MED. SĄD. KRYMINOL., 2010, LX, 243-247 PRACE ORYGINALNE / ORIGINALS Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski Analiza danych populacyjnych loci ministr: D10S1248,

Bardziej szczegółowo

Diagnostyka molekularna w OIT

Diagnostyka molekularna w OIT Diagnostyka molekularna w OIT B A R B A R A A D A M I K K A T E D R A I K L I N I K A A N E S T E Z J O L O G I I I I N T E N S Y W N E J T E R A P I I U N I W E R S Y T E T M E D Y C Z N Y W E W R O C

Bardziej szczegółowo

Poniższe wytyczne dotyczą wszystkich rodzajów materiału klinicznego.

Poniższe wytyczne dotyczą wszystkich rodzajów materiału klinicznego. Strona 1 z 5 Wytyczne dotyczące zlecania, pobierania, oznakowania, przechowywania, transportowania i rejestrowania próbek materiału klinicznego do badań w Pracowni PCR Niżej przedstawione wytyczne dotyczące

Bardziej szczegółowo