PL B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

Wielkość: px
Rozpocząć pokaz od strony:

Download "PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego"

Transkrypt

1 PL B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: (22) Data zgłoszenia: (51) Int.Cl. C12Q 1/68 ( ) C12N 15/00 ( ) C07H 21/04 ( ) (54) Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego (73) Uprawniony z patentu: UNIWERSYTET MEDYCZNY W LUBLINIE, Lublin, PL (43) Zgłoszenie ogłoszono: BUP 03/12 (45) O udzieleniu patentu ogłoszono: WUP 06/14 (72) Twórca(y) wynalazku: RADOSŁAW LESZEK MLAK, Kraśnik, PL PAWEŁ KRAWCZYK, Lublin, PL KAMILA WOJAS-KRAWCZYK, Lublin, PL JUSTYNA EMERYK-MAKSYMIUK, Lublin, PL JANUSZ MILANOWSKI, Lublin, PL (74) Pełnomocnik: rzecz. pat. Anna Bełz

2 2 PL B1 Opis wynalazku Przedmiotem wynalazku jest sposób amplifikacji DNA w multipleks PCR za pomocą mieszaniny starterów specyficznych dla genu receptora β2-adrenergicznego (ADRB2). Sekwencja nukleotydowa oznacza następujące po sobie kolejno (w orientacji 5' 3') zasady azotowe (puryny i pirymidyny) gdzie A oznacza adeninę, T tyminę, G guaninę, C cytozynę. Choroby takie jak: przewlekła obturacyjna choroba płuc (POChP), astma oskrzelowa (AO) czy alergiczny nieżyt nosa (ANN) należą obecnie do najczęściej występujących schorzeń państw uprzemysłowionych. Szacuje się, że liczba nowych zachorowań na POChP kształtuje się na poziomie 10-20% ogółu populacji. Występuje znacznie częściej u osób po 40 roku życia. Gwałtowny wzrost zachorowań na astmę w ostatnich 15 latach spowodował, że w dużych aglomeracjach miejskich ok. 10 procent populacji zgłasza się do lekarza z objawami tej choroby. Czyni to z AO jedną z najczęstszych chorób przewlekłych, z jakimi styka się lekarz pierwszego kontaktu. Niestety badania epidemiologiczne ostatnich lat potwierdzają gwałtowny wzrost zachorowań na wymienione wyżej schorzenia we wszystkich grupach wiekowych. Z farmakogenetycznego i klinicznego punktu widzenia najistotniejsze a zarazem najczęściej występujące są 2 polimorfizmy. Pierwszy z nich dotyczy pozycji aminokwasowej 16 (zamiana Arg/Gly wywołana zmianą w kodonie 16 GGA GGG), drugi pozycji aminokwasowej 27 (zamiana Gln/Glu wywołana zmianą w kodonie 27 GAA CAA). Obecnie coraz większa grupa badaczy wskazuje na możliwą rolę polimorfizmów genu w kształtowaniu się obrazu klinicznego wielu schorzeń układu oddechowego tj. POCHP, AO, ANN jak również w odpowiedzi na stosowane w leczeniu β-mimetyki. Hall i wsp. wykazali istnienie zależności pomiędzy zmniejszoną reaktywnością dróg oddechowych na pochodne choliny (m in. metacholinę) a występowaniem allelu Glu27 w genie ADRB2 u osób chorych na AO. Ramsey i wsp. wykazali ponadto związek pomiędzy występowaniem allelu Arg16 i zwiększoną podatnością na skurcz oskrzeli w przebiegu infekcji dróg oddechowych. Tan i wsp. donieśli o możliwej zależności pomiędzy ekspresją receptora β 2 -adrenergicznego u chorych na AO a obecnością poszczególnych polimorfizmów genu ADRB2. Następstwem czego jest obniżenie wrażliwości na bronchodilację po uprzedniej ekspozycji na β2-sympatykomimetyki. Łańcuchowa reakcja polimerazy (PCR) jest powszechnie znaną, podstawową techniką badawczą i diagnostyczną w biologii molekularnej i medycynie. Umożliwia ona amplifikację wybranego fragmentu DNA, zazwyczaj w celu otrzymania żądanej ilości kopii matrycy. Dzięki technice PCR dysponowanie niewielkimi ilościami DNA nie stanowi obecnie bariery w badaniach w dziedzinie biologii molekularnej oraz w procedurach diagnostycznych opartych na analizie DNA. Znane są również sposoby amplifikacji DNA w łańcuchowej reakcji polimerazy (PCR) za pomocą starterów specyficznych dla genu ADRB2. Znane są również w literaturze patentowej sposoby amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora β2-adrenergicznego. Sposób amplifikacji DNA znany jest m.in. z patentu amerykańskiego US , przy czym sposób opisany w patencie jest kilkuetapowy i kosztowny, gdyż metoda ta wymaga przyłączenia odpowiedniej sondy molekularnej i dopiero po zastosowaniu jej uzyskuje się wynik oznaczenia. Sposób amplifikacji DNA we wspomnianym opisie, jak również w opisie zgłoszenia międzynarodowego WO dotyczy oznaczania ekspresji genu. Zagadnienie allelo specyficznej amplifikacji genu ADRB2 wspomniane było także w zgłoszeniu patentowym US , dotyczącym leczenia jaskry. Z publikacji Ning McLaren et al., ARCH. OPHTHAMOL., 2007, vol.125 Evaluation of the β2- -Adrenergic Receptor Gene as a Candidate Glucoma Gene in 2 Ancestral Populations" znane jest wykorzystanie w reakcji PCR dwóch następujących starterów: starter sensowny F16G dla kodonu 16: 5' GCCTTCTTGCTGGCACCCAATG 3' oraz starter sensowny F16A dla kodonu 16 5' GCCTTCT- TGCTGGCACCCAATA 3'. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą mieszaniny starterów specyficznych dla genu ADRB2 według wynalazku charakteryzuje się tym, że stosuje się łącznie startery posiadające następujące sekwencje nukteotydowe: 1. Starter sensowny F16G dla kodonu 16; 5' GCCTTCTTGCTGGCACCCAATG 3', 2. Starter sensowny F16A dla kodonu 16; 5' GCCTTCTTGCTGGCACCCAATA 3', 3. Starter sensowny F27G dla kodonu 27; 5' GACCACGACGTCACGCAGG 3' 4. Starter sensowny F27C dla kodonu 27; 5' GACCACGACGTCACGCAGC 3'

3 PL B Starter antysensowny R16; 27 (wspólny dla kodonów 16 i 27) 5' AGGCCCATGACCAGATCAGCA 3' Dzięki korzystaniu ze sposobu według wynalazku możliwe jest stosunkowo proste i wydajne otrzymywanie kopii matryc DNA zawierających miejsca przyłączania specyficznych (dla fragmentu genu ADRB2) starterów. Stosowana w sposobie według wynalazku mieszanina starterów może być wykorzystywana, ze względu na swoją efektywność w reakcji PCR jako narzędzie służące do zamplifikowania fragmentów genu czy cdna ADRB2. Przykładem takich zastosowań może być oznaczanie polimorfizmu genu metodą multipleksowego allelospecyficznego PCR, otrzymywanie dużych ilości kopii DNA do sekwencjonowania czy innych analiz, uzyskiwania odcinków DNA mogących służyć jako sondy w metodach hybrydyzacyjnych. Celem uproszczenia w opisie i przykładzie używane są następujące skróty: A - adenina ADRB2 - gen dla receptora β2 adrenergicznego ANN - alergiczny nieżyt nosa AO - astma oskrzelowa C - cytozyna cdna - DNA komplementarne do RNA DNA - kwas dezoksyrybonukleinowy G - guanina mrna - matrycowy RNA PCR - łańcuchowa reakcja polimerazy PCR multipleks - metoda umożliwiająca amplifikację wielu SNP lub genów podczas jednej reakcji POCHP - przewlekła obturacyjna choroba płuc p.z. - par zasad RNA - kwas rybonukleinowy SNP - polimorfizm pojedynczego nukleotydu T - tymina Wynalazek wyjaśniony jest bliżej w przykładzie, który jednak nie ogranicza jego zakresu. P r z y k ł a d 1. Allelospecyficzna Reakcja multipleks PCR z wykorzystaniem unikalnej mieszaniny starterów do amplifikacji specyficznych regionów DNA wykorzystywanych w oznaczaniu SNP w kodonach 16 i 27 genu ADRB2. W celu przeprowadzenia reakcji niezbędne są: 1) Wyizolowany z krwi lub innego materiału biologicznego DNA. 2) Unikalna mieszanina reakcyjna zawierająca wymienione wyżej startery oraz inne odczynniki chemiczne w odpowiednich proporcjach. 3) Termocykler z możliwością ustawienia optymalnych warunków termicznych. Allelospecyficzną reakcję multipleks PCR w wariancie do oznaczania SNP w kodonach 16 i 27 genu dla ADRB2 według wynalazku prowadzono przy użyciu opisanych wyżej 5 starterów. W opisywanym wynalazku oznaczono 2 polimorfizmy. W probówce PCR 200 μι przygotowano odpowiednią mieszaninę reakcyjną o objętości 25 ul dodając kolejno: bufor Taq (z dodatkiem KCI/ bez MgCl 2 ), mieszaninę nukleotydów (dntp mix), roztwór MgCl 2, termostabilną polimerazę Taq DNA oraz startery: sensowne (F27G, F27C), antysensowny (R27), wyizolowane DNA, w proporcjach podanych w tabeli 1. Następnie przeniesiono mieszaninę do termocyklera i ustawiono program składający się z 6 etapów: wstępnej denaturacji DNA, denaturacji właściwej, przyłączania starterów, wydłużania produktu PCR, końcowego wydłużania produktu PCR, chłodzenia próbki. Reakcja prowadzona jest cyklicznie od etapu właściwej denaturacji do etapu wydłużania produktu PCR 33 razy w warunkach temperaturowych podanych w tabeli 2. Po zakończeniu reakcji otrzymane produkty PCR (kodon 16G/A: 227pz; kodon 27G/C: 194pz) rozdzielono elektroforetycznie w 2% żelu agarozowym. W przypadku obecności danych alleli na elektroforegramie pojawią się prążki o odpowiedniej długości ocenianej względem markera wielkości. Przykładowy rozdział elektroforetyczny produktów allelospecyficznej reakcji PCR multipleks powstałych przy użyciu zaprojektowanych starterów przedstawia rycina 1. W załączonej tabeli 1 przedstawiono proporcje odczynników stosowanych podczas oznaczania polimorfizmów genu ADRB2 w reakcji multipleks PCR, zaś w tabeli 2 warunki temperaturowe prowadzenia reakcji multipleks PCR w wariancie służącym do oznaczania polimorfizmów genu ADRB2.

4 4 PL B1 T a b e l a 1. Proporcje odczynników stosowanych podczas oznaczania polimorfizmów genu ADRB2 w reakcji multipleks PCR. Bufor Taq (10x) Skład mieszaniny reakcyjnej (stężenie) Mieszanina nukleotydów (2 mmol/μl) Jony Mg 2+ (25 mmol/μι) Polimeraza Taq DNA (5U/μl) Starter F16G lub F16A (100 pmol/μι) Starter F27G lub F27C (100 pmol/μι) Starter R16;27 (100 pmol/μι) Woda wolna od nukleaz DNA ( ng/μι) Suma Ilość 3 μι 3 μι 3,6 μι 0,14 μι 0,8 μι 0,8 μl 1,6 μι 10 μι 2,06 μι 25 μι T a b e l a 2. Warunki temperaturowe prowadzenia reakcji multipleks PCR w wariancie przystosowanym do oznaczania polimorfizmów genu ADRB2. (Etapy prowadzone cyklicznie wyróżniono pogrubioną czcionką). Etap Temp. Czas 1. Wstępna denaturacja DNA 96 C 8 min. 2. Właściwa denaturacja DNA 96 C 30 sek. 3. Przyłączanie starterów 60 C 30 sek. 4. Wydłużanie produktu PCR 72 C 45 sek. 5. Końcowe wydłużanie produktu PCR 72 C 12 min. 6. Chłodzenie próbki 4 C Rycina 1. Przykładowy rozdział elektroforetyczny produktów reakcji PCR powstałych przy użyciu zaprojektowanych starterów.

5 PL B1 5 Zastrzeżenie patentowe Sposób amplifikacji DNA w multipleksowej łańcuchowej reakcji polimerazy za pomocą mieszaniny starterów specyficznych dla genu receptora β2 adrenergicznego, znamienny tym, że stosuje się łącznie startery posiadające następujące sekwencje nukleotydowe: 1. Starter sensowny F16G dla kodonu 16; 5' GCCTTCTTGCTGGCACCCAATG 3', 2. Starter sensowny F16A dla kodonu 16; 5' GCCTTCTTGCTGGCACCCAATA 3', 3. Starter sensowny F27G dla kodonu 27; 5' GACCACGACGTCACGCAGG 3' 4. Starter sensowny F27C dla kodonu 27; 5' GACCACGACGTCACGCAGC 3' 5. Starter antysensowny R16;27 (wspólny dla kodonów 16 i 27) 5' AGGCCCATGACCAGATCAGCA 3

6 6 PL B1 Departament Wydawnictw UPRP Cena 2,46 zł (w tym 23% VAT)

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu Protokół pochodzi ze strony molekularnie.wordpress.com Kopiowanie i rozpowszechnianie wyłącznie w całości, z zachowaniem praw autorskich zgodnie z zasadami licencji GNU Dziękuję za uszanowanie mojej pracy,

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 04/14. SYLWIA OKOŃ, Dąbrowica, PL KRZYSZTOF KOWALCZYK, Motycz, PL

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 04/14. SYLWIA OKOŃ, Dąbrowica, PL KRZYSZTOF KOWALCZYK, Motycz, PL PL 220315 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 220315 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 400252 (22) Data zgłoszenia: 06.08.2012 (51) Int.Cl.

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

Poradnik: Optymalizacja reakcji PCR algorytm postępowania

Poradnik: Optymalizacja reakcji PCR algorytm postępowania Poradnik: Optymalizacja reakcji PCR algorytm postępowania Jak przeprowadzić optymalizację reakcji PCR? Co zmienić w metodyce, by pozbyć się produktów niespecyficznych? Jak poprawić plon reakcji? Od czego

Bardziej szczegółowo

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208956 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 381219 (22) Data zgłoszenia: 05.12.2006 (51) Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7.2. Metody biologii molekularnej (technika PCR, sekwencjonowanie DNA) wykorzystywane w taksonomii roślin Autor: Magdalena Dudek

Bardziej szczegółowo

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość*

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość* Poznao, 6 lutego 2012 r. Zapytanie ofertowe nr 001 /2012 dotyczące zakupu odczynników chemicznych do izolacji DNA i reakcji PCR GENESIS Polska Sp. z o.o Ul. Za Cytadelą 19, 61-659 Poznao NIP 778 13 56

Bardziej szczegółowo

Ampli-LAMP Babesia canis

Ampli-LAMP Babesia canis Novazym Products Zestaw do identyfikacji materiału genetycznego pierwotniaka Babesia canis canis techniką Loop-mediated Isothermal AMPlification (LAMP) Numery katalogowe produktu: AML-Bc-200 AML-Bc-400

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu DNA) Jest to reakcja powielania (replikacji)

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo

Scenariusz lekcji z biologii w szkole ponadgimnazjalnej

Scenariusz lekcji z biologii w szkole ponadgimnazjalnej Scenariusz lekcji z biologii w szkole ponadgimnazjalnej Temat lekcji: Planowanie doświadczeń biologicznych jak prawidłowo zaplanować próbę kontrolną? Cele kształcenia IV etap edukacyjny: 1. Wymagania ogólne:

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA DNA 28SRNA 18/16S RNA 5SRNA mrna Ilościowa analiza mrna aktywność genów w zależności od wybranych czynników: o rodzaju tkanki o rodzaju czynnika zewnętrznego o rodzaju upośledzenia szlaku metabolicznego

Bardziej szczegółowo

Biochemia: Ćw. 11 Metoda RT-PCR

Biochemia: Ćw. 11 Metoda RT-PCR Ćwiczenie 11 METODA RT-PCR Wyciąg z kart charakterystyki substancji niebezpiecznych: bromek etydyny T+ EDTA Xi etanol, 96% F kwas octowy, 96% C -merkaptoetanol N, T Tris Xi UWAGI WSTĘPNE Praca z kwasami

Bardziej szczegółowo

Przykładowe zadania. przygotowujące do egzaminu maturalnego

Przykładowe zadania. przygotowujące do egzaminu maturalnego Przykładowe zadania z BIOLOGii przygotowujące do egzaminu maturalnego Prezentowane zadania są zgodne z podstawą programową kształcenia ogólnego w zakresie rozszerzonym i podstawowym. Prócz zadań, które

Bardziej szczegółowo

Transformacja pośrednia składa się z trzech etapów:

Transformacja pośrednia składa się z trzech etapów: Transformacja pośrednia składa się z trzech etapów: 1. Otrzymanie pożądanego odcinka DNA z materiału genetycznego dawcy 2. Wprowadzenie obcego DNA do wektora 3. Wprowadzenie wektora, niosącego w sobie

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA.

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SPIS TREŚCI: 1. Wprowadzenie. 2. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. 3. Karty pracy. 1. Karta

Bardziej szczegółowo

PL B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL BUP 19/09. MACIEJ KOKOT, Gdynia, PL WUP 03/14. rzecz. pat.

PL B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL BUP 19/09. MACIEJ KOKOT, Gdynia, PL WUP 03/14. rzecz. pat. PL 216395 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 216395 (13) B1 (21) Numer zgłoszenia: 384627 (51) Int.Cl. G01N 27/00 (2006.01) H01L 21/00 (2006.01) Urząd Patentowy Rzeczypospolitej

Bardziej szczegółowo

PL B1. PĘKACKI PAWEŁ, Skarżysko-Kamienna, PL BUP 02/06. PAWEŁ PĘKACKI, Skarżysko-Kamienna, PL

PL B1. PĘKACKI PAWEŁ, Skarżysko-Kamienna, PL BUP 02/06. PAWEŁ PĘKACKI, Skarżysko-Kamienna, PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208199 (13) B1 (21) Numer zgłoszenia: 369112 (51) Int.Cl. A61C 5/02 (2006.01) A61B 5/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo

PL B1. POLITECHNIKA WROCŁAWSKA, Wrocław, PL BUP 02/14. PIOTR OSIŃSKI, Wrocław, PL WUP 10/16. rzecz. pat.

PL B1. POLITECHNIKA WROCŁAWSKA, Wrocław, PL BUP 02/14. PIOTR OSIŃSKI, Wrocław, PL WUP 10/16. rzecz. pat. PL 223648 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 223648 (13) B1 (21) Numer zgłoszenia: 404800 (51) Int.Cl. F04C 2/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

Mieszanina trójfosforanów deoksyrybonukleotydów (dntp: datp, dgtp, dctp, dttp) Bufor reakcyjny zapewniający odpowiednie warunki reakcji

Mieszanina trójfosforanów deoksyrybonukleotydów (dntp: datp, dgtp, dctp, dttp) Bufor reakcyjny zapewniający odpowiednie warunki reakcji Uniwersytet Gdański, Wydział Biologii Biologia i Biologia medyczna II rok Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią =================================================================

Bardziej szczegółowo

PL B1. HIKISZ BARTOSZ, Łódź, PL BUP 05/07. BARTOSZ HIKISZ, Łódź, PL WUP 01/16. rzecz. pat.

PL B1. HIKISZ BARTOSZ, Łódź, PL BUP 05/07. BARTOSZ HIKISZ, Łódź, PL WUP 01/16. rzecz. pat. PL 220905 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 220905 (13) B1 (21) Numer zgłoszenia: 376878 (51) Int.Cl. F16H 7/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

PL 213904 B1. Elektrolityczna, nanostrukturalna powłoka kompozytowa o małym współczynniku tarcia, zużyciu ściernym i korozji

PL 213904 B1. Elektrolityczna, nanostrukturalna powłoka kompozytowa o małym współczynniku tarcia, zużyciu ściernym i korozji PL 213904 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 213904 (13) B1 (21) Numer zgłoszenia: 390004 (51) Int.Cl. C25D 3/12 (2006.01) C25D 15/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

Choroby układu oddechowego wśród mieszkańców powiatu ostrołęckiego

Choroby układu oddechowego wśród mieszkańców powiatu ostrołęckiego Choroby układu oddechowego wśród mieszkańców powiatu ostrołęckiego Podczas akcji przebadano 4400 osób. Na badania rozszerzone skierowano ok. 950 osób. Do tej pory przebadano prawie 600 osób. W wyniku pogłębionych

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

Nowoczesne systemy ekspresji genów

Nowoczesne systemy ekspresji genów Nowoczesne systemy ekspresji genów Ekspresja genów w organizmach żywych GEN - pojęcia podstawowe promotor sekwencja kodująca RNA terminator gen Gen - odcinek DNA zawierający zakodowaną informację wystarczającą

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO Ćwiczenie numer 6 Analiza próbek spożywczych na obecność markerów GMO 1. Informacje wstępne -screening GMO -metoda CTAB -qpcr 2. Izolacja DNA z soi metodą CTAB 3. Oznaczenie ilościowe i jakościowe DNA

Bardziej szczegółowo

PL 215396 B1. Urządzenie do wymuszonego chłodzenia łożysk, zwłaszcza poziomej pompy do hydrotransportu ciężkiego

PL 215396 B1. Urządzenie do wymuszonego chłodzenia łożysk, zwłaszcza poziomej pompy do hydrotransportu ciężkiego PL 215396 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215396 (13) B1 (21) Numer zgłoszenia: 389424 (51) Int.Cl. F16C 37/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ www.cytogen.com.pl ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ 3 Spis treści 4 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 22 22 Stabilność technologii TAG Specifikacja qpcr Mix-ów Kompatybilność kitów qpcr

Bardziej szczegółowo

Ilość TAK TAK TAK TAK TAK TAK

Ilość TAK TAK TAK TAK TAK TAK Postępowanie WB.2420.6.2013.NG ZAŁĄCZNIK NR 5 L.p. Nazwa asortymentu parametry techniczne Ilość Nazwa wyrobu, nazwa producenta, określenie marki, modelu, znaku towarowego Cena jednostkowa netto (zł) Wartość

Bardziej szczegółowo

... ...J CD CD. N "f"'" Sposób i filtr do usuwania amoniaku z powietrza. POLITECHNIKA LUBELSKA, Lublin, PL 09.11.2009 BUP 23/09

... ...J CD CD. N f' Sposób i filtr do usuwania amoniaku z powietrza. POLITECHNIKA LUBELSKA, Lublin, PL 09.11.2009 BUP 23/09 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19)PL (11)212766 (13) 81 (21) Numer zgłoszenia 385072 (51) Int.CI 801D 53/04 (2006.01) C01C 1/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów Wprowadzenie do genetyki sądowej 2013 Pracownia Genetyki Sądowej Katedra i Zakład Medycyny Sądowej Materiały biologiczne Inne: włosy z cebulkami, paznokcie możliwa degradacja - tkanki utrwalone w formalinie/parafinie,

Bardziej szczegółowo

PL 218203 B1. R&D PROJECT SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Łódź, PL 17.12.2012 BUP 26/12

PL 218203 B1. R&D PROJECT SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Łódź, PL 17.12.2012 BUP 26/12 PL 218203 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 218203 (13) B1 (21) Numer zgłoszenia: 395134 (51) Int.Cl. B23B 3/16 (2006.01) B23B 3/18 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie Sekwencyjność występowania zaburzeń molekularnych w niedrobnokomórkowym raku płuca

Bardziej szczegółowo

PL B1. KRUPANEK LESZEK, Bielsko-Biała, PL BUP 05/05. LESZEK KRUPANEK, Bielsko-Biała, PL WUP 09/10 RZECZPOSPOLITA POLSKA

PL B1. KRUPANEK LESZEK, Bielsko-Biała, PL BUP 05/05. LESZEK KRUPANEK, Bielsko-Biała, PL WUP 09/10 RZECZPOSPOLITA POLSKA RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 206649 (13) B1 (21) Numer zgłoszenia: 361961 (51) Int.Cl. B60K 6/08 (2006.01) F03G 7/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo

PL B1. Sposób kucia półfabrykatu zwłaszcza do wytwarzania wyrobów płaskich z jednym żebrem o zarysie trójkątnym

PL B1. Sposób kucia półfabrykatu zwłaszcza do wytwarzania wyrobów płaskich z jednym żebrem o zarysie trójkątnym PL 215504 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215504 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 395408 (22) Data zgłoszenia: 22.06.2011 (51) Int.Cl.

Bardziej szczegółowo

AmpliTest Salmonella spp. (Real Time PCR)

AmpliTest Salmonella spp. (Real Time PCR) AmpliTest Salmonella spp. (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzaju Salmonella techniką Real Time PCR Nr kat.: BAC01-50 Wielkość zestawu: 50 oznaczeń Objętość

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: , PCT/DE03/ (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: , PCT/DE03/ (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 207732 (21) Numer zgłoszenia: 378818 (22) Data zgłoszenia: 18.12.2003 (86) Data i numer zgłoszenia międzynarodowego:

Bardziej szczegółowo

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS Nowiny Lekarskie 2006, 75, 5, 486 490 ALINA LICZBAŃSKA, ANNA WOŹNIAK, ANNA WAWROCKA, MACIEJ R. KRAWCZYŃSKI TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR

Bardziej szczegółowo

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier.

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier. ID Testu: F5679R8 Imię i nazwisko ucznia Klasa Data 1. Na indywidualne cechy danego osobnika ma (maja) wpływ A. wyłacznie czynniki środowiskowe. B. czynniki środowiskowe i materiał genetyczny. C. wyłacznie

Bardziej szczegółowo

PL 198188 B1. Instytut Chemii Przemysłowej im.prof.ignacego Mościckiego,Warszawa,PL 03.04.2006 BUP 07/06

PL 198188 B1. Instytut Chemii Przemysłowej im.prof.ignacego Mościckiego,Warszawa,PL 03.04.2006 BUP 07/06 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 198188 (13) B1 (21) Numer zgłoszenia: 370289 (51) Int.Cl. C01B 33/00 (2006.01) C01B 33/18 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

Warunki udzielania świadczeń w rodzaju: świadczenia zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE

Warunki udzielania świadczeń w rodzaju: świadczenia zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE Załącznik nr do Zarządzenia.. Warunki udzielania świadczeń w rodzaju: zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE 8.1 WARUNKI WYMAGANE Załącznik nr 2 do rozporządzenia cz. I lit. M Lp 913-916

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

PL B1. SZOSTEK WACŁAW, Warszawa, PL TYZNER TADEUSZ, Warszawa, PL SZOSTEK RADOSŁAW, Warszawa, PL BUP 03/09

PL B1. SZOSTEK WACŁAW, Warszawa, PL TYZNER TADEUSZ, Warszawa, PL SZOSTEK RADOSŁAW, Warszawa, PL BUP 03/09 PL 216064 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 216064 (13) B1 (21) Numer zgłoszenia: 383011 (51) Int.Cl. A47C 7/16 (2006.01) A47C 9/02 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616

Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616 Genomic Maxi AX zestaw do izolacji genomowego DNA wersja 0616 10 izolacji Nr kat. 995-10 Pojemność kolumny do oczyszczania DNA wynosi 500 µg 1 Skład zestawu Składnik Ilość Temp. Przechowywania Kolumny

Bardziej szczegółowo

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Załącznik nr 1 do SIWZ Nazwa i adres Wykonawcy Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Przedmiot zamówienia; automatyczny system do diagnostyki molekularnej:

Bardziej szczegółowo

PL B1. Urządzenie do badania nieciągłości struktury detali ferromagnetycznych na małej przestrzeni badawczej. POLITECHNIKA LUBELSKA, Lublin, PL

PL B1. Urządzenie do badania nieciągłości struktury detali ferromagnetycznych na małej przestrzeni badawczej. POLITECHNIKA LUBELSKA, Lublin, PL PL 212769 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 212769 (13) B1 (21) Numer zgłoszenia: 381653 (51) Int.Cl. G01N 27/82 (2006.01) G01R 33/12 (2006.01) Urząd Patentowy Rzeczypospolitej

Bardziej szczegółowo

PL 206784 B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA, Kraków, PL 04.04.2005 BUP 07/05. ANDRZEJ KOS, Zielonki, PL 30.09.

PL 206784 B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA, Kraków, PL 04.04.2005 BUP 07/05. ANDRZEJ KOS, Zielonki, PL 30.09. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 206784 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 362329 (22) Data zgłoszenia: 22.09.2003 (51) Int.Cl. A61F 9/08 (2006.01)

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: 19.04.2002, PCT/GB02/01828 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: 19.04.2002, PCT/GB02/01828 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 197715 (21) Numer zgłoszenia: 368077 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 19.04.2002 (86) Data i numer zgłoszenia

Bardziej szczegółowo

Harmonogram wykładów z patofizjologii dla Studentów III roku Wydziału Farmaceutycznego kierunku Farmacja studia stacjonarne

Harmonogram wykładów z patofizjologii dla Studentów III roku Wydziału Farmaceutycznego kierunku Farmacja studia stacjonarne Harmonogram wykładów z patofizjologii dla Studentów III roku Wydziału Farmaceutycznego kierunku Farmacja studia stacjonarne Środa 15.45-17.15, ul. Medyczna 9, sala A Data Temat: Prowadzący: 05.10.16 Omówienie

Bardziej szczegółowo

Czy żywność GMO jest bezpieczna?

Czy żywność GMO jest bezpieczna? Instytut Żywności i Żywienia dr n. med. Lucjan Szponar Czy żywność GMO jest bezpieczna? Warszawa, 21 marca 2005 r. Od ponad połowy ubiegłego wieku, jedną z rozpoznanych tajemnic życia biologicznego wszystkich

Bardziej szczegółowo

PL 214592 B1. POLITECHNIKA CZĘSTOCHOWSKA, Częstochowa, PL 14.03.2011 BUP 06/11

PL 214592 B1. POLITECHNIKA CZĘSTOCHOWSKA, Częstochowa, PL 14.03.2011 BUP 06/11 PL 214592 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214592 (13) B1 (21) Numer zgłoszenia: 388915 (51) Int.Cl. G01B 5/28 (2006.01) G01C 7/04 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

Techniki molekularne w biologii SYLABUS A. Informacje ogólne

Techniki molekularne w biologii SYLABUS A. Informacje ogólne Techniki molekularne w biologii SYLABUS A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod przedmiotu

Bardziej szczegółowo

PL 200888 B1. Sposób dokładnego wykrawania elementów z blach i otworów oraz wykrojnik do realizacji tego sposobu

PL 200888 B1. Sposób dokładnego wykrawania elementów z blach i otworów oraz wykrojnik do realizacji tego sposobu RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 200888 (13) B1 (21) Numer zgłoszenia: 355081 (51) Int.Cl. B21D 28/06 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 17.07.2002

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

SCENARIUSZ LEKCJI. TEMAT LEKCJI: Podstawowe techniki inżynierii genetycznej. Streszczenie

SCENARIUSZ LEKCJI. TEMAT LEKCJI: Podstawowe techniki inżynierii genetycznej. Streszczenie SCENARIUSZ LEKCJI OPRACOWANY W RAMACH PROJEKTU: INFORMATYKA MÓJ SPOSÓB NA POZNANIE I OPISANIE ŚWIATA. PROGRAM NAUCZANIA INFORMATYKI Z ELEMENTAMI PRZEDMIOTÓW MATEMATYCZNO-PRZYRODNICZYCH Autorzy scenariusza:

Bardziej szczegółowo

PL B1. Sposób i układ do modyfikacji widma sygnału ultraszerokopasmowego radia impulsowego. POLITECHNIKA GDAŃSKA, Gdańsk, PL

PL B1. Sposób i układ do modyfikacji widma sygnału ultraszerokopasmowego radia impulsowego. POLITECHNIKA GDAŃSKA, Gdańsk, PL PL 219313 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 219313 (13) B1 (21) Numer zgłoszenia: 391153 (51) Int.Cl. H04B 7/00 (2006.01) H04B 7/005 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

(13) B1 (12) OPIS PATENTOWY (19) PL (11) PL B1. Fig. 2 RZECZPOSPOLITA POLSKA. (21) Numer zgłoszenia:

(13) B1 (12) OPIS PATENTOWY (19) PL (11) PL B1. Fig. 2 RZECZPOSPOLITA POLSKA. (21) Numer zgłoszenia: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 178809 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 308862 (22) Data zgłoszenia: 01.06.1995 (51) IntCl7: F16B7/18 E04F

Bardziej szczegółowo

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku Warszawski Uniwersytet Medyczny Wydział Farmaceutyczny Oddział Analityki Medycznej Justyna Krystyna Ciepły Nr albumu 41624 Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008

Bardziej szczegółowo

PL B1. GALISZ WOJCIECH OBRÓBKA I MONTAŻ URZĄDZEŃ DO CELÓW SPORTOWYCH, Jastrzębie Zdrój, PL BUP 08/11

PL B1. GALISZ WOJCIECH OBRÓBKA I MONTAŻ URZĄDZEŃ DO CELÓW SPORTOWYCH, Jastrzębie Zdrój, PL BUP 08/11 PL 215021 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215021 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 389150 (22) Data zgłoszenia: 30.09.2009 (51) Int.Cl.

Bardziej szczegółowo

PL B1. POLITECHNIKA ŚWIĘTOKRZYSKA, Kielce, PL BUP 13/12. WOJCIECH SADKOWSKI, Kielce, PL KRZYSZTOF LUDWINEK, Kostomłoty, PL

PL B1. POLITECHNIKA ŚWIĘTOKRZYSKA, Kielce, PL BUP 13/12. WOJCIECH SADKOWSKI, Kielce, PL KRZYSZTOF LUDWINEK, Kostomłoty, PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 212854 (13) B1 (21) Numer zgłoszenia: 397384 (51) Int.Cl. F02G 1/043 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 13.12.2011

Bardziej szczegółowo

Ziemniak Polski 2014 nr 3

Ziemniak Polski 2014 nr 3 40 Ziemniak Polski 2014 nr 3 Ochrona TECHNIKA PCR I JEJ MODYFIKACJE W IDENTYFIKACJI PATOGENÓW ZIEMNIAKA mgr inż. Joanna Chołuj, dr inż. Włodzimierz Przewodowski IHAR PIB, Pracownia Diagnostyki Molekularnej

Bardziej szczegółowo

PL B1. POLITECHNIKA LUBELSKA, Lublin, PL BUP 01/12. VIKTOR LOZBIN, Lublin, PL PIOTR BYLICKI, Świdnik, PL

PL B1. POLITECHNIKA LUBELSKA, Lublin, PL BUP 01/12. VIKTOR LOZBIN, Lublin, PL PIOTR BYLICKI, Świdnik, PL PL 218000 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 218000 (13) B1 (21) Numer zgłoszenia: 391573 (51) Int.Cl. G01N 25/56 (2006.01) G01N 25/68 (2006.01) Urząd Patentowy Rzeczypospolitej

Bardziej szczegółowo

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa Nazwa Nazwa w j. ang. Wybrane problemy biologii molekularnej kwasy nukleinowe Selected problems of molecular biology

Bardziej szczegółowo

PL 219521 B1. Układ do justowania osi manipulatora, zwłaszcza do pomiarów akustycznych w komorze bezechowej

PL 219521 B1. Układ do justowania osi manipulatora, zwłaszcza do pomiarów akustycznych w komorze bezechowej RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 219521 (13) B1 (21) Numer zgłoszenia: 391350 (51) Int.Cl. B25J 21/00 (2006.01) B25J 1/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

PL 201347 B1. Politechnika Białostocka,Białystok,PL 29.07.2002 BUP 16/02. Roman Kaczyński,Białystok,PL Marek Jałbrzykowski,Wysokie Mazowieckie,PL

PL 201347 B1. Politechnika Białostocka,Białystok,PL 29.07.2002 BUP 16/02. Roman Kaczyński,Białystok,PL Marek Jałbrzykowski,Wysokie Mazowieckie,PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 201347 (13) B1 (21) Numer zgłoszenia: 351999 (51) Int.Cl. G01N 3/56 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 04.02.2002

Bardziej szczegółowo

PL B1. POLWAX SPÓŁKA AKCYJNA, Jasło, PL BUP 21/12. IZABELA ROBAK, Chorzów, PL GRZEGORZ KUBOSZ, Czechowice-Dziedzice, PL

PL B1. POLWAX SPÓŁKA AKCYJNA, Jasło, PL BUP 21/12. IZABELA ROBAK, Chorzów, PL GRZEGORZ KUBOSZ, Czechowice-Dziedzice, PL PL 214177 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214177 (13) B1 (21) Numer zgłoszenia: 394360 (51) Int.Cl. B22C 1/02 (2006.01) C08L 91/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

ĆWICZENIA Z BIOCHEMII

ĆWICZENIA Z BIOCHEMII ĆWICZENIA Z BIOCHEMII D U STUDENTfiW WYDZIAŁU LEKARSKIEGO Pod redakcją Piotra Laidlera, Barbary Piekarskiej, Marii Wróbel WYDAWNICTWO UNIWERSYTETU JAGIELLOŃSKIEGO ĆWICZENIA Z BIOCHEMII DLA STUDENTÓW WYDZIAŁU

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 180331 (13) B1 PL 180331 B1 H04M 11/00 H04L 12/16 G06F 13/00 RZECZPOSPOLITA POLSKA. (21) Numer zgłoszenia: 315315

(12) OPIS PATENTOWY (19) PL (11) 180331 (13) B1 PL 180331 B1 H04M 11/00 H04L 12/16 G06F 13/00 RZECZPOSPOLITA POLSKA. (21) Numer zgłoszenia: 315315 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 180331 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 315315 (22) Data zgłoszenia: 17.07.1996 (51) IntCl7: H04M 1/64 H04M

Bardziej szczegółowo

AmpliTest TBEV (Real Time PCR)

AmpliTest TBEV (Real Time PCR) AmpliTest TBEV (Real Time PCR) Zestaw do wykrywania sekwencji RNA specyficznych dla TBEV (Tick-borne encephalitis virus) techniką Real Time PCR Nr kat.: RV03-50 Wielkość zestawu: 50 oznaczeń Objętość pojedynczej

Bardziej szczegółowo

PL B1. POLIGRAFIA JANUSZ NOWAK SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Poznań, PL BUP 11/13. MIKOŁAJ NOWAK, Lusowo, PL

PL B1. POLIGRAFIA JANUSZ NOWAK SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Poznań, PL BUP 11/13. MIKOŁAJ NOWAK, Lusowo, PL PL 217632 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217632 (13) B1 (21) Numer zgłoszenia: 397007 (51) Int.Cl. B42C 1/12 (2006.01) B42C 7/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

PL B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA W KRAKOWIE, Kraków, PL BUP 08/13

PL B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA W KRAKOWIE, Kraków, PL BUP 08/13 PL 223497 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 223497 (13) B1 (21) Numer zgłoszenia: 399322 (51) Int.Cl. B23P 17/00 (2006.01) C21D 8/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

Izolowanie i amplifikacja kwasów nukleinowych

Izolowanie i amplifikacja kwasów nukleinowych ROZDZIAŁ 4 Izolowanie i amplifikacja kwasów nukleinowych Wojciech Garczorz Diagnostyka molekularna jest obecnie najszybciej rozwijającym się działem diagnostyki medycznej. W wielu dziedzinach medycyny

Bardziej szczegółowo

Zestaw do oczyszczania DNA po reakcjach enzymatycznych. Nr kat. EM03 Wersja zestawu:

Zestaw do oczyszczania DNA po reakcjach enzymatycznych. Nr kat. EM03 Wersja zestawu: Zestaw do oczyszczania DNA po reakcjach enzymatycznych Nr kat. EM03 Wersja zestawu: 1.2012 I. PRZEZNACZENIE ZESTAWU Zestaw EXTRACTME DNA CLEAN-UP przeznaczony jest do szybkiego i wydajnego oczyszczania

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1968711 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 05.01.2007 07712641.5

Bardziej szczegółowo

PL B1. OSTROWSKI LESZEK, Gdańsk-Wrzeszcz, PL OSTROWSKI STANISŁAW, Gdańsk-Wrzeszcz, PL BUP 26/10

PL B1. OSTROWSKI LESZEK, Gdańsk-Wrzeszcz, PL OSTROWSKI STANISŁAW, Gdańsk-Wrzeszcz, PL BUP 26/10 PL 213042 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 213042 (13) B1 (21) Numer zgłoszenia: 388240 (51) Int.Cl. F02D 15/02 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 173902

(12) OPIS PATENTOWY (19) PL (11) 173902 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 173902 (13) B1 Urząd Patentowy Rzeczypospolite] Polskiej (21) Numer zgłoszenia: 2 9 7 7 1 2 (22) Data zgłoszenia: 12.02.1993 (51) IntCl6: A41H3/00

Bardziej szczegółowo

Ampli-LAMP Salmonella species

Ampli-LAMP Salmonella species Novazym Products Novazym Polska ul. Żywokostowa 23, 61-680 Poznań, tel. +48 0 61 610 39 10, fax +48 0 61 610 39 11, email info@novazym.com Zestaw do identyfikacji materiału genetycznego bakterii z rodzaju

Bardziej szczegółowo

PL 214401 B1. Kontener zawierający co najmniej jeden wzmacniający profil oraz sposób wytwarzania takiego profilu

PL 214401 B1. Kontener zawierający co najmniej jeden wzmacniający profil oraz sposób wytwarzania takiego profilu PL 214401 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214401 (13) B1 (21) Numer zgłoszenia: 378396 (51) Int.Cl. B65F 1/00 (2006.01) B65D 88/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

PL B1. BULGA ZBIGNIEW PRZEDSIĘBIORSTWO BUDOWY PIECÓW, AUTOMATYKI I OCHRONY ŚRODOWISKA SZKŁO-PIEC, Kraków, PL

PL B1. BULGA ZBIGNIEW PRZEDSIĘBIORSTWO BUDOWY PIECÓW, AUTOMATYKI I OCHRONY ŚRODOWISKA SZKŁO-PIEC, Kraków, PL PL 217850 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217850 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 392777 (22) Data zgłoszenia: 28.10.2010 (51) Int.Cl.

Bardziej szczegółowo

PL B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA, Kraków, PL BUP 03/06

PL B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA, Kraków, PL BUP 03/06 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 205845 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 369320 (22) Data zgłoszenia: 28.07.2004 (51) Int.Cl. C25B 1/00 (2006.01)

Bardziej szczegółowo

PL 215770 B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL 23.05.2011 BUP 11/11

PL 215770 B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL 23.05.2011 BUP 11/11 PL 215770 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215770 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 389528 (22) Data zgłoszenia: 10.11.2009 (51) Int.Cl.

Bardziej szczegółowo