PL B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

Wielkość: px
Rozpocząć pokaz od strony:

Download "PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego"

Transkrypt

1 PL B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: (22) Data zgłoszenia: (51) Int.Cl. C12Q 1/68 ( ) C12N 15/00 ( ) C07H 21/04 ( ) (54) Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego (73) Uprawniony z patentu: UNIWERSYTET MEDYCZNY W LUBLINIE, Lublin, PL (43) Zgłoszenie ogłoszono: BUP 03/12 (45) O udzieleniu patentu ogłoszono: WUP 06/14 (72) Twórca(y) wynalazku: RADOSŁAW LESZEK MLAK, Kraśnik, PL PAWEŁ KRAWCZYK, Lublin, PL KAMILA WOJAS-KRAWCZYK, Lublin, PL JUSTYNA EMERYK-MAKSYMIUK, Lublin, PL JANUSZ MILANOWSKI, Lublin, PL (74) Pełnomocnik: rzecz. pat. Anna Bełz

2 2 PL B1 Opis wynalazku Przedmiotem wynalazku jest sposób amplifikacji DNA w multipleks PCR za pomocą mieszaniny starterów specyficznych dla genu receptora β2-adrenergicznego (ADRB2). Sekwencja nukleotydowa oznacza następujące po sobie kolejno (w orientacji 5' 3') zasady azotowe (puryny i pirymidyny) gdzie A oznacza adeninę, T tyminę, G guaninę, C cytozynę. Choroby takie jak: przewlekła obturacyjna choroba płuc (POChP), astma oskrzelowa (AO) czy alergiczny nieżyt nosa (ANN) należą obecnie do najczęściej występujących schorzeń państw uprzemysłowionych. Szacuje się, że liczba nowych zachorowań na POChP kształtuje się na poziomie 10-20% ogółu populacji. Występuje znacznie częściej u osób po 40 roku życia. Gwałtowny wzrost zachorowań na astmę w ostatnich 15 latach spowodował, że w dużych aglomeracjach miejskich ok. 10 procent populacji zgłasza się do lekarza z objawami tej choroby. Czyni to z AO jedną z najczęstszych chorób przewlekłych, z jakimi styka się lekarz pierwszego kontaktu. Niestety badania epidemiologiczne ostatnich lat potwierdzają gwałtowny wzrost zachorowań na wymienione wyżej schorzenia we wszystkich grupach wiekowych. Z farmakogenetycznego i klinicznego punktu widzenia najistotniejsze a zarazem najczęściej występujące są 2 polimorfizmy. Pierwszy z nich dotyczy pozycji aminokwasowej 16 (zamiana Arg/Gly wywołana zmianą w kodonie 16 GGA GGG), drugi pozycji aminokwasowej 27 (zamiana Gln/Glu wywołana zmianą w kodonie 27 GAA CAA). Obecnie coraz większa grupa badaczy wskazuje na możliwą rolę polimorfizmów genu w kształtowaniu się obrazu klinicznego wielu schorzeń układu oddechowego tj. POCHP, AO, ANN jak również w odpowiedzi na stosowane w leczeniu β-mimetyki. Hall i wsp. wykazali istnienie zależności pomiędzy zmniejszoną reaktywnością dróg oddechowych na pochodne choliny (m in. metacholinę) a występowaniem allelu Glu27 w genie ADRB2 u osób chorych na AO. Ramsey i wsp. wykazali ponadto związek pomiędzy występowaniem allelu Arg16 i zwiększoną podatnością na skurcz oskrzeli w przebiegu infekcji dróg oddechowych. Tan i wsp. donieśli o możliwej zależności pomiędzy ekspresją receptora β 2 -adrenergicznego u chorych na AO a obecnością poszczególnych polimorfizmów genu ADRB2. Następstwem czego jest obniżenie wrażliwości na bronchodilację po uprzedniej ekspozycji na β2-sympatykomimetyki. Łańcuchowa reakcja polimerazy (PCR) jest powszechnie znaną, podstawową techniką badawczą i diagnostyczną w biologii molekularnej i medycynie. Umożliwia ona amplifikację wybranego fragmentu DNA, zazwyczaj w celu otrzymania żądanej ilości kopii matrycy. Dzięki technice PCR dysponowanie niewielkimi ilościami DNA nie stanowi obecnie bariery w badaniach w dziedzinie biologii molekularnej oraz w procedurach diagnostycznych opartych na analizie DNA. Znane są również sposoby amplifikacji DNA w łańcuchowej reakcji polimerazy (PCR) za pomocą starterów specyficznych dla genu ADRB2. Znane są również w literaturze patentowej sposoby amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora β2-adrenergicznego. Sposób amplifikacji DNA znany jest m.in. z patentu amerykańskiego US , przy czym sposób opisany w patencie jest kilkuetapowy i kosztowny, gdyż metoda ta wymaga przyłączenia odpowiedniej sondy molekularnej i dopiero po zastosowaniu jej uzyskuje się wynik oznaczenia. Sposób amplifikacji DNA we wspomnianym opisie, jak również w opisie zgłoszenia międzynarodowego WO dotyczy oznaczania ekspresji genu. Zagadnienie allelo specyficznej amplifikacji genu ADRB2 wspomniane było także w zgłoszeniu patentowym US , dotyczącym leczenia jaskry. Z publikacji Ning McLaren et al., ARCH. OPHTHAMOL., 2007, vol.125 Evaluation of the β2- -Adrenergic Receptor Gene as a Candidate Glucoma Gene in 2 Ancestral Populations" znane jest wykorzystanie w reakcji PCR dwóch następujących starterów: starter sensowny F16G dla kodonu 16: 5' GCCTTCTTGCTGGCACCCAATG 3' oraz starter sensowny F16A dla kodonu 16 5' GCCTTCT- TGCTGGCACCCAATA 3'. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą mieszaniny starterów specyficznych dla genu ADRB2 według wynalazku charakteryzuje się tym, że stosuje się łącznie startery posiadające następujące sekwencje nukteotydowe: 1. Starter sensowny F16G dla kodonu 16; 5' GCCTTCTTGCTGGCACCCAATG 3', 2. Starter sensowny F16A dla kodonu 16; 5' GCCTTCTTGCTGGCACCCAATA 3', 3. Starter sensowny F27G dla kodonu 27; 5' GACCACGACGTCACGCAGG 3' 4. Starter sensowny F27C dla kodonu 27; 5' GACCACGACGTCACGCAGC 3'

3 PL B Starter antysensowny R16; 27 (wspólny dla kodonów 16 i 27) 5' AGGCCCATGACCAGATCAGCA 3' Dzięki korzystaniu ze sposobu według wynalazku możliwe jest stosunkowo proste i wydajne otrzymywanie kopii matryc DNA zawierających miejsca przyłączania specyficznych (dla fragmentu genu ADRB2) starterów. Stosowana w sposobie według wynalazku mieszanina starterów może być wykorzystywana, ze względu na swoją efektywność w reakcji PCR jako narzędzie służące do zamplifikowania fragmentów genu czy cdna ADRB2. Przykładem takich zastosowań może być oznaczanie polimorfizmu genu metodą multipleksowego allelospecyficznego PCR, otrzymywanie dużych ilości kopii DNA do sekwencjonowania czy innych analiz, uzyskiwania odcinków DNA mogących służyć jako sondy w metodach hybrydyzacyjnych. Celem uproszczenia w opisie i przykładzie używane są następujące skróty: A - adenina ADRB2 - gen dla receptora β2 adrenergicznego ANN - alergiczny nieżyt nosa AO - astma oskrzelowa C - cytozyna cdna - DNA komplementarne do RNA DNA - kwas dezoksyrybonukleinowy G - guanina mrna - matrycowy RNA PCR - łańcuchowa reakcja polimerazy PCR multipleks - metoda umożliwiająca amplifikację wielu SNP lub genów podczas jednej reakcji POCHP - przewlekła obturacyjna choroba płuc p.z. - par zasad RNA - kwas rybonukleinowy SNP - polimorfizm pojedynczego nukleotydu T - tymina Wynalazek wyjaśniony jest bliżej w przykładzie, który jednak nie ogranicza jego zakresu. P r z y k ł a d 1. Allelospecyficzna Reakcja multipleks PCR z wykorzystaniem unikalnej mieszaniny starterów do amplifikacji specyficznych regionów DNA wykorzystywanych w oznaczaniu SNP w kodonach 16 i 27 genu ADRB2. W celu przeprowadzenia reakcji niezbędne są: 1) Wyizolowany z krwi lub innego materiału biologicznego DNA. 2) Unikalna mieszanina reakcyjna zawierająca wymienione wyżej startery oraz inne odczynniki chemiczne w odpowiednich proporcjach. 3) Termocykler z możliwością ustawienia optymalnych warunków termicznych. Allelospecyficzną reakcję multipleks PCR w wariancie do oznaczania SNP w kodonach 16 i 27 genu dla ADRB2 według wynalazku prowadzono przy użyciu opisanych wyżej 5 starterów. W opisywanym wynalazku oznaczono 2 polimorfizmy. W probówce PCR 200 μι przygotowano odpowiednią mieszaninę reakcyjną o objętości 25 ul dodając kolejno: bufor Taq (z dodatkiem KCI/ bez MgCl 2 ), mieszaninę nukleotydów (dntp mix), roztwór MgCl 2, termostabilną polimerazę Taq DNA oraz startery: sensowne (F27G, F27C), antysensowny (R27), wyizolowane DNA, w proporcjach podanych w tabeli 1. Następnie przeniesiono mieszaninę do termocyklera i ustawiono program składający się z 6 etapów: wstępnej denaturacji DNA, denaturacji właściwej, przyłączania starterów, wydłużania produktu PCR, końcowego wydłużania produktu PCR, chłodzenia próbki. Reakcja prowadzona jest cyklicznie od etapu właściwej denaturacji do etapu wydłużania produktu PCR 33 razy w warunkach temperaturowych podanych w tabeli 2. Po zakończeniu reakcji otrzymane produkty PCR (kodon 16G/A: 227pz; kodon 27G/C: 194pz) rozdzielono elektroforetycznie w 2% żelu agarozowym. W przypadku obecności danych alleli na elektroforegramie pojawią się prążki o odpowiedniej długości ocenianej względem markera wielkości. Przykładowy rozdział elektroforetyczny produktów allelospecyficznej reakcji PCR multipleks powstałych przy użyciu zaprojektowanych starterów przedstawia rycina 1. W załączonej tabeli 1 przedstawiono proporcje odczynników stosowanych podczas oznaczania polimorfizmów genu ADRB2 w reakcji multipleks PCR, zaś w tabeli 2 warunki temperaturowe prowadzenia reakcji multipleks PCR w wariancie służącym do oznaczania polimorfizmów genu ADRB2.

4 4 PL B1 T a b e l a 1. Proporcje odczynników stosowanych podczas oznaczania polimorfizmów genu ADRB2 w reakcji multipleks PCR. Bufor Taq (10x) Skład mieszaniny reakcyjnej (stężenie) Mieszanina nukleotydów (2 mmol/μl) Jony Mg 2+ (25 mmol/μι) Polimeraza Taq DNA (5U/μl) Starter F16G lub F16A (100 pmol/μι) Starter F27G lub F27C (100 pmol/μι) Starter R16;27 (100 pmol/μι) Woda wolna od nukleaz DNA ( ng/μι) Suma Ilość 3 μι 3 μι 3,6 μι 0,14 μι 0,8 μι 0,8 μl 1,6 μι 10 μι 2,06 μι 25 μι T a b e l a 2. Warunki temperaturowe prowadzenia reakcji multipleks PCR w wariancie przystosowanym do oznaczania polimorfizmów genu ADRB2. (Etapy prowadzone cyklicznie wyróżniono pogrubioną czcionką). Etap Temp. Czas 1. Wstępna denaturacja DNA 96 C 8 min. 2. Właściwa denaturacja DNA 96 C 30 sek. 3. Przyłączanie starterów 60 C 30 sek. 4. Wydłużanie produktu PCR 72 C 45 sek. 5. Końcowe wydłużanie produktu PCR 72 C 12 min. 6. Chłodzenie próbki 4 C Rycina 1. Przykładowy rozdział elektroforetyczny produktów reakcji PCR powstałych przy użyciu zaprojektowanych starterów.

5 PL B1 5 Zastrzeżenie patentowe Sposób amplifikacji DNA w multipleksowej łańcuchowej reakcji polimerazy za pomocą mieszaniny starterów specyficznych dla genu receptora β2 adrenergicznego, znamienny tym, że stosuje się łącznie startery posiadające następujące sekwencje nukleotydowe: 1. Starter sensowny F16G dla kodonu 16; 5' GCCTTCTTGCTGGCACCCAATG 3', 2. Starter sensowny F16A dla kodonu 16; 5' GCCTTCTTGCTGGCACCCAATA 3', 3. Starter sensowny F27G dla kodonu 27; 5' GACCACGACGTCACGCAGG 3' 4. Starter sensowny F27C dla kodonu 27; 5' GACCACGACGTCACGCAGC 3' 5. Starter antysensowny R16;27 (wspólny dla kodonów 16 i 27) 5' AGGCCCATGACCAGATCAGCA 3

6 6 PL B1 Departament Wydawnictw UPRP Cena 2,46 zł (w tym 23% VAT)

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu Protokół pochodzi ze strony molekularnie.wordpress.com Kopiowanie i rozpowszechnianie wyłącznie w całości, z zachowaniem praw autorskich zgodnie z zasadami licencji GNU Dziękuję za uszanowanie mojej pracy,

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208956 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 381219 (22) Data zgłoszenia: 05.12.2006 (51) Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7.2. Metody biologii molekularnej (technika PCR, sekwencjonowanie DNA) wykorzystywane w taksonomii roślin Autor: Magdalena Dudek

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość*

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość* Poznao, 6 lutego 2012 r. Zapytanie ofertowe nr 001 /2012 dotyczące zakupu odczynników chemicznych do izolacji DNA i reakcji PCR GENESIS Polska Sp. z o.o Ul. Za Cytadelą 19, 61-659 Poznao NIP 778 13 56

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu DNA) Jest to reakcja powielania (replikacji)

Bardziej szczegółowo

Biochemia: Ćw. 11 Metoda RT-PCR

Biochemia: Ćw. 11 Metoda RT-PCR Ćwiczenie 11 METODA RT-PCR Wyciąg z kart charakterystyki substancji niebezpiecznych: bromek etydyny T+ EDTA Xi etanol, 96% F kwas octowy, 96% C -merkaptoetanol N, T Tris Xi UWAGI WSTĘPNE Praca z kwasami

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

Przykładowe zadania. przygotowujące do egzaminu maturalnego

Przykładowe zadania. przygotowujące do egzaminu maturalnego Przykładowe zadania z BIOLOGii przygotowujące do egzaminu maturalnego Prezentowane zadania są zgodne z podstawą programową kształcenia ogólnego w zakresie rozszerzonym i podstawowym. Prócz zadań, które

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA.

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SPIS TREŚCI: 1. Wprowadzenie. 2. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. 3. Karty pracy. 1. Karta

Bardziej szczegółowo

PL 213904 B1. Elektrolityczna, nanostrukturalna powłoka kompozytowa o małym współczynniku tarcia, zużyciu ściernym i korozji

PL 213904 B1. Elektrolityczna, nanostrukturalna powłoka kompozytowa o małym współczynniku tarcia, zużyciu ściernym i korozji PL 213904 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 213904 (13) B1 (21) Numer zgłoszenia: 390004 (51) Int.Cl. C25D 3/12 (2006.01) C25D 15/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo

Choroby układu oddechowego wśród mieszkańców powiatu ostrołęckiego

Choroby układu oddechowego wśród mieszkańców powiatu ostrołęckiego Choroby układu oddechowego wśród mieszkańców powiatu ostrołęckiego Podczas akcji przebadano 4400 osób. Na badania rozszerzone skierowano ok. 950 osób. Do tej pory przebadano prawie 600 osób. W wyniku pogłębionych

Bardziej szczegółowo

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ

ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ www.cytogen.com.pl ODCZYNNIKI DO BIOLOGII MOLEKULARNEJ 3 Spis treści 4 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 22 22 Stabilność technologii TAG Specifikacja qpcr Mix-ów Kompatybilność kitów qpcr

Bardziej szczegółowo

PL 215396 B1. Urządzenie do wymuszonego chłodzenia łożysk, zwłaszcza poziomej pompy do hydrotransportu ciężkiego

PL 215396 B1. Urządzenie do wymuszonego chłodzenia łożysk, zwłaszcza poziomej pompy do hydrotransportu ciężkiego PL 215396 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215396 (13) B1 (21) Numer zgłoszenia: 389424 (51) Int.Cl. F16C 37/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

PL 218203 B1. R&D PROJECT SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Łódź, PL 17.12.2012 BUP 26/12

PL 218203 B1. R&D PROJECT SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Łódź, PL 17.12.2012 BUP 26/12 PL 218203 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 218203 (13) B1 (21) Numer zgłoszenia: 395134 (51) Int.Cl. B23B 3/16 (2006.01) B23B 3/18 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

... ...J CD CD. N "f"'" Sposób i filtr do usuwania amoniaku z powietrza. POLITECHNIKA LUBELSKA, Lublin, PL 09.11.2009 BUP 23/09

... ...J CD CD. N f' Sposób i filtr do usuwania amoniaku z powietrza. POLITECHNIKA LUBELSKA, Lublin, PL 09.11.2009 BUP 23/09 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19)PL (11)212766 (13) 81 (21) Numer zgłoszenia 385072 (51) Int.CI 801D 53/04 (2006.01) C01C 1/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie Sekwencyjność występowania zaburzeń molekularnych w niedrobnokomórkowym raku płuca

Bardziej szczegółowo

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO Ćwiczenie numer 6 Analiza próbek spożywczych na obecność markerów GMO 1. Informacje wstępne -screening GMO -metoda CTAB -qpcr 2. Izolacja DNA z soi metodą CTAB 3. Oznaczenie ilościowe i jakościowe DNA

Bardziej szczegółowo

AmpliTest Salmonella spp. (Real Time PCR)

AmpliTest Salmonella spp. (Real Time PCR) AmpliTest Salmonella spp. (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzaju Salmonella techniką Real Time PCR Nr kat.: BAC01-50 Wielkość zestawu: 50 oznaczeń Objętość

Bardziej szczegółowo

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS Nowiny Lekarskie 2006, 75, 5, 486 490 ALINA LICZBAŃSKA, ANNA WOŹNIAK, ANNA WAWROCKA, MACIEJ R. KRAWCZYŃSKI TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR

Bardziej szczegółowo

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier.

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier. ID Testu: F5679R8 Imię i nazwisko ucznia Klasa Data 1. Na indywidualne cechy danego osobnika ma (maja) wpływ A. wyłacznie czynniki środowiskowe. B. czynniki środowiskowe i materiał genetyczny. C. wyłacznie

Bardziej szczegółowo

PL 198188 B1. Instytut Chemii Przemysłowej im.prof.ignacego Mościckiego,Warszawa,PL 03.04.2006 BUP 07/06

PL 198188 B1. Instytut Chemii Przemysłowej im.prof.ignacego Mościckiego,Warszawa,PL 03.04.2006 BUP 07/06 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 198188 (13) B1 (21) Numer zgłoszenia: 370289 (51) Int.Cl. C01B 33/00 (2006.01) C01B 33/18 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

PL 206784 B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA, Kraków, PL 04.04.2005 BUP 07/05. ANDRZEJ KOS, Zielonki, PL 30.09.

PL 206784 B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA, Kraków, PL 04.04.2005 BUP 07/05. ANDRZEJ KOS, Zielonki, PL 30.09. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 206784 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 362329 (22) Data zgłoszenia: 22.09.2003 (51) Int.Cl. A61F 9/08 (2006.01)

Bardziej szczegółowo

Warunki udzielania świadczeń w rodzaju: świadczenia zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE

Warunki udzielania świadczeń w rodzaju: świadczenia zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE Załącznik nr do Zarządzenia.. Warunki udzielania świadczeń w rodzaju: zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE 8.1 WARUNKI WYMAGANE Załącznik nr 2 do rozporządzenia cz. I lit. M Lp 913-916

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: 19.04.2002, PCT/GB02/01828 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: 19.04.2002, PCT/GB02/01828 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 197715 (21) Numer zgłoszenia: 368077 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 19.04.2002 (86) Data i numer zgłoszenia

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

SCENARIUSZ LEKCJI. TEMAT LEKCJI: Podstawowe techniki inżynierii genetycznej. Streszczenie

SCENARIUSZ LEKCJI. TEMAT LEKCJI: Podstawowe techniki inżynierii genetycznej. Streszczenie SCENARIUSZ LEKCJI OPRACOWANY W RAMACH PROJEKTU: INFORMATYKA MÓJ SPOSÓB NA POZNANIE I OPISANIE ŚWIATA. PROGRAM NAUCZANIA INFORMATYKI Z ELEMENTAMI PRZEDMIOTÓW MATEMATYCZNO-PRZYRODNICZYCH Autorzy scenariusza:

Bardziej szczegółowo

PL 214592 B1. POLITECHNIKA CZĘSTOCHOWSKA, Częstochowa, PL 14.03.2011 BUP 06/11

PL 214592 B1. POLITECHNIKA CZĘSTOCHOWSKA, Częstochowa, PL 14.03.2011 BUP 06/11 PL 214592 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214592 (13) B1 (21) Numer zgłoszenia: 388915 (51) Int.Cl. G01B 5/28 (2006.01) G01C 7/04 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Załącznik nr 1 do SIWZ Nazwa i adres Wykonawcy Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Przedmiot zamówienia; automatyczny system do diagnostyki molekularnej:

Bardziej szczegółowo

PL 214401 B1. Kontener zawierający co najmniej jeden wzmacniający profil oraz sposób wytwarzania takiego profilu

PL 214401 B1. Kontener zawierający co najmniej jeden wzmacniający profil oraz sposób wytwarzania takiego profilu PL 214401 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214401 (13) B1 (21) Numer zgłoszenia: 378396 (51) Int.Cl. B65F 1/00 (2006.01) B65D 88/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

PL 200888 B1. Sposób dokładnego wykrawania elementów z blach i otworów oraz wykrojnik do realizacji tego sposobu

PL 200888 B1. Sposób dokładnego wykrawania elementów z blach i otworów oraz wykrojnik do realizacji tego sposobu RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 200888 (13) B1 (21) Numer zgłoszenia: 355081 (51) Int.Cl. B21D 28/06 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 17.07.2002

Bardziej szczegółowo

PL 215770 B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL 23.05.2011 BUP 11/11

PL 215770 B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL 23.05.2011 BUP 11/11 PL 215770 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215770 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 389528 (22) Data zgłoszenia: 10.11.2009 (51) Int.Cl.

Bardziej szczegółowo

Ziemniak Polski 2014 nr 3

Ziemniak Polski 2014 nr 3 40 Ziemniak Polski 2014 nr 3 Ochrona TECHNIKA PCR I JEJ MODYFIKACJE W IDENTYFIKACJI PATOGENÓW ZIEMNIAKA mgr inż. Joanna Chołuj, dr inż. Włodzimierz Przewodowski IHAR PIB, Pracownia Diagnostyki Molekularnej

Bardziej szczegółowo

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa Nazwa Nazwa w j. ang. Wybrane problemy biologii molekularnej kwasy nukleinowe Selected problems of molecular biology

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 180331 (13) B1 PL 180331 B1 H04M 11/00 H04L 12/16 G06F 13/00 RZECZPOSPOLITA POLSKA. (21) Numer zgłoszenia: 315315

(12) OPIS PATENTOWY (19) PL (11) 180331 (13) B1 PL 180331 B1 H04M 11/00 H04L 12/16 G06F 13/00 RZECZPOSPOLITA POLSKA. (21) Numer zgłoszenia: 315315 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 180331 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 315315 (22) Data zgłoszenia: 17.07.1996 (51) IntCl7: H04M 1/64 H04M

Bardziej szczegółowo

Izolowanie i amplifikacja kwasów nukleinowych

Izolowanie i amplifikacja kwasów nukleinowych ROZDZIAŁ 4 Izolowanie i amplifikacja kwasów nukleinowych Wojciech Garczorz Diagnostyka molekularna jest obecnie najszybciej rozwijającym się działem diagnostyki medycznej. W wielu dziedzinach medycyny

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

ĆWICZENIA Z BIOCHEMII

ĆWICZENIA Z BIOCHEMII ĆWICZENIA Z BIOCHEMII D U STUDENTfiW WYDZIAŁU LEKARSKIEGO Pod redakcją Piotra Laidlera, Barbary Piekarskiej, Marii Wróbel WYDAWNICTWO UNIWERSYTETU JAGIELLOŃSKIEGO ĆWICZENIA Z BIOCHEMII DLA STUDENTÓW WYDZIAŁU

Bardziej szczegółowo

PL 201347 B1. Politechnika Białostocka,Białystok,PL 29.07.2002 BUP 16/02. Roman Kaczyński,Białystok,PL Marek Jałbrzykowski,Wysokie Mazowieckie,PL

PL 201347 B1. Politechnika Białostocka,Białystok,PL 29.07.2002 BUP 16/02. Roman Kaczyński,Białystok,PL Marek Jałbrzykowski,Wysokie Mazowieckie,PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 201347 (13) B1 (21) Numer zgłoszenia: 351999 (51) Int.Cl. G01N 3/56 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 04.02.2002

Bardziej szczegółowo

Ampli-LAMP Salmonella species

Ampli-LAMP Salmonella species Novazym Products Novazym Polska ul. Żywokostowa 23, 61-680 Poznań, tel. +48 0 61 610 39 10, fax +48 0 61 610 39 11, email info@novazym.com Zestaw do identyfikacji materiału genetycznego bakterii z rodzaju

Bardziej szczegółowo

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku Warszawski Uniwersytet Medyczny Wydział Farmaceutyczny Oddział Analityki Medycznej Justyna Krystyna Ciepły Nr albumu 41624 Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008

Bardziej szczegółowo

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System

Parametr Wymagany parametr Oferowany parametr 1. 2. 3. a) z wbudowaną pompą membranową PTEE, b) kondensorem par, System Załącznik nr 1A do SIWZ. PARAMETRY TECHNICZNE PRZEDMIOTU ZAMÓWIENIA Zadanie nr 1. TERMOSTAT CYRKULACYJNY Termostat cyrkulacyjny Z grzaniem i chłodzeniem Zakres temperatury roboczej 25 o C do + 200 o C

Bardziej szczegółowo

PL 216311 B1. Sposób kształtowania plastycznego uzębień wewnętrznych kół zębatych metodą walcowania poprzecznego. POLITECHNIKA LUBELSKA, Lublin, PL

PL 216311 B1. Sposób kształtowania plastycznego uzębień wewnętrznych kół zębatych metodą walcowania poprzecznego. POLITECHNIKA LUBELSKA, Lublin, PL PL 216311 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 216311 (13) B1 (21) Numer zgłoszenia: 392273 (51) Int.Cl. B23P 15/14 (2006.01) B21D 53/28 (2006.01) Urząd Patentowy Rzeczypospolitej

Bardziej szczegółowo

VI.2 Podsumowanie planu zarządzania ryzykiem dotyczącego produktu leczniczego Omnisolvan przeznaczone do publicznej wiadomości

VI.2 Podsumowanie planu zarządzania ryzykiem dotyczącego produktu leczniczego Omnisolvan przeznaczone do publicznej wiadomości VI.2 Podsumowanie planu zarządzania ryzykiem dotyczącego produktu leczniczego Omnisolvan przeznaczone do publicznej wiadomości VI.2.1 Omówienie rozpowszechnienia choroby Nadmierne wydzielanie śluzu w drogach

Bardziej szczegółowo

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy PIWet Zakład Chorób Ryb Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy łososiowatych o (VHS), wirusa zakaźnej a martwicy układu krwiotwórczego (IHN)

Bardziej szczegółowo

Część I Zakup zestawów diagnostycznych do GMO.

Część I Zakup zestawów diagnostycznych do GMO. Załącznik 4a Część I Zakup zestawów diagnostycznych do GMO. NAZWA WIELKOŚC OPAKOWANIA JEDNOSTK OWA VAT % RAZEM WARTOŚĆ 1 2 3 4 5 6 7 8=4*7 9 10 11 1. Zestaw do izolacji DNA - zestaw służący do izolacji

Bardziej szczegółowo

PL 203790 B1. Uniwersytet Śląski w Katowicach,Katowice,PL 03.10.2005 BUP 20/05. Andrzej Posmyk,Katowice,PL 30.11.2009 WUP 11/09 RZECZPOSPOLITA POLSKA

PL 203790 B1. Uniwersytet Śląski w Katowicach,Katowice,PL 03.10.2005 BUP 20/05. Andrzej Posmyk,Katowice,PL 30.11.2009 WUP 11/09 RZECZPOSPOLITA POLSKA RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 203790 (13) B1 (21) Numer zgłoszenia: 366689 (51) Int.Cl. C25D 5/18 (2006.01) C25D 11/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

PL 219521 B1. Układ do justowania osi manipulatora, zwłaszcza do pomiarów akustycznych w komorze bezechowej

PL 219521 B1. Układ do justowania osi manipulatora, zwłaszcza do pomiarów akustycznych w komorze bezechowej RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 219521 (13) B1 (21) Numer zgłoszenia: 391350 (51) Int.Cl. B25J 21/00 (2006.01) B25J 1/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1505553. (96) Data i numer zgłoszenia patentu europejskiego: 05.08.2004 04018511.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1505553. (96) Data i numer zgłoszenia patentu europejskiego: 05.08.2004 04018511. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 3 (96) Data i numer zgłoszenia patentu europejskiego: 0.08.04 0401811.8 (13) (1) T3 Int.Cl. G08C 17/00 (06.01) Urząd Patentowy

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1747298 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547.7 (51) Int. Cl. C22C14/00 (2006.01)

Bardziej szczegółowo

PL 175488 B1 (12) OPIS PATENTOWY (19) PL (11) 175488 (13) B1. (22) Data zgłoszenia: 08.12.1994

PL 175488 B1 (12) OPIS PATENTOWY (19) PL (11) 175488 (13) B1. (22) Data zgłoszenia: 08.12.1994 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 175488 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 306167 (22) Data zgłoszenia: 08.12.1994 (51) IntCl6: G01K 13/00 G01C

Bardziej szczegółowo

(12) OPIS PATENTOWY (19)PL (11)182858

(12) OPIS PATENTOWY (19)PL (11)182858 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19)PL (11)182858 (21) Numer zgłoszenia. 319132 Urząd Patentowy zgłoszenia. 2 0.0 3.1 9 9 7 Rzeczypospolitej Polskiej (51) IntCl7 B62K 5/02 (54) Rower trójkołowy

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 173902

(12) OPIS PATENTOWY (19) PL (11) 173902 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 173902 (13) B1 Urząd Patentowy Rzeczypospolite] Polskiej (21) Numer zgłoszenia: 2 9 7 7 1 2 (22) Data zgłoszenia: 12.02.1993 (51) IntCl6: A41H3/00

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

PL 216136 B1. ŁAZUR ZBIGNIEW, Lublin, PL 27.09.2010 BUP 20/10. ZBIGNIEW ŁAZUR, Lublin, PL 31.03.2014 WUP 03/14 RZECZPOSPOLITA POLSKA

PL 216136 B1. ŁAZUR ZBIGNIEW, Lublin, PL 27.09.2010 BUP 20/10. ZBIGNIEW ŁAZUR, Lublin, PL 31.03.2014 WUP 03/14 RZECZPOSPOLITA POLSKA PL 216136 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 216136 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 387552 (22) Data zgłoszenia: 19.03.2009 (51) Int.Cl.

Bardziej szczegółowo

PL 215277 B1. MAŁKOWSKI ZENON, Wiry, PL 26.09.2011 BUP 20/11. ZENON MAŁKOWSKI, Wiry, PL 29.11.2013 WUP 11/13. rzecz. pat. Antoni Cieszkowski

PL 215277 B1. MAŁKOWSKI ZENON, Wiry, PL 26.09.2011 BUP 20/11. ZENON MAŁKOWSKI, Wiry, PL 29.11.2013 WUP 11/13. rzecz. pat. Antoni Cieszkowski PL 215277 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215277 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 390713 (22) Data zgłoszenia: 15.03.2010 (51) Int.Cl.

Bardziej szczegółowo

AmpliTest TBEV (Real Time PCR)

AmpliTest TBEV (Real Time PCR) AmpliTest TBEV (Real Time PCR) Zestaw do wykrywania sekwencji RNA specyficznych dla TBEV (Tick-borne encephalitis virus) techniką Real Time PCR Nr kat.: RV03-50 Wielkość zestawu: 50 oznaczeń Objętość pojedynczej

Bardziej szczegółowo

PL 212748 B1. GDAŃSKI UNIWERSYTET MEDYCZNY, Gdańsk, PL SKRZYPSKI MARCIN, Sopot, PL JASSEM JACEK, Gdańsk, PL 31.01.2011 BUP 03/11 30.11.

PL 212748 B1. GDAŃSKI UNIWERSYTET MEDYCZNY, Gdańsk, PL SKRZYPSKI MARCIN, Sopot, PL JASSEM JACEK, Gdańsk, PL 31.01.2011 BUP 03/11 30.11. PL 212748 B1 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 212748 (21) Numer zgłoszenia: 388681 (22) Data zgłoszenia: 30.07.2009 (13) B1 (51) Int.Cl.

Bardziej szczegółowo

Zadanie 19. Wyposażenie stanowiska do namnażania fragmentów DNA w czasie rzeczywistym

Zadanie 19. Wyposażenie stanowiska do namnażania fragmentów DNA w czasie rzeczywistym Zadanie 19. Wyposażenie stanowiska do namnażania fragmentów DNA w czasie rzeczywistym Termin realizacji 12 tygodni od daty podpisania (zawarcia) umowy. Koszty transportu, instalacji oraz instruktażu, trwającego

Bardziej szczegółowo

(13) B1 (12) OPIS PATENTOWY (19) PL (11) 183565 PL 183565 B1. (54) Mechanizm przekładni w maszynie do ćwiczeń z obciążeniem narządów ruchu

(13) B1 (12) OPIS PATENTOWY (19) PL (11) 183565 PL 183565 B1. (54) Mechanizm przekładni w maszynie do ćwiczeń z obciążeniem narządów ruchu RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 183565 (13) B1 (21) Numer zgłoszenia: 3 1 9 9 1 6 (22) Data zgłoszenia: 09.05.1997 (5 1) IntCl7: A63B 21/06

Bardziej szczegółowo

PL 215409 B3. BORCZYK MONIKA, Bielsko-Biała, PL 22.06.2009 BUP 13/09. MONIKA BORCZYK, Bielsko-Biała, PL 31.12.2013 WUP 12/13 RZECZPOSPOLITA POLSKA

PL 215409 B3. BORCZYK MONIKA, Bielsko-Biała, PL 22.06.2009 BUP 13/09. MONIKA BORCZYK, Bielsko-Biała, PL 31.12.2013 WUP 12/13 RZECZPOSPOLITA POLSKA PL 215409 B3 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 215409 (21) Numer zgłoszenia: 384078 (22) Data zgłoszenia: 17.12.2007 (61) Patent dodatkowy

Bardziej szczegółowo

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym mgr Magdalena Brzeskwiniewicz Promotor: Prof. dr hab. n. med. Janusz Limon Katedra i Zakład Biologii i Genetyki Gdański Uniwersytet Medyczny

Bardziej szczegółowo

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Praca wykonana pod kierunkiem dr hab. Tomasza Grzybowskiego w Katedrze Medycyny Sądowej w Zakładzie Genetyki Molekularnej

Bardziej szczegółowo

Część I Zakup zestawów diagnostycznych do GMO.

Część I Zakup zestawów diagnostycznych do GMO. Załącznik 4a Część I Zakup zestawów diagnostycznych do GMO. NAZWA WIELKOŚC OPAKNIA RAZEM WARTOŚĆ 1 2 3 4 5 6 7 8=4*7 9 10 11 1. Zestaw do izolacji DNA - zestaw służący do izolacji DNA z surowego materiału

Bardziej szczegółowo

PL 218226 B1. Programator do sprzętu AGD, zwłaszcza do kuchni domowych wolnostojących i do wbudowania. AMICA WRONKI SPÓŁKA AKCYJNA, Wronki, PL

PL 218226 B1. Programator do sprzętu AGD, zwłaszcza do kuchni domowych wolnostojących i do wbudowania. AMICA WRONKI SPÓŁKA AKCYJNA, Wronki, PL PL 218226 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 218226 (13) B1 (21) Numer zgłoszenia: 389418 (51) Int.Cl. F24C 7/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH

DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH Detekcja enterowirusów Detekcja sześciu typów ludzkich herpeswirusów (HHV) Detekcja pięciu bakterii Seeplex Detekcja patogenów powodujących

Bardziej szczegółowo

PL 218025 B1. POLITECHNIKA POZNAŃSKA, Poznań, PL 19.12.2011 BUP 26/11. JULIUSZ PERNAK, Poznań, PL BEATA CZARNECKA, Poznań, PL ANNA PERNAK, Poznań, PL

PL 218025 B1. POLITECHNIKA POZNAŃSKA, Poznań, PL 19.12.2011 BUP 26/11. JULIUSZ PERNAK, Poznań, PL BEATA CZARNECKA, Poznań, PL ANNA PERNAK, Poznań, PL PL 218025 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 218025 (13) B1 (21) Numer zgłoszenia: 391493 (51) Int.Cl. A61K 6/027 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

(21) Numer zgłoszenia 393543 (51) Int.CI B29C 49/68 (2006.01)

(21) Numer zgłoszenia 393543 (51) Int.CI B29C 49/68 (2006.01) RZECZPSPLITA PLSKA (12) PIS PATENTWY (19) PL (11) 217378 (13) 81 (21) Numer zgłoszenia 393543 (51) Int.CI B29C 49/68 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia 31.12.2010

Bardziej szczegółowo

PL 204536 B1. Szczepanik Marian,Kraków,PL Selmaj Krzysztof,Łódź,PL 29.12.2003 BUP 26/03 29.01.2010 WUP 01/10

PL 204536 B1. Szczepanik Marian,Kraków,PL Selmaj Krzysztof,Łódź,PL 29.12.2003 BUP 26/03 29.01.2010 WUP 01/10 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 204536 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 354698 (22) Data zgłoszenia: 24.06.2002 (51) Int.Cl. A61K 38/38 (2006.01)

Bardziej szczegółowo

PL 207433 B1. PRZEMYSŁOWY INSTYTUT AUTOMATYKI I POMIARÓW PIAP, Warszawa, PL 26.06.2006 BUP 13/06. ZBIGNIEW BORKOWICZ, Wrocław, PL 31.12.

PL 207433 B1. PRZEMYSŁOWY INSTYTUT AUTOMATYKI I POMIARÓW PIAP, Warszawa, PL 26.06.2006 BUP 13/06. ZBIGNIEW BORKOWICZ, Wrocław, PL 31.12. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 207433 (13) B1 (21) Numer zgłoszenia: 371716 (51) Int.Cl. G01N 27/82 (2006.01) B25J 15/06 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

(12) OPIS PATENTOWY (19)PL (11)190412 (13) B1 PL 190412 B1 B65G 57/28 B65H 29/38 B65B 35/22 RZECZPOSPOLITA POLSKA. (21 ) Numer zgłoszenia: 336192

(12) OPIS PATENTOWY (19)PL (11)190412 (13) B1 PL 190412 B1 B65G 57/28 B65H 29/38 B65B 35/22 RZECZPOSPOLITA POLSKA. (21 ) Numer zgłoszenia: 336192 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19)PL (11)190412 (21 ) Numer zgłoszenia: 336192 (22) Data zgłoszenia: 2 3.10.1999 (13) B1 (51) IntCl7 B65G 57/28 B65H

Bardziej szczegółowo

(54) Urządzenie do chłodzenia układu półprzewodnikowego typu tranzystor bipolarny

(54) Urządzenie do chłodzenia układu półprzewodnikowego typu tranzystor bipolarny RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 185195 (13) B1 (21 ) Numer zgłoszenia: 323229 (22) Data zgłoszenia: 19.11.1997 (51 ) IntCl7: H01L 23/473

Bardziej szczegółowo

MAXimus. Ul. Wita Stwosza 4. 71-173 Szczecin. tel: 071-718-18-96. fax: 071-718-18-97. biuro@kriokomora.com. www.kriokomora.com

MAXimus. Ul. Wita Stwosza 4. 71-173 Szczecin. tel: 071-718-18-96. fax: 071-718-18-97. biuro@kriokomora.com. www.kriokomora.com MAXimus Ul. Wita Stwosza 4 71-173 Szczecin tel: 071-718-18-96 fax: 071-718-18-97 biuro@kriokomora.com www.kriokomora.com 1434 MAXimus s.c., Wita Stwosza 4, 71-173 Szczecin STANOWISKO DO INHALACJI MAGIC

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 20.07.2007 07787764.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 20.07.2007 07787764. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 4698 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:.07.07 07787764. (1) Int. Cl. C12Q1/68 (06.01) (97) O udzieleniu

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 08.09.2005 05789871.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 08.09.2005 05789871. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1791422 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 08.09.2005 05789871.0 (51) Int. Cl. A01N1/02 (2006.01)

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: 09.08.2001, PCT/DE01/02954 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: 09.08.2001, PCT/DE01/02954 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 199888 (21) Numer zgłoszenia: 360082 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 09.08.2001 (86) Data i numer zgłoszenia

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: 25.04.2002, PCT/EP02/04612 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: 25.04.2002, PCT/EP02/04612 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 203740 (21) Numer zgłoszenia: 371431 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 25.04.2002 (86) Data i numer zgłoszenia

Bardziej szczegółowo

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7 Poznań, dnia 28.04.2014 r. BioVentures Institute Spółka z ograniczoną odpowiedzialnością ul. Promienista 83 60 141 Poznań Zapytanie ofertowe nr 01/2014 Projekt Nowa technologia wytwarzania szczepionek

Bardziej szczegółowo

Analiza danych pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego. - część I -

Analiza danych pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego. - część I - pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego - część I - Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Plan wykładów --------------------------------------------------------

Bardziej szczegółowo

Screening, klonowanie, ekspresja i oczyszczanie białek

Screening, klonowanie, ekspresja i oczyszczanie białek Screening, klonowanie, ekspresja i oczyszczanie białek Kiedy gen jest znany Dostępna sekwencja DNA sekwencjonowanie genomu, biblioteki Dostępna sekwencja białka sekwencjonowanie białka Techniki pozyskania

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937 (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.0 (13) (51) T3 Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ===============================================================================================

Bardziej szczegółowo

2016-01-14. Sekwencje mikrosatelitarne. SNP Single Nucleotide Polymorphism (mutacje punktowe, polimorfizm jednonukleotydowy)

2016-01-14. Sekwencje mikrosatelitarne. SNP Single Nucleotide Polymorphism (mutacje punktowe, polimorfizm jednonukleotydowy) Sekwencje mikrosatelitarne Próba nr 1 GGGGGGGGGGGG 4x GG Próba nr 2 GGGGGGGGGGGGGGGG 6x GG Próba nr 1 GGGGGGGGG Próba nr 2 GGG GGGG SNP Single Nucleotide Polymorphism (mutacje punktowe, polimorfizm jednonukleotydowy)

Bardziej szczegółowo

PRZEWODNIK DYDAKTYCZNY NA ROK AKADEMICKI 2011/2012 NAZWA JEDNOSTKI: Katedra i Klinika Pulmonologii, Alergologii i Onkologii Pulmonologicznej

PRZEWODNIK DYDAKTYCZNY NA ROK AKADEMICKI 2011/2012 NAZWA JEDNOSTKI: Katedra i Klinika Pulmonologii, Alergologii i Onkologii Pulmonologicznej PRZEWODNIK DYDAKTYCZNY NA ROK AKADEMICKI 2011/2012 NAZWA JEDNOSTKI: Katedra i Klinika Pulmonologii, Alergologii i Onkologii Pulmonologicznej 1. Adres jednostki: Adres: ul. Szamarzewskiego 84, 60-569 Poznań

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 185228

(12) OPIS PATENTOWY (19) PL (11) 185228 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 185228 (21) Numer zgłoszenia: 331212 ( 13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 04.07.1997 (86) Data i numer zgłoszenia

Bardziej szczegółowo

PL 217306 B1. AZO DIGITAL SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Gdańsk, PL 27.09.2010 BUP 20/10. PIOTR ADAMOWICZ, Sopot, PL 31.07.

PL 217306 B1. AZO DIGITAL SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Gdańsk, PL 27.09.2010 BUP 20/10. PIOTR ADAMOWICZ, Sopot, PL 31.07. PL 217306 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217306 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 387605 (22) Data zgłoszenia: 25.03.2009 (51) Int.Cl.

Bardziej szczegółowo