Występowanie genów kodujących białka z rodziny Alp u Streptococcus agalactiae *

Wielkość: px
Rozpocząć pokaz od strony:

Download "Występowanie genów kodujących białka z rodziny Alp u Streptococcus agalactiae *"

Transkrypt

1 MED. DOŚW. MIKROBIOL., 2011, 63: 5-14 Monika Brzychczy-Włoch 1, Tomasz Gosiewski 1, Małgorzata Bodaszewska 1, Katarzyna Talaga 1, Joanna Natkaniec 1, Paweł Adamski 2, Piotr B. Heczko 1 Występowanie genów kodujących białka z rodziny Alp u Streptococcus agalactiae * 1 Katedra Mikrobiologii, Uniwersytet Jagielloński Collegium Medicum, Kraków, Kierownik: prof. dr hab. med. Piotr B. Heczko 2 Instytut Ochrony Przyrody, Polska Akademia Nauk, Kraków, Kierownik: prof. dr hab. H. Okarma Detekcję genów bca, epsilon, alp2, alp3, alp4 oraz rib, kodujących białka z rodziny Alp (ang. alpha-like protein family), będące istotnymi czynnikami wirulencji paciorkowców grupy B (GBS), przeprowadzono metodą PCR multipleks. Analizie poddano szczepy Streptococcus agalactiae reprezentujące różne serotypy (Ia, Ib, II, III, IV, i V), które zostały wyizolowane od zdrowych kobiet ciężarnych. Poszukiwane geny występowały pojedynczo we wszystkich badanych izolatach, przy czym dominowały szczepy z genem epsilon (27%), następnie rib (21%) oraz alp2 (21%), bca (17%) i alp3 (14%). w badanej populacji nie stwierdzono szczepów z genem alp4. Wykazano statystycznie istotną zależność pomiędzy prawdopodobieństwem wystąpienia badanych genów, a serotypami GBS (p<0,0001). Podsumowując, typowanie paciorkowców grupy B pod względem występowania genów kodujących białka z rodziny Alp, umożliwia zróżnicowanie szczepów w obrębie serotypów, co ma znaczenie zarówno w badaniach epidemiologicznych, jak również jest szczególnie przydatne w pracach nad szczepionką przeciwko zakażeniom GBS. Streptococcus agalactiae, zaliczany do paciorkowców grupy serologicznej B (ang. Group B Streptococcus - GBS), stanowi część fizjologicznej flory ludzi, może być jednak przyczyną wewnątrzowodniowych zakażeń płodu lub noworodków, związanych z wysoką śmiertelnością, zakażeń połogowych, a także zakażeń u osób w podeszłym wieku oraz osób w immunosupresji (5, 13, 16). Paciorkowce grupy B charakteryzują się dużą zmiennością genetyczną, która zależy między innymi od szerokości geograficznej, grupy wiekowej pacjentów, ich rasy, oraz typu zakażenia (3, 6, 12). w obrębie gatunku S. agalactiae wyróżniamy dziesięć serotypów (Ia, Ib, II IX) wydzielonych na podstawie różnic w budowie polisacharydów powierzchnio- * Praca finansowana w ramach grantu własnego numer N N z Ministerstwa Nauki i Szkolnictwa Wyższego

2 6 M. Brzychczy-Włoch i inni Nr 1 wych (ang. capsular polisacharide CPS) (3, 14, 18). Poznanie częstości występowania określonych serotypów dla wybranych populacji ma szczególne znaczenie w badaniach epidemiologicznych, a także w rozwoju prac nad skonstruowaniem wieloważnej szczepionki przeciwko zakażeniom GBS, nad którą obecnie trwają intensywne badania i której głównym składnikiem są wybrane polisacharydy powierzchniowe GBS (4, 6, 17). W ostatnich latach istotnego znaczenia nabierają także badania nad białkami z rodziny Alp występującymi u S. agalactiae. Wykazano, że niektóre z tych białek wykazują silne właściwości immunogenne i skoniugowane w eksperymentalnych szczepionkach z CPS istotnie podnoszą jego immunogenność (6, 11, 13, 20). Ponadto, typowanie szczepów GBS w zależności od występowania białek z rodziny Alp, lub genów je kodujących, jest bardzo przydatne w badaniach epidemiologicznych (2, 7, 10). Białka z rodziny Alp (ang. alpha-like proteins) są najlepiej poznanymi i opisanymi białkami powierzchniowymi S. agalactiae. Do białek tych zaliczamy białko: Alfa-C, Epsilon (znane również pod nazwą Alp1 lub Epsilon/Alp1), Alp2, Alp3, Alp4 oraz Rib, kodowane odpowiednio przez alleliczne geny bca, epsilon, alp2, alp3, alp4 oraz rib (2, 3, 13). Białko Alfa-C wraz z białkiem Beta-C, które nie należy do rodziny białek Alp, są komponentami antygenu C, pierwszego opisanego antygenu białkowego S. agalactiae (21). Każdy z genów białek Alp posiada w swej strukturze tandemowy region powtórzeń (ang. tandem repeated region) oraz konserwatywne końce N i C (9). Ze względu na mozaikową budowę białek Alp obserwuje się występowanie reakcji krzyżowych pomiędzy tymi białkami, a surowicami diagnostycznymi stosowanymi do typowania serologicznego. Występowanie reakcji krzyżowych sugeruje, że szczepionka zawierająca wybrane, najczęściej występujące białka z rodziny Alp, może zapewnić szerokie spektrum ochrony przeciwko zakażeniom GBS (17). Ponieważ brak jest polskich danych dotyczących badań nad występowaniem genów kodujących białka z rodziny Alp u S. agalactiae, dlatego też głównym celem pracy było oznaczenie genów bca, epsilon, alp2, alp3, alp4 oraz rib u szczepów GBS, a także ocena przydatności opisanej metody PCR multipleks do typowania paciorkowców grupy B. MATERIAŁ I METODY Badania nad nosicielstwem paciorkowców grupy B prowadzono na grupie 1176 kobiet w latach zgodnie z protokołem klinicznym zaakceptowanym przez Komisję Bioetyczną UJ (opinia numer KBET/143/B/2007). Materiałem badanym były wymazy z pochwy i odbytu, diagnozowane w kierunku GBS metodą hodowli prowadzonej według rekomendacji CDC (Centers for Disease Control and Prevention) (16), oraz Polskiego Towarzystwa Ginekologicznego (8). Występowanie genów kodujących białka z rodziny Alp, oznaczono dla 169 szczepów Streptococcus agalactiae (GBS) reprezentujących różne serotypy: Ia (n=36), Ib (n=14), II (n=24), III (n=55), IV (n=8), i V (n=32), określone wcześniej dzięki zastosowaniu metody PCR multipleks zgodnie z opisaną procedurą Brzychczy-Włoch i inni (2009) (1). W celu detekcji genów bca, epsilon, alp2, alp3, alp4 oraz rib, zastosowano metodę PCR multipleks z użyciem 6 starterów odwrotnych i jednego wspólnego dla nich startera wiodącego zgodnie z procedurą Creti i inni (2004) (2) oraz Gherardi i inni (2007) (3). w metodzie tej wykorzystano dwa zestawy starterów, i i II (Tabela I) (Genomed). Przy po-

3 Nr 1 Białka z rodziny Alp u S. agalactiae 7 Tabela I. Sekwencje specyficznych starterów komplementarnych dla genów kodujących białka powierzchniowe z rodziny Alp występujące u S. agalactiae według Creti i inni (2004) (2) oraz Gherardi i inni (2007) (3). Zestaw starterów Nazwa startera Sekwencja (5 i 3 ) Wielkość produktu (pz) I i II Universal TGATACTTCACAGACGAAACAACG - Alpha-C TACATGTGGTAGTCCATCTTCACC 398 Rib CATACTGAGCTTTTAAATCAGGTGA 295 I Epsilon CCAGATACATTTTTTACTAAAGCGG 200 Alp2/3 CACTCGGATTACTATAATATTTAGCAC 334 Alp4 TTAATTTGCACCGGATTAACACCAC 110 II Alp3 GCTTAAGGATAGCAACGAACCAAAA 1243 mocy zestawu i starterów określano obecność genu: bca, epsilon, alp2/alp3, alp4 oraz rib, natomiast zestaw II posłużył do zróżnicowania pomiędzy genami alp2 oraz alp3 i pozwolił na wykazanie obecności genu alp3. w celu przeprowadzenia reakcji amplifikacji, genomowe DNA izolowano przy użyciu kolumienkowego zestawu Genomic Mini (DNA Gdańsk). Mieszanina reakcyjna zawierała: 10 pmoli/µl każdego startera; 50 ng bakteryjnego DNA; 250µM każdego dntp (Roche); 2,0 mm MgCl 2 (Eurx); 1U polimerazy Yellow Taq (Eurx). Próbki poddawano amplifikacji w termocyklerze PTC-200 (BioRad), zgodnie z następującym programem: 96 O C - 3 min., 30 x (95 O C - 60 sek., 58 O C - 45 sek., 72 O C - 45 sek.), 72 O C - 10 min. Otrzymane produkty analizowano w 1,5% żelu agarozowym w obecności bromku etydyny (BioRad) 0.25 µg/ml. Uzyskany obraz poddawano ocenie przy pomocy programu QuantityOne (BioRad) oraz aparatu GelDoc 2000 (BioRad). Do analizy statystycznej stosowano test G 2 (Likelihood ratio), wartość p<0,05 uznawano za istotną statystycznie. WYNIKI I ICH OMÓWIENIE Polisacharydy powierzchniowe oraz białka z rodziny Alp, będące istotnymi czynnikami wirulencji paciorkowców grupy B, są obecnie intensywnie badane jako składniki eksperymentalnych szczepionek przeciwko zakażeniom GBS (4, 6, 20). Ponieważ obserwuje się dużą zmienność genetyczną szczepów S. agalactiae w zależności od szerokości geograficznej oraz badanej populacji, istnieje potrzeba prowadzenia badań epidemiologicznych na szeroką skalę, obejmujących różne populacje i kraje (3, 6, 13). W badaniach tych szczególnie przydatne jest typowanie izolatów GBS polegające na detekcji genów kodujących poszczególne CPS (14) oraz białka z rodziny Alp (2). Wyniki uzyskane z tego typu badań są dostępne z wielu światowych ośrodków naukowych (3, 7, 13), brak jest natomiast takich danych z Polskich centrów badawczych. Zastosowana w prezentowanych badaniach metoda PCR (2, 3) dzięki użyciu dwóch zestawów starterów specyficznych dla genów kodujących poszczególne białka z rodziny Alp w stosunkowo prosty sposób umożliwiła ich detekcję (Tabela I, Ryc. 1, Ryc. 2). Analizie poddano występowanie sześciu genów z rodziny Alp: bca, epsilon, alp2, alp3, alp4 oraz rib, kodujących odpowiednio białka: Alfa-C, Epsilon, Alp2, Alp3, Alp4 oraz Rib. Badanie wykonano dla 169 szczepów S. agalactiae pochodzących z nosicielstwa pochwowego lub

4 8 M. Brzychczy-Włoch i inni Nr 1 Ryc. 1. Przykładowe produkty amplifikacji charakterystyczne dla badanych genów kodujących białka z rodziny Alp uzyskane za pomocą metody PCR multipleks. Ścieżki: 1 17 próby badane: 1, 4, 8, 10, 13, 15 epsilon (200pz); 3, 5, 6, 12, 16 rib (295pz); 2, 7, 9, 11, 14 alp2/3 (334pz); 17 bca (398pz); N próba negatywna; P próba pozytywna; M marker wielkości PerfectTM 100 bp DNA Ladder (Eurx). Ryc. 2. Ścieżki: Przykładowe produkty amplifikacji charakterystyczne dla genu alp3 uzyskane za pomocą metody PCR. 1 7 próby badane, alp3 (1243pz); N próba negatywna; P próba pozytywna; M marker wielkości PerfectTM 100 bp DNA Ladder (Eurx).

5 Nr 1 Białka z rodziny Alp u S. agalactiae 9 odbytniczego od kobiet ciężarnych. Wybrane szczepy reprezentowały różne, najczęściej występujące serotypy GBS w badanej populacji: Ia (n=36), Ib (n=14), II (n=24), III (n=55), IV (n=8), i V (n=32), określone wcześniej dzięki zastosowaniu odpowiedniej metody PCR multipleks (1, 14). Poszukiwane geny występowały pojedynczo we wszystkich badanych izolatach, przy czym dominowały szczepy z genem epsilon (n=44, 27%), a następnie rib (n=36, 21%) oraz alp2 (n=36, 21%), bca (n=29, 17%) i alp3 (n=24, 14%). W badanej populacji nie stwierdzono szczepów z genem alp4 (Ryc. 3). Ryc. 3. Rozkład genów kodujących białka z rodziny Alp wśród szczepów S. agalactiae izolowanych z przypadków nosicielstwa pochwowego lub odbytniczego u ciężarnych. Uzyskany wynik występowania genów kodujących białka z rodziny Alp u paciorkowców grupy B izolowanych z przypadków nosicielstwa różni się w niewielkim stopniu od wyników opisywanych przez innych autorów (3, 12). Obserwowane różnice dotyczą, częstości występowania poszczególnych genów, wśród których, w cytowanych pracach, dominował gen rib (33-42%) (3, 12). Prawdopodobnie związane jest to nie tylko z różnym obszarem geograficznym, ale także z grupą badanych izolatów, która w naszych badaniach obejmowała wyłącznie izolaty pochodzące z nosicielstwa, zaś w omawianych pracach, były to głównie szczepy izolowane z krwi. Procentowy udział poszczególnych serotypów (Ia, Ib, II, III, IV, V), w grupie izolatów GBS posiadających określony gen (bca, alp2, alp3, rib, epsilon) przedstawiono w sposób obrazowy na wykresie (Ryc. 4). Gen bca oznaczono u 29 izolatów GBS, przy czym najczęściej występował u izolatów należących do serotypu II (n=13, 44%), następnie Ia (n=6, 21%) i Ib (n=6, 21%), stosunkowo rzadko w przypadku serotypu III (n=2, 7%) i V (n=2, 7%), zaś u szczepów z serotypem IV nie został stwierdzony. Obecność genu alp2 potwierdzono w grupie 36 izolatów GBS, gdzie istotnie dominował wśród szczepów reprezentujących serotyp III (n=32, 89%), poza tym, był także stwierdzony w serotypie V (n=2, 5%), Ia (n=1, 3%) i II (n=1, 3%), nie występował natomiast w serotypach Ib i IV. Występowanie genu alp3 wykazano dla 24 szczepów GBS, przy czym było ono silnie skorelowane z serotypem V (n=22, 92%). Gen ten w nielicznych przypadkach występował u szczepów z serotypem III

6 10 M. Brzychczy-Włoch i inni Nr 1 Ryc. 4. Procentowy udział poszczególnych serotypów Ia, Ib, II, III, IV, V, w grupie izolatów GBS posiadających określony gen: bca, alp2, alp3, rib, epsilon. (n=2, 8%), nie stwierdzono go natomiast wśród szczepów z serotypem Ia, Ib, III i IV. Gen rib występował u 36 izolatów GBS, z czego dominował wśród szczepów GBS z serotypem III (n=19, 53%), ponadto, występował także w serotypie II (n=10, 28%), V (n=4, 11%) oraz Ia (n=3, 8%), natomiast nie wykazano jego obecność w serotypach Ib i IV. Detekcję genu epsilon wykazano u 44 izolatów S. agalactiae. Gen ten dominował u szczepów z serotypem Ia (n=26, 59%), a także w serotypie Ib (n=8, 18%), IV (n=8, 18%) oraz V (n=2, 5%), brak go natomiast było wśród szczepów z serotypem II i III. Warto zwrócić uwagę, że gen epsilon był silnie skorelowany z serotypem IV, gdyż został oznaczony u wszystkich przebadanych szczepów reprezentujących ten serotyp. Podsumowując, stwierdzono, że istnieje związek pomiędzy prawdopodobieństwem wystąpienia określonych genów kodujących białka z rodziny Alp, a serotypami GBS i zależność ta jest statystycznie istotna (p<0,0001). Przy czym, należy zaznaczyć, że obserwowane zjawisko nie dotyczy ścisłej korelacji pomiędzy danym serotypem, a konkretnym genem kodującym białko z rodziny Alp, ale jest znacznie bardziej złożone i trudne w interpretacji. Uzyskane wyniki potwierdzają już wcześniej opisywane przez innych autorów zależności, pomiędzy występowaniem poszczególnych CPS, a genami kodującymi białka z rodziny Alp (2, 7). Na przykład Creti i inni (2004) (2) zauważyli powiązanie pomiędzy serotypem Ia, Ib i II a genem bca, serotypem III i genem rib oraz serotypem V i VIII, a genem alp3. Podobnie Persson i inni (2007) wykazali występowanie genu epsilon w serotypie Ia, bca w Ib i II, rib w III oraz alp3 z V (13). Ponadto, przeprowadzono szczegółową analizę przeciętnej częstości występowania genów kodujących białka z rodziny Alp: bca, epsilon, alp2, alp3 oraz rib w poszczególnych serotypach S. agalactiae, zgodnie z metodą kalkulacji wartości oczekiwanych w testach częstotliwości według Sokal i Rolf (1992) (19). Na podstawie wyników uzyskanych dla wszystkich badanych szczepów, obliczono przeciętną częstość występowania genów kodujących białka Alp, a następnie użyto jej jako podstawy normalizującej dla poszczególnych serotypów. Wyniki analizy przedstawiono dla każdego oznaczonego genu na osobnym wykresie (Ryc. 5), gdzie oś X stanowi podstawę normalizującą dla badanych serotypów.

7 Nr 1 Białka z rodziny Alp u S. agalactiae 11 Ryc. 5. Przeciętna częstość wystąpienia genów kodujących białka z rodziny Alp: bca, epsilon, alp2, alp3 oraz rib w poszczególnych serotypach S. agalactiae. Oś X stanowi podstawę normalizującą dla badanych serotypów. Słupki powyżej osi X przedstawiają większą od przeciętnej częstość występowania danego genu w określonym serotypie GBS, zaś słupki poniżej osi X, wskazują na mniejszą od przeciętnej częstość występowania danego genu. Wartości dodatnie przedstawione jako słupki powyżej osi X wskazują w próbie na większą od przeciętnej częstość występowania danego genu w grupie izolatów z określonym serotypem, zaś wartości ujemne przedstawione jako słupki poniżej osi X, wskazują na mniejszą od przeciętnej częstość występowania danego genu. Na podstawie uzyskanych wyników wykazano, że szczepy GBS pochodzące z przypadków nosicielstwa charakteryzuje bardzo duża zmienność genetyczna. Dlatego też, typowanie szczepów S. agalactiae tylko w odniesieniu do ich serotypu jest niewystarczające. Dopiero wyniki pochodzące z połączenia metod typowania, uwzględniające obecność genów kodujących poszczególne CPS oraz genów kodujących białka z rodziny Alp, umożliwiają dokładne zróżnicowanie szczepów S. agalactiae w obrębie danego serotypu i są bardzo przydatne w badaniach epidemiologicznych oraz w pracach nad uzyskaniem szczepionki przeciwko zakażeniom paciorkowcami grupy B.

8 12 M. Brzychczy-Włoch i inni Nr 1 WNIOSKI 1. Potwierdzono przydatność metody PCR multipleks do oznaczania genów kodujących wybrane białka powierzchniowe z rodziny Alp u paciorkowców grupy B. 2. Wśród izolatów GBS pochodzących z nosicielstwa pochwowego lub odbytniczego w grupie kobiet ciężarnych, dominowały szczepy GBS z genem epsilon (27%), następnie rib (21%) oraz alp2 (21%), kolejno bca (17%) i alp3 (14%). Poszukiwane geny występowały pojedynczo we wszystkich badanych izolatach GBS, przy czym, w badanej populacji nie stwierdzono szczepów posiadających gen alp4. 3. Wykazano statystycznie istotną zależność pomiędzy prawdopodobieństwem wystąpienia określonych genów kodujących białka z rodziny Alp, a serotypami GBS (p<0,0001). 4. Typowanie paciorkowców grupy B pod względem występowania genów kodujących białka z rodziny Alp, daje możliwość bardzo dokładnego zróżnicowania szczepów w obrębie serotypów, co ma znaczenie zarówno w badaniach epidemiologicznych, jak również jest szczególnie przydatne w pracach nad uzyskaniem szczepionki przeciwko zakażeniom GBS. M. Brzychczy-Włoch, T. Gosiewski, M. Bodaszewska, K. Talaga, J. Natkaniec, P. Adamski, P.B. Heczko Occurrence of surface protein genes from alpha-like protein (Alp) family in Streptococcus agalactiae isolates SUMMARY Distribution of serotypes and alpha-like surface protein (Alp) of Streptococcus agalactiae (Group B Streptococci GBS) vary with geographical region, ethnic origin and the virulence of clinical isolates. Demonstration of different genotypes based on surface protein genes improves the potential of GBS subtyping, is essential in research on new vaccines against invasive neonatal infections and may be useful in epidemiological studies. The molecular characterization of protein gene profile of GBS isolates was the main aim of this study. We evaluated the applicability of multiplex PCR for the identification of GBS protein genes from Alp family, such as: epsilon, bca, rib, alp2, alp3, alp4 and evaluated presence of these genes in the group of GBS isolates originating from vaginal or rectal carriage in pregnant women. For statistical analysis the G 2 (Likelihood ratio) test was used. P values of <0.05 were considered significant. The surface protein genes were found in all investigated strains. The epsilon gene dominated (27%) in GBS isolates originating from healthy pregnant women. The other genes were detected with the following frequency: rib (21%), alp2 (21%), bca (17%) and alp3 (14%). In the analyzed population, GBS strains with alp4 gene were not found. A statistically significant relationship between surface protein genes and capsular polysaccharides was demonstrated (p<0.0001). The results of our study show immense diagnostic usefulness of multiplex PCR for identification of genes encoding GBS surface proteins from Alp family.

9 Nr 1 Białka z rodziny Alp u S. agalactiae 13 PIŚMIENNICTWO 1. Brzychczy-Włoch M, Gosiewski T, Bogdaszewska M i inni. Rozkład serotypów paciorkowców grupy B, izolowanych z przypadków nosicielstwa, oznaczonych metodą multipleks PCR. Med Dośw Mikrobiol 2009; 61: Creti R, Fabretti F, Orefici G i inni. Multiplex PCR assay for direct identification of group B streptococcal alpha-protein-like protein genes. J Clin Microbiol 2004; 42: Gherardi G, Imperi M, Baldassarri L i inni. Molecular epidemiology and distribution of serotypes, surface proteins, and antibiotic resistance among group B streptococci in Italy J Clin Microbiol 2007; 45: Heath PT, Feldman RG. Vaccination against group B streptococcus. Expert Rev Vaccines 2005; 4: Heath PT, Schuchat A. Perinatal group B streptococcal disease. Clin Obstet Gynecol 2007; 21: Johri AK, Paoletti LC, Glaser P i inni. Group B Streptococcus: global incidence and vaccine development. Nat Rev Microbiol 2006; 4: Kong F, Gowan S, Martin D i inni. Molecular profiles of group B streptococcal surface protein antigen genes: relationship to molecular serotypes. J Clin Microbiol 2002; 40: Kotarski J, Heczko PB, Lauterbach R i inni. Rekomendacje Polskiego Towarzystwa Ginekologicznego dotyczące wykrywania nosicielstwa paciorkowców grupy B (GBS) u kobiet w ciąży i zapobiegania zakażeniom u noworodków. Ginekol Pol 2008; 79: Lachenauer CS, Creti R, Michel JL i inni. Mosaicism in the alpha-like protein genes of group B streptococci. Proc Natl Acad Sci USA 2000; 97: Lindahl G, Stalhammar-Carlemalm M, Areschoug T. Surface proteins of Streptococcus agalactiae and related proteins in other bacterial pathogens. Clin Microbiol Rev 2005; 18: Manning S, Ki M, Marrs C i inni. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates. BMC Infect Dis 2006; 6: Persson E, Berg S, Trollfors B i inni. Serotypes and clinical manifestations of invasive group B streptococcal infections in western Sweden Clin Microbiol Infect 2007; 10: Persson E, Berg S, Bevanger L i inni. Characterization of invasive group B streptococci based on investigation of surface proteins and genes encoding surface proteins. Clin Microbiol Infect 2008; 14: Poyart C, Tazi A, Réglier-Poupet H i inni. Multiplex PCR assay for rapid and accurate capsular typing of group B streptococci. J Clin Microbiol 2007; 45: Savoia D, Gottimer C, Crocilla C i inni. Streptococcus agalactiae in pregnant women: phenotypic and genotypic characters. J Infect 2008; 56: Schrag S, Gorwitz R, Fultz-Butts K i inni. Prevention of perinatal group B streptococcal disease. Revised guidelines from CDC. MMWR 2002; 15: Seifert KN, Adderson EE, Whiting AA i inni. A unique serine-rich repeat protein (Srr-2) and novel surface antigen (epsilon) associated with a virulent lineage of serotype III Streptococcus agalactiae. Microbiology 2006; 152: Slotved HC, Kong F, Lambertsen L i inni. Serotype IX, a proposed new Streptococcus agalactiae serotype. J Clin Microbiol 2007; 45: Sokal RR, Rohlf FJ. Introduction to Biostatistics. 2nd ed. Freeman: San Francisco, Stalhammar-Carlemalm M, Stenberg L, Lindhal G. Protein Rib: a novel group B streptococcal cell surface protein that confers protective immunity and is expressed by most strains causing invasive infections. J Exp Med 1993; 177: Wilkinson HW, Eagon RG. Type-specific antigens of group B type Ic streptococci. Infect Immune 1971; 4:

10 14 M. Brzychczy-Włoch i inni Nr 1 Otrzymano: 29 XI 2011 r. Adres Autora: Kraków, ul. Czysta 18, Katedra Mikrobiologii CM UJ

ROZKŁAD SEROTYPÓW PACIORKOWCÓW GRUPY B, IZOLOWANYCH Z PRZYPADKÓW NOSICIELSTWA, OZNACZONYCH METODĄ MULTIPLEKS PCR *

ROZKŁAD SEROTYPÓW PACIORKOWCÓW GRUPY B, IZOLOWANYCH Z PRZYPADKÓW NOSICIELSTWA, OZNACZONYCH METODĄ MULTIPLEKS PCR * MED. DOŚW. MIKROBIOL., 2009, 61: 293-299 Monika Brzychczy-Włoch 1, Tomasz Gosiewski 1, Małgorzata Bodaszewska 1, Wojciech Pabian 2, Małgorzata Bulanda 1, Piotr B. Heczko 1 ROZKŁAD SEROTYPÓW PACIORKOWCÓW

Bardziej szczegółowo

AUTOREFERAT do Wniosku o wszczęcie postępowania habilitacyjnego

AUTOREFERAT do Wniosku o wszczęcie postępowania habilitacyjnego Dr n. biol. Monika Brzychczy-Włoch Collegium Medicum Uniwersytetu Jagiellońskiego Katedra Mikrobiologii Zakład Bakteriologii, Ekologii Drobnoustrojów i Parazytologii ul. Czysta 18, 31-121 Kraków e-mail:

Bardziej szczegółowo

Ćwiczenie 2. Identyfikacja płci z wykorzystaniem genu amelogeniny (AMGXY)

Ćwiczenie 2. Identyfikacja płci z wykorzystaniem genu amelogeniny (AMGXY) Ćwiczenie 2. Identyfikacja płci z wykorzystaniem genu amelogeniny (AMGXY) Cel ćwiczenia Amplifikacja fragmentu genu amelogeniny, znajdującego się na chromosomach X i Y, jako celu molekularnego przydatnego

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Evaluation of ITS-PCR and PCR MP techniques for Streptococcus agalactiae genetic differentiation

Evaluation of ITS-PCR and PCR MP techniques for Streptococcus agalactiae genetic differentiation MED. DOŚW. MIKROBIOL., 2014, 66: 149-160 Ocena przydatności metod: ITS-PCR i PCR MP w genotypowaniu Streptococcus agalactiae Evaluation of ITS-PCR and PCR MP techniques for Streptococcus agalactiae genetic

Bardziej szczegółowo

Ocena oporności paciorkowców hemolizujących grupy B na podstawie badań własnych

Ocena oporności paciorkowców hemolizujących grupy B na podstawie badań własnych Ocena oporności paciorkowców hemolizujących grupy B na podstawie badań własnych Research-based assessment of antibiotic resistance of hemolytic group B streptococci 1 Klinika Perinatologii I Katedry Ginekologii

Bardziej szczegółowo

NARASTANIE STOPNIA KOLONIZACJI KOBIET W CIĄŻY I NOWORODKÓW PRZEZ STREPTOCOCCUS AGALACTIAE NA OBSZARZE POLSKI POŁUDNIOWO-WSCHODNIEJ *

NARASTANIE STOPNIA KOLONIZACJI KOBIET W CIĄŻY I NOWORODKÓW PRZEZ STREPTOCOCCUS AGALACTIAE NA OBSZARZE POLSKI POŁUDNIOWO-WSCHODNIEJ * MED. DOŚW. MIKROBIOL., 2008, 60: 5-12 Monika Brzychczy-Włoch 1, Magdalena Strus 1, Dorota Pawlik 2, Helena Machlarz 2, Tomasz Gosiewski 1, Artur Drzewiecki 1, Krzysztof Rytlewski 3, Ryszard Lauterbach

Bardziej szczegółowo

EWA HELWICH Instytut Matki i Dziecka w Warszawie

EWA HELWICH Instytut Matki i Dziecka w Warszawie VI KONGRES Polskiego Towarzystwa Medycyny Perinatalnej Poznań, 26 28 września 2013 Polska Sieć Neonatologiczna EWA HELWICH Instytut Matki i Dziecka w Warszawie Nadzór celowany w odniesieniu do najważniejszych

Bardziej szczegółowo

Scenariusz lekcji z biologii w szkole ponadgimnazjalnej

Scenariusz lekcji z biologii w szkole ponadgimnazjalnej Scenariusz lekcji z biologii w szkole ponadgimnazjalnej Temat lekcji: Planowanie doświadczeń biologicznych jak prawidłowo zaplanować próbę kontrolną? Cele kształcenia IV etap edukacyjny: 1. Wymagania ogólne:

Bardziej szczegółowo

Ampli-LAMP Babesia canis

Ampli-LAMP Babesia canis Novazym Products Zestaw do identyfikacji materiału genetycznego pierwotniaka Babesia canis canis techniką Loop-mediated Isothermal AMPlification (LAMP) Numery katalogowe produktu: AML-Bc-200 AML-Bc-400

Bardziej szczegółowo

ZALEŻNOŚĆ MIĘDZY WYSOKOŚCIĄ I MASĄ CIAŁA RODZICÓW I DZIECI W DWÓCH RÓŻNYCH ŚRODOWISKACH

ZALEŻNOŚĆ MIĘDZY WYSOKOŚCIĄ I MASĄ CIAŁA RODZICÓW I DZIECI W DWÓCH RÓŻNYCH ŚRODOWISKACH S ł u p s k i e P r a c e B i o l o g i c z n e 1 2005 Władimir Bożiłow 1, Małgorzata Roślak 2, Henryk Stolarczyk 2 1 Akademia Medyczna, Bydgoszcz 2 Uniwersytet Łódzki, Łódź ZALEŻNOŚĆ MIĘDZY WYSOKOŚCIĄ

Bardziej szczegółowo

Zastosowanie metody RAPD do różnicowania szczepów bakteryjnych

Zastosowanie metody RAPD do różnicowania szczepów bakteryjnych Zastosowanie metody RAPD do różnicowania szczepów bakteryjnych Wstęp teoretyczny Technika RAPD (ang. Random Amplification of Polymorphic DNA) opiera się na prostej reakcji PCR, przeprowadzanej na genomowym

Bardziej szczegółowo

dystrybucji serotypów powodujących zakażenia inwazyjne w poszczególnych grupach wiekowych zapadalność na IChP w poszczególnych grupach wiekowych

dystrybucji serotypów powodujących zakażenia inwazyjne w poszczególnych grupach wiekowych zapadalność na IChP w poszczególnych grupach wiekowych Warszawa, 15.06.2015 Rekomendacje Pediatrycznego Zespołu Ekspertów ds. Programu Szczepień Ochronnych (PZEdsPSO) dotyczące realizacji szczepień obowiązkowych, skoniugowaną szczepionką przeciwko pneumokokom;

Bardziej szczegółowo

Analiza badań przesiewowych w kierunku Streptococcus agalactiae u kobiet w ciąży z regionu Pomorza Zachodniego

Analiza badań przesiewowych w kierunku Streptococcus agalactiae u kobiet w ciąży z regionu Pomorza Zachodniego ! " # $ % $ DOI: 10.17772/gp/57858 & ' ( ) * +, - +,. Analiza badań przesiewowych w kierunku Streptococcus agalactiae u kobiet w ciąży z regionu Pomorza Zachodniego Analysis of screening tests for Streptococcus

Bardziej szczegółowo

AmpliTest Salmonella spp. (Real Time PCR)

AmpliTest Salmonella spp. (Real Time PCR) AmpliTest Salmonella spp. (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzaju Salmonella techniką Real Time PCR Nr kat.: BAC01-50 Wielkość zestawu: 50 oznaczeń Objętość

Bardziej szczegółowo

uzyskanymi przy zastosowaniu innych metod użyto testu Manna-Whitney a. Jako miarę korelacji wykorzystano współczynnik. Przedstawiona w dysertacji

uzyskanymi przy zastosowaniu innych metod użyto testu Manna-Whitney a. Jako miarę korelacji wykorzystano współczynnik. Przedstawiona w dysertacji STRESZCZENIE Zakażenia mykoplazmowe u bydła, a zwłaszcza na tle M. bovis, stanowią istotny problem epidemiologiczny i ekonomiczny w wielu krajach świata. Uważa się, że M. bovis jest odpowiedzialna za 25%

Bardziej szczegółowo

PCR bez izolacji testujemy Direct PCR Kits od ThermoFisher Scientific

PCR bez izolacji testujemy Direct PCR Kits od ThermoFisher Scientific PCR bez izolacji testujemy Direct PCR Kits od ThermoFisher Scientific Specjalnie dla Was przetestowaliśmy w naszym laboratorium odczynniki firmy Thermo Scientific umożliwiające przeprowadzanie reakcji

Bardziej szczegółowo

Ampli-LAMP Salmonella species

Ampli-LAMP Salmonella species Novazym Products Novazym Polska ul. Żywokostowa 23, 61-680 Poznań, tel. +48 0 61 610 39 10, fax +48 0 61 610 39 11, email info@novazym.com Zestaw do identyfikacji materiału genetycznego bakterii z rodzaju

Bardziej szczegółowo

Ocena stężenia erytromycyny w surowicy krwi z tętnicy pępowinowej

Ocena stężenia erytromycyny w surowicy krwi z tętnicy pępowinowej Ocena stężenia erytromycyny w surowicy krwi z tętnicy pępowinowej Evaluation of erythromycin concentration in the umbilical artery serum 1 1 2 1 2 2 1 1 Zakład Biofarmacji, Katedra Biofarmacji, Wydział

Bardziej szczegółowo

Diagnostyka molekularna w OIT

Diagnostyka molekularna w OIT Diagnostyka molekularna w OIT B A R B A R A A D A M I K K A T E D R A I K L I N I K A A N E S T E Z J O L O G I I I I N T E N S Y W N E J T E R A P I I U N I W E R S Y T E T M E D Y C Z N Y W E W R O C

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

Ampli-LAMP Goose Parvovirus

Ampli-LAMP Goose Parvovirus Novazym Products Zestaw do identyfikacji materiału genetycznego parwowirusa GPV u gęsi techniką Loop-mediated Isothermal AMPlification (LAMP) Numery katalogowe produktu: AML-GPV-200 AML-GPV-400 Wydanie

Bardziej szczegółowo

Akademia Morska w Szczecinie. Wydział Mechaniczny

Akademia Morska w Szczecinie. Wydział Mechaniczny Akademia Morska w Szczecinie Wydział Mechaniczny ROZPRAWA DOKTORSKA mgr inż. Marcin Kołodziejski Analiza metody obsługiwania zarządzanego niezawodnością pędników azymutalnych platformy pływającej Promotor:

Bardziej szczegółowo

Prezentacja Pracowni Ekologii Drobnoustrojów w Katedry Mikrobiologii UJCM

Prezentacja Pracowni Ekologii Drobnoustrojów w Katedry Mikrobiologii UJCM Prezentacja Pracowni Ekologii Drobnoustrojów w Katedry Mikrobiologii UJCM Informacja o Katedrze Rozwój j naukowy młodej kadry naukowców w w kontekście priorytetów badawczych: W 2009 roku 1 pracownik Katedry

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Problematyka negatywnych okołoporodowych wymazów w kierunku GBS u pacjentek z wcześniejszym dodatnim wynikiem testu przesiewowego

Problematyka negatywnych okołoporodowych wymazów w kierunku GBS u pacjentek z wcześniejszym dodatnim wynikiem testu przesiewowego Perinatologia, Neonatologia i Ginekologia, tom 7, zeszyt 1, 22-30, 2014 Problematyka negatywnych okołoporodowych wymazów w kierunku GBS u pacjentek z wcześniejszym dodatnim wynikiem testu przesiewowego

Bardziej szczegółowo

AmpliTest Panel odkleszczowy (Real Time PCR)

AmpliTest Panel odkleszczowy (Real Time PCR) AmpliTest Panel odkleszczowy (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii Borrelia burgdorferi, Anaplasma, Ehrlichia oraz pierwotniaków rodzaju Babesia (B. canis, B. gibsoni,

Bardziej szczegółowo

MEDYCYNA DOŚWIADCZALNA I MIKROBIOLOGIA

MEDYCYNA DOŚWIADCZALNA I MIKROBIOLOGIA MEDYCYNA DOŚWIADCZALNA I MIKROBIOLOGIA ORGAN NARODOWEGO INSTYTUTU ZDROWIA PUBLICZNEGO PAŃSTWOWEGO ZAKŁADU HIGIENY I POLSKIEGO TOWARZYSTWA MIKROBIOLOGÓW 3-4 ROK LXVI KWARTALNIK 2014 NARODOWY INSTYTUT ZDROWIA

Bardziej szczegółowo

MED. DOŚW. MIKROBIOL., 2014, 66: 89-98

MED. DOŚW. MIKROBIOL., 2014, 66: 89-98 MED. DOŚW. MIKROBIOL., 2014, 66: 89-98 Opracowanie szybkiego testu PCR-RFLP do identyfikacji pałeczek Yersinia enterocolitica bioserotypu 1B/O8 z epidemicznego szczepu tych drobnoustrojów izolowanych w

Bardziej szczegółowo

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków.

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Katarzyna Mazur-Kominek Współautorzy Tomasz Romanowski, Krzysztof P. Bielawski, Bogumiła Kiełbratowska, Magdalena Słomińska-

Bardziej szczegółowo

Analysis of infectious complications inf children with acute lymphoblastic leukemia treated in Voivodship Children's Hospital in Olsztyn

Analysis of infectious complications inf children with acute lymphoblastic leukemia treated in Voivodship Children's Hospital in Olsztyn Analiza powikłań infekcyjnych u dzieci z ostrą białaczką limfoblastyczną leczonych w Wojewódzkim Specjalistycznym Szpitalu Dziecięcym w Olsztynie Analysis of infectious complications inf children with

Bardziej szczegółowo

Genomika praktyczna. Genomika praktyczna. Zakład Biochemii i Farmakogenomiki. prof. dr hab. Grażyna Nowicka. Rok IV. Semestr 8.

Genomika praktyczna. Genomika praktyczna. Zakład Biochemii i Farmakogenomiki. prof. dr hab. Grażyna Nowicka. Rok IV. Semestr 8. Genomika praktyczna 1. Metryczka Nazwa Wydziału: Program kształcenia (kierunek studiów, poziom i profil kształcenia, forma studiów, np. Zdrowie publiczne I stopnia profil praktyczny, studia stacjonarne):

Bardziej szczegółowo

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów Wprowadzenie do genetyki sądowej 2013 Pracownia Genetyki Sądowej Katedra i Zakład Medycyny Sądowej Materiały biologiczne Inne: włosy z cebulkami, paznokcie możliwa degradacja - tkanki utrwalone w formalinie/parafinie,

Bardziej szczegółowo

Ocena skuteczności preparatów miejscowo znieczulających skórę w redukcji bólu w trakcie pobierania krwi u dzieci badanie z randomizacją

Ocena skuteczności preparatów miejscowo znieczulających skórę w redukcji bólu w trakcie pobierania krwi u dzieci badanie z randomizacją 234 Ocena skuteczności preparatów miejscowo znieczulających skórę w redukcji bólu w trakcie pobierania krwi u dzieci badanie z randomizacją The effectiveness of local anesthetics in the reduction of needle

Bardziej szczegółowo

BD Group B Streptococcus Differential Agar (Granada Medium)

BD Group B Streptococcus Differential Agar (Granada Medium) PODŁOŻE NA PŁYTKACH GOTOWE DO UŻYCIA INSTRUKCJA UŻYTKOWANIA PA-257079.05 Wersja poprawiona: Kwi 2013 PRZEZNACZENIE jest przeznaczone do izolacji i identyfikacji Streptococcus agalactiae (Streptococcus

Bardziej szczegółowo

ZAKAŻENIA OKOŁOPORODOWE O ETIOLOGII STREPTOCOCCUS AGALACTIAE

ZAKAŻENIA OKOŁOPORODOWE O ETIOLOGII STREPTOCOCCUS AGALACTIAE POST. MIKROBIOL., 2012, 51, 4, 299 308 http://www.pm.microbiology.pl ZAKAŻENIA OKOŁOPORODOWE O ETIOLOGII STREPTOCOCCUS AGALACTIAE Monika Bigos 1 *, Monika Łysakowska 1, Małgorzata Wasiela 1 1 Zakład Mikrobiologii

Bardziej szczegółowo

PRACE ORYGINALNE ORIGINAL PAPERS

PRACE ORYGINALNE ORIGINAL PAPERS Borgis Postępy Nauk Medycznych, t. XXVIII, nr 4B, 2015 PRACE ORYGINALNE ORIGINAL PAPERS *Magdalena Sikora 1, Marlena Gołaś 2, 3, Katarzyna Piskorska 2, 3, Ewa Swoboda-Kopeć 2, 3 Ocena pokrewieństwa genetycznego

Bardziej szczegółowo

Wirus zapalenia wątroby typu B

Wirus zapalenia wątroby typu B Wirus zapalenia wątroby typu B Kliniczne następstwa zakażenia odsetek procentowy wyzdrowienie przewlekłe zakażenie Noworodki: 10% 90% Dzieci 1 5 lat: 70% 30% Dzieci starsze oraz 90% 5% - 10% Dorośli Choroby

Bardziej szczegółowo

DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH

DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH DETEKCJA PATOGENÓW POWODUJĄCYCH ZAPALENIE OPON MÓZGOWO-RDZENIOWYCH Detekcja enterowirusów Detekcja sześciu typów ludzkich herpeswirusów (HHV) Detekcja pięciu bakterii Seeplex Detekcja patogenów powodujących

Bardziej szczegółowo

Zakład Bakteriologii Narodowego Instytutu Zdrowia Publicznego - - Państwowego Zakładu Higieny w Warszawie Kierownik: prof. dr hab. M.

Zakład Bakteriologii Narodowego Instytutu Zdrowia Publicznego - - Państwowego Zakładu Higieny w Warszawie Kierownik: prof. dr hab. M. MED. DOŚW. MIKROBIOL., 2009, 61: 79-85 Grzegorz Madajczak 1, Danuta Majczyna 2 SEROLOGICZNE TYPOWANIE I GENOSEROTYPOWANIE PAŁECZEK LISTERIA MONOCYTOGENES IZOLOWANYCH Z PRÓBEK MATERIAŁU KLINICZNEGO, PRÓBEK

Bardziej szczegółowo

Materiał i metody. Wyniki

Materiał i metody. Wyniki Abstract in Polish Wprowadzenie Selen jest pierwiastkiem śladowym niezbędnym do prawidłowego funkcjonowania organizmu. Selen jest wbudowywany do białek w postaci selenocysteiny tworząc selenobiałka (selenoproteiny).

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

2014-03-26. Analiza sekwencji promotorów

2014-03-26. Analiza sekwencji promotorów 2014-03-26 Analiza sekwencji promotorów 1 2014-03-26 TFy tworzą zawiły układ regulacyjny, na który składają się różne oddziaływania białko białko poprzez wytworzenie PĘTLI Specyficzne TFy Ogólne TFy Benfey,

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie Sekwencyjność występowania zaburzeń molekularnych w niedrobnokomórkowym raku płuca

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 04/14. SYLWIA OKOŃ, Dąbrowica, PL KRZYSZTOF KOWALCZYK, Motycz, PL

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 04/14. SYLWIA OKOŃ, Dąbrowica, PL KRZYSZTOF KOWALCZYK, Motycz, PL PL 220315 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 220315 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 400252 (22) Data zgłoszenia: 06.08.2012 (51) Int.Cl.

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo

Zmodyfikowane wg Kadowaki T in.: J Clin Invest. 2006;116(7):1784-92

Zmodyfikowane wg Kadowaki T in.: J Clin Invest. 2006;116(7):1784-92 Magdalena Szopa Związek pomiędzy polimorfizmami w genie adiponektyny a wybranymi wyznacznikami zespołu metabolicznego ROZPRAWA DOKTORSKA Promotor: Prof. zw. dr hab. med. Aldona Dembińska-Kieć Kierownik

Bardziej szczegółowo

WYSTĘPOWANIE PAŁECZEK ESCHERICHIA COLI Z ANTYGENEM POWIERZCHNIOWYM K1 U KOBIET CIĘŻARNYCH I NOWORODKÓW*

WYSTĘPOWANIE PAŁECZEK ESCHERICHIA COLI Z ANTYGENEM POWIERZCHNIOWYM K1 U KOBIET CIĘŻARNYCH I NOWORODKÓW* MED. DOŚW. MIKROBIOL., 2010, 62: 59-65 Agnieszka Kaczmarek, Anna Budzyńska, Eugenia Gospodarek WYSTĘPOWANIE PAŁECZEK ESCHERICHIA COLI Z ANTYGENEM POWIERZCHNIOWYM K1 U KOBIET CIĘŻARNYCH I NOWORODKÓW* Katedra

Bardziej szczegółowo

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów

Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Załącznik nr 1 do SIWZ Nazwa i adres Wykonawcy Opis przedmiotu zamówienia wraz z wymaganiami technicznymi i zestawieniem parametrów Przedmiot zamówienia; automatyczny system do diagnostyki molekularnej:

Bardziej szczegółowo

Is there a relationship between age and side dominance of tubal ectopic pregnancies? A preliminary report

Is there a relationship between age and side dominance of tubal ectopic pregnancies? A preliminary report Is there a relationship between age and side dominance of tubal ectopic pregnancies? A preliminary report Czy istnieje zależność pomiędzy wiekiem i stroną, po której umiejscawia się ciąża ektopowa jajowodowa?

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

EPIDEMIOLOGIA. Mierniki epidemiologiczne. Mierniki epidemiologiczne. Mierniki epidemiologiczne. Mierniki epidemiologiczne

EPIDEMIOLOGIA. Mierniki epidemiologiczne. Mierniki epidemiologiczne. Mierniki epidemiologiczne. Mierniki epidemiologiczne EPIDEMIOLOGIA NOWOTWORÓW ZŁOŚLIWYCH EPIDEMIOLOGIA prof. dr hab. med. Jan Kornafel Katedra Onkologii i Klinika Onkologii Ginekologicznej AM we Wrocławiu Mierniki epidemiologiczne Mierniki epidemiologiczne

Bardziej szczegółowo

CARRIER-STATE OF GROUP B STREPTOCOCCUS IN PREGNANT WOMEN PERFORMANCE STANDARDS

CARRIER-STATE OF GROUP B STREPTOCOCCUS IN PREGNANT WOMEN PERFORMANCE STANDARDS PRZEGL EPIDEMIOL 2012; 66: 33 - ost.str Problemy zakażeń Karol Szwabowicz, Anatol Panasiuk NOSICIELSTWO PACIORKOWCA GRUPY B U KOBIET CIĘŻARNYCH - STANDARDY POSTĘPOWANIA CARRIER-STATE OF GROUP B STREPTOCOCCUS

Bardziej szczegółowo

Obecność paciorkowców grupy B (GBS) u noworodków w aspekcie profilaktyki śródporodowej

Obecność paciorkowców grupy B (GBS) u noworodków w aspekcie profilaktyki śródporodowej Perinatologia, Neonatologia i Ginekologia, tom 7, zeszyt 1, 31-36, 2014 Obecność paciorkowców grupy B (GBS) u noworodków w aspekcie profilaktyki śródporodowej MARTA SIBILSKA 1, MARTA SZYMANKIEWICZ 1, JANUSZ

Bardziej szczegółowo

NIPT Nieinwazyjny Test Prenatalny (ang. Non-Invasive Prenatal Test)

NIPT Nieinwazyjny Test Prenatalny (ang. Non-Invasive Prenatal Test) NIPT Nieinwazyjny Test Prenatalny (ang. Non-Invasive Prenatal Test) Nieinwazyjne badanie krwi kobiety ciężarnej w kierunku wykluczenia najczęstszych trisomii u płodu Cel testu NIPT Celem testu NIPT jest

Bardziej szczegółowo

Rodzinna transmisja Helicobacter pylori z wykorzystaniem typowania molekularnego

Rodzinna transmisja Helicobacter pylori z wykorzystaniem typowania molekularnego Artykuł oryginalny/original paper Rodzinna transmisja Helicobacter pylori z wykorzystaniem typowania molekularnego Intrafamiliar transmission patterns of Helicobacter pylori strains by using molecular

Bardziej szczegółowo

Projekt Alexander w Polsce w latach

Projekt Alexander w Polsce w latach Projekt Alexander w Polsce w latach 1996-2008 NaduŜywanie antybiotyków i chemioterapeutyków oraz ich niewłaściwe stosowanie doprowadziło do globalnego zagroŝenia, jakim jest powstawanie i szerzenie się

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

Test BRCA1. BRCA1 testing

Test BRCA1. BRCA1 testing Test BRCA1 BRCA1 testing 2 Streszczenie Za najczęstszą przyczynę występowania wysokiej, genetycznie uwarunkowanej predyspozycji do rozwoju raka piersi i/lub jajnika w Polsce uznaje się nosicielstwo trzech

Bardziej szczegółowo

Alicja Drohomirecka, Katarzyna Kotarska

Alicja Drohomirecka, Katarzyna Kotarska ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO NR 384 PRACE INSTYTUTU KULTURY FIZYCZNEJ NR 20 2003 ALICJA DROHOMIRECKA KATARZYNA KOTARSKA SPRAWNOŚĆ FIZYCZNA DZIECI PRZEDSZKOLNYCH ZE STARGARDU SZCZECIŃSKIEGO

Bardziej szczegółowo

Ocena wpływu nasilenia objawów zespołu nadpobudliwości psychoruchowej na masę ciała i BMI u dzieci i młodzieży

Ocena wpływu nasilenia objawów zespołu nadpobudliwości psychoruchowej na masę ciała i BMI u dzieci i młodzieży Ewa Racicka-Pawlukiewicz Ocena wpływu nasilenia objawów zespołu nadpobudliwości psychoruchowej na masę ciała i BMI u dzieci i młodzieży Rozprawa na stopień doktora nauk medycznych PROMOTOR: Dr hab. n.

Bardziej szczegółowo

WYSTĘPOWANIE I ZRÓŻNICOWANIE GENÓW ODPOWIEDZIALNYCH ZA OPORNOŚĆ NA TETRACYKLINĘ SZCZEPÓW ENTEROCOCCUS FAECALIS IZOLOWANYCH W REGIONIE GDAŃSKIM.

WYSTĘPOWANIE I ZRÓŻNICOWANIE GENÓW ODPOWIEDZIALNYCH ZA OPORNOŚĆ NA TETRACYKLINĘ SZCZEPÓW ENTEROCOCCUS FAECALIS IZOLOWANYCH W REGIONIE GDAŃSKIM. MED. DOŚW. MIKROBIOL., 2008, 60: 13-17 Tomasz Jarzembowski 1), Aleksandra Dybikowska 2) Maria Dąbrowska-Szponar 1) WYSTĘPOWANIE I ZRÓŻNICOWANIE GENÓW ODPOWIEDZIALNYCH ZA OPORNOŚĆ NA TETRACYKLINĘ SZCZEPÓW

Bardziej szczegółowo

Ocena immunologiczna i genetyczna białaczkowych komórek macierzystych

Ocena immunologiczna i genetyczna białaczkowych komórek macierzystych Karolina Klara Radomska Ocena immunologiczna i genetyczna białaczkowych komórek macierzystych Streszczenie Wstęp Ostre białaczki szpikowe (Acute Myeloid Leukemia, AML) to grupa nowotworów mieloidalnych,

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

Medycyna Wet. 2008, 64 (5) MARCIN WEINER

Medycyna Wet. 2008, 64 (5) MARCIN WEINER 668 Praca oryginalna Original paper Identyfikacja i charakterystyka shigatoksycznych szczepów Escherichia coli wystêpuj¹cych w surowej wo³owinie przy u yciu sondy molekularnej oraz multiplex PCR* ) MARCIN

Bardziej szczegółowo

Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych

Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych Dr n. med. Joanna Walczak- Sztulpa Katedra i Zakład Genetyki Medycznej Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Diagnostyka

Bardziej szczegółowo

Wprowadzenie do genetyki medycznej i sądowej

Wprowadzenie do genetyki medycznej i sądowej Genetyka medyczno-sądowa Wprowadzenie do genetyki medycznej i sądowej Kierownik Pracowni Genetyki Medycznej i Sądowej Ustalanie tożsamości zwłok Identyfikacja sprawców przestępstw Identyfikacja śladów

Bardziej szczegółowo

Śródporodowa profilaktyka zakażeń paciorkowcami grupy B doświadczenia własne

Śródporodowa profilaktyka zakażeń paciorkowcami grupy B doświadczenia własne Śródporodowa profilaktyka zakażeń paciorkowcami grupy B doświadczenia własne Intrapartum prophylaxis against Group B Streptococcus infection own experience Kociszewska-Najman Bożena 1, Oslislo Anna 2,

Bardziej szczegółowo

Interpretacja wyników testów serologicznych

Interpretacja wyników testów serologicznych Interpretacja wyników testów serologicznych Dr hab. Kazimierz Tarasiuk Główny Lekarz Weterynarii PIC Polska i Europa Centralna VI FORUM PIC, Stryków, 18.11.09 Systematyczne monitorowanie statusu zdrowia

Bardziej szczegółowo

Genotypy i antybiotykooporność izolatów Staphylococcus aureus wyosobnionych od świń, kur oraz z mięsa wieprzowego i drobiowego

Genotypy i antybiotykooporność izolatów Staphylococcus aureus wyosobnionych od świń, kur oraz z mięsa wieprzowego i drobiowego UNIWERSYTET PRZYRODNICZY WE WROCŁAWIU WYDZIAŁ MEDYCYNY WETERYNARYJNEJ Mgr inż. Paweł Krupa Genotypy i antybiotykooporność izolatów Staphylococcus aureus wyosobnionych od świń, kur oraz z mięsa wieprzowego

Bardziej szczegółowo

AmpliTest TBEV (Real Time PCR)

AmpliTest TBEV (Real Time PCR) AmpliTest TBEV (Real Time PCR) Zestaw do wykrywania sekwencji RNA specyficznych dla TBEV (Tick-borne encephalitis virus) techniką Real Time PCR Nr kat.: RV03-50 Wielkość zestawu: 50 oznaczeń Objętość pojedynczej

Bardziej szczegółowo

WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH UŻYWANYCH W PROGRAMACH HODOWLANYCH JABŁONI.

WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH UŻYWANYCH W PROGRAMACH HODOWLANYCH JABŁONI. Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) MAŁGORZATA KORBIN, SYLWIA KELLER-PRZYBYŁKOWICZ, EDWARD ŻURAWICZ WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH

Bardziej szczegółowo

Ocena pracy doktorskiej mgr inż. Eweliny Szacawy

Ocena pracy doktorskiej mgr inż. Eweliny Szacawy Dr hab. Marek Gehrke, prof. nadzw. UP Instytut Weterynarii Wydział Medycyny Weterynaryjnej i Nauk o Zwierzętach Uniwersytet Przyrodniczy w Poznaniu Poznań, dn. 9.03.2016 r. Ocena pracy doktorskiej mgr

Bardziej szczegółowo

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku

Justyna Krystyna Ciepły Nr albumu 41624. Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008 roku Warszawski Uniwersytet Medyczny Wydział Farmaceutyczny Oddział Analityki Medycznej Justyna Krystyna Ciepły Nr albumu 41624 Charakterystyka lekoopornych szczepów wirusa HIV 1 izolowanych w Polsce w 2008

Bardziej szczegółowo

OFERTA TEMATÓW PRAC DYPLOMOWYCH (MAGISTERSKICH) do zrealizowania w Katedrze MIKROBIOLOGII

OFERTA TEMATÓW PRAC DYPLOMOWYCH (MAGISTERSKICH) do zrealizowania w Katedrze MIKROBIOLOGII OFERTA TEMATÓW PRAC DYPLOMOWYCH (MAGISTERSKICH) do zrealizowania w Katedrze MIKROBIOLOGII Opracowanie zestawu do wykrywania DNA Aspergillus flavus za pomocą specjalistycznego sprzętu medycznego. Jednym

Bardziej szczegółowo

Sytuacja epidemiologiczna choroby meningokokowej w województwie

Sytuacja epidemiologiczna choroby meningokokowej w województwie Sytuacja epidemiologiczna choroby meningokokowej w województwie śląskim w latach 07-. Analizie poddano zgłoszenia zachorowań na chorobę meningokokową w latach 07- na terenie województwa śląskiego. ZakaŜenia

Bardziej szczegółowo

Tarczyca a ciąża. Kraków 22-23 października 2010. www.tarczycaciaza.cm-uj.krakow.pl

Tarczyca a ciąża. Kraków 22-23 października 2010. www.tarczycaciaza.cm-uj.krakow.pl Tarczyca a ciąża Kraków 22-23 października 2010 Organizator: Katedra i Klinika Endokrynologii Uniwersytetu Jagiellońskiego Collegium Medicum www.tarczycaciaza.cm-uj.krakow.pl Szanowni Państwo, Drogie Koleżanki,

Bardziej szczegółowo

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu Protokół pochodzi ze strony molekularnie.wordpress.com Kopiowanie i rozpowszechnianie wyłącznie w całości, z zachowaniem praw autorskich zgodnie z zasadami licencji GNU Dziękuję za uszanowanie mojej pracy,

Bardziej szczegółowo

Sequence-based typing molekularne typowanie szczepów Legionella pneumophila w ramach międzynarodowego sprawdzianu external quality assessment

Sequence-based typing molekularne typowanie szczepów Legionella pneumophila w ramach międzynarodowego sprawdzianu external quality assessment MED. DOŚW. MIKROBIOL., 2013, 65: 103-110 Sequence-based typing molekularne typowanie szczepów Legionella pneumophila w ramach międzynarodowego sprawdzianu external quality assessment Sequence-based typing

Bardziej szczegółowo

tkanki płucnej obecność App i Ss stwierdzono odpowiednio w 6,6% i 22,2% próbek. W

tkanki płucnej obecność App i Ss stwierdzono odpowiednio w 6,6% i 22,2% próbek. W STRESZCZENIE Obecnie jednym z głównych problemów zdrowia świń w krajach rolniczo rozwniętych są zakażenia układu oddechowego o charakterze wieloczynnikowym, określane jako zespół chorobowy układu oddechowego

Bardziej szczegółowo

Rekomendacje diagnostyczne inwazyjnych zakażeń bakteryjnych nabytych poza szpitalem M. Kadłubowski, A. Skoczyńska, W. Hryniewicz, KOROUN, NIL, 2009

Rekomendacje diagnostyczne inwazyjnych zakażeń bakteryjnych nabytych poza szpitalem M. Kadłubowski, A. Skoczyńska, W. Hryniewicz, KOROUN, NIL, 2009 Opracowanie: Marcin Kadłubowski, Anna Skoczyńska, Waleria Hryniewicz Krajowy Ośrodek Referencyjny ds. Diagnostyki Bakteryjnych Zakażeń Ośrodkowego Układu Nerwowego (KOROUN) Zakład Epidemiologii i Mikrobiologii

Bardziej szczegółowo

Monitoring genetyczny populacji wilka (Canis lupus) jako nowy element monitoringu stanu populacji dużych drapieżników

Monitoring genetyczny populacji wilka (Canis lupus) jako nowy element monitoringu stanu populacji dużych drapieżników Monitoring genetyczny populacji wilka (Canis lupus) jako nowy element monitoringu stanu populacji dużych drapieżników Wojciech Śmietana Co to jest monitoring genetyczny? Monitoring genetyczny to regularnie

Bardziej szczegółowo

UCHWAŁA Nr XXXIII/332/2013

UCHWAŁA Nr XXXIII/332/2013 UCHWAŁA Nr XXXIII/332/2013 Rady Miejskiej w Nowym Warpnie z dnia 26 września 2013 r. w sprawie realizacji w 2013 roku Programu profilaktycznego przeciwko zakażeniom pneumokokowym wśród dzieci po 2 r.ż.

Bardziej szczegółowo

Europejska Komisja ds. Kontrolowania Pryszczycy (EUFMD) Vademecum wykrywania ogniska pryszczycy i dochodzenia Wersja 1 (12/2009)

Europejska Komisja ds. Kontrolowania Pryszczycy (EUFMD) Vademecum wykrywania ogniska pryszczycy i dochodzenia Wersja 1 (12/2009) Europejska Komisja ds. Kontrolowania Pryszczycy (EUFMD) Vademecum wykrywania ogniska pryszczycy i dochodzenia Wersja 1 (12/2009) Wstęp: Poniższy dokument został sporządzony przez Sekretariat Komisji aby

Bardziej szczegółowo

AKTUALNOÂCI BINET. Drogie Koleżanki i Koledzy! Nr 5 / styczeƒ 2010. www.koroun.edu.pl

AKTUALNOÂCI BINET. Drogie Koleżanki i Koledzy! Nr 5 / styczeƒ 2010. www.koroun.edu.pl www.koroun.edu.pl Drogie Koleżanki i Koledzy! Witam serdecznie w Nowym Roku oddając w Państwa ręce piąty numer AKTUALNOŚCI BINET. Poświecony on jest m. in. zakażeniom inwazyjnym wywoływanym przez Streptococcus

Bardziej szczegółowo

głównie do cytowania Rekomendacji Polskiego Towarzystwa Ginekologicznego. Test podwójny jest omówiony pobieżnie i Autor poświęca mu znacznie mniej

głównie do cytowania Rekomendacji Polskiego Towarzystwa Ginekologicznego. Test podwójny jest omówiony pobieżnie i Autor poświęca mu znacznie mniej Warszawa 22.12.2016 Recenzja rozprawy na stopień doktora nauk medycznych lekarza Jacka Więcka pt. Analiza wad rozwojowych u płodów i noworodków w oparciu o program badań prenatalnych w województwie opolskim

Bardziej szczegółowo

Ćwiczenie: Wybrane zagadnienia z korelacji i regresji.

Ćwiczenie: Wybrane zagadnienia z korelacji i regresji. Ćwiczenie: Wybrane zagadnienia z korelacji i regresji. W statystyce stopień zależności między cechami można wyrazić wg następującej skali: Skala Guillforda Przedział Zależność Współczynnik [0,00±0,20)

Bardziej szczegółowo

Katarzyna Durda STRESZCZENIE STĘŻENIE KWASU FOLIOWEGO ORAZ ZMIANY W OBRĘBIE GENÓW REGULUJĄCYCH JEGO METABOLIZM JAKO CZYNNIK RYZYKA RAKA W POLSCE

Katarzyna Durda STRESZCZENIE STĘŻENIE KWASU FOLIOWEGO ORAZ ZMIANY W OBRĘBIE GENÓW REGULUJĄCYCH JEGO METABOLIZM JAKO CZYNNIK RYZYKA RAKA W POLSCE Pomorski Uniwersytet Medyczny Katarzyna Durda STRESZCZENIE STĘŻENIE KWASU FOLIOWEGO ORAZ ZMIANY W OBRĘBIE GENÓW REGULUJĄCYCH JEGO METABOLIZM JAKO CZYNNIK RYZYKA RAKA W POLSCE Promotor: dr hab. prof. nadzw.

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

The placental transfer of erythromycin in human pregnancies with group B streptococcal infection

The placental transfer of erythromycin in human pregnancies with group B streptococcal infection The placental transfer of erythromycin in human pregnancies with group B streptococcal infection Przepływ erytromycyny przez łożysko w ciąży powikłanej zakażeniem paciorkowcami grupy B 1 1 2 2 1 1 Chair

Bardziej szczegółowo

O P I N I A. Grupy Ekspertów na temat skuteczności szczepień ochronnych przeciwko Streptococcus pneumoniae. Warszawa, kwiecień 2014 PATRONATY

O P I N I A. Grupy Ekspertów na temat skuteczności szczepień ochronnych przeciwko Streptococcus pneumoniae. Warszawa, kwiecień 2014 PATRONATY OGEPneumokoki2_15.4.14 2014-04-23 21:57 Page 1 O P I N I A Grupy Ekspertów na temat skuteczności szczepień ochronnych przeciwko Streptococcus pneumoniae Warszawa, kwiecień 2014 PATRONATY Polskie Towarzystwo

Bardziej szczegółowo

Sylabus Biologia molekularna

Sylabus Biologia molekularna Sylabus Biologia molekularna 1. Metryczka Nazwa Wydziału Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej Program kształcenia Farmacja, jednolite studia magisterskie, forma studiów: stacjonarne

Bardziej szczegółowo

ZMIANY ODŻYWIANIA SIĘ KOBIET W CZASIE CIĄŻY

ZMIANY ODŻYWIANIA SIĘ KOBIET W CZASIE CIĄŻY Agnieszka Palka, Kamil Rzeźnikowski Akademia Morska w Gdyni ZMIANY ODŻYWIANIA SIĘ KOBIET W CZASIE CIĄŻY Dieta kobiety ciężarnej jest istotnym czynnikiem wpływającym na zdrowie zarówno matki, jak i dziecka.

Bardziej szczegółowo

Fizjologiczne i molekularne markery tolerancji buraka cukrowego na suszę. Dr Danuta Chołuj

Fizjologiczne i molekularne markery tolerancji buraka cukrowego na suszę. Dr Danuta Chołuj Fizjologiczne i molekularne markery tolerancji buraka cukrowego na suszę Dr Danuta Chołuj Szacunkowe straty plonu buraków cukrowych w Europie na skutek suszy kształtują się pomiędzy 5 a 30 % W jakiej fazie

Bardziej szczegółowo