(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 20.07.2007 07787764."

Transkrypt

1 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 4698 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: (1) Int. Cl. C12Q1/68 (06.01) (97) O udzieleniu patentu europejskiego ogłoszono: Urząd Patentowy Rzeczypospolitej Polskiej Europejski Biuletyn Patentowy /21 EP 4698 B1 (4) Tytuł wynalazku: SPOSÓB WYKRYWANIA MUTACJI EGFR W PRÓBKACH KRWI (30) Pierwszeństwo: EP (43) Zgłoszenie ogłoszono: Europejski Biuletyn Patentowy 09/16 (4) O złożeniu tłumaczenia patentu ogłoszono: 29.. Wiadomości Urzędu Patentowego / (73) Uprawniony z patentu: Pangaea Biotech, S.A., Barcelona, ES PL/EP 4698 T3 (72) Twórca (y) wynalazku: ROSELL COSTA Rafael, Badalona, ES TARÓN ROCA Miguel, Badalona, ES (74) Pełnomocnik: WTS Rzecznicy Patentowi rzecz. pat. Gdula Anna Wrocław ul. R. Weigla 12 Uwaga: W ciągu dziewięciu miesięcy od publikacji informacji o udzieleniu patentu europejskiego, każda osoba może wnieść do Europejskiego Urzędu Patentowego sprzeciw dotyczący udzielonego patentu europejskiego. Sprzeciw wnosi się w formie uzasadnionego na piśmie oświadczenia. Uważa się go za wniesiony dopiero z chwilą wniesienia opłaty za sprzeciw (Art. 99 (1) Konwencji o udzielaniu patentów europejskich).

2 2 SPOSÓB WYKRYWANIA MUTACJI EGFR W PRÓBKACH KRWI Opis DZIEDZINA WYNALAZKU [0001] Niniejszy wynalazek dotyczy wykrywania mutacji EGFR w próbce krwi (surowica/osocze) pobranej od pacjenta. TŁO WYNALAZKU [0002] Rak płuc stanowi główną przyczynę śmiertelności spowodowanej przez chorobę nowotworową, zarówno wśród mężczyzn, jak i kobiet. Pod względem występowania, rak płuc 1 jest drugi jedynie po raku prostaty u mężczyzn oraz po raku piersi u kobiet. Rak płuc ostatnio prześcignął chorobę serca jako główną przyczynę umieralności związanej z paleniem. Ponadto, większość pacjentów, u których rozwinął się rak płuc, pali i cierpi na związane z paleniem uszkodzenie serca i płuc, skutkując tym, że wykorzystanie agresywnych terapii chirurgicznych lub terapii wielotorowych staje się mniej realne. Większość nowotworów płuc jest diagnozowanych w stadium zaawansowanym, co skutkuje złym rokowaniem. [0003] Niedrobnokomórkowy rak płuc (NSCLC) stanowi w 2 przybliżeniu 7% wszystkich nowotworów płuc. NSCLC jest heterogenicznym skupiskiem postaci histologicznych. Najbardziej powszechne postacie histologiczne obejmują raka

3 3 naskórkowego lub płaskokomórkowego, gruczolakoraka, oraz raka wielkokomórkowego. [0004] W wielu badaniach podjęto próby zidentyfikowania klinicznych, laboratoryjnych, i molekularnych markerów, które mogą pomóc klinicystom i badaczom w rozróżnieniu podgrup pacjentów NSCLC. Podobnie, rozmaite badania pokazały nadekspresję receptora czynnika wzrostu naskórka (EGFR) w 40 do 80 procentach niedrobnokomórkowych raków płuc oraz w wielu innych rakach nabłonkowych. [000] Nieprawidłowa sygnalizacja receptora czynnika wzrostu naskórka (EGFR) jest krytyczna dla ograniczania wrażliwości na środki przeciwnowotworowe i niezależna od liganda aktywacja kinazy tyrozynowej EGFR jest często powodowana przez mutacje EGFR w domenie zewnątrzkomórkowej, 1 które zostały zaobserwowane w rozmaitych typach guzów, takich jak glejak wielopostaciowy. Sygnalizacja EGFR jest uruchamiana przez wiązanie czynników wzrostu, takich jak czynnik wzrostu naskórka (EGF). Autofosforylacja i transfosforylacja receptorów poprzez ich domeny kinazy tyrozynowej prowadzi do rekrutacji efektorów w dół szlaku sygnałowego oraz aktywacji sygnałów proliferacyjnych i decydujących o przeżyciu komórki. [0006] Dwie mutacje stanowią w przybliżeniu 90% mutacji EGFR dotychczas opisanych w gruczolakorakach płuc. W 2 populacji kaukaskiej, najbardziej powszechnym typem mutacji obserwowanym w około 6% przypadków z mutacjami EGFR, jest krótka nie prowadząca do przesunięcia ramki odczytu delecja 9, 12, 1, 18 lub 24 nukleotydów w eksonie 19. Drugą

4 4 najbardziej powszechną mutacją, obserwowaną w około 3% przypadków z mutacjami EGFR, jest mutacja punktowa (CTG do CGG) w eksonie 21 przy nukleotydzie 273, która powoduje podstawienie leucyny przez argininę przy kodonie 88 (L88R) sąsiadującym z motywem DFG w płacie C-terminalnym w pętli aktywacyjnej kinazy. [0007] Te mutacje EGFR są autentycznymi somatycznymi mutacjami w NSCLC i nie zostały zidentyfikowane w innych typach guzów pierwotnych. Co więcej, mutacje EGFR stanowią silny czynnik determinujący odpowiedź guza na gefitinib w niedrobnokomórkowym raku płuc (NSCLC). Inne opisane mutacje, znacznie mniej powszechne, występują w eksonach 18,, i 21. [0008] Dotychczas, badania mające na celu wykrycie tych mutacji były oparte na bezpośrednim sekwencjonowaniu lub 1 analizie poliformizmu jednoniciowego DNA. Metody amplifikacji kwasu nukleinowego (na przykład, reakcja łańcuchowa polimerazy) umożliwiają wykrywanie małych ilości zmutowanych cząsteczek na tle cząsteczek prawidłowych. Chociaż alternatywne metody wykrywania małych ilości komórek guza (takie jak cytometria przepływowa) są na ogół ograniczone do chorób rozrostowych układu krwiotwórczego, testy bazujące na amplifikacji kwasu nukleinowego okazały się być zarówno czułe i specyficzne w identyfikowaniu komórek inwazyjnych, jak i w przewidywaniu rokowania po chemioterapii. 2 [0009] Opracowano rozmaite strategie amplifikacji kwasu nukleinowego do wykrywania małych ilości zmutowanych cząsteczek w tkance guzów litych. Na przykład, jedna czuła i specyficzna metoda identyfikuje DNA zmutowanego onkogenu ras

5 na podstawie niepowodzenia w odszczepieniu miejsca działania enzymu restrykcyjnego przy kluczowym 12-tym kodonie (Kahn i in., Rapid and sensitive nonradioactive detection of mutant K-ras genes via enriched PCR amplification. Oncogene. Czerwiec 1991; 6(6):79-83). Podobne protokoły mogą być stosowane do wykrywania dowolnego zmutowanego obszaru DNA w nowotworze, umożliwiając detekcję DNA innego onkogenu lub DNA towarzyszącego guzom. Ponieważ zmutowany DNA może być wykrywany nie tylko w raku pierwotnym, lecz zarówno w prekursorowych zmianach patologicznych, jak i w miejscach przerzutów nowotworowych, testy z zastosowaniem amplifikacji kwasu nukleinowego dostarczają metody wykrywania i monitorowania raka we wczesnym i w późniejszym przebiegu choroby. 1 [00] W innych badaniach wykorzystywane są testy oparte na amplifikacji kwasu nukleinowego do analizy krwi obwodowej pacjentów cierpiących na raka, w celu wykrywania wewnątrzkomórkowego DNA wyekstrahowanego z cyrkulujących komórek rakowych u pacjentów. Jednakże, należy podkreślić, że w tych badaniach próbuje się wykorzystać testy bazujące na amplifikacji kwasu nukleinowego w celu wykrywania wyekstrahowanego wewnątrzkomórkowego DNA w cyrkulujących komórkach rakowych. Test jest prowadzony na frakcji komórkowej krwi od pacjentów cierpiących na raka, przy 2 zastosowaniu osadu komórkowego lub komórek zawartych w pełnej krwi, natomiast frakcja surowicy lub osocza jest zazwyczaj pomijana lub odrzucana przed analizą. Ponieważ takie podejście wymaga obecności tworzących przerzuty,

6 6 cyrkulujących komórek rakowych (w przypadku guzów niehematologicznych), ma ograniczone zastosowanie kliniczne u pacjentów z wczesnymi rakami, i nie jest użyteczne w wykrywaniu niehematologicznych nieinwazyjnych nowotworów lub stanów przed powstawaniem przerzutów. [0011] Ze stanu techniki wiadomo, że małe lecz znaczące ilości prawidłowego DNA krążą we krwi zdrowych ludzi i stwierdzono, że ta ilość wzrasta w stanach rakowych. Stan techniki zawiera ujawnienie, że DNA zmutowanego onkogenu może być wykryty w osoczu lub surowicy krwi obwodowej pacjentów cierpiących na raka. Jednakże, te doniesienia są także na ogół ograniczone do pacjentów z zaawansowanym rakiem lub ze stwierdzoną chorobą nowotworową lub proliferacyjną. Niektórzy autorzy (Kimura i in., 06. EGFR Mutation of Tumor and Serum 1 in Gefitinib-Treated Pacjents with Chemotherapy-Naive Non- small Cell Lung Cancer) opisali, że mutacje genu EGFR mogą być wykrywane w próbkach surowicy od pacjentów cierpiących na NSCLC. W wymienionym dokumencie opisano wykrywanie takich mutacji z wykorzystaniem PCR i sekwencjonowania, stosując startery flankujące wymienione mutacje. ISTOTA WYNALAZKU [0012] Niniejszy wynalazek dotyczy sposobu wykrywania 2 mutacji genu EGFR w próbce krwi pobranej od pacjenta, przy czym wymieniony sposób obejmuje etapy, w których: (i) otrzymuje się DNA z wymienionej próbki;

7 7 (ii) amplifikuje się sekwencję kwasu nukleinowego odpowiadającą specyficznemu obszarowi genu EGFR z wykorzystaniem PCR, stosując sondę z kwasu peptydonukleinowego PNA, przy czym wymieniona sonda z kwasu peptydonukleinowego PNA jest zdolna do specyficznego rozpoznawania i hybrydyzowania z sekwencją EGFR dzikiego typu, tym samym hamując jej amplifikację; i (iii) wykrywa się wymienioną mutację. [0013] W tym zgłoszeniu, wynalazcy opracowali i potwierdzili działanie testu bazującego na reakcji łańcuchowej polimerazy (PCR) do wykrywania najbardziej powszechnych mutacji EGFR w próbkach osocza/surowicy. Ten test zapewnia większą czułość analityczną, dzięki zwiększeniu 1 amplifikacji zmutowanych alleli w próbkach przeznaczonych do analizy, stosując sondę z kwasu peptydonukleinowego (PNA), w porównaniu do standardowych metod, w których startery flankujące mutacje są wykorzystywane do amplifikacji PCR i dalszej analizy sekwencjonowania. W ten sposób, wynalazek dostarcza wydajne i przystępne podejście do szybkiej identyfikacji większości pacjentów z rakiem płuc, którzy prawdopodobnie będą odpowiadać na leczenie z zastosowaniem specyficznych inhibitorów EGFR. [0014] Dodatkowo, podczas gdy bezpośrednia analiza 2 tkanki nowotworowej jest często trudna lub niemożliwa (tak jak w przypadkach ukrytej, nierozpoznanej choroby), zaletą opisanego powyżej sposobu jest wykorzystywanie krwi, takiej jak krew obwodowa, do wykrywania wymienionej mutacji. Krew

8 8 obwodowa jest łatwo dostępna i nadająca się do testów bazujących na kwasie nukleinowym. SZCZEGÓŁOWY OPIS WYNALAZKU [001] W celu ułatwienia zrozumienia niniejszego opisu, znaczenie niektórych terminów i wyrażeń w kontekście według wynalazku zostanie wyjaśnione poniżej: Stosowany tu termin pacjent dotyczy człowiek płci męskiej lub żeńskiej, dowolnego wieku lub rasy. Korzystnie, termin ten obejmuje ludzi cierpiących na niedrobnokomórkowego raka płuc (NSCLC) lub, u których istnieje podejrzenie tej choroby. Metody diagnozowania NSCLC i opis kliniczny 1 rozpoznania NSCLC są dobrze znane przeciętnemu specjaliście w dziedzinach medycyny. Przykładowo, metody identyfikowania pacjentów, u których podejrzewa się NSCLC mogą obejmować badanie przedmiotowe, rodzinny wywiad chorobowy pacjenta, wywiad chorobowy pacjenta, biopsję płuca, lub liczne techniki obrazowania, takie jak ultrasonografia. Stosowany tu termin kwas nukleinowy dotyczy wielomerowego związku obejmującego nukleozydy lub analogi nukleozydów zawierających azotowe zasady heterocykliczne, lub analogi zasad, które są połączone przez wiązania 2 fosfodiestrowe z wytworzeniem polinukleotydu. Stosowany tu termin DNA dotyczy kwasu dezoksyrybonukleinowego. Sekwencja DNA oznacza sekwencję dezoksyrybonukleinową. DNA oznacza długi polimer składający

9 9 się z nukleotydów, który koduje sekwencję reszt aminokwasowych w białkach z zastosowaniem kodu genetycznego. Stosowany tu termin sonda z kwasu peptydonukleinowego dotyczy syntetycznego analogu DNA, w którym fosfodiestrowy łańcuch główny jest zastąpiony przez powtarzające się jednostki N-(2-aminoetylo)glicyny, do których przyłączone są zasady purynowe i pirymidynowe z wykorzystaniem łączącej grupy metylokarbonylowej. [0016] W jednym aspekcie, wynalazek dotyczy sposobu, oznaczanego w niniejszym opisie jako sposób według wynalazku, wykrywania mutacji genu EGFR w próbce krwi pobranej od pacjenta, przy czym wymieniony sposób obejmuje etapy, w których: 1 (i) otrzymuje się DNA z wymienionej próbki; (ii) amplifikuje się sekwencję kwasu nukleinowego odpowiadającą specyficznemu obszarowi genu EGFR z wykorzystaniem PCR, stosując sondę z kwasu peptydonukleinowego PNA, przy czym wymieniona sonda z kwasu peptydonukleinowego PNA jest zdolna do specyficznego rozpoznawania i hybrydyzowania z sekwencją EGFR dzikiego typu, tym samym hamując jej amplifikację; i (iii) wykrywa się wymienioną mutację. 2 [0017] Sposób według wynalazku może być stosowany do wykrywania dowolnej mutacji genu EGFR. W szczególnej realizacji według wynalazku, wykrywana mutacja genu EGFR jest

10 wybrana z grupy obejmującej mutacje, takie jak delecje ELREA przy eksonie 19, mutacja L88R przy eksonie 21 oraz mutacja T790M. Próbki [0018] Ilustrujące, nieograniczające przykłady próbek, z których kwasy nukleinowe mogą być ekstrahowane i analizowane sposobem według wynalazku obejmują, między innymi próbki, takie jak prawidłowa i nowotworowa krew (surowica lub osocze) i inne płyny ustrojowe zawierające kwasy nukleinowe, które mogą być wykrywane. [0019] W celu realizacji sposobu według wynalazku, próbka jest pobierana od pacjenta podczas badania. W 1 szczególnej realizacji, próbką jest próbka krwi. Próbki mogą być otrzymywane od pacjentów, u których uprzednio zdiagnozowano NSCLC, lub u których nie zdiagnozowano NSCLC, lub od pacjentów, którzy obecnie są poddawani leczeniu przeciwko NSCLC, lub którzy byli uprzednio leczeniu przeciwko NSCLC. W realizacji, próbką jest próbka od pacjenta posiadającego prawidłowo funkcjonującą tkankę płuc, tj. pacjenta bez objawów NSCLC. [00] W praktyce według wynalazku, krew jest pobierana z wykorzystaniem standardowych metod do probówki do 2 pobierania próbek, korzystnie z silikonizowanego szkła, bez dodatku antykoagulanta do przygotowywania surowicy lub z EDTA, heparyny, lub podobnych antykoagulantów, najbardziej korzystnie EDTA, do przygotowywania osocza. Osocze może być

11 11 opcjonalnie następnie przekształcone w surowicę na drodze inkubacji antykoagulowanego osocza z równą objętością chlorku wapnia, w temperaturze 37 C, przez krótki okres czasu, najbardziej korzystnie przez 1-3 minuty, do momentu wystąpienia krzepnięcia. Skrzeplina może następnie być osadzana z wykorzystaniem krótkiego odwirowywania i pozbawione białka osocze usuwa się do innej probówki. Alternatywnie, odwirowywanie może zostać pominięte. Surowica może także być otrzymywana, stosując probówki ze środkiem aktywującym krzepnięcie. Amplifikacja DNA [0021] W szczególnej realizacji według wynalazku, 1 surowica lub osocze mogą być stosowane bezpośrednio do identyfikacji zmutowanego DNA. W kolejnej szczególnej realizacji, kwas nukleinowy jest ekstrahowany z osocza lub surowicy w początkowym etapie według wynalazku. W takich przypadkach, całkowity DNA wyekstrahowany z wymienionych próbek może reprezentować materiał roboczy odpowiedni do następnej amplifikacji. [0022] Po otrzymaniu próbki, przeprowadza się amplifikację kwasu nukleinowego. W szczególnej realizacji, amplifikacja DNA jest prowadzona z wykorzystaniem PCR. Ogólne 2 zasady i warunki prowadzenia amplifikacji i wykrywania kwasów nukleinowych, takie jak z zastosowaniem PCR, są dobrze znane specjaliście w dziedzinie. W szczególności, reakcja łańcuchowa polimerazy (PCR) prowadzona sposobem według

12 12 niniejszego wynalazku wykorzystuje odpowiednie i specyficzne startery oligonukleotydowe lub oligonukleotydy do amplifikacji w celu specyficznego amplifikowania docelowych sekwencji EGFR. Ilustrujące, nieograniczające, przykłady takich oligonukleotydów do amplifikacji obejmują sekwencje o SEQ ID NO: 1 i SEQ ID NO: 2. Terminy startery oligonukleotydowe lub oligonukleotydy do amplifikacji są stosowane w niniejszym opisie zamiennie i dotyczą polimerowego kwasu nukleinowego zawierającego na ogół mniej niż 00 reszt, obejmując kwasy o wielkościach w zakresie o dolnej granicy wynoszącej około 2 do reszt i górnej granicy wynoszącej około 00 do 900 reszt. W korzystnych realizacjach, startery oligonukleotydowe mają wielkości w zakresie o dolnej granicy wynoszącej około do około 1 1 reszt i górnej granicy wynoszącej około 0 do 0 reszt. Bardziej korzystnie, startery oligonukleotydowe według niniejszego wynalazku mają wielkości w zakresie o dolnej granicy wynoszącej około do około 1 reszt i górnej granicy wynoszącej około 17 do 0 reszt. Chociaż startery oligonukleotydowe mogą być oczyszczane z naturalnie występujących kwasów nukleinowych, są one na ogół syntetyzowane z zastosowaniem dowolnej spośród rozmaitych dobrze znanych metod enzymatycznych lub chemicznych. W szczególnej realizacji według wynalazku, takie startery 2 oligonukleotydowe umożliwiają specyficzną amplifikację fragmentów DNA odpowiadających delecji specyficznych nukleotydów w eksonie 19 genu EGFR.

13 13 [0023] A zatem, w szczególnej realizacji, sposób według wynalazku może być stosowany do wykrywania delecji ELREA przy eksonie 19. W korzystnej realizacji, niniejszy wynalazek dotyczy sposobu wykrywania delecji 9, 12, 1, 18, lub 24 nukleotydów w eksonie 19 genu EGFR. W kolejnej szczególnej realizacji, sposób według wynalazku może być stosowany do wykrywania mutacji L88R przy eksonie 21 genu EGFR. W kolejnej realizacji, sposób według wynalazku może być stosowany do wykrywania mutacji T790M w genie EGFR. [0024] Stosowany tu termin oligonukleotyd do amplifikacji dotyczy oligonukleotydu, który hybrydyzuje z docelowym kwasem nukleinowym, lub jego dopełnieniem, i bierze udział w reakcji amplifikacji kwasu nukleinowego. Oligonukleotydy do amplifikacji obejmują startery i startery 1 promotorowe, w których koniec 3 oligonukleotydu jest przedłużony enzymatycznie z zastosowaniem nici innego kwasu nukleinowego jako matrycy. W pewnych realizacjach, oligonukleotyd do amplifikacji zawiera co najmniej około przylegających zasad, i bardziej korzystnie około 12 przylegających zasad, które są komplementarne do obszaru docelowej sekwencji (lub jej komplementarnej nici). Wiążące się z docelowym miejscem zasady są korzystnie w co najmniej około 80%, i bardziej korzystnie około 90% do 0% komplementarne do sekwencji, z którą się wiążą. 2 Oligonukleotyd do amplifikacji zawiera korzystnie od około do około 60 zasad i może obejmować zmodyfikowane nukleotydy lub analogi zasad.

14 14 [002] Stosowane tu terminy amplifikować lub amplifikacja dotyczą procedury wytwarzania wielokrotnych kopi docelowej sekwencji kwasu nukleinowego lub jej dopełnienia lub jej fragmentów (tj., produkt amplifikacji może zawierać mniejszy fragment niż całkowita docelowa sekwencja). Na przykład, mogą być wytwarzane fragmenty poprzez amplifikację części docelowego kwasu nukleinowego z zastosowaniem oligonukleotydu do amplifikacji, który hybrydyzuje się z wewnętrznym miejscem docelowego kwasu nukleinowego i zapoczątkowuje polimeryzację od tego miejsca. Znane metody amplifikacji obejmują, na przykład, amplifikację bazującą na reakcji łańcuchowej polimerazy (PCR), amplifikację, w której pośredniczy replikaza, amplifikację bazującą na łańcuchowej reakcji ligazy (LCR), amplifikację z 1 wykorzystaniem techniki zastępowania nici (SDA) i amplifikację opartą o transkrypcję, lub w której pośredniczy transkrypcja (TMA). Amplifikacja PCR wykorzystuje polimerazę DNA, startery dla przeciwległych nici i cykliczne ogrzewanie do syntezowania wielokrotnych kopii DNA lub cdna. Amplifikacja, w której pośredniczy replikaza wykorzystuje QB- replikazę do amplifikacji sekwencji RNA. Amplifikacja LCR wykorzystuje co najmniej cztery różne oligonukleotydy do amplifikacji komplementarnych nici docelowej sekwencji z zastosowaniem cyklicznie powtarzających się etapów 2 hybrydyzacji, ligacji i denaturacji. SDA wykorzystuje starter, który zawiera miejsce rozpoznawane przez endonukleazę restrykcyjną oraz endonukleazę, która nacina jedną nić zmodyfikowanego w połowie podwójnego DNA

15 1 zawierającą docelową sekwencję, po czym następuje seria etapów wydłużania startera i zastępowania nici. Izotermiczna amplifikacja z wykorzystaniem techniki zastępowania nici, która nie polega na nacinaniu przy zastosowaniu endonukleazy, jest także znana. Amplifikacja oparta na transkrypcji, lub w której pośredniczy transkrypcja wykorzystuje starter, który zawiera sekwencję promotorową oraz polimerazę RNA specyficzną dla promotora w celu wytworzenia zwielokrotnionych transkryptów docelowej sekwencji, w ten sposób amplifikując docelową sekwencję. [0026] W korzystnych realizacjach według niniejszego wynalazku amplifikuje się docelowe sekwencje EGFR z zastosowaniem niniejszych oligonukleotydów do amplifikacji w amplifikacji metodą reakcji łańcuchowej polimerazy (PCR). 1 Specjalista w dziedzinie będzie zdawał sobie sprawę z tego, że te oligonukleotydy do amplifikacji mogą być łatwo stosowane w innych metodach amplifikacji kwasu nukleinowego, które wykorzystują wydłużanie startera za pośrednictwem polimerazy. [0027] W etapie amplifikacji sposobem według wynalazku, sekwencja kwasu nukleinowego odpowiadająca specyficznemu obszarowi genu EGFR jest amplifikowana z wykorzystaniem PCR, stosując sondę z kwasu peptydonukleinowego (PNA). Sondami PNA są analogi kwasu nukleinowego, w których szkielet z fosforanu 2 cukru naturalnego kwasu nukleinowego został zastąpiony przez syntetyczny peptydowy łańcuch główny, zazwyczaj utworzony z jednostek N-(2-aminoetylo)glicyny, tworząc achiralny i nienaładowany analog. Ta nowa cząsteczka jest chemicznie

16 16 trwała i odporna na hydrolityczny (enzymatyczny) rozkład, dlatego też oczekuje się, że nie ulegnie degradacji wewnątrz żywej komórki. Pomimo tych wszystkich zmian w porównaniu do naturalnych kwasów nukleinowych, PNA jest wciąż zdolny do specyficznego względem sekwencji wiązania się do DNA, jak również RNA, stosownie do reguł tworzenia wiązań wodorowych Watson a-crick a. Jego kompleksy hybrydowe wykazują nadzwyczajną termostabilność i unikalne właściwości dotyczące siły jonowej. W przypadku wielu zastosowań, sondy PNA są korzystne jako sondy do kwasu nukleinowego, ponieważ w przeciwieństwie do dupleksów kwas nukleinowy/kwas nukleinowy, które są destabilizowane w warunkach o małej zawartości soli, dupleksy PNA/kwas nukleinowy są tworzone i pozostają stabilne w warunkach o bardzo małej zawartości soli. Przeciętny 1 specjalista w dziedzinie hybrydyzacji kwasu nukleinowego rozpozna, że czynniki powszechnie stosowane do narzucania lub kontrolowania rygorystyczności hybrydyzacji obejmują stężenie formamidu (lub innego chemicznego reagenta denaturującego), stężenie soli (tj., siła jonowa), temperatura hybrydyzacji, stężenie detergentu, ph i obecność lub brak czynników chaotropowych. Optymalna rygorystyczność dla kombinacji sonda/docelowa sekwencja jest często określana z wykorzystaniem dobrze znanej techniki łączenia kilku wymienionych powyżej czynników ograniczających i następnie 2 wyznaczania efektu zmiany pojedynczego czynnika ograniczającego. Te same czynniki ograniczające mogą być modulowane w celu kontrolowania rygorystyczności hybrydyzacji sondy PNA z kwasem nukleinowym, z tym wyjątkiem, że

17 17 hybrydyzacja sondy PNA jest całkowicie niezależna od siły jonowej. Optymalna rygorystyczność dla testu może być wyznaczana doświadczalnie na drodze badania każdego czynnika ograniczającego, do momentu osiągnięcia pożądanego stopnia rozróżnienia. [0028] Oligomery PNA mogą być wytwarzane zgodnie ze standardowymi protokołami syntezy w fazie stałej dla peptydów (Merrifield, B Solid-phase synthesis. Science 232, ), stosując, na przykład, polistyrenową żywicę (metylobenzhydrylo)aminową jako stały nośnik. Sondy PNA mogą mieć strukturę chmieryczną, taką jak chimera PNA/DNA, w której oligomer PNA jest skondensowany z oligomerem DNA. [0029] Próbki kliniczne zawierają cząsteczki DNA z allelami dzikiego typu oprócz cząsteczek DNA ze zmutowanymi 1 allelami. Dlatego też, w normalnych warunkach, trudne jest wykrywanie mutacji EGFR (zmutowanych alleli) na tle dużych ilości genów EGFR dzikiego typu (allele dzikiego typu). Sonda PNA wykorzystywana przez wynalazców jest zdolna do specyficznego rozpoznawania i hybrydyzowania z sekwencją EGFR dzikiego typu. Jako ilustrujący, nieograniczający przykład, sonda PNA do zastosowania w sposobie według niniejszego wynalazku obejmuje sondę PNA opisaną jako SEQ ID NO:3 w przykładzie towarzyszącym niniejszemu wynalazkowi. Taka sonda jest dodawana do mieszaniny reakcyjnej PCR, w ten sposób 2 hamując amplifikację alleli dzikiego typu i sprzyjając amplifikacji zmutowanych alleli obecnych w próbce, tj. zmutowanego EGFR, ułatwiając jego późniejszą detekcję. Przeciętny specjalista w dziedzinie będzie zdawał sobie

18 18 sprawę z tego, że odpowiednia sonda PNA nie musi mieć dokładnie tych sekwencji sondujących kwas nukleinowy, ażeby była czynna, lecz często jest modyfikowana stosownie do poszczególnych warunków prowadzenia testu. Na przykład, krótsze sondy PNA mogą być wytwarzane przez obcinanie sekwencji kwasu nukleinowego, w przypadku, gdy stabilność hybrydy musi zostać zmodyfikowana, ażeby w ten sposób obniżyć Tm i/lub uregulować ze względu na rygorystyczność. Podobnie, sekwencja kwasu nukleinowego może być obcinana przy jednym końcu i wydłużana przy drugim końcu, tak długo jak odróżniająca sekwencja kwasu nukleinowego pozostaje w ramach sekwencji sondy PNA. Takie odmiany sondujących sekwencji kwasu nukleinowego w zakresie parametrów tu opisanych są rozważane jako realizacje według niniejszego wynalazku. 1 [0030] Jak można zaobserwować w przykładzie 1 według niniejszego wynalazku, warunki reakcji łańcuchowej polimerazy, stosując taką sondę PNA w metodzie według niniejszego wynalazku, charakteryzują się tym, że wymagane jest przeprowadzenie jedynie 40 cykli amplifikacji, co jest wystarczające do otrzymania dokładnego produktu amplifikacji PCR zawierającego fragment genomowy o długości 1 bp, zawierający mutację interesującego eksonu 19 genu EGFR. [0031] Ogólne warunki dla reakcji PCR sposobem według niniejszego wynalazku są takie, jak zilustrowano w 2 przykładzie 1 według niniejszego wynalazku. W tym przykładzie, DNA stosowane w reakcji amplifikacji PCR pochodzi z próbek osocza/surowicy.

19 19 Wykrywanie mutacji DNA [0032] Wiele metod wykrywania i analizowania produktów amplifikacji PCR zostało wcześniej ujawnionych. Szczególnie, wykrywanie sekwencji zmutowanych DNA można prowadzić z wykorzystaniem dowolnej spośród licznych metod znanych specjalistom w dziedzinie (Kilger i in., 1997, Nucleic Acids Res. 2: 32-4). W szczególnej realizacji według wynalazku, etap wykrywania w metodzie według wynalazku jest prowadzony z wykorzystaniem sekwencjonowania kwasu nukleinowego. Ilustrujące, nieograniczające przykłady metod sekwencjonowania kwasu nukleinowego obejmują sekwencjonowanie cykliczne (Sarkar i in., 199, Nucleic Acids Res. 23: ) lub bezpośrednie sekwencjonowanie dideoksynukleotydowe, w 1 którym część lub cały interesujący DNA zebrany z próbki jest stosowany jako matryca do reakcji sekwencjonowania. W standardowych reakcjach sekwencjonowania stosowany jest starter oligonukleotydowy lub zestaw starterów specyficznych dla interesującego genu lub DNA. Inne metody sekwencjonowania DNA, takie jak sekwencjonowanie z wykorzystaniem hybrydyzacji, sekwencjonowanie z zastosowaniem chipu zawierającego wiele oligonukleotydów do hybrydyzacji (jak, na przykład, te wytwarzane przez Affymetrix Corp.; Ramsay i in., 1998, Nature Biotechnology 16: 40-44; Marshall i in., 1998, 2 Nature Biotechnology 16: 27-31), sekwencjonowanie z wykorzystaniem HPLC (DeDionisio i in., 1996, J Chromatogr A 73: 191-8), i modyfikacje strategii sekwencjonowania DNA, takie jak multipleksowy test diagnostyczny specyficzny

20 względem alleli (MASDA; Shuber i in., 1997, Hum. Molec. Genet. 6: ), sekwencjonowanie dideoksynukleotydowe typu genetyczny odcisk palca (Sarkar i in., 1992, Genomics 13: 441-3;; Martincic i in., 1996, Oncogene 13: 39-44), i metody PCR oparte na sondzie fluoropochodnej (takie jak Taqman; Perkin-Elmer Corp.; Heid i in., 1996, Genome Res. 6: ) i metody wykorzystujące enzym rozszczepiający, mogą także być stosowane. [0033] Alternatywnie, amplifikacja może być przeprowadzana z zastosowaniem starterów, które są odpowiednio znakowane, i amplifikowane produkty wydłużania startera mogą być wykrywane z zastosowaniem procedury i wyposażenie do wykrywania znacznika. Korzystnie, sondy według niniejszego wynalazku są znakowane z zastosowaniem co 1 najmniej jednej, nadającej się do wykrywania grupy, przy czym ta nadająca się do wykrywania grupa lub grupy, jest wybrana spośród takich jak koniugat, rozgałęziony system wykrywania, chromofor, fluorofor, znacznik spinowy, radioizotop, enzym, hapten, ester akrydyniowy i związek luminescencyjny. Jako ilustrujący, nieograniczający przykład, startery stosowane w metodzie według niniejszego wynalazku mogą być znakowane przy użyciu fluoroforu. Bardziej dokładnie, starter odwrotny w metodzie według niniejszego wynalazku jest znakowany z zastosowaniem fluoroforu 6-FAM przy jego końcu. Ten 2 fluorofor emituje fluorescencję o maksymalnej długości fali wynoszącej 22 nm. PCR może być przeprowadzana z zastosowaniem jednego spośród starterów znakowanych z

21 21 zastosowaniem na przykład barwników, takich jak barwniki FAM, HEX, VIC lub NED. [0034] W korzystnej realizacji według wynalazku, końcowe wykrywanie i analiza DNA amplifikowanego sposobem według wynalazku, jest prowadzona z wykorzystaniem techniki GeneScan, jak to jest zilustrowane w przykładzie towarzyszącym niniejszemu wynalazkowi. A zatem, jako ilustrujący, nieograniczający przykład przeprowadzania etapu wykrywania w metodzie według wynalazku, podwielokrotna część mieszaniny reakcyjnej PCR (typowo 1 µl) jest dodawana do 9 µl formamidu HI-DI i 0,2 µl markera GeneScan -00 LIZ jako standardu wielkości. Po procesie denaturacji, próbka jest umieszczana w analizatorze ABI 3130 Genetic Analyzer i prowadzona jest elektroforeza kapilarna. Surowe dane są 1 analizowane z zastosowaniem oprogramowania GeneScan. Ta analiza jest bardzo ważna, ponieważ określanie wielkości produktów PCR będzie realizowane poprzez ekstrapolację względem standardu wielkości dodanego do próbki. Z zastosowaniem tej techniki, wynalazcy mają możliwość wykrywania interesującej mutacji w bardzo precyzyjny i dokładny sposób. [003] Wynalazek jest dodatkowo zilustrowany z zastosowaniem przedstawionych poniżej przykładów, które są dostarczone w celu zilustrowania pewnych realizacji według 2 niniejszego wynalazku i nie mają na celu stanowić ograniczenia wynalazku.

22 22 PRZYKŁAD 1 Oznaczanie delecji ELREA przy eksonie 19 genu EGFR z wykorzystaniem GeneScan Materiały i metody: 1 - Pobieranie próbki [0036] Krew żylną ( ml) pobraną od każdego pacjenta umieszczono w probówkach zawierających 0 mmoli EDTA (kwasu etylenodiaminotetraoctowego) na litr, i genomowy DNA wyizolowano z zastosowaniem zestawu QIAmp DNA blood Mini kit (Qiagen, Germany), zgodnie z instrukcjami podanymi przez 1 producenta. 2 - Przygotowanie reakcji GeneScan 1.1 Materiały [0037] - Analizator Abi Prism 3130 DNA Analyser (Perkin- Elmer, Applied Biosystems) - 96-studzienkowa płytka do reakcji optycznej 2 (Applied Biosystems, numer katalogowy )

23 Mieszanina reakcyjna PCR z sondą PNA [0038] Mieszaninę reakcyjną PCR przygotowano w następujący sposób: - 2, µl buforu x (Ecogen) - 0, µl 0 mm MgCl 2 (Ecogen) - 0,62 µl mm dntps (Promega) - 1,2 µl mm roztworu każdego startera - 0,1 µl polimerazy TAQ (Ecogen) - 12, µl mm roztworu sondy PNA (Applied Biosystems) - µl DNA z surowicy lub osocza - Dodano sterylną destylowaną H 2 O do końcowej 1 objętości wynoszącej 2µl Mieszanina reakcyjna PCR bez sondy PNA [0039] Mieszaninę reakcyjną PCR przygotowano w następujący sposób: - 2, µl buforu x (Ecogen) - 0, µl 0 mm MgCl 2 (Ecogen) - 0,62 µl mm dntps (Promega) 2-1,2 µl µm roztworu każdego startera - 0,1 µl polimerazy TAQ (Ecogen) - µl DNA z surowicy lub osocza

24 24 - Dodano sterylną destylowaną H 2 O do końcowej objętości wynoszącej 2 µl. [0040] Starter odwrotny był znakowany z zastosowaniem fluoroforu 6-FAM (6-FAM emituje fluorescencję o maksymalnej długości fali wynoszącej 22 nm). Starter wiodący: ACTCTGGATCCCAGAAGGTGAG (SEQ ID NO: 1) Starter odwrotny: 6-FAM-CCACACAGCAAAGCAGAAACTC (SEQ ID NO: 2) Sekwencja sondy PNA: Ac-AGATGTTGCTTCTCTTA (SEQ ID NO: 3) Program PCR 1 [0041] PCR przeprowadzono w następujący sposób: 9 C w ciągu minut, a następnie 40 cykli w temperaturze 9 C przez 30 sekund, 8 C przez 30 sekund i 72 C przez 1 minutę, i końcowe wydłużanie w temperaturze 72 C przez minut. 3 - Przygotowanie GeneScan [0042] - 9 µl formamidu HI-DI (Applied Biosystems) - 0,2 µl markera GeneScan -00 LIZ jako standardu 2 wielkości (Applied Biosystems) - 1 µl rozcieńczonego końcowego produktu PCR

25 2 [0043] Próbki poddawano denaturacji w temperaturze 93 C przez 3 minuty i oziębiano na lodzie przez minut. Próbki następnie poddano analizie metodą elektroforezy kapilarnej, po czym poddawano wzbudzeniu promieniowaniem o długości fali wynoszącej 494 nm i wykrywano emisję promieniowania o długości fali 22 nm z zastosowaniem analizatora ABI 3130 DNA analyzer. Wyniki: [0044] W sumie analizie poddano 41 próbek surowicy/osocza z wykorzystaniem GeneScan do wykrywania delecji w eksonie 19. Wszystkie analizowane próbki pochodziły od pacjentów z dodatnimi wynikami mutacji w tkance guza. 1 [004] Wyniki analizy GeneScan pokazują, że % próbek z pozytywnymi wynikami mutacji w tkance guza dały także pozytywne wyniki z wykorzystaniem analizy GeneScan (tablica 1). Tablica 1. Analiza mutacji w eksonie 19 EGFR w próbkach surowicy/osocza od pacjentów z pozytywnymi wynikami mutacji w tkance guza. Mutacje EGFR w tkance guza S/P pozytywny S/P negatywny N = 41 N = 22 (%) N = 19 (4%) Mężczyźni 8 8 Kobiety Erlotinib Leczenie pierwszego rzutu 12 11

26 26 Leczenie drugiego rzutu 8 Nigdy nie palący 1 12 Byli palący 7 6 Palący 0 1 Ekstrakcja krwi Przed leczeniem 16 9 Po leczeniu 8 Nieznane 1 2 CR + PR SD + PD PRZYKŁAD 2 Oznaczanie mutacji L88R w eksonie 21 genu EGFR z wykorzystaniem GeneScan Materiały i metody: 1 - Pobieranie próbki [0046] Krew żylną ( ml) pobraną od każdego pacjenta umieszczono w probówkach zawierających 0 mmoli EDTA (kwasu etylenodiaminotetraoctowego) na litr, i genomowy DNA wyizolowano z zastosowaniem zestawu QIAmp DNA blood Mini kit 1 (Qiagen, Germany), zgodnie z instrukcjami podanymi przez producenta.

27 Reakcja Taqman (test aktywności -nukleazy) 1.1 Materiały [0047] - AB 7000 lub 7900HT (Applied Biosystems) Mieszanina reakcyjna PCR (test aktywności - nukleazy) z sondą PNA [0048] Mieszaninę reakcyjną PCR przygotowano w następujący sposób (tablica 2): Tablica 2 Mieszanina reakcyjna Stężenie Stężenie w Dla każdej końcowe mieszaninie próbki (µl) podstawowej Mieszanina Universal 1x 2x 12, TaqMan Master Starter F 0,6 µm µm 1, Starter R 0,6 µm µm 1, Sonda wt-vic 0,2 µm µm 0, Sonda mut-fam 0,2 µm µm 0, PNA 0, µm µm 1,2 DNA z surowicy lub osocza Woda,2 1

28 28 [0049] PCR przeprowadzono w następujący sposób: 60 C w czasie 2 minut, a następnie 0 cykli w temperaturze 9 C podczas minut, po czym 0 cykli w temperaturze 9 C przez 1 sekund i 60 C w czasie 1 minuty 30 sekund. 3- Startery, sondy i PNA [000] Sonda do wykrywania sekwencji dzikiego typu była znakowana z zastosowaniem fluorochromu VIC, podczas gdy sonda do wykrywania zmutowanych alleli była znakowana z zastosowaniem fluorochromu FAM Starter wiodący: AACACCGCAGCATGTCAAGA (SEQ ID NO:4) Starter odwrotny: TTCTCTTCCGCACCCAGC (SEQ ID NO:) 1 [001] Sonda do wykrywania alleli dzikiego typu była znakowana z zastosowaniem fluorochromu VIC: VIC-TCACAGATTTTGGGCTGGCCAAAC-TAMRA (SEQ ID NO:6) [002] Sonda do wykrywania zmutowanych alleli była znakowana z zastosowaniem fluorochromu FAM: 6-FAM-CAGATTTTGGGCGGGCCAAAC-TAMRA (SEQ ID NO:7) 2 Sonda PNA: AGTTTGGCCAGCCCA (SEQ ID NO:8)

29 29 Wyniki: [003] W sumie analizie poddano 41 próbek surowicy/osocza z wykorzystaniem GeneScan do wykrywania w L88R. Wszystkie analizowane próbki pochodziły od pacjentów z dodatnimi wynikami mutacji w tkance guza. [004] Wyniki analizy testu aktywności -nukleazy pokazują, że % (L88R) próbek z pozytywnymi wynikami mutacji w tkance guza były także pozytywne z zastosowaniem tej analizy (tablica 3). Tablica 3 Mutacje EGFR w tkance guza S/P pozytywny S/P negatywny N = 41 N = 22 (%) N = 19 (4%) PRZYKŁAD 3 1 Oznaczanie mutacji T790M w genie EGFR z wykorzystaniem reakcji Taqman Materiały i metody: 1 - Pobieranie próbki [00] Krew żylną ( ml) pobraną od każdego pacjenta umieszczono w probówkach zawierających 0 mmoli EDTA (kwasu

30 30 etylenodiaminotetraoctowego) na litr, i genomowy DNA wyizolowano z zastosowaniem zestawu QIAmp DNA blood Mini kit (Qiagen, Germany), zgodnie z instrukcjami podanymi przez producenta. 2 - Reakcja Taqman (test aktywności -nukleazy) 1.1 Materiały [006] - AB 7000 lub 7900HT (Applied Biosystems) Mieszanina reakcyjna PCR (test aktywności - nukleazy) z sondą PNA 1 [007] Mieszaninę reakcyjną PCR przygotowano sposobem opisanym w przykładzie 2 (patrz tablica 2): PCR przeprowadzono w następujący sposób: 60 C przez 2 minuty, następnie 0 cykli w temperaturze 9 C podczas minut, po czym 0 cykli w temperaturze 9 C przez 1 sekund i 60 C w czasie 1 minuty 30 sekund. 3- Startery, sondy i PNA 2 [008] Sonda do wykrywania sekwencji dzikiego typu była znakowana z zastosowaniem fluorochromu VIC, podczas gdy sonda

31 31 do wykrywania zmutowanych alleli była znakowana z zastosowaniem fluorochromu FAM Starter wiodący: AGGCAGCCGAAGGGC (SEQ ID NO:9) Starter odwrotny: CCTCACCTCCACCGTGCA (SEQ ID NO:) [009] Sonda do wykrywania alleli dzikiego typu była znakowana z zastosowaniem fluorochromu VIC: VIC- TGAGCTGCGTGATGA-MGB (SEQ ID NO:11) [0060] Sonda do wykrywania zmutowanych alleli była znakowana z zastosowaniem fluorochromu FAM: 1 6-FAM-TGAGCTGCATGATGA-MGB (SEQ ID NO:12) Sonda PNA: TCATCACGCAGCTC (SEQ ID NO:13) Wyniki: [0061] W sumie poddano analizie 4 próbki surowicy/osocza. Wszystkie analizowane próbki pochodziły od pacjentów z pozytywnymi wynikami mutacji w tkance guza. [0062] Analiza wyników testu aktywności -nukleazy pokazuje, że 7% (T790M) próbek z pozytywnymi wynikami 2 mutacji w tkance guza było także pozytywnych z zastosowaniem tej analizy (tablica 4 dla T790M).

32 32 Tablica 4 Mutacje EGFR w tkance guza S/P pozytywny S/P negatywny N = 4 N = 3 (7%) N = 1 (2%) LISTA SEKWENCJI [0063] <1> PANGAEA BIOTECH, S.A. <1> SPOSÓB WYKRYWANIA MUTACJI EGFR W PRÓBKACH KRWI <130> P166EPPC <140> EP <141> <> EP <11> <160> 13 <170> PatentIn wersja 3. <2> 1 <211> 22 2 <212> DNA

33 33 <213> Sztuczna sekwencja <2> <223> Starter wiodący przeznaczony do wykrywania delecji ELREA przy eksonie 19 genu EGFR <400> 1 actctggatc ccagaaggtg ag 22 <2> 2 <211> 22 <212> DNA <213> Sztuczna sekwencja 1 <2> <223> Starter odwrotny przeznaczony do wykrywania delecji ELREA przy eksonie 19 genu EGFR. Starter jest modyfikowany z wykorzystaniem znakowania fluoroforem 6-FAM jego końca. <400> 2 ccacacagca aagcagaaac tc 22 <2> 3 2 <211> 17 <212> DNA <213> Sztuczna sekwencja

34 34 <2> <223> Sonda z kwasu peptydonukleinowego (PNA) przeznaczona do wykrywania delecji ELREA przy eksonie 19 genu EGFR. Starter jest modyfikowany z zastosowaniem grupy Ac przy jego końcu. <400> 3 agatgttgct tctctta 17 <2> 4 <211> <212> DNA <213> Sztuczna sekwencja 1 <2> <223> Starter wiodący przeznaczony do wykrywania mutacji L88R w eksonie 21 genu EGFR <400> 4 aacaccgcag catgtcaaga <2> <211> 18 2 <212> DNA <213> Sztuczna sekwencja <2>

35 3 <223> Starter odwrotny przeznaczony do wykrywania mutacji L88R w eksonie 21 genu EGFR <400> ttctcttccg cacccagc 18 <2> 6 <211> 24 <212> DNA <213> Sztuczna sekwencja <2> <223> Sonda przeznaczona do wykrywania alleli genu dzikiego typu EGFR w obszarze mutacji L88R. Starter jest 1 modyfikowany z zastosowaniem grupy VIC przy końcu. <400> 6 tcacagattt tgggctggcc aaac 24 <2> 7 <211> 21 <212> DNA <213> Sztuczna sekwencja 2 <2> <223> Sonda przeznaczona do wykrywania mutanta L88R w allelach genu EGFR. Starter jest modyfikowany z zastosowaniem grupy 6-FAM przy końcu.

36 36 <400> 7 cagattttgg gcgggccaaa c 21 <2> 8 <211> 1 <212> DNA <213> Sztuczna sekwencja <2> <223> Sonda z kwasu peptydonukleinowego (PNA) przeznaczona do wykrywania mutacji L88R przy eksonie 21 genu EGFR. 1 <400> 8 agtttggcca gccca 1 <2> 9 <211> 1 <212> DNA <213> Sztuczna sekwencja <2> 2 <223> Starter wiodący przeznaczony do wykrywania mutacji T790M w eksonie 21 genu EGFR <400> 9

37 37 aggcagccga agggc 1 <2> <211> 18 <212> DNA <213> Sztuczna sekwencja <2> <223> Starter odwrotny przeznaczony do wykrywania mutacji T790M w eksonie 21 genu EGFR <400> cctcacctcc accgtgca 18 1 <2> 11 <211> 1 <212> DNA <213> Sztuczna sekwencja <2> <223> Sonda przeznaczona do wykrywania alleli genu dzikiego typu EGFR w obszarze mutacji T790M. Starter jest modyfikowany z zastosowaniem grupy VIC przy końcu. 2 <400> 11 tgagctgcgt gatga 1 <2> 12

38 38 <211> 1 <212> DNA <213> Sztuczna sekwencja <2> <223> Sonda przeznaczona do wykrywania mutanta T790M w allelach genu EGFR. Starter jest modyfikowany z zastosowaniem grupy 6-FAM przy końcu. <400> 12 tgagctgcat gatga 1 <2> 13 <211> 14 1 <212> DNA <213> Sztuczna sekwencja <2> <223> Sonda z kwasu peptydonukleinowego (PNA) przeznaczona do wykrywania mutacji T790M przy eksonie 21 genu EGFR. <400> 13 tcatcacgca gctc 14 2

39 39 Zastrzeżenia patentowe 1. Sposób wykrywania mutacji genu EGFR w próbce krwi pobranej od pacjenta, znamienny tym, że obejmuje etapy, w których: (i) otrzymuje się DNA z wymienionej próbki; (ii) amplifikuje się sekwencję kwasu nukleinowego odpowiadającą specyficznemu obszarowi genu EGFR z wykorzystaniem PCR, stosując sondę z kwasu peptydonukleinowego PNA przy czym wymieniona sonda z kwasu 1 peptydonukleinowego PNA jest zdolna do specyficznego rozpoznawania i hybrydyzowania z sekwencją EGFR dzikiego typu, tym samym hamując jej amplifikację; i (iii) wykrywa się wymienioną mutację. 2. Sposób według zastrz. 1, znamienny tym, że przeznaczoną do wykrycia mutację genu EGFR wybiera się z grupy obejmującej mutacje, takie jak: delecje ELREA przy eksonie 19, mutacja L88R przy eksonie 21 i mutacja T790M. 3. Sposób według zastrz. 1, znamienny tym, że jako wymienioną próbkę krwi stosuje się próbkę surowicy lub 2 osocza. 4. Sposób według zastrz. 1, znamienny tym, że etap wykrywania prowadzi się z wykorzystaniem sekwencjonowania kwasu nukleinowego.

40 40. Sposób według zastrz. 1, znamienny tym, że etap wykrywania prowadzi się z wykorzystaniem technologii GeneScan. 6. Sposób według zastrz., znamienny tym, że w wymienionej technologii GeneScan stosuje się starter oligonukleotydowy, który jest znakowany fluorescencyjnie przy jego końcu z zastosowaniem barwnika fluorescencyjnego. 7. Sposób według zastrz. 6, znamienny tym, że wymieniony barwnik fluorescencyjny wybiera się z grupy obejmującej barwniki 6-FAM, HEX lub NED.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1773451 (96) Data i numer zgłoszenia patentu europejskiego: 08.06.2005 05761294.7 (13) (51) T3 Int.Cl. A61K 31/4745 (2006.01)

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie Sekwencyjność występowania zaburzeń molekularnych w niedrobnokomórkowym raku płuca

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

(96) Data i numer zgłoszenia patentu europejskiego:

(96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1690978 (96) Data i numer zgłoszenia patentu europejskiego: 11.02.2005 05101042.9 (13) T3 (51) Int. Cl. D06F81/08 (2006.01)

Bardziej szczegółowo

AmpliTest TBEV (Real Time PCR)

AmpliTest TBEV (Real Time PCR) AmpliTest TBEV (Real Time PCR) Zestaw do wykrywania sekwencji RNA specyficznych dla TBEV (Tick-borne encephalitis virus) techniką Real Time PCR Nr kat.: RV03-50 Wielkość zestawu: 50 oznaczeń Objętość pojedynczej

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1747298 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547.7 (51) Int. Cl. C22C14/00 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609. (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609. (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609 (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792.2 (13) (51) T3 Int.Cl. A61K 38/17 (2006.01)

Bardziej szczegółowo

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 26/11

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 26/11 PL 214501 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214501 (13) B1 (21) Numer zgłoszenia: 391458 (51) Int.Cl. C12Q 1/68 (2006.01) C12N 15/29 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1886669 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 02.08.2007 07113670.9

Bardziej szczegółowo

Hybrydyzacja kwasów nukleinowych

Hybrydyzacja kwasów nukleinowych Hybrydyzacja kwasów nukleinowych Jaka jest lokalizacja tego genu na chromosomie? Jakie jest jego sąsiedztwo? Hybrydyzacja - powstawanie stabilnych struktur dwuniciowych z cząsteczek jednoniciowych o komplementarnych

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1968711 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 05.01.2007 07712641.5

Bardziej szczegółowo

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP WYNALAZKI BIOTECHNOLOGICZNE W POLSCE Ewa Waszkowska ekspert UPRP Źródła informacji w biotechnologii projekt SLING Warszawa, 9-10.12.2010 PLAN WYSTĄPIENIA Umocowania prawne Wynalazki biotechnologiczne Statystyka

Bardziej szczegółowo

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 04/14. SYLWIA OKOŃ, Dąbrowica, PL KRZYSZTOF KOWALCZYK, Motycz, PL

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 04/14. SYLWIA OKOŃ, Dąbrowica, PL KRZYSZTOF KOWALCZYK, Motycz, PL PL 220315 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 220315 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 400252 (22) Data zgłoszenia: 06.08.2012 (51) Int.Cl.

Bardziej szczegółowo

Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan

Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan Klasyczna metoda PCR jest metodą jakościową, nie ilościową co np.

Bardziej szczegółowo

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA DNA 28SRNA 18/16S RNA 5SRNA mrna Ilościowa analiza mrna aktywność genów w zależności od wybranych czynników: o rodzaju tkanki o rodzaju czynnika zewnętrznego o rodzaju upośledzenia szlaku metabolicznego

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1802536 (96) Data i numer zgłoszenia patentu europejskiego: 20.09.2004 04774954.4 (13) T3 (51) Int. Cl. B65D77/20 B65D85/72

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1680075 (13) T3 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 11.10.2004

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1701111 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 11.03.2005 05090064.6 (51) Int. Cl. F24H9/20 (2006.01)

Bardziej szczegółowo

AmpliTest Salmonella spp. (Real Time PCR)

AmpliTest Salmonella spp. (Real Time PCR) AmpliTest Salmonella spp. (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzaju Salmonella techniką Real Time PCR Nr kat.: BAC01-50 Wielkość zestawu: 50 oznaczeń Objętość

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1711158 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 16.11.2004 04806793.8

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058. (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058. (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058 (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244.7 (13) (51) T3 Int.Cl. C22C 38/40 (2006.01)

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 161679 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 24.06.0 064.7 (1) Int. Cl. B60R21/01 (06.01) (97) O udzieleniu

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937 (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.0 (13) (51) T3 Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

RT31-020, RT , MgCl 2. , random heksamerów X 6

RT31-020, RT , MgCl 2. , random heksamerów X 6 RT31-020, RT31-100 RT31-020, RT31-100 Zestaw TRANSCRIPTME RNA zawiera wszystkie niezbędne składniki do przeprowadzenia syntezy pierwszej nici cdna na matrycy mrna lub całkowitego RNA. Uzyskany jednoniciowy

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 06.09.2005 05788867.9

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 06.09.2005 05788867.9 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1786660 (96) Data i numer zgłoszenia patentu europejskiego: 06.09.2005 05788867.9 (13) T3 (51) Int. Cl. B62D25/08 B60G15/06

Bardziej szczegółowo

Metody: PCR, MLPA, Sekwencjonowanie, PCR-RLFP, PCR-Multiplex, PCR-ASO

Metody: PCR, MLPA, Sekwencjonowanie, PCR-RLFP, PCR-Multiplex, PCR-ASO Diagnostyka molekularna Dr n.biol. Anna Wawrocka Strategia diagnostyki genetycznej: Aberracje chromosomowe: Metody:Analiza kariotypu, FISH, acgh, MLPA, QF-PCR Gen(y) znany Metody: PCR, MLPA, Sekwencjonowanie,

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2003466 (96) Data i numer zgłoszenia patentu europejskiego: 12.06.2008 08460024.6 (13) (51) T3 Int.Cl. G01S 5/02 (2010.01)

Bardziej szczegółowo

EKSTRAHOWANIE KWASÓW NUKLEINOWYCH JAK ZMIERZYĆ ILOŚĆ KWASÓW NUKLEINOWYCH PO IZOLACJI? JAK ZMIERZYĆ ILOŚĆ KWASÓW NUKLEINOWYCH PO IZOLACJI?

EKSTRAHOWANIE KWASÓW NUKLEINOWYCH JAK ZMIERZYĆ ILOŚĆ KWASÓW NUKLEINOWYCH PO IZOLACJI? JAK ZMIERZYĆ ILOŚĆ KWASÓW NUKLEINOWYCH PO IZOLACJI? EKSTRAHOWANIE KWASÓW NUKLEINOWYCH Wytrącanie etanolem Rozpuszczenie kwasu nukleinowego w fazie wodnej (met. fenol/chloroform) Wiązanie ze złożem krzemionkowym za pomocą substancji chaotropowych: jodek

Bardziej szczegółowo

Zestaw do wykrywania Babesia spp. i Theileria spp. w kleszczach, krwi i hodowlach komórkowych

Zestaw do wykrywania Babesia spp. i Theileria spp. w kleszczach, krwi i hodowlach komórkowych Nr kat. PK25N Wersja zestawu: 1.2012 Zestaw do wykrywania spp. i Theileria spp. w kleszczach, krwi i hodowlach komórkowych dwie oddzielne reakcje PCR 2x50 reakcji PCR (50 µl), włączając w to kontrole Zestaw

Bardziej szczegółowo

AmpliTest Chlamydia/Chlamydophila (Real Time PCR)

AmpliTest Chlamydia/Chlamydophila (Real Time PCR) AmpliTest Chlamydia/Chlamydophila (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzajów Chlamydia i Chlamydophila techniką Real Time PCR Nr kat.: BAC18-50 BAC18-100 Wielkość

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2135881 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 14.06.2006 09010789.7

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.07.2004 04740699.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.07.2004 04740699. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1658064 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.07.2004 04740699.6 (51) Int. Cl. A61K31/37 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 223771 (96) Data i numer zgłoszenia patentu europejskiego: 06.12.08 0886773.1 (13) (1) T3 Int.Cl. A47L 1/42 (06.01) Urząd

Bardziej szczegółowo

Applied Biosystems 7500 Fast Real Time PCR System, czyli Mercedes wśród termocyklerów do analizy PCR w czasie rzeczywistym

Applied Biosystems 7500 Fast Real Time PCR System, czyli Mercedes wśród termocyklerów do analizy PCR w czasie rzeczywistym Applied Biosystems 7500 Fast Real Time PCR System, czyli Mercedes wśród termocyklerów do analizy PCR w czasie rzeczywistym Rynek aparatury laboratoryjnej pęka w szwach od ilości różnych aparatów przeznaczonych

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 09.12.2005 05077837.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 09.12.2005 05077837. RZECZPSPLITA PLSKA (12) TŁUMACZENIE PATENTU EURPEJSKIEG (19) PL (11) PL/EP 1671547 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 09.12.2005 05077837.2 (51) Int. Cl. A23B7/154 (2006.01) (97)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1854925 (96) Data i numer zgłoszenia patentu europejskiego: 16.12.2005 05826699.0 (13) (51) T3 Int.Cl. E03D 1/00 (2006.01)

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość*

2. Przedmiot zamówienia: Odczynniki chemiczne do izolacji DNA i reakcji PCR, wymienione w Tabeli 1. Nazwa odczynnika Specyfikacja Ilość* Poznao, 6 lutego 2012 r. Zapytanie ofertowe nr 001 /2012 dotyczące zakupu odczynników chemicznych do izolacji DNA i reakcji PCR GENESIS Polska Sp. z o.o Ul. Za Cytadelą 19, 61-659 Poznao NIP 778 13 56

Bardziej szczegółowo

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów Wprowadzenie do genetyki sądowej 2013 Pracownia Genetyki Sądowej Katedra i Zakład Medycyny Sądowej Materiały biologiczne Inne: włosy z cebulkami, paznokcie możliwa degradacja - tkanki utrwalone w formalinie/parafinie,

Bardziej szczegółowo

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 ALEKSANDRA ŚWIERCZ Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 Ekspresja genów http://genome.wellcome.ac.uk/doc_wtd020757.html A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1730054 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 22.03.2005 05731932.9 (51) Int. Cl. B65G17/06 (2006.01)

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1505553. (96) Data i numer zgłoszenia patentu europejskiego: 05.08.2004 04018511.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1505553. (96) Data i numer zgłoszenia patentu europejskiego: 05.08.2004 04018511. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 3 (96) Data i numer zgłoszenia patentu europejskiego: 0.08.04 0401811.8 (13) (1) T3 Int.Cl. G08C 17/00 (06.01) Urząd Patentowy

Bardziej szczegółowo

PCR bez izolacji testujemy Direct PCR Kits od ThermoFisher Scientific

PCR bez izolacji testujemy Direct PCR Kits od ThermoFisher Scientific PCR bez izolacji testujemy Direct PCR Kits od ThermoFisher Scientific Specjalnie dla Was przetestowaliśmy w naszym laboratorium odczynniki firmy Thermo Scientific umożliwiające przeprowadzanie reakcji

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 71811 (96) Data i numer zgłoszenia patentu europejskiego: 29.09.06 06791167.7 (13) (1) T3 Int.Cl. H04Q 11/00 (06.01) Urząd

Bardziej szczegółowo

Materiał i metody. Wyniki

Materiał i metody. Wyniki Abstract in Polish Wprowadzenie Selen jest pierwiastkiem śladowym niezbędnym do prawidłowego funkcjonowania organizmu. Selen jest wbudowywany do białek w postaci selenocysteiny tworząc selenobiałka (selenoproteiny).

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2120618. (96) Data i numer zgłoszenia patentu europejskiego: 28.02.2008 08719309.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2120618. (96) Data i numer zgłoszenia patentu europejskiego: 28.02.2008 08719309. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2120618 (96) Data i numer zgłoszenia patentu europejskiego: 28.02.2008 08719309.0 (13) (1) T3 Int.Cl. A41B 11/02 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1614553 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 01.07.2005 05014326.2 (51) Int. Cl. B60C27/06 (2006.01)

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II 10 października 2013: Elementarz biologii molekularnej www.bioalgorithms.info Wykład nr 2 BIOINFORMATYKA rok II Komórka: strukturalna i funkcjonalne jednostka organizmu żywego Jądro komórkowe: chroniona

Bardziej szczegółowo

(96) Data i numer zgłoszenia patentu europejskiego: 28.07.2004 04017866.7

(96) Data i numer zgłoszenia patentu europejskiego: 28.07.2004 04017866.7 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1504998 (96) Data i numer zgłoszenia patentu europejskiego: 28.07.2004 04017866.7 (13) T3 (51) Int. Cl. B65C9/04 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1477128 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 14.05.2004 04076445.8 (51) Int. Cl. A61D1/02 (2006.01)

Bardziej szczegółowo

Definicje. Białka rekombinowane (ang. recombinant proteins, r-proteins) Ukierunkowana mutageneza (ang. site-directed/site-specific mutagenesis)

Definicje. Białka rekombinowane (ang. recombinant proteins, r-proteins) Ukierunkowana mutageneza (ang. site-directed/site-specific mutagenesis) Definicje Białka rekombinowane (ang. recombinant proteins, r-proteins) Białka, które powstały w żywych organizmach (lub liniach komórkowych) w wyniku ekspresji rekombinowanego DNA. Rekombinowany DNA jest

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 27.10.2004 04791425.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 27.10.2004 04791425. PL/EP 1809944 T3 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1809944 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 27.10.2004 04791425.4 (51) Int. Cl.

Bardziej szczegółowo

TRANSKRYPCJA - I etap ekspresji genów

TRANSKRYPCJA - I etap ekspresji genów Eksparesja genów TRANSKRYPCJA - I etap ekspresji genów Przepisywanie informacji genetycznej z makrocząsteczki DNA na mniejsze i bardziej funkcjonalne cząsteczki pre-mrna Polimeraza RNA ETAP I Inicjacja

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1690923 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 1.02.0 0460002.8 (97)

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków)

ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków) ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków) Celem ćwiczenia jest wprowadzenie mutacji punktowej do genu

Bardziej szczegółowo

AmpliTest Panel odkleszczowy (Real Time PCR)

AmpliTest Panel odkleszczowy (Real Time PCR) AmpliTest Panel odkleszczowy (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii Borrelia burgdorferi, Anaplasma, Ehrlichia oraz pierwotniaków rodzaju Babesia (B. canis, B. gibsoni,

Bardziej szczegółowo

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym mgr Magdalena Brzeskwiniewicz Promotor: Prof. dr hab. n. med. Janusz Limon Katedra i Zakład Biologii i Genetyki Gdański Uniwersytet Medyczny

Bardziej szczegółowo

Diagnostyka molekularna umożliwia terapie spersonalizowane. Janusz A. Siedlecki

Diagnostyka molekularna umożliwia terapie spersonalizowane. Janusz A. Siedlecki Diagnostyka molekularna umożliwia terapie spersonalizowane. Janusz A. Siedlecki Centrum Onkologii-Instytut, Warszawa 2015 Rozwój Rozwój medycyny i nauk podstawowych w ciągu ostatnich pięćdziesięciu lat

Bardziej szczegółowo

mikrosatelitarne, minisatelitarne i polimorfizm liczby kopii

mikrosatelitarne, minisatelitarne i polimorfizm liczby kopii Zawartość 139371 1. Wstęp zarys historii genetyki, czyli od genetyki klasycznej do genomiki 2. Chromosomy i podziały jądra komórkowego 2.1. Budowa chromosomu 2.2. Barwienie prążkowe chromosomów 2.3. Mitoza

Bardziej szczegółowo

Płynna biopsja Liquid biopsy. Rafał Dziadziuszko Klinika Onkologii i Radioterapii Gdański Uniwersytet Medyczny

Płynna biopsja Liquid biopsy. Rafał Dziadziuszko Klinika Onkologii i Radioterapii Gdański Uniwersytet Medyczny Płynna biopsja Liquid biopsy Rafał Dziadziuszko Klinika Onkologii i Radioterapii Gdański Uniwersytet Medyczny Podstawowe pojęcia Biopsja uzyskanie materiału tkankowego lub komórkowego z guza celem ustalenia

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1660738 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 28.04.2005 05737864.8 (51) Int. Cl. E04G1/32 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1947302. (96) Data i numer zgłoszenia patentu europejskiego: 03.12.2007 07122193.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1947302. (96) Data i numer zgłoszenia patentu europejskiego: 03.12.2007 07122193. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1947302 (96) Data i numer zgłoszenia patentu europejskiego: 03.12.2007 07122193.1 (13) (51) T3 Int.Cl. F01M 11/00 (2006.01)

Bardziej szczegółowo

PL B1. Preparat o właściwościach przeciwutleniających oraz sposób otrzymywania tego preparatu. POLITECHNIKA ŁÓDZKA, Łódź, PL

PL B1. Preparat o właściwościach przeciwutleniających oraz sposób otrzymywania tego preparatu. POLITECHNIKA ŁÓDZKA, Łódź, PL PL 217050 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217050 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 388203 (22) Data zgłoszenia: 08.06.2009 (51) Int.Cl.

Bardziej szczegółowo

Ampli-LAMP Babesia canis

Ampli-LAMP Babesia canis Novazym Products Zestaw do identyfikacji materiału genetycznego pierwotniaka Babesia canis canis techniką Loop-mediated Isothermal AMPlification (LAMP) Numery katalogowe produktu: AML-Bc-200 AML-Bc-400

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 17.01.2005 05701526.5

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 17.01.2005 05701526.5 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1841919 (96) Data i numer zgłoszenia patentu europejskiego: 17.01.2005 05701526.5 (13) T3 (51) Int. Cl. E01B27/10 E01B27/06

Bardziej szczegółowo

(96) Data i numer zgłoszenia patentu europejskiego:

(96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1529464 (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2004 04105133.5 (13) T3 (51) Int. Cl. A47B91/06 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: PL/EP 1699990 T3 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1699990 (96) Data i numer zgłoszenia patentu europejskiego: 09.11.2004 04800186.1 (13) (51) T3 Int.Cl. E04G

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1886585 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 24.07.2006 06291197.9

Bardziej szczegółowo

Jaka jest lokalizacja genu na chromosomie? Jakie jest jego sąsiedztwo?

Jaka jest lokalizacja genu na chromosomie? Jakie jest jego sąsiedztwo? Jaka jest lokalizacja genu na chromosomie? Jakie jest jego sąsiedztwo? Hybrydyzacja - powstawanie stabilnych struktur dwuniciowych z cząsteczek jednoniciowych o komplementarnych sekwencjach nukleotydów

Bardziej szczegółowo

(96) Data i numer zgłoszenia patentu europejskiego: 18.03.2004 04006485.9

(96) Data i numer zgłoszenia patentu europejskiego: 18.03.2004 04006485.9 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1464787 (96) Data i numer zgłoszenia patentu europejskiego: 18.03.2004 04006485.9 (13) T3 (51) Int. Cl. E06B1/60 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2044552. (96) Data i numer zgłoszenia patentu europejskiego: 11.05.2007 07719230.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2044552. (96) Data i numer zgłoszenia patentu europejskiego: 11.05.2007 07719230. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2044552 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 11.05.2007 07719230.0

Bardziej szczegółowo

STATYSTYKI DOTYCZĄCE RAKA PŁUCA

STATYSTYKI DOTYCZĄCE RAKA PŁUCA bioprognos OncoLUNG Nieinwazyjne badanie krwi umożliwiające zasugerowanie diagnozy u pacjentów z podejrzeniem nowotworu złośliwego płuca oraz ograniczenie liczby nieadekwatnych badań diagnostycznych, skrócenie

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 12.10.2006 06804347.0

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 12.10.2006 06804347.0 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1943177 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 12..2006 06804347.0

Bardziej szczegółowo

Transformacja pośrednia składa się z trzech etapów:

Transformacja pośrednia składa się z trzech etapów: Transformacja pośrednia składa się z trzech etapów: 1. Otrzymanie pożądanego odcinka DNA z materiału genetycznego dawcy 2. Wprowadzenie obcego DNA do wektora 3. Wprowadzenie wektora, niosącego w sobie

Bardziej szczegółowo

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7 Poznań, dnia 28.04.2014 r. BioVentures Institute Spółka z ograniczoną odpowiedzialnością ul. Promienista 83 60 141 Poznań Zapytanie ofertowe nr 01/2014 Projekt Nowa technologia wytwarzania szczepionek

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1648484 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 01.06.04 047366.4 (97)

Bardziej szczegółowo

PCR łańcuchowa reakcja polimerazy

PCR łańcuchowa reakcja polimerazy PCR łańcuchowa reakcja polimerazy PCR - ang. polymerase chain reaction Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1712702 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 28.03.2006 06006359.1 (51) Int. Cl. E04F15/02 (2006.01)

Bardziej szczegółowo

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe Promotory genu Promotor bliski leży w odległości do 40 pz od miejsca startu transkrypcji, zawiera kasetę TATA. Kaseta TATA to silnie konserwowana sekwencja TATAAAA, występująca w większości promotorów

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2328822 (96) Data i numer zgłoszenia patentu europejskiego: 02.09.2009 09782487.4 (13) (51) T3 Int.Cl. B65G 15/38 (2006.01)

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 19929 (96) Data i numer zgłoszenia patentu europejskiego: 02.03.2004 04716261. (13) T3 (1) Int. Cl. B0D7/22 B0D1/02 (2006.01)

Bardziej szczegółowo

Przykładowe zadania. przygotowujące do egzaminu maturalnego

Przykładowe zadania. przygotowujące do egzaminu maturalnego Przykładowe zadania z BIOLOGii przygotowujące do egzaminu maturalnego Prezentowane zadania są zgodne z podstawą programową kształcenia ogólnego w zakresie rozszerzonym i podstawowym. Prócz zadań, które

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA.

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SPIS TREŚCI: 1. Wprowadzenie. 2. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. 3. Karty pracy. 1. Karta

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2326237 (96) Data i numer zgłoszenia patentu europejskiego: 07.07.2009 09780285.4 (13) (51) T3 Int.Cl. A47L 15/50 (2006.01)

Bardziej szczegółowo