Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2"

Transkrypt

1 ALEKSANDRA ŚWIERCZ

2 Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2

3 Ekspresja genów A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 3

4 Co to jest mikromacierz? Mikromacierz DNA (określany także jako chip DNA) to zbiór, krótkich DNA przyczepionych do powierzchni szklanej płytki. Mikromacierzy można użyć do mierzenia poziomu ekspresji genów Każdy punkt na mikromacierzy zawiera specyficzną sekwencję DNA, która reprezentuje jeden z genów (sonda, ang. probe) A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 5

5 Macierz ekspresji genów Geny/ sondy Próbki Próbka 1 Próbka 2 Próbka 3 Próbka 4 Próbka Poziom ekspresji genu lub stosunek, dla genu i-tego w j-tej próbce mrna M= A= A. Świercz { { log 2 (red intensity/green intensity) Funkcja (PM,MM) MAS, dchip lub RMA ½ log 2 (red intensity*green intensity) Funkcja (PM,MM) MAS, dchip lub RMA ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 6

6 Różnice między eksperymentem mikromacierzowym a RNA-seq Przy użyciu mikromacierzy można badać poziom ekspresji znanych genów, natomiast wykorzystując RNA-seq można także wykryć nowe izoformy genów A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 7

7 RNA-seq razem z Ion Torent A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 8

8 Dlaczego RNA-seq zamiast DNA-seq? Badanie funkcjonalności Genom może być taki sam, ale warunki eksperymentalne mogą mieć wpływ na ekspresję genów (np. traktowanie komórek lekarstwem, vs niczym nietraktowane, lub mysz dzika vs zmieniona genetycznie) Niektóre zmiany mogą być widoczne dopiero na poziome RNA Alternatywne izoformy Fuzja transkryptów (trans-splicing, transcription-induced chimerism) Edytowanie RNA - zmiana informacji w transkrypcie RNA przez reakcję chemiczną powodującą zmianę jednej zasady azotowej w inną (C->U, A->I, Inozyna interpretowana jako G). Przewidywanie sekwencji transkryptów z sekwencji genomu jest trudne: Alternatywny transkrypt Edytowanie RNA A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 9

9 Dlaczego RNA-seq zamiast DNA-seq? Interpretacja, czy poszczególne mutacje mają wpływ na sekwencje białkową Mutacje regulujące które wpływają na to czy izoformy mrna ulegają ekspresji i jak dużej Czy mutacje wpływają na promotory, eksonowe/intronowe motywy, miejsca splicingowe? Wpływ na białka kodujące mutacje somatyczne (często heterozygotyczne) Jeśli gen nie ulega ekspresji, mutacja w takim genie będzie mniej interesująca Jeśli gen ulega ekspresji tylko z alleli dzikiego typu, może to sugerować na utratę funkcjonalności (haploinsufficiency) Jeśli allel mutanta ulega ekspresji, może to oznaczać kandydata na target dla leku A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 10

10 Do czego wykorzystywane jest RNA-seq? Badanie ekspresji genów oraz różnicowej ekspresji genów Wyszukiwanie alternatywnego splicingu w genach Odkrywanie nowych transkryptów/izoform Odkrywanie mutacji w genach Wykrywanie fuzji genów Edytowanie RNA (mutacje w RNA) A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 11

11 Mikromacierze vs sekwencjonowanie Porównanie eksperymentów mikromacierzowych i RNA-seq pokazało, że: Jest duża zgodność w wynikach pomiędzy platformami, w szczególności pomiędzy wykrywaniem różnicowej ekspresji genów Platforma sekwencjonowania jest bardziej wrażliwa na wykrycie zmian, jest bardziej odporna na tło i różnice w powtórzeniach technicznych Zaletą RNA-seq jest porównanie poziomu ekspresji różnych genów między sobą (dla mikromacierzy można porównać ten sam gen między różnymi warunkami) Ograniczeniem RNA-seq jest natomiast wykrzywienie GC oraz niejednoznaczność w mapowaniu Większa jest moc statystyczna w wykrywaniu zmian, gdy odczyty występują w większej liczności A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 12

12 Sekwencjonowanie RNA po kolei RNA-seq Module, 2013, A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 14

13 Trzy podejścia do mapowania RNA-seq A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 15

14 Trudności przy mapowaniu RNA Geny w genomach eukariotycznych zawierają introny, a sewkencje mrna są już ich pozbawione. Programy mapujące odczyty z eksperymentów RNA-seq muszą być w stanie dopasować sekwencje z przerwami Introny w genomach ssaków mają długość od 50 bp - 100,000 bp. Średnia długość transkryptu mrna u człowieka to 2227 bp Średnia długość eksonu to 235 bp Średnio w jednym genie jest 9 eksonów Około 20% odczytów które mapują się na łączeniach eksonów mapują się tylko na < 10 nukleotydach na drugim eksonie A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 16

15 Trudności przy mapowaniu RNA Część sekwencji pochodzi z przetworzonych pseudogenów, z których niektóre lub wszystkie introny zostały usunięte (może to spowodować nieprawidłowe mapowanie odczytów) Genom ludzki posiada 14tys pseudogenów Pseudogeny mają sekwencję bardzo podobną do funkcjonalnych genów zawierających introny. W większości przypadków nie ulegają transkrypcji Problem w mapowaniu wynika stąd że odczyty, które mapują się na łączeniu eksonów, będą się mapowały w całości dokładnie lub z niewielkim błędem do pseudogenów, które nie zawierają intronów. Jeśli metoda mapująca mapuje najpierw odczyty w całości, a resztę próbuje dopasować z podziałem na eksony, to pominie odczyty które w całości zmapowane zostały do pseudogenów A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 17

16 D. Kim, G. Pertea, C. Trapnell, H. Pimentel, R. Kelley, S.L. Salzberg TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions Genome Biology 2013, 14:R36 A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 18

17 Trudności przy mapowaniu RNA Transkrypt badanego genomu może się różnić od genomu referencyjnego Różnice mogą być małe, typu SNP, insercje, delecje, niedopasowania Zmiany mogą być większe, rearanżacje chromosomowe przeniesienia dłuższych fragmentów, wiele kopii Małe zmiany nie wpływają znacznie na mapowanie trzeba dopuścić możliwość błędów w niedopasowaniu (może to niestety spowodować wiele miejsc mapowania) Większe zmiany: duże usunięcia, inwersje w obrębie tego samego chromosomu, oraz translokacje między-chromosomowe powodują że trudno znaleźć kolejne eksony genu fragment chrom. 2 fragment chrom. 5 W genomie badanym w stosunku do genomu referencyjnego część genu uległa translokacji oraz inwersji A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 19

18 TopHat2 pipeline Znane sygnały podziału eksonów GT-AG, GC-AG, AT-AC A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 20

19 A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 21

20 A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 22

21 Alamancos GP, Agirre E, Eyras E. (2014) Methods to study splicing from high-throughput RNA sequencing data. Methods Mol Biol 1126: A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 24

Różnorodność osobników gatunku

Różnorodność osobników gatunku ALEKSANDRA ŚWIERCZ Różnorodność osobników gatunku Single Nucleotide Polymorphism (SNP) Różnica na jednej pozycji, małe delecje, insercje (INDELs) SNP pojawia się ~1/1000 pozycji Można je znaleźć porównując

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

Analiza zmienności czasowej danych mikromacierzowych

Analiza zmienności czasowej danych mikromacierzowych Systemy Inteligencji Obliczeniowej Analiza zmienności czasowej danych mikromacierzowych Kornel Chromiński Instytut Informatyki Uniwersytet Śląski Plan prezentacji Dane mikromacierzowe Cel badań Prezentacja

Bardziej szczegółowo

BUDOWA I FUNKCJA GENOMU LUDZKIEGO

BUDOWA I FUNKCJA GENOMU LUDZKIEGO BUDOWA I FUNKCJA GENOMU LUDZKIEGO Magdalena Mayer Katedra i Zakład Genetyki Medycznej UM w Poznaniu 1. Projekt poznania genomu człowieka: Cele programu: - skonstruowanie szczegółowych map fizycznych i

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE

PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE WSTĘP 1. Mikromacierze ekspresyjne tworzenie macierzy przykłady zastosowań 2. Mikromacierze SNP tworzenie macierzy przykłady zastosowań MIKROMACIERZE EKSPRESYJNE

Bardziej szczegółowo

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II 10 października 2013: Elementarz biologii molekularnej www.bioalgorithms.info Wykład nr 2 BIOINFORMATYKA rok II Komórka: strukturalna i funkcjonalne jednostka organizmu żywego Jądro komórkowe: chroniona

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

MIKROMACIERZE. dr inż. Aleksandra Świercz dr Agnieszka Żmieńko

MIKROMACIERZE. dr inż. Aleksandra Świercz dr Agnieszka Żmieńko MIKROMACIERZE dr inż. Aleksandra Świercz dr Agnieszka Żmieńko Informacje ogólne Wykłady będą częściowo dostępne w formie elektronicznej http://cs.put.poznan.pl/aswiercz aswiercz@cs.put.poznan.pl Godziny

Bardziej szczegółowo

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe Promotory genu Promotor bliski leży w odległości do 40 pz od miejsca startu transkrypcji, zawiera kasetę TATA. Kaseta TATA to silnie konserwowana sekwencja TATAAAA, występująca w większości promotorów

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo

Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii

Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii 1. Technologia rekombinowanego DNA jest podstawą uzyskiwania genetycznie zmodyfikowanych organizmów 2. Medycyna i ochrona zdrowia

Bardziej szczegółowo

GENOM I JEGO STRUKTURA

GENOM I JEGO STRUKTURA GENOM I JEGO STRUKTURA GENOM Ogół materiału genetycznego (kwasu nukleinowego niosącego informację genetyczną) zawartego w pojedynczej części składowej (komórce, cząstce wirusa) organizmu 1 Genom eukariotyczny

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

Dr. habil. Anna Salek International Bio-Consulting 1 Germany

Dr. habil. Anna Salek International Bio-Consulting 1 Germany 1 2 3 Drożdże są najprostszymi Eukariontami 4 Eucaryota Procaryota 5 6 Informacja genetyczna dla każdej komórki drożdży jest identyczna A zatem każda komórka koduje w DNA wszystkie swoje substancje 7 Przy

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

TRANSKRYPCJA - I etap ekspresji genów

TRANSKRYPCJA - I etap ekspresji genów Eksparesja genów TRANSKRYPCJA - I etap ekspresji genów Przepisywanie informacji genetycznej z makrocząsteczki DNA na mniejsze i bardziej funkcjonalne cząsteczki pre-mrna Polimeraza RNA ETAP I Inicjacja

Bardziej szczegółowo

Metody: PCR, MLPA, Sekwencjonowanie, PCR-RLFP, PCR-Multiplex, PCR-ASO

Metody: PCR, MLPA, Sekwencjonowanie, PCR-RLFP, PCR-Multiplex, PCR-ASO Diagnostyka molekularna Dr n.biol. Anna Wawrocka Strategia diagnostyki genetycznej: Aberracje chromosomowe: Metody:Analiza kariotypu, FISH, acgh, MLPA, QF-PCR Gen(y) znany Metody: PCR, MLPA, Sekwencjonowanie,

Bardziej szczegółowo

ANALIZA DANYCH POCHODZĄCYCH Z SEKWENCJONOWANIA NASTĘPNEJ GENERACJI

ANALIZA DANYCH POCHODZĄCYCH Z SEKWENCJONOWANIA NASTĘPNEJ GENERACJI ANALIZA DANYCH POCHODZĄCYCH Z SEKWENCJONOWANIA NASTĘPNEJ GENERACJI JOANNA SZYDA MAGDALENA FRĄSZCZAK MAGDA MIELCZAREK WSTĘP 1. Katedra Genetyki 2. Pracownia biostatystyki 3. Projekty NGS 4. Charakterystyka

Bardziej szczegółowo

Searching for SNPs with cloud computing

Searching for SNPs with cloud computing Ben Langmead, Michael C Schatz, Jimmy Lin, Mihai Pop and Steven L Salzberg Genome Biology November 20, 2009 April 7, 2010 Problem Cel Problem Bardzo dużo krótkich odczytów mapujemy na genom referencyjny

Bardziej szczegółowo

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność Wersja 1.05 Wprowadzenie do Informatyki Biomedycznej Wykład 3: Wyszukiwanie w bazach sekwencji Przewidywanie genów Wydział Informatyki PB Marek Krętowski pokój 206 e-mail: m.kretowski@pb.edu.pl http://aragorn.pb.bialystok.pl/~mkret

Bardziej szczegółowo

Choroby genetyczne na tle zmian w genomie człowieka rodzaje, fenotyp, diagnostyka genetyczna

Choroby genetyczne na tle zmian w genomie człowieka rodzaje, fenotyp, diagnostyka genetyczna Przedmiot: Genetyka kliniczna V Rok, Wydział Lekarski I Katedra i Zakład Genetyki Medycznej UM w Poznaniu Choroby genetyczne na tle zmian w genomie człowieka rodzaje, fenotyp, diagnostyka genetyczna Opracowanie:

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ 1. Gen to odcinek DNA odpowiedzialny

Bardziej szczegółowo

Statystyczna analiza danych

Statystyczna analiza danych Statystyczna analiza danych ukryte modele Markowa, zastosowania Anna Gambin Instytut Informatyki Uniwersytet Warszawski plan na dziś Ukryte modele Markowa w praktyce modelowania rodzin białek multiuliniowienia

Bardziej szczegółowo

Niepełnosprawność intelektualna

Niepełnosprawność intelektualna Niepełnosprawność intelektualna stan badań a możliwości diagnostyki molekularnej Agnieszka Charzewska Zakład Genetyki Medycznej Instytut Matki i Dziecka Niepełnosprawność intelektualna (NI, ID) zaburzenie

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA DNA 28SRNA 18/16S RNA 5SRNA mrna Ilościowa analiza mrna aktywność genów w zależności od wybranych czynników: o rodzaju tkanki o rodzaju czynnika zewnętrznego o rodzaju upośledzenia szlaku metabolicznego

Bardziej szczegółowo

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej Wprowadzenie do Informatyki Biomedycznej Wykład 1: Podstawy bioinformatyki Wydział Informatyki PB Podstawy biologiczne - komórki Wszystkie organizmy zbudowane są z komórek komórka jest skomplikowanym systemem

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 4 Jak działają geny?

Bardziej szczegółowo

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

Przydatność technologii Sekwencjonowania Nowej Generacji (NGS) w kolekcjach Banków Genów Joanna Noceń Kinga Smolińska Marta Puchta Kierownik tematu:

Przydatność technologii Sekwencjonowania Nowej Generacji (NGS) w kolekcjach Banków Genów Joanna Noceń Kinga Smolińska Marta Puchta Kierownik tematu: Przydatność technologii Sekwencjonowania Nowej Generacji (NGS) w kolekcjach Banków Genów Joanna Noceń Kinga Smolińska Marta Puchta Kierownik tematu: prof. dr hab. Jerzy H. Czembor SEKWENCJONOWANIE I generacji

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Budowa rybosomu Translacja

Bardziej szczegółowo

Nowoczesne systemy ekspresji genów

Nowoczesne systemy ekspresji genów Nowoczesne systemy ekspresji genów Ekspresja genów w organizmach żywych GEN - pojęcia podstawowe promotor sekwencja kodująca RNA terminator gen Gen - odcinek DNA zawierający zakodowaną informację wystarczającą

Bardziej szczegółowo

BADANIA GENETYCZNE W DYSTROFIACH MIOTONICZNYCH

BADANIA GENETYCZNE W DYSTROFIACH MIOTONICZNYCH Kurs Neurogenetyki BADANIA GENETYCZNE W DYSTROFIACH MIOTONICZNYCH Anna Sułek Pracownia Molekularnych Podstaw Chorób Neurodegeneracyjnych Zakład Genetyki, IPiN OBRAZ KLINICZNY DYSTROFII MIOTONICZNEJ WIELE

Bardziej szczegółowo

Sekwencjonowanie, przewidywanie genów

Sekwencjonowanie, przewidywanie genów Instytut Informatyki i Matematyki Komputerowej UJ, opracowanie: mgr Ewa Matczyńska, dr Jacek Śmietański Sekwencjonowanie, przewidywanie genów 1. Technologie sekwencjonowania Genomem nazywamy sekwencję

Bardziej szczegółowo

dostateczny oraz: wyjaśnia, z czego wynika komplementarność zasad przedstawia graficznie regułę

dostateczny oraz: wyjaśnia, z czego wynika komplementarność zasad przedstawia graficznie regułę WYMAGANIA EDUKACYJNE Z BIOLOGII ZAKRES PODSTAWOWY KLASA I Dział Zakres wymagań na poszczególne oceny szkolne programowy dopuszczający dostateczny dobry bardzo dobry celujący Od genu do cechy określa rolę

Bardziej szczegółowo

Mutacje jako źródło różnorodności wewnątrzgatunkowej

Mutacje jako źródło różnorodności wewnątrzgatunkowej Mutacje jako źródło różnorodności wewnątrzgatunkowej Zajęcia terenowe: Zajęcia w klasie: Poziom nauczania oraz odniesienie do podstawy programowej: Liceum IV etap edukacyjny zakres rozszerzony: Różnorodność

Bardziej szczegółowo

DNA musi współdziałać z białkami!

DNA musi współdziałać z białkami! DNA musi współdziałać z białkami! Specyficzność oddziaływań między DNA a białkami wiążącymi DNA zależy od: zmian konformacyjnych wzdłuż cząsteczki DNA zróżnicowania struktury DNA wynikającego z sekwencji

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

Bioinformatyka, edycja 2016/2017, laboratorium

Bioinformatyka, edycja 2016/2017, laboratorium Instytut Informatyki i Matematyki Komputerowej UJ, opracowanie: dr Jacek Śmietański Mikromacierze 1. Mikromacierze wprowadzenie Mikromacierze to technologia pozwalająca na pomiar aktywności genów w komórce.

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) I. Od genu do cechy Budowa i funkcje kwasów

Bardziej szczegółowo

2014-03-26. Analiza sekwencji promotorów

2014-03-26. Analiza sekwencji promotorów 2014-03-26 Analiza sekwencji promotorów 1 2014-03-26 TFy tworzą zawiły układ regulacyjny, na który składają się różne oddziaływania białko białko poprzez wytworzenie PĘTLI Specyficzne TFy Ogólne TFy Benfey,

Bardziej szczegółowo

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie Sekwencyjność występowania zaburzeń molekularnych w niedrobnokomórkowym raku płuca

Bardziej szczegółowo

GENOM I POCHODZENIE CZŁOWIEKA. Geoff Barnard PhD MA (Theol) MIBiol

GENOM I POCHODZENIE CZŁOWIEKA. Geoff Barnard PhD MA (Theol) MIBiol GENOM I POCHODZENIE CZŁOWIEKA Geoff Barnard PhD MA (Theol) MIBiol Do niedawna debaty dotyczące darwinizmu koncentrowały się wokół różnorodnych świadectw historycznych takich jak molekularne i strukturalne

Bardziej szczegółowo

Badanie doboru naturalnego na poziomie molekularnym

Badanie doboru naturalnego na poziomie molekularnym Badanie doboru naturalnego na poziomie molekularnym Podstawy ewolucji molekulanej Jak ewoluują sekwencje Zmiany genetyczne w ewolucji Mutacje tworzą nowe allele genów Inwersje zmieniają układ genów na

Bardziej szczegółowo

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań dopuszczający

Bardziej szczegółowo

Bioinformatyka. Rodzaje Mutacji

Bioinformatyka. Rodzaje Mutacji Bioinformatyka (wykład monograficzny) wykład 3. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas Rodzaje Mutacji zmienność sekwencji (sequence variation) mutacje polimorfizm

Bardziej szczegółowo

Genom człowieka. Typy mutacji genomu i związane z tym choroby genetyczne. III Rok WL1 dr Katarzyna Wicher

Genom człowieka. Typy mutacji genomu i związane z tym choroby genetyczne. III Rok WL1 dr Katarzyna Wicher Genom człowieka. Typy mutacji genomu i związane z tym choroby genetyczne. III Rok WL1 dr Katarzyna Wicher 1. Budowa, funkcje i rodzaje DNA -podstawowe funkcje kwasu deosyrybonukleinowego -struktura prawoskrętnej

Bardziej szczegółowo

THE UNFOLDED PROTEIN RESPONSE

THE UNFOLDED PROTEIN RESPONSE THE UNFOLDED PROTEIN RESPONSE Anna Czarnecka Źródło: Intercellular signaling from the endoplasmatic reticulum to the nucleus: the unfolded protein response in yeast and mammals Ch. Patil & P. Walter The

Bardziej szczegółowo

The Role of Maf1 Protein in trna Processing and Stabilization / Rola białka Maf1 w dojrzewaniu i kontroli stabilności trna

The Role of Maf1 Protein in trna Processing and Stabilization / Rola białka Maf1 w dojrzewaniu i kontroli stabilności trna Streszczenie rozprawy doktorskiej pt. The Role of Maf1 Protein in trna Processing and Stabilization / Rola białka Maf1 w dojrzewaniu i kontroli stabilności trna mgr Tomasz Turowski, promotor prof. dr hab.

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański BIOINFORMATYKA edycja 2016 / 2017 wykład 11 RNA dr Jacek Śmietański jacek.smietanski@ii.uj.edu.pl http://jaceksmietanski.net Plan wykładu 1. Rola i rodzaje RNA 2. Oddziaływania wewnątrzcząsteczkowe i struktury

Bardziej szczegółowo

Wymagania edukacyjne z biologii w klasie pierwszej, zakres podstawowy. Podręcznik Biologia na czasie - Wyd. Nowa Era

Wymagania edukacyjne z biologii w klasie pierwszej, zakres podstawowy. Podręcznik Biologia na czasie - Wyd. Nowa Era Wymagania edukacyjne z biologii w klasie pierwszej, zakres podstawowy. Podręcznik Biologia na czasie - Wyd. Nowa Era Poziom wymagań konieczny ocena dopuszczająca - podstawowy ocena dostateczna - rozszerzający

Bardziej szczegółowo

Zaoczne Liceum Ogólnokształcące Pegaz

Zaoczne Liceum Ogólnokształcące Pegaz WYMAGANIA EGZAMINACYJNE ROK SZKOLNY 2015/2016 Semestr jesienny TYP SZKOŁY: liceum ogólnokształcące PRZEDMIOT: biologia SEMESTR: II LICZBA GODZIN W SEMESTRZE: 15 PROGRAM NAUCZANIA: Program nauczania biologii

Bardziej szczegółowo

Budowa kwasów nukleinowych

Budowa kwasów nukleinowych Bioinformatyka (wykład monograficzny) wykład 2. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas Budowa kwasów nukleinowych Kwasy nukleinowe (DA i RA) zbudowane są z nukleotydów

Bardziej szczegółowo

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3 Księgarnia PWN: Terry A. Brown - Genomy Przedmowa Przedmowa do drugiego wydania polskiego Wstęp Spis rozdziałów Skróty V VI VII XI XIX Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy

Bardziej szczegółowo

mikrosatelitarne, minisatelitarne i polimorfizm liczby kopii

mikrosatelitarne, minisatelitarne i polimorfizm liczby kopii Zawartość 139371 1. Wstęp zarys historii genetyki, czyli od genetyki klasycznej do genomiki 2. Chromosomy i podziały jądra komórkowego 2.1. Budowa chromosomu 2.2. Barwienie prążkowe chromosomów 2.3. Mitoza

Bardziej szczegółowo

Organizacja genomu człowieka i sekwencjonowanie DNA

Organizacja genomu człowieka i sekwencjonowanie DNA Organizacja genomu człowieka i sekwencjonowanie DNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Organizacja genów na ludzkim chromosomie.

Bardziej szczegółowo

Przeglądanie bibliotek

Przeglądanie bibliotek Przeglądanie bibliotek Czyli jak złapać (i sklonować) ciekawy gen? Klonowanie genów w oparciu o identyczność lub podobieństwo ich sekwencji do znanego już DNA Sonda homologiczna (komplementarna w 100%)

Bardziej szczegółowo

Mutacje Interakcje genetyczne I

Mutacje Interakcje genetyczne I Mutacje Interakcje genetyczne I Powstawanie mutacji - teorie Spontaniczne powstają przypadkowo, środowisko może wpływać na częstość (np. mutageny) mutacji, ale nie na to, w którym genie zachodzą Indukowane

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) 1 Budowa i funkcje

Bardziej szczegółowo

Acrodermatitis enteropathica

Acrodermatitis enteropathica Acrodermatitis enteropathica Acrodermatitis enteropathica (zespół Brandta) to choroba związana z uszkodzeniem białka odpowiedzialnego za wchłanianie cynku. Objawy choroby ujawniają się w pierwszych miesiącach

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE BIOLOGIA zakres podstawowy biologia na czasie

WYMAGANIA EDUKACYJNE BIOLOGIA zakres podstawowy biologia na czasie WYMAGANIA EDUKACYJNE BIOLOGIA zakres podstawowy biologia na czasie Dział programu Lp. Temat Poziom wymagań dopuszczający dostateczny dobry bardzo dobry I. Od genu do cechy 1 Budowa i funkcje kwasów nukleinowych

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) I. Od genu do cechy 1 Budowa i funkcje

Bardziej szczegółowo

Jaki koń jest nie każdy widzi - genomika populacji polskich ras koni

Jaki koń jest nie każdy widzi - genomika populacji polskich ras koni Jaki koń jest nie każdy widzi - genomika populacji polskich ras koni Gurgul A., Jasielczuk I., Semik-Gurgul E., Pawlina-Tyszko K., Szmatoła T., Bugno-Poniewierska M. Instytut Zootechniki PIB Zakład Biologii

Bardziej szczegółowo

Podstawy genetyki IV. Mutacje

Podstawy genetyki IV. Mutacje Podstawy genetyki IV Mutacje Powstawanie mutacji - teorie Spontaniczne powstają przypadkowo, środowisko może wpływać na częstość (np. mutageny) mutacji, ale nie na to, w którym genie zachodzą Indukowane

Bardziej szczegółowo

Bioinformatyka. Michał Przyłuski

Bioinformatyka. Michał Przyłuski Bioinformatyka Michał Przyłuski Plan prezentacji Wstęp biologiczny Biologia molekularna genetyka Bioinformatyka Przykłady zastosowań: sekwencjonowanie mikromacierze filogenetyka Czemu wstęp biologiczny?

Bardziej szczegółowo

Wymagania na poszczególne stopnie szkolne dla przedmiotu biologia. Klasa I Liceum Ogólnokształcącego poziom podstawowy

Wymagania na poszczególne stopnie szkolne dla przedmiotu biologia. Klasa I Liceum Ogólnokształcącego poziom podstawowy Wymagania na poszczególne stopnie szkolne dla przedmiotu biologia Klasa I Liceum Ogólnokształcącego poziom podstawowy Dział programu Lp Poziom wymagań na poszczególne stopnie szkolne Temat Ocena dopuszczająca

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy przedmiot biologia nauczana dwujęzycznie poziom podstawowy klasa Ib i Ic

Wymagania edukacyjne Biologia na czasie zakres podstawowy przedmiot biologia nauczana dwujęzycznie poziom podstawowy klasa Ib i Ic Wymagania edukacyjne Biologia na czasie zakres podstawowy przedmiot biologia nauczana dwujęzycznie poziom podstawowy klasa Ib i Ic Dział programu Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający

Bardziej szczegółowo

Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO

Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań konieczny (K) dopuszczający podstawowy (P) dostateczny rozszerzający (R) dobry

Bardziej szczegółowo

definiuje pojęcia: inżynieria genetyczna, replikacja DNA wyjaśnia regułę komplementarności

definiuje pojęcia: inżynieria genetyczna, replikacja DNA wyjaśnia regułę komplementarności Wymagania programowe na poszczególne stopnie przygotowane w oparciu o podstawę programową oraz treści podręcznika : Biologia na czasie zakres podstawowy (Wydawnictwo Nowa Era) Opracowała: Anna Wojdan Dział

Bardziej szczegółowo

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP WYNALAZKI BIOTECHNOLOGICZNE W POLSCE Ewa Waszkowska ekspert UPRP Źródła informacji w biotechnologii projekt SLING Warszawa, 9-10.12.2010 PLAN WYSTĄPIENIA Umocowania prawne Wynalazki biotechnologiczne Statystyka

Bardziej szczegółowo

Skrypt Bioinformatyka DRAFT Strona 67

Skrypt Bioinformatyka DRAFT Strona 67 Spis treści 5 Budowa kwasów nukleinowych... 68 5.1 Nukleotydy... 68 5.2 Łaocuch polinukleotydowy... 71 5.3 Nić komplementarna... 71 6 Centralny dogmat Biologii Molekularnej... 74 7 Przepływ informacji

Bardziej szczegółowo

Mutacje Interakcje genetyczne I

Mutacje Interakcje genetyczne I 1 Mutacje Interakcje genetyczne I Powstawanie mutacji - teorie } Spontaniczne } powstają przypadkowo, środowisko może wpływać na częstość (np. mutageny) mutacji, ale nie na to, w którym genie zachodzą

Bardziej szczegółowo

Moczówka prosta nerkowa

Moczówka prosta nerkowa Moczówka prosta nerkowa Moczówka prosta nerkowa jest chorobą, która objawia się we wczesnym dzieciństwie nadmiernym wydalaniem moczu (poliurią) i zwiększonym pragnieniem (polidypsją), co jest skutkiem

Bardziej szczegółowo

Wrodzony przerost nadnerczy

Wrodzony przerost nadnerczy Wrodzony przerost nadnerczy Geny i zespoły genetyczne Gen Choroba/objawy Sposób dziedziczenia Znane warianty chorobotwórcze CYP11B1 Wrodzony przerost nadnerczy AD/AR 22 CYP17A1 Wrodzony przerost nadnerczy

Bardziej szczegółowo

Profilowanie somatyczne BRCA1, BRCA2

Profilowanie somatyczne BRCA1, BRCA2 Profilowanie somatyczne BRCA1, BRCA2 Nowotwór złośliwy rozwija się w momencie, gdy w DNA komórek nagromadzone zostaną liczne mutacje. Od rodzaju tych mutacji zależy dobór właściwego schematu leczenia,

Bardziej szczegółowo

Technikum Nr 2 im. gen. Mieczysława Smorawińskiego w Zespole Szkół Ekonomicznych w Kaliszu

Technikum Nr 2 im. gen. Mieczysława Smorawińskiego w Zespole Szkół Ekonomicznych w Kaliszu Technikum Nr 2 im. gen. Mieczysława Smorawińskiego w Zespole Szkół Ekonomicznych w Kaliszu Wymagania edukacyjne niezbędne do uzyskania poszczególnych śródrocznych i rocznych ocen klasyfikacyjnych z obowiązkowych

Bardziej szczegółowo

podstawowy. Jest on niezastąpiony przy obiektywnej ocenie postępów ucznia w nauce.

podstawowy. Jest on niezastąpiony przy obiektywnej ocenie postępów ucznia w nauce. Wymagania edukacyjne zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń powinien opanować po omówieniu poszczególnych lekcji z podręcznika Biologia na czasie zakres podstawowy. Jest on

Bardziej szczegółowo

Wymagania edukacyjne z biologii nauczanej dwujęzycznie. Poziomy oczekiwanych osiągnięć ucznia. Stopnie szkolne

Wymagania edukacyjne z biologii nauczanej dwujęzycznie. Poziomy oczekiwanych osiągnięć ucznia. Stopnie szkolne Wymagania edukacyjne z biologii nauczanej dwujęzycznie zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń powinien opanować po omówieniu poszczególnych lekcji z podręcznika Biologia na

Bardziej szczegółowo

prof. dr hab. Krystyna M. Charon Warszawa Recenzja

prof. dr hab. Krystyna M. Charon Warszawa Recenzja prof. dr hab. Krystyna M. Charon Warszawa 04.03.2016 Recenzja rozprawy doktorskiej mgr inż. Klaudii Pawliny pt. Charakterystyka mutacji w komórkach nowotworowych sarkoidu końskiego Przedstawiona mi do

Bardziej szczegółowo

Plan wykładu: Budowa chromatyny - nukleosomy. Wpływ nukleosomów na replikację i transkrypcję

Plan wykładu: Budowa chromatyny - nukleosomy. Wpływ nukleosomów na replikację i transkrypcję Nukleosomy 1 Plan wykładu: Budowa chromatyny - nukleosomy Wpływ nukleosomów na replikację i transkrypcję Metody pozwalające na wyznaczanie miejsc wiązania nukleosomów Charakterystyka obsadzenia nukleosomów

Bardziej szczegółowo

Wykład 1. Od atomów do komórek

Wykład 1. Od atomów do komórek Wykład 1. Od atomów do komórek Skład chemiczny komórek roślinnych Składniki mineralne (nieorganiczne) - popiół Substancje organiczne (sucha masa) - węglowodany - lipidy - kwasy nukleinowe - białka Woda

Bardziej szczegółowo

Zaburzenia metabolizmu kreatyny

Zaburzenia metabolizmu kreatyny Zaburzenia metabolizmu kreatyny Kreatyna jest związkiem, który u człowieka występuje głównie w mięśniach i jest wykorzystywany do magazynowania i uwalniania energii, wykorzystywanej w wielu procesach komórkowych.

Bardziej szczegółowo

Warunki udzielania świadczeń w rodzaju: świadczenia zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE

Warunki udzielania świadczeń w rodzaju: świadczenia zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE Załącznik nr do Zarządzenia.. Warunki udzielania świadczeń w rodzaju: zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE 8.1 WARUNKI WYMAGANE Załącznik nr 2 do rozporządzenia cz. I lit. M Lp 913-916

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI 6 BAZA DANYCH NCBI - II

PODSTAWY BIOINFORMATYKI 6 BAZA DANYCH NCBI - II PODSTAWY BIOINFORMATYKI 6 BAZA DANYCH NCBI - II BAZA DANYCH NCBI 1. NCBI 2. Dane gromadzone przez NCBI 3. Przegląd baz danych NCBI: Publikacje naukowe Projekty analizy genomów OMIM: fenotypy człowieka

Bardziej szczegółowo

Praca klasowa waga 3. Sprawdzian waga 3. Kartkówka waga 2. Odpowiedź waga 1. Aktywność waga 1

Praca klasowa waga 3. Sprawdzian waga 3. Kartkówka waga 2. Odpowiedź waga 1. Aktywność waga 1 1 Przepisy ogólne 2 3 Praca klasowa waga 3 Sprawdzian waga 3 Kartkówka waga 2 Odpowiedź waga 1 Aktywność waga 1 4 Wymagania edukacyjne zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń

Bardziej szczegółowo

Rak tarczycy - prognostyka

Rak tarczycy - prognostyka Rak tarczycy - prognostyka Wariant rs966423-tt w genie DIRC3 jest czynnikiem rokowniczo niekorzystnym, związanym ze zwiększonym ryzykiem zgonu w przebiegu raka zróżnicowanego tarczycy (Świerniak et al.

Bardziej szczegółowo

Na czym skończyliśmy BLACK BOX. Sekwencjonowanie polega na odczytaniu sekwencji liter DNA/RNA badanego fragmentu genomu

Na czym skończyliśmy BLACK BOX. Sekwencjonowanie polega na odczytaniu sekwencji liter DNA/RNA badanego fragmentu genomu ALEKSANDRA ŚWIERCZ Na czym skończyliśmy BLACK BOX AAATGCCTGCCCTGAAGGCCTGCGTA GTTTTGGGAGAAGACCCACGGATA AAGGTGTAGCCCCGTAGC GGGGGGTATTATTTATTTTATACCCAC.. ACAGGAUCGUUGGAUGGTGGGA. Sekwencjonowanie polega na

Bardziej szczegółowo

Przytarczyce, zaburzenia metabolizmu wapnia

Przytarczyce, zaburzenia metabolizmu wapnia Przytarczyce, zaburzenia metabolizmu wapnia Geny i zespoły genetyczne Gen Choroba/objawy Sposób dziedziczenia Znane warianty chorobotwórcze BSND Zespół Barttera, Głuchota czuciowo-nerwowa AR 10 CASR Nadczynność

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie klasa 1 LO, poziom podstawowy

Wymagania edukacyjne Biologia na czasie klasa 1 LO, poziom podstawowy SZCZEGÓŁOWE WYMAGANIA EDUKACYJNE klasa 1 PLO Zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń powinien opanować po omówieniu poszczególnych lekcji z podręcznika Biologia na czasie zakres

Bardziej szczegółowo

Hiperoksaluria pierwotna

Hiperoksaluria pierwotna Hiperoksaluria pierwotna Pierwotne hiperoksalurie są rzadkimi zaburzeniami szlaków metabolicznych prowadzących do powstawania nadmiernej ilości szczawianów, które powodują nawracającą kamicy nerkową, prowadzącą

Bardziej szczegółowo