Mikrosatelitarne sekwencje DNA

Save this PDF as:

Wielkość: px
Rozpocząć pokaz od strony:

Download "Mikrosatelitarne sekwencje DNA"


1 Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym Leśny Bank Genów Kostrzyca

2 Spis treści I. DNA II. Ogólne zasady genetyki molekularnej III.Reakcja PCR IV.Markery genetyczne V.Mikrosatelity 2

3 DNA DNA kwas deoksyrybonukleinowy (dawn. kwas dezoksyrybonukleinowy), w skrócie DNA (od ang. deoxyribonucleic acid) wielkocząsteczkowy organiczny związek zek chemiczny należący do kwasów nukleinowych może być zlokalizowany w jądrze komórkowym i w cytoplazmie, u wirusów w kapsydach pełni rolę nośnika nika informacji genetycznej organizmów żywych autorami modelu podwójnej helisy DNA są James Watson i Francis Crick, na podstawie zdjęć krystalografii rentgenowskiej wykonanych przez Rosalind Franklin i Maurice a Wilkinsa (1953 r.) 3

4 DNA DNA W komórkach DNA znajduje się w: jądrze komórkowym (ndna- jądrowy DNA) chloroplastach (cpdna- chloroplastowy DNA) mitochondriach (mtdna- mitochondrialny DNA) 4

5 DNA DNA- nieskomplikowana budowa chemiczna przeważnie cząsteczka jest dwuniciowa, nici są skręcone spiralnie wokół siebie koniec (5 ) jednej nici leży naprzeciwko początku (3 ) drugiej nici (usytuowanie naprzeciwległe) podstawową jednostką budulcową jest nukleotyd: cukier (deoksyryboza lub ryboza) + zasada azotowa + reszta kwasu fosforowego nukleotyd 5

6 DNA DNA- nieskomplikowana budowa chemiczna Zasady azotowe dwóch przeciwległych nici łączą się ze sobą komplementarnie (łac. complementum dopełnienie), tj. zawsze adenina łączy się z tyminą a cytozyna z guaniną 6

7 Ogólne zasady genetyki molekularnej Przepływ informacji genetycznej w komórce odbywa się jednokierunkowo: DNA RNA BIAŁKA Wszystkie komórki organizmu zawierają identyczną, pełną informację genetyczną Zależnie od rodzaju komórki, fazy cyklu życiowego, jej stanu i warunków zewnętrznych- ekspresji ulegają inne fragmenty zapisu genetycznego Jednostki informacji genetycznej (m.in.): Nukleotyd- cukier (deoksyryboza lub ryboza) + zasada azotowa + reszta kwasu fosforowego Gen- odcinek DNA odpowiedzialny za powstanie jednej cząsteczki białka, trna lub rrna Chromosom- nić DNA połączona z białkami, która jako całość wędruje z komórki macierzystej do komórki potomnej Genom- całość informacji genetycznej zawartej w komórce lub w określonym organellum np. genom chloroplastowy, genom mitochondrialny 7

8 Ogólne zasady genetyki molekularnej Każda cecha fenotypowa (np. kolor włosów) jest warunkowana przez zapis genetyczny w genach Locus (l. mnoga loci)- określony obszar chromosomu zajmowany przez gen. W obrębie chromosomu znajduje się wiele różnych loci. W locus mogą znajdować się różne warianty danego genu (różniące się sekwencją nukleotydów w DNA) zwane allelami Organizm haploidalny ma zestaw pojedynczych chromosomów (N) Organizm diploidalny ma zestaw chromosomów połączonych parami (2N) 8

9 Reakcja PCR PCR- Reakcja łańcuchowa polimerazy (ang. Polymerase Chain Reaction) metoda powielania łańcuchów DNA w warunkach laboratoryjnych (w termocyklerze). Składniki do przeprowadzenia PCR: 1) wyizolowany, o odpowiedniej czystości DNA (z tkanek roślinnych, z krwi, z włosów itp.) 2) środowisko reakcji (bufor, jony magnezowe oraz odpowiedniej czystości woda) 3) primery (in. startery- czyli kilku do kilkunastu nukleotydowe sekwencje flankujące znany lub nieznany odcinek DNA) 4) dntp (wolne nukleotydy) 5) termostabilna (nie ulegająca degradacji w wysokich temperaturach) polimeraza DNA 9

10 Reakcja PCR PCR- Reakcja łańcuchowa polimerazy (ang. Polymerase Chain Reaction) metoda powielania łańcuchów DNA w warunkach laboratoryjnych. Technika została wynaleziona w 1983 r. przez Karye go Mullisa z kalifornijskiej firmy Cetus, za co Mullis otrzymał w roku 1993 Nagrodę Nobla PCR znajduje wiele zastosowań, m.in.: w badaniach nad genomem charakterystyce ekspresji genów w klonowaniu genów diagnostyce klinicznej identyfikacji osób zaginionych kryminalistyce paleontologii 10

11 11 Reakcja PCR

12 Markery genetyczne Markery genetyczne to cechy jakościowe organizmów podlegające prostym zasadom dziedziczenia zgodnie z prawami Mendla. Można je podzielić na 3 główne klasy: I. Markery morfologiczne (brak chlorofilu, specyficzny kształt łusek szyszkowych czy blaszki liściowej), II. Markery biochemiczne (izoenzymy, terpeny, antygeny), III. Markery DNA (oparte na zmienności sekwencji nukleotydów). Markery genetyczne służą m.in.: badaniu zmienności genetycznej populacji umożliwiają identyfikację osobniczą, w tym analizę rodzicielstwa umożliwiają badanie śladów biologicznych w miejscu przestępstwa i porównanie ich z genotypami osób podejrzanych o jego popełnienie są szeroko wykorzystywane w badaniach populacyjnych drzew leśnych. 12

13 Mikrosatelity Specyficznym rodzajem markerów DNA są sekwencje mikrosatelitarne czyli mikrosatelity- SSR (ang. Simple Sequence Repeats) Występują jako tandemowe powtórzenia krótkich jednostek (sekwencji) o długości od 1 do 6 nukleotydów. O polimorfizmie (różnorodności) mikrosatelitów stanowi zmienność liczby powtórzeń krótkich sekwencji, która w zależności od locus może wahać się od kilku do ponad trzydziestu. Polimorfizm mikrosatelitów bada się poprzez analizę długości fragmentów DNA zawierających mikrosatelity, wykorzystując mechanizm reakcji PCR, a różne allele identyfikuje się jako fragmenty DNA o różnej długości mierzone liczbą nukleotydów. 13

14 Mikrosatelity- SSR Mikrosatelity SSR (ang. Simple Sequence Repeats) należą do grupy powtarzających się sekwencji DNA. Występują jako tandemowe powtórzenia krótkich jednostek (sekwencji) o długości od 1 do 6 nukleotydów np. : O polimorfizmie (różnorodności) mikrosatelitów stanowi zmienność liczby powtórze rzeń krótkich sekwencji, która w zależności od locus może wahać się od kilku do ponad trzydziestu: 14

15 Mikrosatelity Typowy locus mikrosatelitarny składa się zatem z obszaru DNA, w ramach którego występują sekwencje powtarzające się, oraz z konserwatywnych fragmentów końcowych, które są podstawą do wyznaczenia (opracowania) starterów oligonukleotydów o długości ok. 20 nukleotydów wykorzystywanych w reakcji PCR. 5 3 CTACCCGAACACACACACACATTTCGACATTA GATGGGCTTGTGTGTGTGTGTAAAGCTGTAAT 3 5 fragment końcowy, flankujący mikrosatelita fragment końcowy, flankujący 15

16 Mikrosatelity Zalety i wady mikrosatelitów Zalety wykazują wysoki polimorfizm kodominacyjny system dziedziczenia genotyp można analizować na podstawie każdej tkanki, z której można wyizolować DNA analizy laboratoryjne są wysoce powtarzalne, a sam proces można w dużym stopniu zautomatyzować Wady stosunkowo wysokie koszty wyposażenia laboratoryjnego umiarkowanie wysokie koszty analiz laboratoryjnych podawana przez niektórych autorów podatność tych markerów na zmienność mutacyjną oraz błędy określania genotypów wynikające m.in. z występowania alleli null 16

17 Dziękuj kuję za uwagę autorki prezentacji: E. Kaczmarek, A. Pasławska Zdjęcia w prezentacji: Internet A.Pasławska M.Pałucka Wykorzystano m.in. Markery mikrosatelitarne DNA i ich wykorzystanie w badaniach z zakresu genetyki drzew leśnych, J.Burczyk 17


MARKERY MIKROSATELITARNE MARKERY MIKROSATELITARNE Badania laboratoryjne prowadzone w Katedrze Genetyki i Ogólnej Hodowli Zwierząt SGGW w ramach monitoringu genetycznego wykorzystują analizę genetyczną markerów mikrosatelitarnych.

Bardziej szczegółowo

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier.

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier. ID Testu: F5679R8 Imię i nazwisko ucznia Klasa Data 1. Na indywidualne cechy danego osobnika ma (maja) wpływ A. wyłacznie czynniki środowiskowe. B. czynniki środowiskowe i materiał genetyczny. C. wyłacznie

Bardziej szczegółowo

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A...

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A... 1. Zadanie (0 2 p. ) Porównaj mitozę i mejozę, wpisując do tabeli podane określenia oraz cyfry. ta sama co w komórce macierzystej, o połowę mniejsza niż w komórce macierzystej, gamety, komórki budujące

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo

Johann Friedrich Miescher

Johann Friedrich Miescher Certyfikacja DNA u psów FANCLUBU Fakt, iż każdy żywy organizm zwierzę, roślina, człowiek jest jednostką unikalną, niepowtarzalną, jedyną w swoim rodzaju - był od dawna prawie pewnikiem. Jednakże pełne

Bardziej szczegółowo

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :.

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :. CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A imię i nazwisko :. klasa :.. ilość punktów :. Zadanie 1 Przeanalizuj schemat i wykonaj polecenia. a. Wymień cztery struktury występujące zarówno w komórce roślinnej,

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7.2. Metody biologii molekularnej (technika PCR, sekwencjonowanie DNA) wykorzystywane w taksonomii roślin Autor: Magdalena Dudek

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

Imię i nazwisko...kl...

Imię i nazwisko...kl... Gimnazjum nr 4 im. Ojca Świętego Jana Pawła II we Wrocławiu SPRAWDZIAN GENETYKA GR. A Imię i nazwisko...kl.... 1. Nauka o regułach i mechanizmach dziedziczenia to: (0-1pkt) a) cytologia b) biochemia c)

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

DNA musi współdziałać z białkami!

DNA musi współdziałać z białkami! DNA musi współdziałać z białkami! Specyficzność oddziaływań między DNA a białkami wiążącymi DNA zależy od: zmian konformacyjnych wzdłuż cząsteczki DNA zróżnicowania struktury DNA wynikającego z sekwencji

Bardziej szczegółowo

Dr hab.n.med. Renata Jacewicz

Dr hab.n.med. Renata Jacewicz GENOM CZŁOWIEKA >99 % 0,05%(100MtDNA) 65% Dr hab.n.med. Renata Jacewicz Kierownik Pracowni Genetyki Medycznej i Sądowej 3% 32% 2013 Pracownia Genetyki Medycznej i Sądowej ZMS Dojrzałe erytrocyty, trzony

Bardziej szczegółowo

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

Numer pytania Numer pytania

Numer pytania Numer pytania KONKURS BIOLOGICZNY ZMAGANIA Z GENETYKĄ 2016/2017 ELIMINACJE SZKOLNE I SESJA GENETYKA MOLEKULARNA KOD UCZNIA. IMIĘ i NAZWISKO. DATA... GODZINA.. Test, który otrzymałeś zawiera 20 pytań zamkniętych. W każdym

Bardziej szczegółowo

Profaza I wykształcenie się wrzeciona podziałowego, kondensacja chromatyny do chromosomów jest długa i składa się z 5 stadiów:

Profaza I wykształcenie się wrzeciona podziałowego, kondensacja chromatyny do chromosomów jest długa i składa się z 5 stadiów: Cykl komórkowy Podział komórki - proces zachodzący u wszystkich żywych organizmów, w którym komórka macierzysta dzieli się na dwie lub więcej komórek potomnych. Najpierw następuje podział jądra komórkowego

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

Zaoczne Liceum Ogólnokształcące Pegaz

Zaoczne Liceum Ogólnokształcące Pegaz WYMAGANIA EGZAMINACYJNE ROK SZKOLNY 2015/2016 Semestr jesienny TYP SZKOŁY: liceum ogólnokształcące PRZEDMIOT: biologia SEMESTR: II LICZBA GODZIN W SEMESTRZE: 15 PROGRAM NAUCZANIA: Program nauczania biologii

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

Maria Szczepaniec Badania genetyczne DNA na użytek procesu karnego. Zeszyty Prawnicze 13/1, 171-184

Maria Szczepaniec Badania genetyczne DNA na użytek procesu karnego. Zeszyty Prawnicze 13/1, 171-184 Maria Szczepaniec Badania genetyczne DNA na użytek procesu karnego Zeszyty Prawnicze 13/1, 171-184 2013 Zeszyty Prawnicze 13.1 / 2013 Maria Szczepaniec Uniwersytet Kardynała Stefana Wyszyńskiego BADANIA

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

Genetyka w nowej podstawie programowej

Genetyka w nowej podstawie programowej Genetyka w nowej podstawie programowej Dział Genetyka - III etap edukacyjny Rzetelna realizacja tego działu w gimnazjum jest kluczowa ze względu na to, że biotechnologia i inżynieria genetyczna jest omawiana

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

Biotechnologia i inżynieria genetyczna

Biotechnologia i inżynieria genetyczna Wersja A Test podsumowujący rozdział II i inżynieria genetyczna..................................... Imię i nazwisko.............................. Data Klasa oniższy test składa się z 16 zadań. rzy każdym

Bardziej szczegółowo

Przedmiotowe zasady oceniania:

Przedmiotowe zasady oceniania: Przedmiotowe zasady oceniania: Przedmiotowe Zasady Oceniania z biologii obowiązujący w roku szkolnym 2012/13 r. w VIII LO realizowany przez nauczycieli przedmiotu Justynę Baranowską, Mirosławę Drażniuk,

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

Składniki jądrowego genomu człowieka

Składniki jądrowego genomu człowieka Składniki jądrowego genomu człowieka Genom człowieka 3 000 Mpz (3x10 9, 100 cm) Geny i sekwencje związane z genami (900 Mpz, 30% g. jądrowego) DNA pozagenowy (2100 Mpz, 70%) DNA kodujący (90 Mpz ~ ok.

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ===============================================================================================

Bardziej szczegółowo

Genetyka Rasowych Świnek Morskich

Genetyka Rasowych Świnek Morskich Genetyka Rasowych Świnek Morskich nauka o dziedziczności i zmienności organizmów, które są oparte na informacji zawartej w podstawowych jednostkach dziedziczności genach. Opracowanie : Daniel Dawid Banasiak

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe

Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe Marcin Kruszewski Centrum Radiobiologii i Dozymetrii Biologicznej Instytut Chemii

Bardziej szczegółowo

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI Fot. W. Wołkow Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt POPULACJA Zbiór organizmów żywych, które łączy

Bardziej szczegółowo

Księgarnia PWN: Joanna R. Freeland - Ekologia molekularna

Księgarnia PWN: Joanna R. Freeland - Ekologia molekularna Księgarnia PWN: Joanna R. Freeland - Ekologia molekularna Spis treści Przedmowa................................. Podziękowania............................... XIII XIV 1 Metody genetyki molekularnej w badaniach

Bardziej szczegółowo

Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych. do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym

Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych. do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym Konferencja szkoleniowa 27.09.2012 Leśny Bank Genów Kostrzyca

Bardziej szczegółowo


GENOM I JEGO STRUKTURA GENOM I JEGO STRUKTURA GENOM Ogół materiału genetycznego (kwasu nukleinowego niosącego informację genetyczną) zawartego w pojedynczej części składowej (komórce, cząstce wirusa) organizmu 1 Genom eukariotyczny

Bardziej szczegółowo

Geny, a funkcjonowanie organizmu

Geny, a funkcjonowanie organizmu Geny, a funkcjonowanie organizmu Wprowadzenie do genów letalnych Geny kodują Białka Kwasy rybonukleinowe 1 Geny Występują zwykle w 2 kopiach Kopia pochodząca od matki Kopia pochodząca od ojca Ekspresji

Bardziej szczegółowo

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Praca wykonana pod kierunkiem dr hab. Tomasza Grzybowskiego w Katedrze Medycyny Sądowej w Zakładzie Genetyki Molekularnej

Bardziej szczegółowo


INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo



Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) I. Od genu do cechy Budowa i funkcje kwasów

Bardziej szczegółowo

Znaczenie genetyki. Opracował A. Podgórski

Znaczenie genetyki. Opracował A. Podgórski Znaczenie genetyki Opracował A. Podgórski InŜynieria genetyczna InŜynieria genetyczna ingerencja w materiał genetyczny organizmów, w celu zmiany ich właściwości dziedzicznych. Istota inŝynierii genetycznej

Bardziej szczegółowo

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1 Przedmiot: Biochemia Nazwa testu: Biochemia wer. 1.0.5 Nr testu 14883078 Klasa: zaoczni_2007 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Do aminokwasów aromatycznych zalicza się A) G, P oraz S B) L,

Bardziej szczegółowo

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo


SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SPIS TREŚCI: 1. Wprowadzenie. 2. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. 3. Karty pracy. 1. Karta

Bardziej szczegółowo

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki Klub Młodego Wynalazcy - Laboratoria i wyposażenie Zadbaliśmy o to, żeby wyposażenie w Klubie Młodego Wynalazcy było w pełni profesjonalne. Ważne jest, aby dzieci i młodzież, wykonując doświadczenia korzystały

Bardziej szczegółowo

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań dopuszczający

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo


2015-11-18. DNA i RNA ENZYMY MODYFIKUJĄCE KOŃCE CZĄSTECZEK. DNA i RNA. DNA i RNA Fosfataza alkaliczna CIP Calf Intestine Phosphatase- pochodzenie: jelito cielęce BAP Bacterial Alcaline Phosphatase- pochodzenie: E. coli SAP Shrimp Alcaline Phosphatase- pochodzenie: krewetki Pandalus

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecnośd Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo


ODDZIAŁYWANIE KSENOBIOTYKÓW Z DNA Wydział Chemiczny olitechniki Gdańskiej Katedra Technologii Leków i Biochemii Biochemia DDZIAŁYWAIE KSEBITYKÓW Z DA Struktura DA DA, kwas deoksyrybonukleinowy, może być docelowym miejscem działania ksenobiotyku

Bardziej szczegółowo

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10.

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10. Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016 Ćwiczenie nr 1 (06-07.10.2015) Temat: Wprowadzenie 1. Omówienie regulaminu zajęć Temat: Wprowadzenie

Bardziej szczegółowo

Zastosowanie teorii węzłów w biologii molekularnej. Piotr Krzywda Gr. 10B2

Zastosowanie teorii węzłów w biologii molekularnej. Piotr Krzywda Gr. 10B2 Zastosowanie teorii węzłów w biologii molekularnej Piotr Krzywda Gr. 10B2 Na początku trochę biologii. Biologia molekularna Biologia molekularna jest to dziedzina nauki z pogranicza kilku nauk biologicznych,

Bardziej szczegółowo

Zmienność genomu. Przyczyny, skutki i sposoby kontroli

Zmienność genomu. Przyczyny, skutki i sposoby kontroli Zmienność genomu Przyczyny, skutki i sposoby kontroli Zmienność genomu Przez zmienność genomu (polimorfizm) rozumiemy różnice w sekwencji DNA genomowego pomiędzy osobnikami jednego gatunku. Wyróżniamy:

Bardziej szczegółowo

Rozkład materiału z biologii do klasy III.

Rozkład materiału z biologii do klasy III. Rozkład materiału z biologii do klasy III. L.p. Temat lekcji Treści programowe Uwagi 1. Nauka o funkcjonowaniu przyrody. 2. Genetyka nauka o dziedziczności i zmienności. -poziomy różnorodności biologicznej:

Bardziej szczegółowo

SCENARIUSZ LEKCJI. TEMAT LEKCJI: Podstawowe techniki inżynierii genetycznej. Streszczenie


Bardziej szczegółowo



Bardziej szczegółowo

Spis treści Część I. Genetyczne podstawy hodowli roślin 1. Molekularne podstawy dziedziczenia cech Dariusz Crzebelus, Adeta Adamus, Maria Klein

Spis treści Część I. Genetyczne podstawy hodowli roślin 1. Molekularne podstawy dziedziczenia cech Dariusz Crzebelus, Adeta Adamus, Maria Klein Spis treści Część I. Genetyczne podstawy hodowli roślin 1. Molekularne podstawy dziedziczenia cech... 15 Dariusz Crzebelus, Adeta Adamus, Maria Klein 1.1. Budowa DNA i przepływ informacji genetycznej...

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten proces. Na schemacie przedstawiono etapy przekazywania

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka Inżynieria genetyczna- 6 ECTS Część I Badanie ekspresji genów Podstawy klonowania i różnicowania transformantów Kolokwium (14pkt) Część II Klonowanie ekspresyjne Od genu do białka Kolokwium (26pkt) EGZAMIN

Bardziej szczegółowo

Podstawy genetyki. ESPZiWP 2010

Podstawy genetyki. ESPZiWP 2010 Podstawy genetyki ESPZiWP 2010 Genetyka - nauka o dziedziczności i zmienności organizmów, wyjaśniająca prawa rządzące podobieństwami i różnicami pomiędzy osobnikami spokrewnionymi przez wspólnego przodka

Bardziej szczegółowo

Wykorzystując go wykonał doświadczenie, a następnie na podstawie obserwacji spod mikroskopu sporządził rysunek:

Wykorzystując go wykonał doświadczenie, a następnie na podstawie obserwacji spod mikroskopu sporządził rysunek: Budowa komórkowa Zadanie 1 (1 pkt) Uzasadnij, za pomocą jednego argumentu, że: lizosomy są grabarzami obumarłych składników cytoplazmy lub całych komórek. Zadanie 2 (2 pkt.) W komórkach roślinnych i zwierzęcych

Bardziej szczegółowo


KONKURS BIOLOGICZNY GIMNAZJUM ETAP I JEDNOŚĆ I RÓŻNORODNOŚĆ ORGANIZMÓW. WIADOMOŚCI: KONKURS BIOLOGICZNY GIMNAZJUM ETAP I JEDNOŚĆ I RÓŻNORODNOŚĆ ORGANIZMÓW. WIADOMOŚCI: 1. Szczeble organizacji materii żywej (komórki, tkanki roślinne i zwierzęce, narządy i układy narządów). 2. Budowa chemiczna

Bardziej szczegółowo

dr hab. Beata Krawczyk Katedra Mikrobiologii PG

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Metody amplifikacji kwasów nukleinowych dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej pj j w ramach Europejskiego Funduszu Społecznego Amplifikacja

Bardziej szczegółowo

... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna.

... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna. Zadanie 1. (2 pkt.) W tabeli przedstawiono kodony kodu genetycznego. Poniżej przedstawiono dwie sekwencje nukleotydów w mrna. Ustal czy koduja takie same czy inne odcinki polipeptydów. Uzasadnij jednym

Bardziej szczegółowo


GIMNAZJUM SPRAWDZIANY SUKCES W NAUCE GIMNAZJUM SPRAWDZIANY BIOLOGIA klasa III SUKCES W NAUCE II GENETYKA CZŁOWIEKA Zadanie 1. Cechy organizmu są warunkowane przez allele dominujące i recesywne. Uzupełnij tabelę, wykorzystując poniższe określenia,

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo


POZIOMY WYMAGAŃ EDUKACYJNYCH Z BIOLOGII DLA UCZNIÓW Z UPOŚLEDZENIEM W STOPNIU LEKKIM DLA UCZNIÓW Z UPOŚLEDZENIEM W STOPNIU LEKKIM DZIAŁ I, II i III: RÓŻNORODNOŚĆ ŻYCIA Uczeń umie wymienić niektóre czynności żywego organizmu. Uczeń wie, co to jest komórka. Uczeń umie wymienić niektóre czynności

Bardziej szczegółowo

Kwasy nukleinowe i białka

Kwasy nukleinowe i białka Metody bioinformatyki Kwasy nukleinowe i białka prof. dr hab. Jan Mulawka Kwasy nukleinowe DNA Kwas dezoksyrybonukleinowy jest to należący do kwasów nukleinowych wielkocząsteczkowy organiczny związek chemiczny,

Bardziej szczegółowo

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej Wprowadzenie do Informatyki Biomedycznej Wykład 1: Podstawy bioinformatyki Wydział Informatyki PB Podstawy biologiczne - komórki Wszystkie organizmy zbudowane są z komórek komórka jest skomplikowanym systemem

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Analiza zmienności czasowej danych mikromacierzowych

Analiza zmienności czasowej danych mikromacierzowych Systemy Inteligencji Obliczeniowej Analiza zmienności czasowej danych mikromacierzowych Kornel Chromiński Instytut Informatyki Uniwersytet Śląski Plan prezentacji Dane mikromacierzowe Cel badań Prezentacja

Bardziej szczegółowo

Wymagania edukacyjne z biologii dla klasy III gimnazjum. Wymagania podstawowe uczeń poprawnie:

Wymagania edukacyjne z biologii dla klasy III gimnazjum. Wymagania podstawowe uczeń poprawnie: Wymagania edukacyjne z biologii dla klasy III gimnazjum Dział Czym jest genetyka? genetyka jako nauka o dziedziczeniu cech oraz zmienności organizmów cechy dziedziczne i niedziedziczne cechy gatunkowe

Bardziej szczegółowo

Zapis w nowej podstawie programowej. Proponowane procedury osiągania celów. Proponowane środki dydaktyczne. Dział programu.

Zapis w nowej podstawie programowej. Proponowane procedury osiągania celów. Proponowane środki dydaktyczne. Dział programu. Rozkład materiału Dział programu I. Od genu do cechy Treści nauczania 1. Budowa i funkcje kwasów nukleinowych DNA jako materiał genetyczny budowa DNA rodzaje zasad azotowych komplementarność zasad azotowych

Bardziej szczegółowo

4. DNA podporządkowany człowiekowi manipulacje DNA

4. DNA podporządkowany człowiekowi manipulacje DNA . DN podporządkowany człowiekowi manipulacje DN Poznanie mechanizmów replikacji, transkrypcji i translacji oraz rozwój biochemii, genetyki i informatyki doprowadziły do wynalezienia metod pozwalających

Bardziej szczegółowo

Kod przedmiotu: PLPILAIOZKOS-L-2p1-2014S Pozycja planu: A1

Kod przedmiotu: PLPILAIOZKOS-L-2p1-2014S Pozycja planu: A1 Kod przedmiotu: PLPILAIOZKOS-L-2p1-2014S Pozycja planu: A1 1. INFORMACJE O PRZEDMIOCIE A. Podstawowe dane 1 Nazwa przedmiotu Biologia i genetyka 2 Kierunek studiów Kosmetologia 3 Poziom studiów I stopnia

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Wynikowy plan nauczania z biologii dla klasy III gimnazjum oparty na podręczniku Puls życia 3. Wymagania podstawowe uczeń poprawnie:

Wynikowy plan nauczania z biologii dla klasy III gimnazjum oparty na podręczniku Puls życia 3. Wymagania podstawowe uczeń poprawnie: I. Genetyka Wynikowy plan nauczania z biologii dla klasy III gimnazjum oparty na podręczniku Puls życia 3 Materiał nauczania L.g. Czym jest genetyka? genetyka jako nauka o dziedziczeniu cech oraz zmienności

Bardziej szczegółowo


SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU JAKĄ BUDOWĘ MA DNA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1.

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

Badamy DNA. Agata Rogowska, Jakub Urbański. Opracowanie merytoryczne treści zestawu:

Badamy DNA. Agata Rogowska, Jakub Urbański. Opracowanie merytoryczne treści zestawu: Badamy DNA Agata Rogowska, Jakub Urbański Opracowanie merytoryczne treści zestawu: Agata Rogowska, Jakub Urbański Ilustracje: Dean Madden Korekta: Joanna Lilpop Zestaw opracowany w ramach projektu Science

Bardziej szczegółowo

TERAPIA GENOWA. dr Marta Żebrowska

TERAPIA GENOWA. dr Marta Żebrowska TERAPIA GENOWA dr Marta Żebrowska Pracownia Diagnostyki Molekularnej i Farmakogenomiki, Zakładu Biochemii Farmaceutycznej, Uniwersytetu Medycznego w Łodzi Źródło zdjęcia: httpblog.ebdna.plindex.phpjednoznajwiekszychzagrozenludzkosciwciazniepokonane

Bardziej szczegółowo

Podstawy genetyki. Genetyka to dział biologii, analizujący problemy związane z dziedziczeniem cech i zmiennością organizmów.

Podstawy genetyki. Genetyka to dział biologii, analizujący problemy związane z dziedziczeniem cech i zmiennością organizmów. R o z d z i a ł 1 Podstawy genetyki Genetyka w medycynie W ostatnich dziesięcioleciach dokonał się znaczny postęp w zrozumieniu, jaką rolę odgrywają czynniki dziedziczne w procesach patologii człowieka.

Bardziej szczegółowo

1. DNA - podstawowy nośnik informacji genetycznej

1. DNA - podstawowy nośnik informacji genetycznej Elementy genetyki 1. DNA - podstawowy nośnik informacji genetycznej 1.1. Informacja o budowie i funkcjonowaniu organizmu zapisana w DNA początki genetyki jako nauki doświadczenia na bakteriach wywołujących

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Choroby genetyczne o złożonym

Bardziej szczegółowo

podstawowy. Jest on niezastąpiony przy obiektywnej ocenie postępów ucznia w nauce.

podstawowy. Jest on niezastąpiony przy obiektywnej ocenie postępów ucznia w nauce. Wymagania edukacyjne zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń powinien opanować po omówieniu poszczególnych lekcji z podręcznika Biologia na czasie zakres podstawowy. Jest on

Bardziej szczegółowo

Dr hab. Beata Krawczyk Katedra Mikrobiologii, Politechnika Gdańska

Dr hab. Beata Krawczyk Katedra Mikrobiologii, Politechnika Gdańska Narzędzia diagnostyki molekularnej w typowaniu genetycznym (genotypowaniu) Dr hab. Beata Krawczyk Katedra Mikrobiologii, Politechnika Gdańska Publikacja współfinansowana ze środków Unii Europejskiej w

Bardziej szczegółowo

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją).

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Czym jest życie? metabolizm + informacja (replikacja) 2 Cząsteczki organiczne mog y powstać w atmosferze pierwotnej

Bardziej szczegółowo

Zagrożenia i ochrona przyrody

Zagrożenia i ochrona przyrody Wymagania podstawowe Uczeń: Wymagania ponadpodstawowe Uczeń: Zagrożenia i ochrona przyrody wskazuje zagrożenia atmosfery powstałe w wyniku działalności człowieka, omawia wpływ zanieczyszczeń atmosfery

Bardziej szczegółowo

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz.

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. 1 ROZDZIAŁ 1. KOMÓRKI WPROWADZENIE 1 Jedność i różnorodność komórek 1

Bardziej szczegółowo

Substancje o Znaczeniu Biologicznym

Substancje o Znaczeniu Biologicznym Substancje o Znaczeniu Biologicznym Tłuszcze Jadalne są to tłuszcze, które może spożywać człowiek. Stanowią ważny, wysokoenergetyczny składnik diety. Z chemicznego punktu widzenia głównym składnikiem tłuszczów

Bardziej szczegółowo

PODSTAWY GENETYKI ... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna.

PODSTAWY GENETYKI ... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna. Zadanie 1. (2 pkt.) W tabeli przedstawiono kodony kodu genetycznego. Poniżej przedstawiono dwie sekwencje nukleotydów w mrna. Ustal czy koduja takie same czy inne odcinki polipeptydów. Uzasadnij jednym

Bardziej szczegółowo