Mikrosatelitarne sekwencje DNA

Wielkość: px
Rozpocząć pokaz od strony:

Download "Mikrosatelitarne sekwencje DNA"

Transkrypt

1 Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym Leśny Bank Genów Kostrzyca

2 Spis treści I. DNA II. Ogólne zasady genetyki molekularnej III.Reakcja PCR IV.Markery genetyczne V.Mikrosatelity 2

3 DNA DNA kwas deoksyrybonukleinowy (dawn. kwas dezoksyrybonukleinowy), w skrócie DNA (od ang. deoxyribonucleic acid) wielkocząsteczkowy organiczny związek zek chemiczny należący do kwasów nukleinowych może być zlokalizowany w jądrze komórkowym i w cytoplazmie, u wirusów w kapsydach pełni rolę nośnika nika informacji genetycznej organizmów żywych autorami modelu podwójnej helisy DNA są James Watson i Francis Crick, na podstawie zdjęć krystalografii rentgenowskiej wykonanych przez Rosalind Franklin i Maurice a Wilkinsa (1953 r.) 3

4 DNA DNA W komórkach DNA znajduje się w: jądrze komórkowym (ndna- jądrowy DNA) chloroplastach (cpdna- chloroplastowy DNA) mitochondriach (mtdna- mitochondrialny DNA) 4

5 DNA DNA- nieskomplikowana budowa chemiczna przeważnie cząsteczka jest dwuniciowa, nici są skręcone spiralnie wokół siebie koniec (5 ) jednej nici leży naprzeciwko początku (3 ) drugiej nici (usytuowanie naprzeciwległe) podstawową jednostką budulcową jest nukleotyd: cukier (deoksyryboza lub ryboza) + zasada azotowa + reszta kwasu fosforowego nukleotyd 5

6 DNA DNA- nieskomplikowana budowa chemiczna Zasady azotowe dwóch przeciwległych nici łączą się ze sobą komplementarnie (łac. complementum dopełnienie), tj. zawsze adenina łączy się z tyminą a cytozyna z guaniną 6

7 Ogólne zasady genetyki molekularnej Przepływ informacji genetycznej w komórce odbywa się jednokierunkowo: DNA RNA BIAŁKA Wszystkie komórki organizmu zawierają identyczną, pełną informację genetyczną Zależnie od rodzaju komórki, fazy cyklu życiowego, jej stanu i warunków zewnętrznych- ekspresji ulegają inne fragmenty zapisu genetycznego Jednostki informacji genetycznej (m.in.): Nukleotyd- cukier (deoksyryboza lub ryboza) + zasada azotowa + reszta kwasu fosforowego Gen- odcinek DNA odpowiedzialny za powstanie jednej cząsteczki białka, trna lub rrna Chromosom- nić DNA połączona z białkami, która jako całość wędruje z komórki macierzystej do komórki potomnej Genom- całość informacji genetycznej zawartej w komórce lub w określonym organellum np. genom chloroplastowy, genom mitochondrialny 7

8 Ogólne zasady genetyki molekularnej Każda cecha fenotypowa (np. kolor włosów) jest warunkowana przez zapis genetyczny w genach Locus (l. mnoga loci)- określony obszar chromosomu zajmowany przez gen. W obrębie chromosomu znajduje się wiele różnych loci. W locus mogą znajdować się różne warianty danego genu (różniące się sekwencją nukleotydów w DNA) zwane allelami Organizm haploidalny ma zestaw pojedynczych chromosomów (N) Organizm diploidalny ma zestaw chromosomów połączonych parami (2N) 8

9 Reakcja PCR PCR- Reakcja łańcuchowa polimerazy (ang. Polymerase Chain Reaction) metoda powielania łańcuchów DNA w warunkach laboratoryjnych (w termocyklerze). Składniki do przeprowadzenia PCR: 1) wyizolowany, o odpowiedniej czystości DNA (z tkanek roślinnych, z krwi, z włosów itp.) 2) środowisko reakcji (bufor, jony magnezowe oraz odpowiedniej czystości woda) 3) primery (in. startery- czyli kilku do kilkunastu nukleotydowe sekwencje flankujące znany lub nieznany odcinek DNA) 4) dntp (wolne nukleotydy) 5) termostabilna (nie ulegająca degradacji w wysokich temperaturach) polimeraza DNA 9

10 Reakcja PCR PCR- Reakcja łańcuchowa polimerazy (ang. Polymerase Chain Reaction) metoda powielania łańcuchów DNA w warunkach laboratoryjnych. Technika została wynaleziona w 1983 r. przez Karye go Mullisa z kalifornijskiej firmy Cetus, za co Mullis otrzymał w roku 1993 Nagrodę Nobla PCR znajduje wiele zastosowań, m.in.: w badaniach nad genomem charakterystyce ekspresji genów w klonowaniu genów diagnostyce klinicznej identyfikacji osób zaginionych kryminalistyce paleontologii 10

11 11 Reakcja PCR

12 Markery genetyczne Markery genetyczne to cechy jakościowe organizmów podlegające prostym zasadom dziedziczenia zgodnie z prawami Mendla. Można je podzielić na 3 główne klasy: I. Markery morfologiczne (brak chlorofilu, specyficzny kształt łusek szyszkowych czy blaszki liściowej), II. Markery biochemiczne (izoenzymy, terpeny, antygeny), III. Markery DNA (oparte na zmienności sekwencji nukleotydów). Markery genetyczne służą m.in.: badaniu zmienności genetycznej populacji umożliwiają identyfikację osobniczą, w tym analizę rodzicielstwa umożliwiają badanie śladów biologicznych w miejscu przestępstwa i porównanie ich z genotypami osób podejrzanych o jego popełnienie są szeroko wykorzystywane w badaniach populacyjnych drzew leśnych. 12

13 Mikrosatelity Specyficznym rodzajem markerów DNA są sekwencje mikrosatelitarne czyli mikrosatelity- SSR (ang. Simple Sequence Repeats) Występują jako tandemowe powtórzenia krótkich jednostek (sekwencji) o długości od 1 do 6 nukleotydów. O polimorfizmie (różnorodności) mikrosatelitów stanowi zmienność liczby powtórzeń krótkich sekwencji, która w zależności od locus może wahać się od kilku do ponad trzydziestu. Polimorfizm mikrosatelitów bada się poprzez analizę długości fragmentów DNA zawierających mikrosatelity, wykorzystując mechanizm reakcji PCR, a różne allele identyfikuje się jako fragmenty DNA o różnej długości mierzone liczbą nukleotydów. 13

14 Mikrosatelity- SSR Mikrosatelity SSR (ang. Simple Sequence Repeats) należą do grupy powtarzających się sekwencji DNA. Występują jako tandemowe powtórzenia krótkich jednostek (sekwencji) o długości od 1 do 6 nukleotydów np. : O polimorfizmie (różnorodności) mikrosatelitów stanowi zmienność liczby powtórze rzeń krótkich sekwencji, która w zależności od locus może wahać się od kilku do ponad trzydziestu: 14

15 Mikrosatelity Typowy locus mikrosatelitarny składa się zatem z obszaru DNA, w ramach którego występują sekwencje powtarzające się, oraz z konserwatywnych fragmentów końcowych, które są podstawą do wyznaczenia (opracowania) starterów oligonukleotydów o długości ok. 20 nukleotydów wykorzystywanych w reakcji PCR. 5 3 CTACCCGAACACACACACACATTTCGACATTA GATGGGCTTGTGTGTGTGTGTAAAGCTGTAAT 3 5 fragment końcowy, flankujący mikrosatelita fragment końcowy, flankujący 15

16 Mikrosatelity Zalety i wady mikrosatelitów Zalety wykazują wysoki polimorfizm kodominacyjny system dziedziczenia genotyp można analizować na podstawie każdej tkanki, z której można wyizolować DNA analizy laboratoryjne są wysoce powtarzalne, a sam proces można w dużym stopniu zautomatyzować Wady stosunkowo wysokie koszty wyposażenia laboratoryjnego umiarkowanie wysokie koszty analiz laboratoryjnych podawana przez niektórych autorów podatność tych markerów na zmienność mutacyjną oraz błędy określania genotypów wynikające m.in. z występowania alleli null 16

17 Dziękuj kuję za uwagę autorki prezentacji: E. Kaczmarek, A. Pasławska Zdjęcia w prezentacji: Internet A.Pasławska M.Pałucka Wykorzystano m.in. Markery mikrosatelitarne DNA i ich wykorzystanie w badaniach z zakresu genetyki drzew leśnych, J.Burczyk 17

MARKERY MIKROSATELITARNE

MARKERY MIKROSATELITARNE MARKERY MIKROSATELITARNE Badania laboratoryjne prowadzone w Katedrze Genetyki i Ogólnej Hodowli Zwierząt SGGW w ramach monitoringu genetycznego wykorzystują analizę genetyczną markerów mikrosatelitarnych.

Bardziej szczegółowo

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier.

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier. ID Testu: F5679R8 Imię i nazwisko ucznia Klasa Data 1. Na indywidualne cechy danego osobnika ma (maja) wpływ A. wyłacznie czynniki środowiskowe. B. czynniki środowiskowe i materiał genetyczny. C. wyłacznie

Bardziej szczegółowo

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A...

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A... 1. Zadanie (0 2 p. ) Porównaj mitozę i mejozę, wpisując do tabeli podane określenia oraz cyfry. ta sama co w komórce macierzystej, o połowę mniejsza niż w komórce macierzystej, gamety, komórki budujące

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo

Wprowadzenie do biologii molekularnej.

Wprowadzenie do biologii molekularnej. Wprowadzenie do biologii molekularnej. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Biologia molekularna zajmuje się badaniem biologicznych

Bardziej szczegółowo

Johann Friedrich Miescher

Johann Friedrich Miescher Certyfikacja DNA u psów FANCLUBU Fakt, iż każdy żywy organizm zwierzę, roślina, człowiek jest jednostką unikalną, niepowtarzalną, jedyną w swoim rodzaju - był od dawna prawie pewnikiem. Jednakże pełne

Bardziej szczegółowo

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :.

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :. CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A imię i nazwisko :. klasa :.. ilość punktów :. Zadanie 1 Przeanalizuj schemat i wykonaj polecenia. a. Wymień cztery struktury występujące zarówno w komórce roślinnej,

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej

7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7. Metody molekularne jako źródło informacji botanicznej i lichenologicznej 7.2. Metody biologii molekularnej (technika PCR, sekwencjonowanie DNA) wykorzystywane w taksonomii roślin Autor: Magdalena Dudek

Bardziej szczegółowo

Budowa i rola DNA. 1. Cele lekcji. a) Wiadomości. b) Umiejętności. 2. Metoda i forma pracy. 3. Środki dydaktyczne. Metadane scenariusza

Budowa i rola DNA. 1. Cele lekcji. a) Wiadomości. b) Umiejętności. 2. Metoda i forma pracy. 3. Środki dydaktyczne. Metadane scenariusza Metadane scenariusza Budowa i rola DNA 1. Cele lekcji a) Wiadomości Uczeń: zna nazwy związków chemicznych budujących cząsteczkę DNA i wie, jak są ze sobą powiązane, wie, jak wygląda model przestrzenny

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

Czy żywność GMO jest bezpieczna?

Czy żywność GMO jest bezpieczna? Instytut Żywności i Żywienia dr n. med. Lucjan Szponar Czy żywność GMO jest bezpieczna? Warszawa, 21 marca 2005 r. Od ponad połowy ubiegłego wieku, jedną z rozpoznanych tajemnic życia biologicznego wszystkich

Bardziej szczegółowo

BUDOWA I FUNKCJA GENOMU LUDZKIEGO

BUDOWA I FUNKCJA GENOMU LUDZKIEGO BUDOWA I FUNKCJA GENOMU LUDZKIEGO Magdalena Mayer Katedra i Zakład Genetyki Medycznej UM w Poznaniu 1. Projekt poznania genomu człowieka: Cele programu: - skonstruowanie szczegółowych map fizycznych i

Bardziej szczegółowo

Monitoring genetyczny populacji wilka (Canis lupus) jako nowy element monitoringu stanu populacji dużych drapieżników

Monitoring genetyczny populacji wilka (Canis lupus) jako nowy element monitoringu stanu populacji dużych drapieżników Monitoring genetyczny populacji wilka (Canis lupus) jako nowy element monitoringu stanu populacji dużych drapieżników Wojciech Śmietana Co to jest monitoring genetyczny? Monitoring genetyczny to regularnie

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

GENETYKA. Genetyka. Dziedziczność przekazywanie cech rodziców potomstwu Zmienność występowanie różnic pomiędzy różnymi osobnikami tego samego gatunku

GENETYKA. Genetyka. Dziedziczność przekazywanie cech rodziców potomstwu Zmienność występowanie różnic pomiędzy różnymi osobnikami tego samego gatunku GENETYKA Genetyka Nauka o dziedziczności i zmienności organizmów, wyjaśniająca prawa rządzące podobieństwami i różnicami pomiędzy osobnikami spokrewnionymi przez wspólnego przodka Dziedziczność przekazywanie

Bardziej szczegółowo

Imię i nazwisko...kl...

Imię i nazwisko...kl... Gimnazjum nr 4 im. Ojca Świętego Jana Pawła II we Wrocławiu SPRAWDZIAN GENETYKA GR. A Imię i nazwisko...kl.... 1. Nauka o regułach i mechanizmach dziedziczenia to: (0-1pkt) a) cytologia b) biochemia c)

Bardziej szczegółowo

Markery klasy II -Polimorfizm fragmentów DNA (na ogół niekodujących): - RFLP - VNTR - RAPD

Markery klasy II -Polimorfizm fragmentów DNA (na ogół niekodujących): - RFLP - VNTR - RAPD Marker genetyczny- polimorficzna cecha jakościowa organizmu, którą charakteryzuje proste dziedziczenie (mendlowskie) oraz którą można dokładnie identyfikować metodami analitycznymi. Markery klasy I - Antygeny

Bardziej szczegółowo

Transformacja pośrednia składa się z trzech etapów:

Transformacja pośrednia składa się z trzech etapów: Transformacja pośrednia składa się z trzech etapów: 1. Otrzymanie pożądanego odcinka DNA z materiału genetycznego dawcy 2. Wprowadzenie obcego DNA do wektora 3. Wprowadzenie wektora, niosącego w sobie

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów Wprowadzenie do genetyki sądowej 2013 Pracownia Genetyki Sądowej Katedra i Zakład Medycyny Sądowej Materiały biologiczne Inne: włosy z cebulkami, paznokcie możliwa degradacja - tkanki utrwalone w formalinie/parafinie,

Bardziej szczegółowo

Dr hab.n.med. Renata Jacewicz

Dr hab.n.med. Renata Jacewicz GENOM CZŁOWIEKA >99 % 0,05%(100MtDNA) 65% Dr hab.n.med. Renata Jacewicz Kierownik Pracowni Genetyki Medycznej i Sądowej 3% 32% 2013 Pracownia Genetyki Medycznej i Sądowej ZMS Dojrzałe erytrocyty, trzony

Bardziej szczegółowo

DNA musi współdziałać z białkami!

DNA musi współdziałać z białkami! DNA musi współdziałać z białkami! Specyficzność oddziaływań między DNA a białkami wiążącymi DNA zależy od: zmian konformacyjnych wzdłuż cząsteczki DNA zróżnicowania struktury DNA wynikającego z sekwencji

Bardziej szczegółowo

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

Numer pytania Numer pytania

Numer pytania Numer pytania KONKURS BIOLOGICZNY ZMAGANIA Z GENETYKĄ 2016/2017 ELIMINACJE SZKOLNE I SESJA GENETYKA MOLEKULARNA KOD UCZNIA. IMIĘ i NAZWISKO. DATA... GODZINA.. Test, który otrzymałeś zawiera 20 pytań zamkniętych. W każdym

Bardziej szczegółowo

Dr hab.n.med. Renata Jacewicz

Dr hab.n.med. Renata Jacewicz GENOM CZŁOWIEKA >99,999% 0,0005% 65% Dr hab.n.med. Renata Jacewicz Kierownik Pracowni Genetyki Medycznej i Sądowej 3% 32% 2013 Pracownia Genetyki Medycznej i Sądowej ZMS Dojrzałe erytrocyty, trzony włosów

Bardziej szczegółowo

I. Genetyka. Dział programu Lp. Temat konieczny podstawowy rozszerzający

I. Genetyka. Dział programu Lp. Temat konieczny podstawowy rozszerzający I. Genetyka 1. Czym jest genetyka? wymienia cechy gatunkowe i indywidualne podanych organizmów wyjaśnia, że jego podobieństwo do rodziców jest wynikiem dziedziczenia cech definiuje pojęcia genetyka oraz

Bardziej szczegółowo

Wprowadzenie do genetyki sądowej

Wprowadzenie do genetyki sądowej DNA - kwas deoksyrybonukleinowy Wprowadzenie do genetyki sądowej część 2 odwójna helisa ok. 3,2 miliardy par zasad (base pairs) A=T, G=C ok. 20 000-30 000 genów onad 99% identyczności w populacji; 1% różnic

Bardziej szczegółowo

Profaza I wykształcenie się wrzeciona podziałowego, kondensacja chromatyny do chromosomów jest długa i składa się z 5 stadiów:

Profaza I wykształcenie się wrzeciona podziałowego, kondensacja chromatyny do chromosomów jest długa i składa się z 5 stadiów: Cykl komórkowy Podział komórki - proces zachodzący u wszystkich żywych organizmów, w którym komórka macierzysta dzieli się na dwie lub więcej komórek potomnych. Najpierw następuje podział jądra komórkowego

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

Zaoczne Liceum Ogólnokształcące Pegaz

Zaoczne Liceum Ogólnokształcące Pegaz WYMAGANIA EGZAMINACYJNE ROK SZKOLNY 2015/2016 Semestr jesienny TYP SZKOŁY: liceum ogólnokształcące PRZEDMIOT: biologia SEMESTR: II LICZBA GODZIN W SEMESTRZE: 15 PROGRAM NAUCZANIA: Program nauczania biologii

Bardziej szczegółowo

Kwasy Nukleinowe. Rys. 1 Struktura typowego dinukleotydu

Kwasy Nukleinowe. Rys. 1 Struktura typowego dinukleotydu Kwasy Nukleinowe Kwasy nukleinowe są biopolimerami występującymi w komórkach wszystkich organizmów. Wyróżnia się dwa główne typy kwasów nukleinowych: Kwas deoksyrybonukleinowy (DNA) Kwasy rybonukleinowe

Bardziej szczegółowo

Mitochondrialna Ewa;

Mitochondrialna Ewa; Mitochondrialna Ewa; jej sprzymierzeńcy i wrogowie Lien Dybczyńska Zakład genetyki, Uniwersytet Warszawski 01.05.2004 Milion lat temu Ale co dalej??? I wtedy wkracza biologia molekularna Analiza różnic

Bardziej szczegółowo

Sylabus Biologia molekularna

Sylabus Biologia molekularna Sylabus Biologia molekularna 1. Metryczka Nazwa Wydziału Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej Program kształcenia Farmacja, jednolite studia magisterskie, forma studiów: stacjonarne

Bardziej szczegółowo

PCR. Aleksandra Sałagacka

PCR. Aleksandra Sałagacka PCR Aleksandra Sałagacka Reakcja PCR naśladuje proces replikacji DNA in vitro pozwala na amplifikację określonego krótkiego (kilkadziesiąt kilka tys.pz) fragmentu DNA obecnie najważniejsze narzędzie biologii

Bardziej szczegółowo

Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan

Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan Klasyczna metoda PCR jest metodą jakościową, nie ilościową co np.

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

Maria Szczepaniec Badania genetyczne DNA na użytek procesu karnego. Zeszyty Prawnicze 13/1, 171-184

Maria Szczepaniec Badania genetyczne DNA na użytek procesu karnego. Zeszyty Prawnicze 13/1, 171-184 Maria Szczepaniec Badania genetyczne DNA na użytek procesu karnego Zeszyty Prawnicze 13/1, 171-184 2013 Zeszyty Prawnicze 13.1 / 2013 Maria Szczepaniec Uniwersytet Kardynała Stefana Wyszyńskiego BADANIA

Bardziej szczegółowo

Temat: Komórka jako podstawowa jednostka strukturalna i funkcjonalna organizmu utrwalenie wiadomości.

Temat: Komórka jako podstawowa jednostka strukturalna i funkcjonalna organizmu utrwalenie wiadomości. SCENARIUSZ LEKCJI BIOLOGII DLA KLASY I GIMNAZJUM Temat: Komórka jako podstawowa jednostka strukturalna i funkcjonalna organizmu utrwalenie wiadomości. Cele: Utrwalenie pojęć związanych z budową komórki;

Bardziej szczegółowo

Rozkład materiału z biologii dla klasy III AD. 7 godz / tyg rok szkolny 2016/17

Rozkład materiału z biologii dla klasy III AD. 7 godz / tyg rok szkolny 2016/17 Rozkład materiału z biologii dla klasy III AD zakres rozszerzony LO 7 godz / tyg rok szkolny 2016/17 Biologia na czasie 2 zakres rozszerzony nr dopuszczenia 564/2/2012 Biologia na czasie 3 zakres rozszerzony

Bardziej szczegółowo

Biologia molekularna

Biologia molekularna Biologia molekularna 1. Metryczka Nazwa Wydziału Program kształcenia Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej Analityka Medyczna, studia jednolite magisterskie, studia stacjonarne i niestacjonarne

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych

Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych Dr n. med. Joanna Walczak- Sztulpa Katedra i Zakład Genetyki Medycznej Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Diagnostyka

Bardziej szczegółowo

Genetyka w nowej podstawie programowej

Genetyka w nowej podstawie programowej Genetyka w nowej podstawie programowej Dział Genetyka - III etap edukacyjny Rzetelna realizacja tego działu w gimnazjum jest kluczowa ze względu na to, że biotechnologia i inżynieria genetyczna jest omawiana

Bardziej szczegółowo

Nowoczesne systemy ekspresji genów

Nowoczesne systemy ekspresji genów Nowoczesne systemy ekspresji genów Ekspresja genów w organizmach żywych GEN - pojęcia podstawowe promotor sekwencja kodująca RNA terminator gen Gen - odcinek DNA zawierający zakodowaną informację wystarczającą

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

IZOLACJA KWASÓW NUKLEINOWYCH WARUNKI ZALICZENIA PRZEDMIOTU- 7 ECTS PRZEDMIOT PROGOWY!!!

IZOLACJA KWASÓW NUKLEINOWYCH WARUNKI ZALICZENIA PRZEDMIOTU- 7 ECTS PRZEDMIOT PROGOWY!!! WARUNKI ZALICZENIA PRZEDMIOTU- 7 ECTS PRZEDMIOT PROGOWY!!! W1-4p W2-4p W3-4p W4-4p W5-4p W6-4p W7-4p W8-4p W9-4p W10-4p min 21p wyjściówka I 40p wyjściówka II 40p egzamin I egzamin II min 21p 60p 60p min

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

Struktura DNA i chromatyny. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Struktura DNA i chromatyny. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Struktura DA i chromatyny. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. W trakcie podziału komórkowego (mitozy) chromosomy są wiernie

Bardziej szczegółowo

Wprowadzenie do genetyki medycznej i sądowej

Wprowadzenie do genetyki medycznej i sądowej Genetyka medyczno-sądowa Wprowadzenie do genetyki medycznej i sądowej Kierownik Pracowni Genetyki Medycznej i Sądowej Ustalanie tożsamości zwłok Identyfikacja sprawców przestępstw Identyfikacja śladów

Bardziej szczegółowo

GENOM I JEGO STRUKTURA

GENOM I JEGO STRUKTURA GENOM I JEGO STRUKTURA GENOM Ogół materiału genetycznego (kwasu nukleinowego niosącego informację genetyczną) zawartego w pojedynczej części składowej (komórce, cząstce wirusa) organizmu 1 Genom eukariotyczny

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Chromosomy - przypomnienie

Bardziej szczegółowo

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

Biotechnologia i inżynieria genetyczna

Biotechnologia i inżynieria genetyczna Wersja A Test podsumowujący rozdział II i inżynieria genetyczna..................................... Imię i nazwisko.............................. Data Klasa oniższy test składa się z 16 zadań. rzy każdym

Bardziej szczegółowo

Plan wykładów z genetyki ogólnej

Plan wykładów z genetyki ogólnej Plan wykładów z genetyki ogólnej 01 Metody genetyki klasycznej 02 Metody analizy DNA 03 Metody analizy genomu 04 Genomy prokariontów 05 Genomy eukariontów 06 Zmienność genomów w populacjach 07 Genomy a

Bardziej szczegółowo

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów:

Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: Powodzenie reakcji PCR wymaga właściwego doboru szeregu parametrów: dobór warunków samej reakcji PCR (temperatury, czas trwania cykli, ilości cykli itp.) dobór odpowiednich starterów do reakcji amplifikacji

Bardziej szczegółowo

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe Promotory genu Promotor bliski leży w odległości do 40 pz od miejsca startu transkrypcji, zawiera kasetę TATA. Kaseta TATA to silnie konserwowana sekwencja TATAAAA, występująca w większości promotorów

Bardziej szczegółowo

Przedmiotowe zasady oceniania:

Przedmiotowe zasady oceniania: Przedmiotowe zasady oceniania: Przedmiotowe Zasady Oceniania z biologii obowiązujący w roku szkolnym 2012/13 r. w VIII LO realizowany przez nauczycieli przedmiotu Justynę Baranowską, Mirosławę Drażniuk,

Bardziej szczegółowo

Genetyka Rasowych Świnek Morskich

Genetyka Rasowych Świnek Morskich Genetyka Rasowych Świnek Morskich nauka o dziedziczności i zmienności organizmów, które są oparte na informacji zawartej w podstawowych jednostkach dziedziczności genach. Opracowanie : Daniel Dawid Banasiak

Bardziej szczegółowo

Składniki jądrowego genomu człowieka

Składniki jądrowego genomu człowieka Składniki jądrowego genomu człowieka Genom człowieka 3 000 Mpz (3x10 9, 100 cm) Geny i sekwencje związane z genami (900 Mpz, 30% g. jądrowego) DNA pozagenowy (2100 Mpz, 70%) DNA kodujący (90 Mpz ~ ok.

Bardziej szczegółowo

GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ

GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ ZMIENNOŚĆ - występowanie dziedzicznych i niedziedzicznych różnic między osobnikami należącymi do tej samej

Bardziej szczegółowo

TRANSKRYPCJA - I etap ekspresji genów

TRANSKRYPCJA - I etap ekspresji genów Eksparesja genów TRANSKRYPCJA - I etap ekspresji genów Przepisywanie informacji genetycznej z makrocząsteczki DNA na mniejsze i bardziej funkcjonalne cząsteczki pre-mrna Polimeraza RNA ETAP I Inicjacja

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI Fot. W. Wołkow Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt POPULACJA Zbiór organizmów żywych, które łączy

Bardziej szczegółowo

Księgarnia PWN: Joanna R. Freeland - Ekologia molekularna

Księgarnia PWN: Joanna R. Freeland - Ekologia molekularna Księgarnia PWN: Joanna R. Freeland - Ekologia molekularna Spis treści Przedmowa................................. Podziękowania............................... XIII XIV 1 Metody genetyki molekularnej w badaniach

Bardziej szczegółowo

Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe

Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe Marcin Kruszewski Centrum Radiobiologii i Dozymetrii Biologicznej Instytut Chemii

Bardziej szczegółowo

KARTA KURSU. Kod Punktacja ECTS* 4

KARTA KURSU. Kod Punktacja ECTS* 4 Załącznik nr 4 do Zarządzenia Nr.. KARTA KURSU Nazwa Nazwa w j. ang. Cytologia i genetyka Cytology and Genetics Kod Punktacja ECTS* 4 Koordynator prof. dr hab. Zbigniew Miszalski Zespół dydaktyczny dr

Bardziej szczegółowo

Geny, a funkcjonowanie organizmu

Geny, a funkcjonowanie organizmu Geny, a funkcjonowanie organizmu Wprowadzenie do genów letalnych Geny kodują Białka Kwasy rybonukleinowe 1 Geny Występują zwykle w 2 kopiach Kopia pochodząca od matki Kopia pochodząca od ojca Ekspresji

Bardziej szczegółowo

Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych. do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym

Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych. do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym Konferencja szkoleniowa 27.09.2012 Leśny Bank Genów Kostrzyca

Bardziej szczegółowo

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Praca wykonana pod kierunkiem dr hab. Tomasza Grzybowskiego w Katedrze Medycyny Sądowej w Zakładzie Genetyki Molekularnej

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ===============================================================================================

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1 Przedmiot: Biochemia Nazwa testu: Biochemia wer. 1.0.5 Nr testu 14883078 Klasa: zaoczni_2007 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Do aminokwasów aromatycznych zalicza się A) G, P oraz S B) L,

Bardziej szczegółowo

Znaczenie genetyki. Opracował A. Podgórski

Znaczenie genetyki. Opracował A. Podgórski Znaczenie genetyki Opracował A. Podgórski InŜynieria genetyczna InŜynieria genetyczna ingerencja w materiał genetyczny organizmów, w celu zmiany ich właściwości dziedzicznych. Istota inŝynierii genetycznej

Bardziej szczegółowo

SYLABUS DOTYCZY CYKLU KSZTAŁCENIA

SYLABUS DOTYCZY CYKLU KSZTAŁCENIA SYLABUS DOTYCZY CYKLU KSZTAŁCENIA 2016-2022 1.1. PODSTAWOWE INFORMACJE O PRZEDMIOCIE/MODULE Nazwa przedmiotu/ modułu Biologia molekularna Kod przedmiotu/ modułu* Wydział (nazwa jednostki prowadzącej kierunek)

Bardziej szczegółowo

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) I. Od genu do cechy Budowa i funkcje kwasów

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA.

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU PCR sposób na DNA. SPIS TREŚCI: 1. Wprowadzenie. 2. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. 3. Karty pracy. 1. Karta

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo

ZARZĄDZANIE POPULACJAMI ZWIERZĄT

ZARZĄDZANIE POPULACJAMI ZWIERZĄT ZARZĄDZANIE POPULACJAMI ZWIERZĄT Ćwiczenia 1 mgr Magda Kaczmarek-Okrój magda_kaczmarek_okroj@sggw.pl 1 ZAGADNIENIA struktura genetyczna populacji obliczanie frekwencji genotypów obliczanie frekwencji alleli

Bardziej szczegółowo

PCR - ang. polymerase chain reaction

PCR - ang. polymerase chain reaction PCR - ang. polymerase chain reaction łańcuchowa (cykliczna) reakcja polimerazy Technika PCR umożliwia otrzymywanie dużej liczby kopii specyficznych fragmentów DNA (czyli amplifikację zwielokrotnienie fragmentu

Bardziej szczegółowo

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki

Klub Młodego Wynalazcy - Laboratoria i wyposażenie. Pracownia genetyki Klub Młodego Wynalazcy - Laboratoria i wyposażenie Zadbaliśmy o to, żeby wyposażenie w Klubie Młodego Wynalazcy było w pełni profesjonalne. Ważne jest, aby dzieci i młodzież, wykonując doświadczenia korzystały

Bardziej szczegółowo

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań dopuszczający

Bardziej szczegółowo

PRZEDMIOTOWY SYSTEM OCENIANIA BIOLOGIA POZIOM ROZSZERZONY Opracowany w oparciu o program DKOS /02 KLASA III

PRZEDMIOTOWY SYSTEM OCENIANIA BIOLOGIA POZIOM ROZSZERZONY Opracowany w oparciu o program DKOS /02 KLASA III PRZEDMIOTOWY SYSTEM OCENIANIA BIOLOGIA POZIOM ROZSZERZONY Opracowany w oparciu o program DKOS 4015 5/02 ZAKRES WYMAGAŃ NA POSZCZEGÓLNE STOPNIE KLASA III DZIAŁ PROGRAMOWY I. Informacja genetyczna II. Przekazywanie

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecnośd Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

Techniki biologii molekularnej Kod przedmiotu

Techniki biologii molekularnej Kod przedmiotu Techniki biologii molekularnej - opis przedmiotu Informacje ogólne Nazwa przedmiotu Techniki biologii molekularnej Kod przedmiotu 13.9-WB-BMD-TBM-W-S14_pNadGenI2Q8V Wydział Kierunek Wydział Nauk Biologicznych

Bardziej szczegółowo

Zmienność genomu. Przyczyny, skutki i sposoby kontroli

Zmienność genomu. Przyczyny, skutki i sposoby kontroli Zmienność genomu Przyczyny, skutki i sposoby kontroli Zmienność genomu Przez zmienność genomu (polimorfizm) rozumiemy różnice w sekwencji DNA genomowego pomiędzy osobnikami jednego gatunku. Wyróżniamy:

Bardziej szczegółowo

Zastosowanie teorii węzłów w biologii molekularnej. Piotr Krzywda Gr. 10B2

Zastosowanie teorii węzłów w biologii molekularnej. Piotr Krzywda Gr. 10B2 Zastosowanie teorii węzłów w biologii molekularnej Piotr Krzywda Gr. 10B2 Na początku trochę biologii. Biologia molekularna Biologia molekularna jest to dziedzina nauki z pogranicza kilku nauk biologicznych,

Bardziej szczegółowo

Podstawy biologii. Informacja genetyczna. Co to jest ewolucja.

Podstawy biologii. Informacja genetyczna. Co to jest ewolucja. Podstawy biologii Informacja genetyczna. Co to jest ewolucja. Zarys biologii molekularnej genu Podstawowe procesy genetyczne Replikacja powielanie informacji Ekspresja wyrażanie (realizowanie funkcji)

Bardziej szczegółowo

Rozkład materiału z biologii do klasy III.

Rozkład materiału z biologii do klasy III. Rozkład materiału z biologii do klasy III. L.p. Temat lekcji Treści programowe Uwagi 1. Nauka o funkcjonowaniu przyrody. 2. Genetyka nauka o dziedziczności i zmienności. -poziomy różnorodności biologicznej:

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) 1 Budowa i funkcje

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy przedmiot biologia nauczana dwujęzycznie poziom podstawowy klasa Ib i Ic

Wymagania edukacyjne Biologia na czasie zakres podstawowy przedmiot biologia nauczana dwujęzycznie poziom podstawowy klasa Ib i Ic Wymagania edukacyjne Biologia na czasie zakres podstawowy przedmiot biologia nauczana dwujęzycznie poziom podstawowy klasa Ib i Ic Dział programu Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający

Bardziej szczegółowo

2015-11-18. DNA i RNA ENZYMY MODYFIKUJĄCE KOŃCE CZĄSTECZEK. DNA i RNA. DNA i RNA

2015-11-18. DNA i RNA ENZYMY MODYFIKUJĄCE KOŃCE CZĄSTECZEK. DNA i RNA. DNA i RNA Fosfataza alkaliczna CIP Calf Intestine Phosphatase- pochodzenie: jelito cielęce BAP Bacterial Alcaline Phosphatase- pochodzenie: E. coli SAP Shrimp Alcaline Phosphatase- pochodzenie: krewetki Pandalus

Bardziej szczegółowo

Wykład 1. Od atomów do komórek

Wykład 1. Od atomów do komórek Wykład 1. Od atomów do komórek Skład chemiczny komórek roślinnych Składniki mineralne (nieorganiczne) - popiół Substancje organiczne (sucha masa) - węglowodany - lipidy - kwasy nukleinowe - białka Woda

Bardziej szczegółowo

Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO

Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań konieczny (K) dopuszczający podstawowy (P) dostateczny rozszerzający (R) dobry

Bardziej szczegółowo

definiuje pojęcia: inżynieria genetyczna, replikacja DNA wyjaśnia regułę komplementarności

definiuje pojęcia: inżynieria genetyczna, replikacja DNA wyjaśnia regułę komplementarności Wymagania programowe na poszczególne stopnie przygotowane w oparciu o podstawę programową oraz treści podręcznika : Biologia na czasie zakres podstawowy (Wydawnictwo Nowa Era) Opracowała: Anna Wojdan Dział

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo