WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH UŻYWANYCH W PROGRAMACH HODOWLANYCH JABŁONI.

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH UŻYWANYCH W PROGRAMACH HODOWLANYCH JABŁONI."

Transkrypt

1 Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) MAŁGORZATA KORBIN, SYLWIA KELLER-PRZYBYŁKOWICZ, EDWARD ŻURAWICZ WYSTĘPOWANIE WYBRANYCH GENÓW ODPORNOŚCI NA PARCH JABŁONI U ODMIAN I GATUNKÓW DZIKICH UŻYWANYCH W PROGRAMACH HODOWLANYCH JABŁONI Z Zakładu Hodowli Roślin Sadowniczych Instytutu Sadownictwa i Kwiaciarstwa w Skierniewicach ABSTRACT. Screening of cultivars from apple breeding programme for the presence of genes coding resistance to apple scab was conducted in the Research Institute of Pomology and Floriculture in Skierniewice. The Vbj-gene (source: resistant Malus baccata jackii) was identified in all plants independently on the level of tolerance/susceptibility to this disease. The Vf-related fragment (source: M. floribunda 821) was also recognized in majority of tested plants, and only three cvs ( Antonówka Zwykła, Red Rome and Rome Spur ) do not seem to be the donors of this gene. Key words: apple, apple scab, resistance genes, screening Wstęp Parch jabłoni, powodowany przez Venturia inaequalis, jest jedną z najgroźniejszych chorób jabłoni. Patogen osłabia siłę wzrostu rośliny oraz poważnie uszkadza owoce, zmniejszając tym samym plon. Niemal wszystkie odmiany jabłoni uprawiane dla potrzeb komercyjnych na świecie są podatne na tę chorobę. Program ochrony jabłoni przed parchem obejmuje oprysków pestycydami rocznie, co znacząco podnosi koszty produkcji. Alternatywą jest wprowadzanie do uprawy nowych odmian, charakteryzujących się odpornością na V. inaequalis, ale zastosowanie takiej strategii wymaga znacznej wiedzy na temat donorów cechy odporności na tego patogena i mechanizmu tego procesu. Analiza odmian jabłoni pod kątem obecności wszystkich genów, znanych jako warunkujące odporność na parch jabłoni, prowadzona w Instytucie Sadownictwa i Kwiaciarstwa w Skierniewicach, ma na celu wyodrębnienie genotypów będących potencjalnie najlepszymi formami wyjściowymi dla hodowli odpornościowej. W niniejszej pracy przedstawiamy dane dotyczące screeningu na obecność dwóch genów typowych dla gatunków dzikich, tj. genu Vf i Vbj. Rocz. AR Pozn. CCCLXXXIII, Ogrodn. 41: Wydawnictwo Akademii Rolniczej im. Augusta Cieszkowskiego w Poznaniu, Poznań 2007 PL ISSN

2 322 M. Korbin, S. Keller-Przybyłkowicz, E. Żurawicz Materiał i metody Materiał roślinny stanowiły rośliny odmiany McIntosh znanej z bardzo dużej podatności na zakażenie przez parcha jabłoni, rośliny 13 odmian mniej wrażliwych na tę chorobę ( Retina, Rubinola, Ariwa, J-79, Rajka, Melfree, Early Freegold, Free Redstar, Topaz, Gold Rush, Antonówka Zwykła, Red Rome i Rome Spur ) oraz rośliny odpornych gatunków dzikich Malus floribunda 821 i M. baccata jackii (jedna roślina karłowa K). Rośliny odmian uprawnych i M. floribunda 821 pochodziły w kolekcji ISK. Rośliny M. baccata rosły na trawnikach w dwóch rejonach Skierniewic. Z każdego z wytypowanych genotypów pobrano po 2 próby (2 g świeżych liści), z których izolowano materiał genetyczny (DNA). DNA izolowano metodą Aldricha i Cullisa (1993). Czystość uzyskanych preparatów DNA oceniano spektrofotometrycznie i na żelu agarozowym. Wyizolowany DNA służył jako matryca w PCR. Startery SCAR do PCR zsyntetyzowano na podstawie sekwencji genów Vf i Vbj oznaczonych na mapie genomu jabłoni (Patocci i in. 1999, Xu i Korban 2000, Gygax i in. 2004, Huaracha i in. 2004). Do amplifikacji genu Vf zastosowano startery: a) ACS-3 (taagaccccacttgtttttggcatg/gaattcagagtttagtctttcaatt), b) ACS-7 (gtgccaatgtaatcagagtgacgtg/atgtaggtggtgatgtatctggatt), c) ACS-9 (acatggaagatgaaggagaaggag/gataaattgagtgactgcaaagcg). Do amplifikacji genu Vbj użyto starterów: a) K08 (gaacactgggcaaaggaaac/taaaagccacgttctctcgc), b) T06 (cgttcaactcataagtggtcc/aagggcagaatgataaaagcc), c) Z13 (ccctagcatgccataaaacc/cccagtggaatatttcgagg). Reakcję amplifikacji przeprowadzono w termocyklerze PTC-200 MJ Research (35 cykli). Mieszanina reakcyjna (13 μl) zawierała 3 ng genomowego DNA, 5U Taq Polimerazy Platinium w 10x PCR-buforze z 10 mm MgCl 2 (Invitrogen) i 5 mm każdego startera. Profile termiczne PCR różniły się w zależności od zastosowanych starterów: dla starterów ACS 94 C przez 30 s, 65 C przez 30 s i 72 C przez 60 s, dla starterów K08 i Z13 94 C przez 30 s, 67 C przez 30 s, 72 C przez 60 s, dla starterów T06 94 C przez 30 s, 60 C przez 30 s i 72 C przez 60 s. Produkty PCR były rozdzielane w 1-procentowym żelu agarozowym, wybarwiane bromkiem etydyny i wizualizowane w świetle UV. Wielkość produktów oceniano przez porównanie z DNA faga λ trawionego enzymami restrykcyjnymi EcoR I i Hind III (Frementas). Wyniki i dyskusja W wyniku reakcji ze starterami SCAR, zsyntetyzowanymi na podstawie sekwencji genu Vbj z mapy genomu jabłoni, uzyskano produkty PCR o spodziewanej długości 743 (K0-8) i 773 pz (Z-13) (ryc. 1 a, b). Produkt o długości około 740 pz był obserwowany w próbkach DNA roślin M. baccata jackii, będącej donorem genu Vbj, oraz w DNA roślin Retina, Ariwa, J-79, Melfree, Early Freegold, Free Redstar, Gold Rush, Antonówka Zwykła, Red Rome i Rome Spur, znanych jako względnie tolerancyjne na parch jabłoni. Jednocześnie fragment DNA o tej samej długości wykryto w roślinie M. floribunda 821, będącej donorem genu Vf oraz w bardzo wrażliwej na porażenie przez V. inaequalis odmiany McIntosh.

3 Występowanie wybranych genów odporności a) 900pz 831pz 743pz b) 870pz 773 c) pz d) 118pz e) Ryc. 1. Elektroforogram produktów uzyskanych w reakcjach PCR ze starterami: a K-08, b Z-13, c ACS-03, d ACS-07, e ACS-09. Próbki: 1 Retina, 2 Rubinola, 3 Ariwa, 4 J-79, 5 Rajka, 6 Melfree, 7 Early Freegold, 8 Free Redstar, 9 Topaz, 10 Gold Rush, 11 Antonówka Zwykła, 12 Red Rome, 13 Rome Spur, 14 Malus floribunda 821, 15 McIntosh, 16 M. baccata jackii K, 17 M. baccata jackii Fig. 1. Electrophorogram of products generated in PCR with primers: a K-08, b Z-13, c ACS-03, d ACS-07, e ACS-09. Lines: 1 Retina, 2 Rubinola, 3 Ariwa, 4 J-79, 5 Rajka, 6 Melfree, 7 Early Freegold, 8 Free Redstar, 9 Topaz, 10 Gold Rush, 11 Antonowka Zwykła, 12 Red Rome, 13 Rome Spur, 14 Malus floribunda 821, 15 McIntosh, 16 M. baccata jackii K, 17 M. baccata jackii

4 324 M. Korbin, S. Keller-Przybyłkowicz, E. Żurawicz Produktu 743 pz nie obserwowano w reakcjach przeprowadzonych na matrycy DNA roślin Rubinola, Rajka i Topaz. W reakcji z tym samym starterem uzyskano natomiast (także dla roślin Retina, Ariwa, Early Freegold, Free Redstar, Gold Rush ) produkt o długości 900 pz., prawdopodobnie zamplifikowany drugi locus genu Vbj (Gygax i in. 2004). Podobnie w reakcji ze starterem Z-13 produkt o oczekiwanej długości 773 pz obserwowano dla próbek z DNA roślin Early Freegold, Topaz, Gold Rush, Red Rome, Rome Spur, McIntosh oraz M. floribunda 821, podczas gdy drugi produkt (drugi locus) o długości 870 pz był widoczny dla próbek Ariwa, Rajka, Melfree, Topaz, Gold Rush, M. floribunda 821 oraz karłowej odmiany M. baccata K. Uzyskane wyniki wskazują, iż wszystkie z wymienionych roślin są donorami fragmentu odpowiadającego sekwencji Vbj, ale nie we wszystkich roślinach obserwuje się jego ekspresję. W reakcjach ze starterami SCAR specyficznymi dla dominującego genu Vf produktów PCR nie obserwowano w ogóle na matrycy DNA z roślin Antonówka Zwykła, Red Rome i Rome Spur. Dla bardzo podatnej na parch jabłoni odmiany McIntosh nie stwierdzono produktów w reakcji ze starterami ACS-03 i ACS-09, natomiast w reakcji ze starterem ACS-07 widoczny był produkt o spodziewanej długości około 260 pz (ryc. 1 c, d, e). Z badanych genotypów tylko trzy odmiany Antonówka Zwykła, Red Rome i Rome Spur wydają się, mimo ich względnej tolerancji na parch w warunkach polowych, nie być nośnikami genu Vf. Obecność obydwu genów odporności Vf i Vbj w obu odpornych gatunkach dzikich jak też w odmianach wykazujących różny stopień tolerancji bądź nawet podatność ( McIntosh ) na parch jabłoni potwierdza złożony charakter zjawiska odporności na tę chorobę. Jak dotychczas wykryto już 6 różnych fragmentów DNA sprzężonych z odpornością na zakażenie przez V. inaequalis (Gygax i in. 2004). Wskazuje to, wbrew pierwszym doniesieniom (Hough i in. 1953), na poligeniczność cechy i co za tym idzie, korelację między ekspresją wszystkich genów w całym układzie a rzeczywistą reakcją polową roślin. Literatura Aldrich J., Cullis C.A. (1993): RAPD analysis in flax. optimization of yield and reproducibility using Klen Taq 1 DNA polymerase, Chelex 100 and gel purification of genomic DNA. Plant Mol. Biol. Rep. 11: Gygax M., Gianfranceschi L., Liebhard R., Kellerhaus M., Gessler C., Patocci A. (2004): Molecular markers linked to the apple scab resistance gene Vbj derived from Malus baccata jackii. Theor. Appl. Genet. 109: Huaracha E., Xu M., Korban S. (2004): Narrowing down the region of the Vf locus for scab resistance in apple using AFLP-derived SCARS. Theor. Appl. Genet. 108: Hough L.F., Williams E.B., Dayton D.F. (1953): Apple scab resistance from Malus floribunda Sieb. Am. Soc. Hort. Sci. 62: Patocci A., Gianfranceschi L., Gesler C. (1999): Towards the map-based cloning of Vf fine and physical mapping of Vf region. Theor. Appl. Genet. 99: Xu M.L., Korban S. (2000): Saturation mapping of the apple scab resistance gene Vf using AFLP markers. Theor. Appl. Genet. 101:

5 Występowanie wybranych genów odporności THE OCCURRENCE OF SELECTED GENES CODING RESISTANCE TO APPLE SCAB IN POPULATION OF CULTIVATED VARIETIES AND WILD SPECIES USED IN APPLE BREEDING PROGRAMME Summary Thirteen cultivars with partial tolerance to apple scab, susceptible McIntosh and two wild, resistant species Malus floribunda 821 and Malus baccata jackii were analysed for the presence of genes coding resistance to Venturia inaequalis. Six primers were selected for isolation of DNA fragments connected with Vf and Vbj resistance genes. DNA fragments with expected size for the Vbj-gene were identified in all plants, meanwhile only genome of 3 cvs did not contain the Vf. The obtained results allowed to recognize donors of the analysed genes and confirm polygenic character of resistance to apple scab.

Zastosowanie markerów molekularnych do oceny genotypów jab³oni pod k¹tem odpornoœci na parcha jab³oniowego (Venturia inaequalis)

Zastosowanie markerów molekularnych do oceny genotypów jab³oni pod k¹tem odpornoœci na parcha jab³oniowego (Venturia inaequalis) PRACE EKSPERYMENTALNE Zastosowanie markerów molekularnych do oceny genotypów jab³oni pod k¹tem odpornoœci na parcha jab³oniowego (Venturia inaequalis) Ma³gorzata Korbin, Sylwia Keller-Przyby³kowicz, Edward

Bardziej szczegółowo

Autor: dr Mirosława Staniaszek

Autor: dr Mirosława Staniaszek Zakład Hodowli Roślin Ogrodniczych Pracownia Genetyki i Hodowli Roślin Warzywnych Fot. J. Sobolewski Procedura identyfikacji genu Frl warunkującego odporność pomidora na Fusarium oxysporum f.sp. radicis-lycopersici

Bardziej szczegółowo

WYKORZYSTANIE MARKERÓW MOLEKULARNYCH W HODOWLI ODPORNOŚCIOWEJ POMIDORA NA CHOROBY POWODOWANE PRZEZ FUSARIUM OXYSPORUM

WYKORZYSTANIE MARKERÓW MOLEKULARNYCH W HODOWLI ODPORNOŚCIOWEJ POMIDORA NA CHOROBY POWODOWANE PRZEZ FUSARIUM OXYSPORUM WYKORZYSTANIE ARKERÓW OLEKULARNYCH W HODOWLI ODPORNOŚCIOWEJ POIDORA NA CHOROBY POWODOWANE PRZEZ FUSARIU OXYSPORU F.SP. LYCOPERSICI I PSEUDOONAS SYRINGAE PV. TOATO USE OF OLECULAR ARKERS IN THE BREEDING

Bardziej szczegółowo

PLONOWANIE NOWYCH PARCHOODPORNYCH ODMIAN JABŁONI HODOWLI INSTYTUTU SADOWNICTWA I KWIACIARSTWA W SKIERNIEWICACH NA RÓŻNYCH TYPACH PODKŁADEK

PLONOWANIE NOWYCH PARCHOODPORNYCH ODMIAN JABŁONI HODOWLI INSTYTUTU SADOWNICTWA I KWIACIARSTWA W SKIERNIEWICACH NA RÓŻNYCH TYPACH PODKŁADEK Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) MARIUSZ LEWANDOWSKI, EDWARD ŻURAWICZ PLONOWANIE NOWYCH PARCHOODPORNYCH ODMIAN JABŁONI HODOWLI INSTYTUTU SADOWNICTWA I KWIACIARSTWA W SKIERNIEWICACH

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 26/11

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 26/11 PL 214501 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214501 (13) B1 (21) Numer zgłoszenia: 391458 (51) Int.Cl. C12Q 1/68 (2006.01) C12N 15/29 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

Ćwiczenie 2. Identyfikacja płci z wykorzystaniem genu amelogeniny (AMGXY)

Ćwiczenie 2. Identyfikacja płci z wykorzystaniem genu amelogeniny (AMGXY) Ćwiczenie 2. Identyfikacja płci z wykorzystaniem genu amelogeniny (AMGXY) Cel ćwiczenia Amplifikacja fragmentu genu amelogeniny, znajdującego się na chromosomach X i Y, jako celu molekularnego przydatnego

Bardziej szczegółowo

Zastosowanie metody RAPD do różnicowania szczepów bakteryjnych

Zastosowanie metody RAPD do różnicowania szczepów bakteryjnych Zastosowanie metody RAPD do różnicowania szczepów bakteryjnych Wstęp teoretyczny Technika RAPD (ang. Random Amplification of Polymorphic DNA) opiera się na prostej reakcji PCR, przeprowadzanej na genomowym

Bardziej szczegółowo

WZROST I PLONOWANIE PAPRYKI SŁODKIEJ (CAPSICUM ANNUUM L.), UPRAWIANEJ W POLU W WARUNKACH KLIMATYCZNYCH OLSZTYNA

WZROST I PLONOWANIE PAPRYKI SŁODKIEJ (CAPSICUM ANNUUM L.), UPRAWIANEJ W POLU W WARUNKACH KLIMATYCZNYCH OLSZTYNA Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) ŁUCJA MICHALIK WZROST I PLONOWANIE PAPRYKI SŁODKIEJ (CAPSICUM ANNUUM L.), UPRAWIANEJ W POLU W WARUNKACH KLIMATYCZNYCH OLSZTYNA Z Katedry Ogrodnictwa

Bardziej szczegółowo

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 04/14. SYLWIA OKOŃ, Dąbrowica, PL KRZYSZTOF KOWALCZYK, Motycz, PL

PL B1. UNIWERSYTET PRZYRODNICZY W LUBLINIE, Lublin, PL BUP 04/14. SYLWIA OKOŃ, Dąbrowica, PL KRZYSZTOF KOWALCZYK, Motycz, PL PL 220315 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 220315 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 400252 (22) Data zgłoszenia: 06.08.2012 (51) Int.Cl.

Bardziej szczegółowo

Ampli-LAMP Babesia canis

Ampli-LAMP Babesia canis Novazym Products Zestaw do identyfikacji materiału genetycznego pierwotniaka Babesia canis canis techniką Loop-mediated Isothermal AMPlification (LAMP) Numery katalogowe produktu: AML-Bc-200 AML-Bc-400

Bardziej szczegółowo

WZROST, PLONOWANIE I WIELKOŚCI OWOCÓW TRZYNASTU ODMIAN JABŁONI OKULIZOWANYCH NA PODKŁADCE M.9. Wstęp

WZROST, PLONOWANIE I WIELKOŚCI OWOCÓW TRZYNASTU ODMIAN JABŁONI OKULIZOWANYCH NA PODKŁADCE M.9. Wstęp Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) STANISŁAW WOCIÓR, PIOTR BARYŁA, SALWINA PALONKA, IRENA WÓJCIK WZROST, PLONOWANIE I WIELKOŚCI OWOCÓW TRZYNASTU ODMIAN JABŁONI OKULIZOWANYCH NA PODKŁADCE

Bardziej szczegółowo

SPRAWOZDANIE O STANIE REALIZACJI ZADANIA z wykonania badań podstawowych na rzecz postępu biologicznego w produkcji roślinnej w 2011 roku

SPRAWOZDANIE O STANIE REALIZACJI ZADANIA z wykonania badań podstawowych na rzecz postępu biologicznego w produkcji roślinnej w 2011 roku SPRAWOZDANIE O STANIE REALIZACJI ZADANIA z wykonania badań podstawowych na rzecz postępu biologicznego w produkcji roślinnej w 2011 roku 1. Nr decyzji MRiRW: HOR hn 078--37/11 zadanie nr 22 2. Nazwa tematu:

Bardziej szczegółowo

USZLACHETNIANIE NASION WYBRANYCH GATUNKÓW ROŚLIN WARZYWNYCH POPRZEZ STYMULACJĘ PROMIENIAMI LASERA. Wstęp. Materiał i metody

USZLACHETNIANIE NASION WYBRANYCH GATUNKÓW ROŚLIN WARZYWNYCH POPRZEZ STYMULACJĘ PROMIENIAMI LASERA. Wstęp. Materiał i metody Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (7) HANNA SZAJSNER, DANUTA DROZD USZLACHETNIANIE NASION WYBRANYCH GATUNÓW ROŚLIN WARZYWNYCH POPRZEZ STYMULACJĘ PROMIENIAMI LASERA Z atedry Hodowli Roślin

Bardziej szczegółowo

REAKCJA NASION WYBRANYCH ODMIAN OGÓRKA NA PRZEDSIEWNĄ BIOSTYMULACJĘ LASEROWĄ. Wstęp

REAKCJA NASION WYBRANYCH ODMIAN OGÓRKA NA PRZEDSIEWNĄ BIOSTYMULACJĘ LASEROWĄ. Wstęp Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) DANUTA DROZD, HANNA SZAJSNER REACJA NASION WYBRANYCH ODMIAN OGÓRA NA PRZEDSIEWNĄ BIOSTYMULACJĘ LASEROWĄ Z atedry Hodowli Roślin i Nasiennictwa Uniwersytetu

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne cereal mosaic virus, SBCMV)

Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne cereal mosaic virus, SBCMV) Małgorzata Jeżewska Zakład Wirusologii i Bakteriologii, Instytut Ochrony Roślin Państwowy Instytut Badawczy, Poznań Poszukiwanie źródeł odporności u pszenic na wirus odglebowej mozaiki zbóż (Soil-borne

Bardziej szczegółowo

WPŁYW OSŁON ORAZ SPOSOBU SADZENIA ZĄBKÓW NA PLONOWANIE CZOSNKU W UPRAWIE NA ZBIÓR PĘCZKOWY. Wstęp

WPŁYW OSŁON ORAZ SPOSOBU SADZENIA ZĄBKÓW NA PLONOWANIE CZOSNKU W UPRAWIE NA ZBIÓR PĘCZKOWY. Wstęp Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) EWA REKOWSKA WPŁYW OSŁON ORAZ SPOSOBU SADZENIA ZĄBKÓW NA PLONOWANIE CZOSNKU W UPRAWIE NA ZBIÓR PĘCZKOWY Z Katedry Warzywnictwa Akademii Rolniczej

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

Zadanie 2.4 Poszerzanie puli genetycznej buraka cukrowego przez doskonalenie procesu gynogenezy oraz podnoszenie odporno

Zadanie 2.4 Poszerzanie puli genetycznej buraka cukrowego przez doskonalenie procesu gynogenezy oraz podnoszenie odporno Zadanie 2.4 Poszerzanie puli genetycznej buraka cukrowego przez doskonalenie procesu gynogenezy oraz podnoszenie odporności na wirus nekrotycznego żółknięcia nerwów i tolerancji na suszę Wykonawcy: Dr

Bardziej szczegółowo

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9

Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów. Rozdział 9 Badanie próbek żywności na obecność Genetycznie Zmodyfikowanych Organizmów Rozdział 9 Wykrywanie jakościowe kukurydzy MON810, kukurydzy Bt-176 i soi Roundup Ready metodą PCR M. Querci, M. Maretti, M. Mazzara

Bardziej szczegółowo

PCR bez izolacji testujemy Direct PCR Kits od ThermoFisher Scientific

PCR bez izolacji testujemy Direct PCR Kits od ThermoFisher Scientific PCR bez izolacji testujemy Direct PCR Kits od ThermoFisher Scientific Specjalnie dla Was przetestowaliśmy w naszym laboratorium odczynniki firmy Thermo Scientific umożliwiające przeprowadzanie reakcji

Bardziej szczegółowo

ANNALES UNIVERSITATIS MARIAE CURIE-SKŁODOWSKA LUBLIN POLONIA

ANNALES UNIVERSITATIS MARIAE CURIE-SKŁODOWSKA LUBLIN POLONIA ANNALES UNIVERSITATIS MARIAE CURIE-SKŁODOWSKA LUBLIN POLONIA VOL. LXVIII (3) SECTIO E 2013 Instytut Genetyki, Hodowli i Biotechnologii Roślin, Uniwersytet Przyrodniczy w Lublinie ul. Akademicka 15, 20-950

Bardziej szczegółowo

Ampli-LAMP Goose Parvovirus

Ampli-LAMP Goose Parvovirus Novazym Products Zestaw do identyfikacji materiału genetycznego parwowirusa GPV u gęsi techniką Loop-mediated Isothermal AMPlification (LAMP) Numery katalogowe produktu: AML-GPV-200 AML-GPV-400 Wydanie

Bardziej szczegółowo

Zadanie 2.4. Cel badań:

Zadanie 2.4. Cel badań: Zadanie 2.4 Poszerzanie puli genetycznej buraka cukrowego przez doskonalenie procesu gynogenezy oraz podnoszenie odporności na wirus nekrotycznego żółknięcia nerwów i tolerancji na suszę Cel badań: Celem

Bardziej szczegółowo

WZROST I PLONOWANIE PÓŹNYCH ODMIAN TRUSKAWKI W WARUNKACH POLSKI CENTRALNEJ. Wstęp. Materiał i metody

WZROST I PLONOWANIE PÓŹNYCH ODMIAN TRUSKAWKI W WARUNKACH POLSKI CENTRALNEJ. Wstęp. Materiał i metody Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) AGNIESZKA MASNY, EDWARD ŻURAWICZ WZROST I PLONOWANIE PÓŹNYCH ODMIAN TRUSKAWKI W WARUNKACH POLSKI CENTRALNEJ Z Zakładu Hodowli Roślin Sadowniczych

Bardziej szczegółowo

WYKORZYSTANIE MARKERÓW SSR DO MOLEKULARNEJ CHARAKTERYSTYKI ZASOBÓW GENOWYCH JABŁONI. Wstęp

WYKORZYSTANIE MARKERÓW SSR DO MOLEKULARNEJ CHARAKTERYSTYKI ZASOBÓW GENOWYCH JABŁONI. Wstęp Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) ANNA HAWLICZEK, MARTA STANKIEWICZ-KOSYL, STANISŁAW W. GAWROŃSKI WYKORZYSTANIE MARKERÓW SSR DO MOLEKULARNEJ CHARAKTERYSTYKI ZASOBÓW GENOWYCH JABŁONI

Bardziej szczegółowo

ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków)

ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków) ĆWICZENIE 1 i 2 Modyfikacja geu wołowej beta-laktoglobuliny przy użyciu metody Overlap Extension PCR (wydłużania nakładających się odcinków) Celem ćwiczenia jest wprowadzenie mutacji punktowej do genu

Bardziej szczegółowo

Transformacja pośrednia składa się z trzech etapów:

Transformacja pośrednia składa się z trzech etapów: Transformacja pośrednia składa się z trzech etapów: 1. Otrzymanie pożądanego odcinka DNA z materiału genetycznego dawcy 2. Wprowadzenie obcego DNA do wektora 3. Wprowadzenie wektora, niosącego w sobie

Bardziej szczegółowo

WYKRYWANIE MICRODOCHIUM NIVALE VAR. NIVALE I M. NIVALE VAR. MAJUS W PSZENICY OZIMEJ UPRAWIANEJ W RÓŻNYCH SYSTEMACH PRODUKCJI

WYKRYWANIE MICRODOCHIUM NIVALE VAR. NIVALE I M. NIVALE VAR. MAJUS W PSZENICY OZIMEJ UPRAWIANEJ W RÓŻNYCH SYSTEMACH PRODUKCJI Progress in Plant Protection/Postępy w Ochronie Roślin 48 (2) 2008 WYKRYWANIE MICRODOCHIUM NIVALE VAR. NIVALE I M. NIVALE VAR. MAJUS W PSZENICY OZIMEJ UPRAWIANEJ W RÓŻNYCH SYSTEMACH PRODUKCJI EWA SOLARSKA,

Bardziej szczegółowo

WARTOŚĆ PRODUKCYJNA NOWYCH ODMIAN I KLONÓW HODOWLANYCH PORZECZKI CZARNEJ OCENIANA W LATACH

WARTOŚĆ PRODUKCYJNA NOWYCH ODMIAN I KLONÓW HODOWLANYCH PORZECZKI CZARNEJ OCENIANA W LATACH Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) STANISŁAW PLUTA 1, EDWARD ŻURAWICZ 1, AGATA BRONIAREK-NIEMIEC 2 WARTOŚĆ PRODUKCYJNA NOWYCH ODMIAN I KLONÓW HODOWLANYCH PORZECZKI CZARNEJ OCENIANA

Bardziej szczegółowo

Występowanie chorób przechowalniczych na jabłkach odmian parchoodpornych HANNA BRYK, DOROTA KRUCZYŃSKA

Występowanie chorób przechowalniczych na jabłkach odmian parchoodpornych HANNA BRYK, DOROTA KRUCZYŃSKA ACTA AGROBOTANICA Vol. 58, z. 2 25 s. 25 212 Występowanie chorób przechowalniczych na jabłkach odmian parchoodpornych HANNA BRYK, DOROTA KRUCZYŃSKA Instytut Sadownictwa i Kwiaciarstwa, ul. Pomologiczna

Bardziej szczegółowo

Przewidywane procedury rejestracji i kontroli uprawy odmian transgenicznych w Polsce

Przewidywane procedury rejestracji i kontroli uprawy odmian transgenicznych w Polsce NR 221 BIULETYN INSTYTUTU HODOWLI I AKLIMATYZACJI ROŚLIN 2002 EDWARD GACEK Centralny Ośrodek Badania Odmian Roślin Uprawnych, Słupia Wielka Przewidywane procedury rejestracji i kontroli uprawy odmian transgenicznych

Bardziej szczegółowo

Przydatność markera QTL w hodowli jabłoni odpornej na mączniaka (Podosphaera leucotricha (Ellis et Ev.) Salm.)

Przydatność markera QTL w hodowli jabłoni odpornej na mączniaka (Podosphaera leucotricha (Ellis et Ev.) Salm.) NR 240/241 BIULETYN INSTYTUTU HODOWLI I AKLIMATYZACJI ROŚLIN 2006 MARTA STANKIEWICZ-KOSYL EMILIAN PITERA STANISŁAW W. GAWROŃSKI Samodzielny Zakład Przyrodniczych Podstaw Ogrodnictwa Wydział Ogrodnictwa

Bardziej szczegółowo

PW Zadanie 3.3: Monitoring zmian zdolności chorobotwórczych populacji patogenów z kompleksu Stagonospora spp. / S.

PW Zadanie 3.3: Monitoring zmian zdolności chorobotwórczych populacji patogenów z kompleksu Stagonospora spp. / S. PW 2015-2020 Zadanie 3.3: Monitoring zmian zdolności chorobotwórczych populacji patogenów z kompleksu Stagonospora spp. / S. tritici sprawców plamistości liści i plew pszenicy i pszenżyta Zakład Fitopatologii,

Bardziej szczegółowo

Ocena stabilności genetycznej rozmnażanych in vitro polskich odmian tulipanów przy użyciu markerów molekularnych ISSR

Ocena stabilności genetycznej rozmnażanych in vitro polskich odmian tulipanów przy użyciu markerów molekularnych ISSR Ocena stabilności genetycznej rozmnażanych in vitro polskich odmian tulipanów przy użyciu markerów molekularnych ISSR Małgorzata Podwyszyńska, Anita Kuras, Małgorzata Korbin Instytut sadownictwa i Kwiaciarstwa,

Bardziej szczegółowo

POSSIBILITIES IN GROWING AND PROTECTION OF APPLE TREES AGAINST DISEASES IN ORGANIC ORCHARDS

POSSIBILITIES IN GROWING AND PROTECTION OF APPLE TREES AGAINST DISEASES IN ORGANIC ORCHARDS Hanna BRYK, Dorota E. KRUCZYŃSKA Instytut Ogrodnictwa, Oddział Sadownictwa ul. Pomologiczna 18, 9-100 Skierniewice e-mail: Hanna.Bryk@insad.pl POSSIBILITIES IN GROWING AND PROTECTION OF APPLE TREES AGAINST

Bardziej szczegółowo

Zestawy do izolacji DNA i RNA

Zestawy do izolacji DNA i RNA Syngen kolumienki.pl Gotowe zestawy do izolacji i oczyszczania kwasów nukleinowych Zestawy do izolacji DNA i RNA Katalog produktów 2012-13 kolumienki.pl Syngen Biotech Sp. z o.o., 54-116 Wrocław, ul. Ostródzka

Bardziej szczegółowo

Zestaw do wykrywania Babesia spp. i Theileria spp. w kleszczach, krwi i hodowlach komórkowych

Zestaw do wykrywania Babesia spp. i Theileria spp. w kleszczach, krwi i hodowlach komórkowych Nr kat. PK25N Wersja zestawu: 1.2012 Zestaw do wykrywania spp. i Theileria spp. w kleszczach, krwi i hodowlach komórkowych dwie oddzielne reakcje PCR 2x50 reakcji PCR (50 µl), włączając w to kontrole Zestaw

Bardziej szczegółowo

Fizjologiczne i molekularne markery tolerancji buraka cukrowego na suszę. Dr Danuta Chołuj

Fizjologiczne i molekularne markery tolerancji buraka cukrowego na suszę. Dr Danuta Chołuj Fizjologiczne i molekularne markery tolerancji buraka cukrowego na suszę Dr Danuta Chołuj Szacunkowe straty plonu buraków cukrowych w Europie na skutek suszy kształtują się pomiędzy 5 a 30 % W jakiej fazie

Bardziej szczegółowo

MONITORING ODPORNOŚCI VENTURIA INAEQUALIS NA FUNGICYDY STROBILURYNOWE I DODYNOWE

MONITORING ODPORNOŚCI VENTURIA INAEQUALIS NA FUNGICYDY STROBILURYNOWE I DODYNOWE ZESZYTY NAUKOWE INSTYTUTU SADOWNICTWA I KWIACIARSTWA TOM 13 2005 MONITORING ODPORNOŚCI VENTURIA INAEQUALIS NA FUNGICYDY STROBILURYNOWE I DODYNOWE Monitoring of Venturia inaequalis resistance to strobiluryn

Bardziej szczegółowo

ZALEŻNOŚĆ MIĘDZY NORMĄ WYSIEWU NASION A PLONEM ZIELA KARCZOCHA (CYNARA SCOLYMUS L.) * Wstęp. Materiał i metody

ZALEŻNOŚĆ MIĘDZY NORMĄ WYSIEWU NASION A PLONEM ZIELA KARCZOCHA (CYNARA SCOLYMUS L.) * Wstęp. Materiał i metody Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (27) ANDRZEJ SAŁATA, HALINA BUCZKOWSKA ZALEŻNOŚĆ MIĘDZY NORMĄ WYSIEWU NASION A PLONEM ZIELA KARCZOCHA (CYNARA SCOLYMUS L.) * Z Katedry Warzywnictwa i Roślin

Bardziej szczegółowo

A N N A L E S U N I V E R S I T A T I S M A R I A E C U R I E - S K Ł O D O W S K A L U B L I N P O L O N I A

A N N A L E S U N I V E R S I T A T I S M A R I A E C U R I E - S K Ł O D O W S K A L U B L I N P O L O N I A A N N A L E S U N I V E R S I T A T I S M A R I A E C U R I E - S K Ł O D O W S K A L U B L I N P O L O N I A VOL. LXVII (3) SECTIO E 2012 1 Instytut Genetyki, Hodowli i Biotechnologii Roślin, Uniwersytet

Bardziej szczegółowo

PODATNOŚĆ NOWYCH ODMIAN DESEROWYCH TRUSKAWKI NA WERTYCYLIOZĘ W WARUNKACH POLOWYCH

PODATNOŚĆ NOWYCH ODMIAN DESEROWYCH TRUSKAWKI NA WERTYCYLIOZĘ W WARUNKACH POLOWYCH ZESZYTY NAUKOWE INSTYTUTU SADOWNICTWA I KWIACIARSTWA TOM 16 2008 PODATNOŚĆ NOWYCH ODMIAN DESEROWYCH TRUSKAWKI NA WERTYCYLIOZĘ W WARUNKACH POLOWYCH A g n i e s z k a M a s n y, E d w a r d Ż u r a w i c

Bardziej szczegółowo

BADANIA RZECZYWISTYCH KOSZTÓW OBSŁUGI TECHNICZNEJ NOWOCZESNYCH KOMBAJNÓW ZBOŻOWYCH. Wstęp

BADANIA RZECZYWISTYCH KOSZTÓW OBSŁUGI TECHNICZNEJ NOWOCZESNYCH KOMBAJNÓW ZBOŻOWYCH. Wstęp Roczniki Akademii Rolniczej w Poznaniu CCCXLIII (2002) ZENON GRZEŚ BADANIA RZECZYWISTYCH KOSZTÓW OBSŁUGI TECHNICZNEJ NOWOCZESNYCH KOMBAJNÓW ZBOŻOWYCH Z Instytutu Inżynierii Rolniczej Akademii Rolniczej

Bardziej szczegółowo

Zad. 2.2 Poszerzenie puli genetycznej jęczmienia

Zad. 2.2 Poszerzenie puli genetycznej jęczmienia Zad. 2.2 Poszerzenie puli genetycznej jęczmienia Sprawozdanie 2016r Kierownik zadania: prof. dr hab. Jerzy H. Czembor (KCRZG) Wykonawcy: dr hab. Paweł Cz. Czembor (ZGiHR) mgr Piotr Słowacki (ZGiHR) mgr

Bardziej szczegółowo

Zestaw dydaktyczny. genotypowanie szczepów 5taphy/ococcus aureus metodą PCR-RFLP

Zestaw dydaktyczny. genotypowanie szczepów 5taphy/ococcus aureus metodą PCR-RFLP 2014-07-17 Zestaw dydaktyczny EasyGenotyping PCR-RFLP - S. aureus genotypowanie szczepów 5taphy/ococcus aureus metodą PCR-RFLP Celem ćwiczenia jest przeprowadzenie typowania genetycznego dostarczonych

Bardziej szczegółowo

DR ŻANETA PACUD Zdolność patentowa roślin

DR ŻANETA PACUD Zdolność patentowa roślin DR ŻANETA PACUD Zdolność patentowa roślin czyli rzecz o brokułach i pomidorach Sposoby ochrony prawnej roślin wprowadzenie Ochrona prawna odmian roślin - Międzynarodowa konwencja o ochronie nowych odmian

Bardziej szczegółowo

Analiza zmienności allelicznej w locus Xgwm261 w odmianach pszenicy zwyczajnej (Triticum aestivum L.) zarejestrowanych w Polsce w latach

Analiza zmienności allelicznej w locus Xgwm261 w odmianach pszenicy zwyczajnej (Triticum aestivum L.) zarejestrowanych w Polsce w latach NR 252 BIULETYN INSTYTUTU HODOWLI I AKLIMATYZACJI ROŚLIN 2009 KRZYSZTOF KOWALCZYK SYLWIA OKOŃ Instytut Genetyki, Hodowli i Biotechnologii Roślin Uniwersytet Przyrodniczy w Lublinie Analiza zmienności allelicznej

Bardziej szczegółowo

PLONOWANIE DZIEWIĘCIU ODMIAN MARCHWI PRZEZNACZONYCH DLA PRZETWÓRSTWA, UPRAWIANYCH W REJONIE WARMII. Wstęp. Materiał i metody

PLONOWANIE DZIEWIĘCIU ODMIAN MARCHWI PRZEZNACZONYCH DLA PRZETWÓRSTWA, UPRAWIANYCH W REJONIE WARMII. Wstęp. Materiał i metody Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) JOANNA MAJKOWSKA-GADOMSKA 1, BRYGIDA WIERZBICKA 1, MACIEJ NOWAK 2 PLONOWANIE DZIEWIĘCIU ODMIAN MARCHWI PRZEZNACZONYCH DLA PRZETWÓRSTWA, UPRAWIANYCH

Bardziej szczegółowo

PLONOWANIE BOCZNIAKA PLEUROTUS PRECOCE (FR.) QUEL W ZALEŻNOŚCI OD MASY PODŁOŻA. Wstęp

PLONOWANIE BOCZNIAKA PLEUROTUS PRECOCE (FR.) QUEL W ZALEŻNOŚCI OD MASY PODŁOŻA. Wstęp Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (27) MIROSŁAWA ZIOMBRA, ALEKSANDRA CZERWIŃSKA, KINGA ŁAWICKA PLONOWANIE BOCZNIAKA PLEUROTUS PRECOCE (FR.) QUEL W ZALEŻNOŚCI OD MASY PODŁOŻA Z Katedry Warzywnictwa

Bardziej szczegółowo

MOLEKULARNE PODSTAWY ODPORNOŚCI MIOTŁY ZBOŻOWEJ (APERA SPICA-VENTI L.) NA HERBICYDY SULFONYLOMOCZNIKOWE

MOLEKULARNE PODSTAWY ODPORNOŚCI MIOTŁY ZBOŻOWEJ (APERA SPICA-VENTI L.) NA HERBICYDY SULFONYLOMOCZNIKOWE Progress in Plant Protection / Postępy w Ochronie Roślin, 47 (3) 2007 MOLEKULARNE PODSTAWY ODPORNOŚCI MIOTŁY ZBOŻOWEJ (APERA SPICA-VENTI L.) NA HERBICYDY SULFONYLOMOCZNIKOWE MICHAŁ KRYSIAK 1, MAGDALENA

Bardziej szczegółowo

Spis treści Część I. Genetyczne podstawy hodowli roślin 1. Molekularne podstawy dziedziczenia cech Dariusz Crzebelus, Adeta Adamus, Maria Klein

Spis treści Część I. Genetyczne podstawy hodowli roślin 1. Molekularne podstawy dziedziczenia cech Dariusz Crzebelus, Adeta Adamus, Maria Klein Spis treści Część I. Genetyczne podstawy hodowli roślin 1. Molekularne podstawy dziedziczenia cech... 15 Dariusz Crzebelus, Adeta Adamus, Maria Klein 1.1. Budowa DNA i przepływ informacji genetycznej...

Bardziej szczegółowo

PRÓBA OSZACOWANIA AKTUALNEJ WARTOŚCI WSKAŹNIKA KOSZTU NAPRAW CIĄGNIKÓW ROLNICZYCH UŻYTKOWANYCH W WARUNKACH GOSPODARSTW WIELKOOBSZAROWYCH

PRÓBA OSZACOWANIA AKTUALNEJ WARTOŚCI WSKAŹNIKA KOSZTU NAPRAW CIĄGNIKÓW ROLNICZYCH UŻYTKOWANYCH W WARUNKACH GOSPODARSTW WIELKOOBSZAROWYCH Roczniki Akademii Rolniczej w Poznaniu CCCLVIII (2003) ZENON GRZEŚ PRÓBA OSZACOWANIA AKTUALNEJ WARTOŚCI WSKAŹNIKA KOSZTU NAPRAW CIĄGNIKÓW ROLNICZYCH UŻYTKOWANYCH W WARUNKACH GOSPODARSTW WIELKOOBSZAROWYCH

Bardziej szczegółowo

Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan

Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan Klasyczna metoda PCR jest metodą jakościową, nie ilościową co np.

Bardziej szczegółowo

Prof. dr hab. Helena Kubicka- Matusiewicz Prof. dr hab. Jerzy PuchalskI Polska Akademia Nauk Ogród Botaniczny Centrum Zachowania Różnorodności

Prof. dr hab. Helena Kubicka- Matusiewicz Prof. dr hab. Jerzy PuchalskI Polska Akademia Nauk Ogród Botaniczny Centrum Zachowania Różnorodności Prof. dr hab. Helena Kubicka- Matusiewicz Prof. dr hab. Jerzy PuchalskI Polska Akademia Nauk Ogród Botaniczny Centrum Zachowania Różnorodności Biologicznej w Powsinie Wstęp Kraje, które ratyfikowały Konwencję

Bardziej szczegółowo

OCENA PLONOWANIA I JAKOŚCI OWOCÓW DZIEWIĘCIU ODMIAN TRUSKAWKI. Wstęp. Materiał i metody

OCENA PLONOWANIA I JAKOŚCI OWOCÓW DZIEWIĘCIU ODMIAN TRUSKAWKI. Wstęp. Materiał i metody Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) MONIKA BIENIASZ, MONIKA MAŁODOBRY, WŁODZIMIERZ LECH OCENA PLONOWANIA I JAKOŚCI OWOCÓW DZIEWIĘCIU ODMIAN TRUSKAWKI Z Katedry Sadownictwa i Pszczelnictwa

Bardziej szczegółowo

KOSZTY UŻYTKOWANIA MASZYN W STRUKTURZE KOSZTÓW PRODUKCJI ROŚLINNEJ W WYBRANYM PRZEDSIĘBIORSTWIE ROLNICZYM

KOSZTY UŻYTKOWANIA MASZYN W STRUKTURZE KOSZTÓW PRODUKCJI ROŚLINNEJ W WYBRANYM PRZEDSIĘBIORSTWIE ROLNICZYM Inżynieria Rolnicza 13/2006 Zenon Grześ, Ireneusz Kowalik Instytut Inżynierii Rolniczej Akademia Rolnicza w Poznaniu KOSZTY UŻYTKOWANIA MASZYN W STRUKTURZE KOSZTÓW PRODUKCJI ROŚLINNEJ W WYBRANYM PRZEDSIĘBIORSTWIE

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

LOKALIZACJA GENÓW WPŁYWAJĄCYCH NA JAKOŚĆ JABŁEK NA MAPIE REFERENCYJNEJ GENOMU JABŁONI (Malus domestica Borkh.)

LOKALIZACJA GENÓW WPŁYWAJĄCYCH NA JAKOŚĆ JABŁEK NA MAPIE REFERENCYJNEJ GENOMU JABŁONI (Malus domestica Borkh.) ZESZYTY NAUKOWE INSTYTUTU SADOWNICTWA I KWIACIARSTWA TOM 16 2008 LOKALIZACJA GENÓW WPŁYWAJĄCYCH NA JAKOŚĆ JABŁEK NA MAPIE REFERENCYJNEJ GENOMU JABŁONI (Malus domestica Borkh.) Localization of genes affecting

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Chromosomowa lokalizacja markerów tolerancyjności na glin u żyta

Chromosomowa lokalizacja markerów tolerancyjności na glin u żyta NR 230 BIULETYN INSTYTUTU HODOWLI I AKLIMATYZACJI ROŚLIN 2003 IWONA WIŚNIEWSKA ANDRZEJ RAFALSKI Zakład Biochemii i Fizjologii Roślin Instytut Hodowli i Aklimatyzacji Roślin, Radzików Chromosomowa lokalizacja

Bardziej szczegółowo

WPŁYW NASTĘPCZY PREPARATÓW ASAHI SL I TYTANITU STOSOWANEGO W UPRAWIE ROSA MULTIFLORA THUNB. NA JAKOŚĆ OKULANTÓW RÓŻ ODMIANY FLAMINGO.

WPŁYW NASTĘPCZY PREPARATÓW ASAHI SL I TYTANITU STOSOWANEGO W UPRAWIE ROSA MULTIFLORA THUNB. NA JAKOŚĆ OKULANTÓW RÓŻ ODMIANY FLAMINGO. Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) JOLANTA ADAMIAK, JERZY HETMAN WPŁYW NASTĘPCZY PREPARATÓW ASAHI SL I TYTANITU STOSOWANEGO W UPRAWIE ROSA MULTIFLORA THUNB. NA JAKOŚĆ OKULANTÓW RÓŻ

Bardziej szczegółowo

Charakterystyka materiałów hodowlanych pszenicy ozimej pod względem odporności na rdzę brunatną (Puccinia triticina)

Charakterystyka materiałów hodowlanych pszenicy ozimej pod względem odporności na rdzę brunatną (Puccinia triticina) NR 268 BIULETYN INSTYTUTU HODOWLI I AKLIMATYZACJI ROŚLIN 2013 ANNA STRZEMBICKA GRZEGORZ CZAJOWSKI KATARZYNA KARSKA Zakład Roślin Zbożowych w Krakowie Instytut Hodowli i Aklimatyzacji Roślin PIB Charakterystyka

Bardziej szczegółowo

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu

Optymalizacja warunków reakcji PCR w gradiencie temperatury i magnezu Protokół pochodzi ze strony molekularnie.wordpress.com Kopiowanie i rozpowszechnianie wyłącznie w całości, z zachowaniem praw autorskich zgodnie z zasadami licencji GNU Dziękuję za uszanowanie mojej pracy,

Bardziej szczegółowo

Zmienność cech ilościowych w populacjach linii DH i SSD jęczmienia

Zmienność cech ilościowych w populacjach linii DH i SSD jęczmienia NR 226/227/1 BIULETYN INSTYTUTU HODOWLI I AKLIMATYZACJI ROŚLIN 2003 MARIA SURMA 1 TADEUSZ ADAMSKI 1 ZYGMUNT KACZMAREK 1 STANISŁAW CZAJKA 2 1 Instytut Genetyki Roślin Polskiej Akademii Nauk, Poznań 2 Katedra

Bardziej szczegółowo

RT31-020, RT , MgCl 2. , random heksamerów X 6

RT31-020, RT , MgCl 2. , random heksamerów X 6 RT31-020, RT31-100 RT31-020, RT31-100 Zestaw TRANSCRIPTME RNA zawiera wszystkie niezbędne składniki do przeprowadzenia syntezy pierwszej nici cdna na matrycy mrna lub całkowitego RNA. Uzyskany jednoniciowy

Bardziej szczegółowo

WPROWADZENIE MATERIAŁ BADAWCZY I CEL BADAŃ

WPROWADZENIE MATERIAŁ BADAWCZY I CEL BADAŃ Sprawozdanie merytoryczne z wykonania zadania nr 2: Poszukiwanie markerów molekularnych i fenotypowych do identyfikacji genów odporności pszenicy na łamliwość źdźbła powodowaną przez Oculimacula yallundae

Bardziej szczegółowo

SPRAWOZDANIE O STANIE REALIZACJI ZADANIA z wykonania badań podstawowych na rzecz postępu biologicznego w produkcji roślinnej w 2013 roku

SPRAWOZDANIE O STANIE REALIZACJI ZADANIA z wykonania badań podstawowych na rzecz postępu biologicznego w produkcji roślinnej w 2013 roku SPRAWOZDANIE O STANIE REALIZACJI ZADANIA z wykonania badań podstawowych na rzecz postępu biologicznego w produkcji roślinnej w 2013 roku 1. Nr decyzji MRiRW: HOR hn 801-14/13 zadanie nr 22 2. Nazwa tematu:

Bardziej szczegółowo

Zastosowanie markerów DNA do badań odmian składników mieszańcowych rzepaku

Zastosowanie markerów DNA do badań odmian składników mieszańcowych rzepaku Tom XIX Rośliny Oleiste 1998 Katarzyna Mikołajczyk, Marcin Matuszczak, Teresa Piętka Iwona Bartkowiak-Broda, Jan Krzymański Instytut Hodowli i Aklimatyzacji Roślin, Zakład Roślin Oleistych w Poznaniu Zastosowanie

Bardziej szczegółowo

EVALUATION OF APPLE CULTIVARS FOR SUSTAINABLE FRUIT PRODUCTION

EVALUATION OF APPLE CULTIVARS FOR SUSTAINABLE FRUIT PRODUCTION PROTECTION OF GENETIC RESOURCES OF POMOLOGICAL PLANTS AND SELECTION OF GENITORS WITH TRAITS VALUABLE FOR SUSTAINABLE FRUIT PRODUCTION Journal of Fruit and Ornamental Plant Research vol. 12, 2004 Special

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

GROWTH AND YIELDING IN SIX SCAB-RESISTANT APPLE CULTIVARS GRAFTED ON THREE DWARFING ROOTSTOCKS IN INTEGRATED FRUIT PRODUCTION

GROWTH AND YIELDING IN SIX SCAB-RESISTANT APPLE CULTIVARS GRAFTED ON THREE DWARFING ROOTSTOCKS IN INTEGRATED FRUIT PRODUCTION Journal of Fruit and Ornamental Plant Research Vol. 13, 2005: 19-23 GROWTH AND YIELDING IN SIX SCAB-RESISTANT APPLE CULTIVARS GRAFTED ON THREE DWARFING ROOTSTOCKS IN INTEGRATED FRUIT PRODUCTION A l o j

Bardziej szczegółowo

Marta Jańczak-Pieniążek

Marta Jańczak-Pieniążek Projekt Bioróżnorodność Opolszczyzny skarbem dziedzictwa przyrodniczego (nr decyzji RPOP.05.01.00-16-0001/15-00) współfinansowany jest ze środków Europejskiego Funduszu Rozwoju Regionalnego w ramach Regionalnego

Bardziej szczegółowo

Brunatna nekroza nerwów liści (wirus Y ziemniaka (PVY)

Brunatna nekroza nerwów liści (wirus Y ziemniaka (PVY) Brunatna nekroza nerwów liści (wirus Y ziemniaka (PVY) Dawniej najgroźniejsza i najbardziej masowo występująca choroba tytoniu w Polsce. Mniej więcej w połowie ubiegłego wieku wirus Y ziemniaka wywołał,

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

Źródła odporności na rdzę żółtą, rdzę brunatną i rdzę źdźbłową w polskich materiałach hodowlanych pszenicy

Źródła odporności na rdzę żółtą, rdzę brunatną i rdzę źdźbłową w polskich materiałach hodowlanych pszenicy NR 218/219 BULETYN NSTYTUTU HODOWL AKLMATYZACJ ROŚLN 2001 CZESŁAW ZAMORSK BOGDAN NOWCK WOJCECH WAKULŃSK MAŁGORZATA SCHOLLENBERGER Katedra Fitopatologii Szkoła Główna Gospodarstwa Wiejskiego, Warszawa Źródła

Bardziej szczegółowo

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa

KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa KARTA KURSU (realizowanego w module specjalności) Biologia eksperymentalna i środowiskowa Nazwa Nazwa w j. ang. Wybrane problemy biologii molekularnej kwasy nukleinowe Selected problems of molecular biology

Bardziej szczegółowo

WZROST I ROZWÓJ FREZJI UPRAWIANEJ W GRUNCIE W ZALEŻNOŚCI OD TERMINU SADZENIA. Wstęp

WZROST I ROZWÓJ FREZJI UPRAWIANEJ W GRUNCIE W ZALEŻNOŚCI OD TERMINU SADZENIA. Wstęp Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) PIOTR SALACHNA, MONIKA PLACEK WZROST I ROZWÓJ FREZJI UPRAWIANEJ W GRUNCIE W ZALEŻNOŚCI OD TERMINU SADZENIA Z Katedry Roślin Ozdobnych Akademii Rolniczej

Bardziej szczegółowo

Ampli-LAMP Salmonella species

Ampli-LAMP Salmonella species Novazym Products Novazym Polska ul. Żywokostowa 23, 61-680 Poznań, tel. +48 0 61 610 39 10, fax +48 0 61 610 39 11, email info@novazym.com Zestaw do identyfikacji materiału genetycznego bakterii z rodzaju

Bardziej szczegółowo

AmpliTest Salmonella spp. (Real Time PCR)

AmpliTest Salmonella spp. (Real Time PCR) AmpliTest Salmonella spp. (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzaju Salmonella techniką Real Time PCR Nr kat.: BAC01-50 Wielkość zestawu: 50 oznaczeń Objętość

Bardziej szczegółowo

Badanie polimorfizmu rzepakochwastów za pomocą markerów RAPD *

Badanie polimorfizmu rzepakochwastów za pomocą markerów RAPD * Tom XXV ROŚLINY OLEISTE 2004 Łukasz Aleksandrzak, Zbigniew Broda Akademia Rolnicza im. Augusta Cieszkowskiego w Poznaniu, Katedra Genetyki i Hodowli Roślin Badanie polimorfizmu rzepakochwastów za pomocą

Bardziej szczegółowo

Rocz. Nauk. Zoot., T. 37, z. 2 (2010) 145 149. Identyfikacja sekwencji genu kodującego dehydrogenazę NADH 1 u sarny

Rocz. Nauk. Zoot., T. 37, z. 2 (2010) 145 149. Identyfikacja sekwencji genu kodującego dehydrogenazę NADH 1 u sarny Rocz. Nauk. Zoot., T. 37, z. 2 (2010) 145 149 Identyfikacja sekwencji genu kodującego dehydrogenazę NADH 1 u sarny M a ł g o r z a t a N a t o n e k - W i ś n i e w s k a, E w a S ł o t a Instytut Zootechniki

Bardziej szczegółowo

Scenariusz lekcji z biologii w szkole ponadgimnazjalnej

Scenariusz lekcji z biologii w szkole ponadgimnazjalnej Scenariusz lekcji z biologii w szkole ponadgimnazjalnej Temat lekcji: Planowanie doświadczeń biologicznych jak prawidłowo zaplanować próbę kontrolną? Cele kształcenia IV etap edukacyjny: 1. Wymagania ogólne:

Bardziej szczegółowo

Czy żywność GMO jest bezpieczna?

Czy żywność GMO jest bezpieczna? Instytut Żywności i Żywienia dr n. med. Lucjan Szponar Czy żywność GMO jest bezpieczna? Warszawa, 21 marca 2005 r. Od ponad połowy ubiegłego wieku, jedną z rozpoznanych tajemnic życia biologicznego wszystkich

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

AmpliTest Panel odkleszczowy (Real Time PCR)

AmpliTest Panel odkleszczowy (Real Time PCR) AmpliTest Panel odkleszczowy (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii Borrelia burgdorferi, Anaplasma, Ehrlichia oraz pierwotniaków rodzaju Babesia (B. canis, B. gibsoni,

Bardziej szczegółowo

INSTYTUT GENETYKI I HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK W JASTRZĘBCU. mgr inż. Ewa Metera-Zarzycka

INSTYTUT GENETYKI I HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK W JASTRZĘBCU. mgr inż. Ewa Metera-Zarzycka INSTYTUT GENETYKI I HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK W JASTRZĘBCU mgr inż. Ewa Metera-Zarzycka Profil metaboliczny osocza krwi i wartość biologiczna mleka krów w gospodarstwach ekologicznych Praca

Bardziej szczegółowo

AmpliTest Chlamydia/Chlamydophila (Real Time PCR)

AmpliTest Chlamydia/Chlamydophila (Real Time PCR) AmpliTest Chlamydia/Chlamydophila (Real Time PCR) Zestaw do wykrywania sekwencji DNA specyficznych dla bakterii z rodzajów Chlamydia i Chlamydophila techniką Real Time PCR Nr kat.: BAC18-50 BAC18-100 Wielkość

Bardziej szczegółowo

DIAGNOSTYKA POLSKICH SZCZEPÓW WIRUSA MOZAIKI PEPINO (PEPINO MOSAIC VIRUS)

DIAGNOSTYKA POLSKICH SZCZEPÓW WIRUSA MOZAIKI PEPINO (PEPINO MOSAIC VIRUS) Progress in Plant Protection / Postępy w Ochronie Roślin, 47 (2) 2007 DIAGNOSTYKA POLSKICH SZCZEPÓW WIRUSA MOZAIKI PEPINO (PEPINO MOSAIC VIRUS) HENRYK POSPIESZNY, BEATA HASIÓW, NATASZA BORODYNKO Instytut

Bardziej szczegółowo

Poradnik: Optymalizacja reakcji PCR algorytm postępowania

Poradnik: Optymalizacja reakcji PCR algorytm postępowania Poradnik: Optymalizacja reakcji PCR algorytm postępowania Jak przeprowadzić optymalizację reakcji PCR? Co zmienić w metodyce, by pozbyć się produktów niespecyficznych? Jak poprawić plon reakcji? Od czego

Bardziej szczegółowo

Analiza podobieństwa genetycznego odmian orkiszu (Triticum aestivum ssp. spelta L.) za pomocą markerów RAPD

Analiza podobieństwa genetycznego odmian orkiszu (Triticum aestivum ssp. spelta L.) za pomocą markerów RAPD NR 252 BIULETYN INSTYTUTU HODOWLI I AKLIMATYZACJI ROŚLIN 2009 SYLWIA OKOŃ 1 EDYTA PACZOS-GRZĘDA 1 PIOTR KRASKA 2 EWA KWIECIŃSKA-POPPE 2 EDWARD PAŁYS 2 1 Instytut Genetyki, Hodowli I Biotechnologii Roślin,

Bardziej szczegółowo

TEMPO SZERZENIA SIĘ ALTERNARIOZY (ALTERNARIA SPP.) NA PLANTACJI ZIEMNIAKA W EKOLOGICZNYM I INTEGROWANYM SYSTEMIE UPRAWY

TEMPO SZERZENIA SIĘ ALTERNARIOZY (ALTERNARIA SPP.) NA PLANTACJI ZIEMNIAKA W EKOLOGICZNYM I INTEGROWANYM SYSTEMIE UPRAWY Progress in Plant Protection/Postępy w Ochronie Roślin 51 (3) 2011 TEMPO SZERZENIA SIĘ ALTERNARIOZY (ALTERNARIA SPP.) NA PLANTACJI ZIEMNIAKA W EKOLOGICZNYM I INTEGROWANYM SYSTEMIE UPRAWY BARBARA SAWICKA

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

ANALIZA ZALEŻNOŚCI POMIĘDZY CECHAMI DIELEKTRYCZNYMI A WŁAŚCIWOŚCIAMI CHEMICZNYMI MĄKI

ANALIZA ZALEŻNOŚCI POMIĘDZY CECHAMI DIELEKTRYCZNYMI A WŁAŚCIWOŚCIAMI CHEMICZNYMI MĄKI Inżynieria Rolnicza 5(103)/2008 ANALIZA ZALEŻNOŚCI POMIĘDZY CECHAMI DIELEKTRYCZNYMI A WŁAŚCIWOŚCIAMI CHEMICZNYMI MĄKI Deta Łuczycka, Leszek Romański Instytut Inżynierii Rolniczej, Uniwersytet Przyrodniczy

Bardziej szczegółowo

OCENA PLONOWANIA ODMIAN BURAKA LIŚCIOWEGO W UPRAWIE JESIENNEJ. Wstęp. Materiał i metody

OCENA PLONOWANIA ODMIAN BURAKA LIŚCIOWEGO W UPRAWIE JESIENNEJ. Wstęp. Materiał i metody Roczniki Akademii Rolniczej w Poznaniu CCCLXXXIII (2007) KAMILA CZERNIAK, EUGENIUSZ KOŁOTA OCENA PLONOWANIA ODMIAN BURAKA LIŚCIOWEGO W UPRAWIE JESIENNEJ Z Katedry Ogrodnictwa Uniwersytetu Przyrodniczego

Bardziej szczegółowo

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 ALEKSANDRA ŚWIERCZ Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 Ekspresja genów http://genome.wellcome.ac.uk/doc_wtd020757.html A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH

Bardziej szczegółowo

mikrosatelitarne, minisatelitarne i polimorfizm liczby kopii

mikrosatelitarne, minisatelitarne i polimorfizm liczby kopii Zawartość 139371 1. Wstęp zarys historii genetyki, czyli od genetyki klasycznej do genomiki 2. Chromosomy i podziały jądra komórkowego 2.1. Budowa chromosomu 2.2. Barwienie prążkowe chromosomów 2.3. Mitoza

Bardziej szczegółowo