Bioinformatyka. (wykład monograficzny) wykład 5. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM

Save this PDF as:

Wielkość: px
Rozpocząć pokaz od strony:

Download "Bioinformatyka. (wykład monograficzny) wykład 5. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM"


1 Bioinformatyka (wykład monograficzny) wykład 5. E. Banachowicz Zakład Biofizyki Molekularnej IF UM lgorytmy macierze punktowe (DotPlot) programowanie dynamiczne metody heurystyczne (BLS, FS) metody statystyczne (modele Markova, statystyka Bayesa) Rodzaje dopasowań pokrycie sekwencji globalne, lokalne liczba sekwencji porównywanych para (pairwise sequence alignment) więcej niż dwie (multiple sequences alignment) Wykład 5,

2 Pokrycie sekwencji dopasowanie globalne dopasowanie wzdłuż całej sekwencji (zastosowanie: do białek składających się z pojedynczej domeny lub homologicznych słabo zróżnicowanych) dopasowanie lokalne uwzględnia domenową naturę białek, szuka subsekwencji (zastosowanie: do białek wielodomenowych, mrn z sekwencją genomową) DotPlot- Dotter Dotter: wykrywają fragmenty powtarzalne i rearanżacje opierają się na ocenie wizualnej czasami skuteczniejszej niż alignment idealny do szukania lokalnego podobieństwa Przykład: czynnik krzepnięcia XII (F12) aktywator tkankowo specyficznego plazminogenu (PL) (Bioinformatyka. Podręcznik do analizy genów i białek..d. Baxevanis, B.F.F. Quellette, PWN, 2005 ) Wykład 5,

3 Dotter - sekwencje Dotter - sekwencje Wykład 5,

4 Dotter SMR ( >gi gb H PL protein [Homo sapiens] >gi gb coagulation factor XII FN1 fibrynonektyna typ I, powtarzalna jednostka FN2 fibrynonektyna typ II, powtarzalna jednostka EF moduł nabłonkowego czynnika wzrostu KR domena typu kringle ryp SPc domena katalityczna zapewniająca aktywność proteinazy serynowej Wykład 5,

5 czynnik krzepnięcia krwi aktywator tkankowo specyficznego plazminogenu czynnik krzepnięcia krwi aktywator tkankowo specyficznego plazminogenu Wykład 5,

6 czynnik krzepnięcia krwi aktywator tkankowo specyficznego plazminogenu Dotter niektóre układy punktów tworząścieżkę każda ścieżka odpowiada jednemu dopasowaniu M Y S E Q U E N E H I S S E Q E N E H I S S E Q E N E M Y S E Q U E N E M Y S E Q U E N E H I S S E Q E N E znaleźć najlepszą ścieżkę! Wykład 5,

7 Najlepsza ścieżka Madryt Poznań optymalna? najszybsza? najkrótsza? Najlepsza ścieżka? Wykład 5,

8 lgorytm Needlemana-Wunscha strategia najlepszej ścieżki programowanie dynamiczne przeszukiwanie dotyczy pełnego zakresu sekwencji (obszaru dopasowania)- dopasowanie globalne każda podścieżka stanowić może fragment optymalnej ścieżki. Ścieżki szuka się poszerzając zakres podscieżek. Needlemann, Wunch (1970) J.Mol.Biol. 48, Sekwencja Sekwencja Sekwencja Sekwencja B Sekwencja B Sekwencja B Wykład 5,

9 lgorytm Smitha-Watermana dopasowanie lokalne ścieżka dopasowania nie musi osiągać krawędzi analizowanej sekwencji ścieżka jest lokalnie optymalna jeśli jej wydłużanie/skracanie nie poprawia obliczonej dla niej wartości system wartościowania dopasowania zaniża wartości w regionach słabego dopasowania = przerwanie ścieżki mogą istniećścieżki złożone z kilku połączonych ścieżek Smith, Waterman (1981) J.Mol.Biol. 147, Szukanie wielu dopasowań -subdopasowania Metoda optymalna daje zawsze najlepsze dopasowanie nawet jeśli nie ma ono znaczenia biologicznego znaczących, niezachodzących na siebie dopasowń lokalnych można naleźć kilka subdopasownia rzeba szukać więcej niż jednego dopasowania! (lalign, SIM) Przykład: zynnik krzepnięcia IX (F9, SWISS-PRO P00740) zynnik krzepnięcia XII (F12, SWISS-PRO P00748) Wykład 5,


11 oraz dopasowania 2 i 3: SIM P00740 P00748 Wykład 5,

12 Wartości substytucji i kary za przerwy schemat wartościowania I: (match) dopasowany: +1 (mismatch) niedopasowany: -1 (gap) przerwa: -1 (nie-afiniczne kary za przerwy każda przerwa traktowana jest tak samo) schemat wartościowania II: dopasowany: +1 niedopasowany: -1 otwarcie przerwy: przedłużenie przerwy: L (afiniczne kary za przerwy kara za otwarcie, kary za przedłużenie ) Punktacja obszar dopasowania - dopasowanie przerwa niedopasowanie S punktacja za dopasowanie Score = Max(S) S = Σ(dopasowania) - Σ(niedopasowania) - Σ(przerwy) Wykład 5,

13 Punktowanie przerw non-affine model (nieafinicznie): równo (match:4, mismatch:-3, gap:-4) affine model (afinicznie): + L n (match:4, mismatch:-3, gap creation:-8, gap:-4) : : : : Programowanie dynamiczne najlepsza ścieżka schemat wartościowania I: (match) dopasowany: +1 (mismatch) niedopasowany: -1 (gap) przerwa: -1 (nie-afiniczne kary za przerwy każda przerwa traktowana jest tak samo) Wykład 5,

14 Programowanie dynamiczne zasady: dopasowane z = -1 dopasowane z = +1 NULL dopasowane z = -1 dopasowane z NULL = -1 Programowanie dynamiczne Wykład 5,

15 Programowanie dynamiczne stopniowe poszerzanie ścieżek Programowanie dynamiczne stopniowe poszerzanie ścieżek Wykład 5,

16 Programowanie dynamiczne stopniowe poszerzanie ścieżek Programowanie dynamiczne stopniowe poszerzanie ścieżek Wykład 5,

17 Programowanie dynamiczne stopniowe poszerzanie ścieżek wszystkie punkty musza zostać zbadane Programowanie dynamiczne stopniowe poszerzanie ścieżek Wykład 5,

18 Programowanie dynamiczne stopniowe poszerzanie ścieżek - Programowanie dynamiczne stopniowe poszerzanie ścieżek - Wykład 5,

19 Wartości substytucji i kary za przerwy Schemat punktacji bardziej złożony: macierze substytucji PM: macierze oparte na modelu ewolucyjnym akceptowanych mutacji punktowych (1 jednostka PM- stopień zróznicowania ewolucyjnego, w którym zmienił się 1% aminokwasów) częstość zmian przypadkowych częstość tła częstość substytucji częstość docelowa zmiany pojawiające się w białkach spokrewnionych Macierz PM250 wartości w macierzy są proporcjonalne do logarytmu z (cz. docelowej/cz.tła) zbudowana na podstawie analizy par blisko spokrewnionych (1PM) i ekstrapolowana do 250PM ekstrapolacje można przeprowadzić dla różnych odległości ewolucyjnych PM duże PM stosuje się do porównywania sekwencji o dużym stopniu dywergencji ewolucyjnej małe PM do badania sekwencji podobnych Wykład 5,

20 Macierze BLOSUM Powstały w oparciu o bazę BLOKS dopasowanie sekwencji daleko spokrewnionych (oszacowanie częstotliwości docelowych, bez modelu ewolucyjnego) Rodzina macierzy: różnice (indeksu) związane są z maksymalnym stopniem identyczności sekwencji wziętych do obliczeń () BLOSUM62 BLOSUM90 do analizy sekwencji blisko spokrewnionych BOLSUM30 do analizy odległych ewolucyjnie sekwencji Wykład 5,

21 Statystyczne znaczenie dopasowań jaka jest wartość/ istotność dopasowania? Dla dopasowań globalnych: porównanie obliczonej wartości dla danego dopasowania z wartościami obliczonymi dla wielu dopasowań przypadkowych sekwencji o podobnym składzie i długości Dla dopasowań lokalnych: podstawą jest rozkład wartości granicznej, scharakteryzowanej paramerami K i λ E (S) = K m n exp -λs Expected value, wartość oczekiwana sekwencji mających wartość sonajmniej S S bit score, punktacja podobieństwa m range of alignment, długość porównywanego segmentu n wielkość bazy λ - określa wpływ systemu punktowania K liczba powtarzających się segmentów w przeszukiwanej sekwencji Wykład 5,

22 Następny wykład BLS, FS porównanie wielosekwencyjne w poszukiwanie wspólnego przodka KONIE Wykład 5,

Bioinformatyka. Porównywanie sekwencji

Bioinformatyka. Porównywanie sekwencji Bioinformatyka Wykład 5 E. Banachowicz Zakład Biofizyki Molekularnej IF UM 1 Porównywanie sekwencji Pierwsze pytanie biologa molekularnego, kiedy odkryje nową sekwencję: zy

Bardziej szczegółowo

Dopasowanie sekwencji Sequence alignment. Bioinformatyka, wykłady 3 i 4 (19, 26.X.2010)

Dopasowanie sekwencji Sequence alignment. Bioinformatyka, wykłady 3 i 4 (19, 26.X.2010) Dopasowanie sekwencji Sequence alignment Bioinformatyka, wykłady 3 i 4 (19, 26.X.2010) terminologia alignment 33000 dopasowanie sekwencji 119 uliniowienie sekwencji 82 uliniowianie

Bardziej szczegółowo

Porównywanie sekwencji białkowych

Porównywanie sekwencji białkowych Bioinformatyka -9 Bioinformatyka Wykład 4. E. Banachowicz Zakład Biofizyki Molekularnej Porównywanie sekwencji białkowych Wykład 4, Bioinformatyka -9 Porównywanie sekwencji

Bardziej szczegółowo

Bioinformatyka. Podsumowanie algorytmów dynamicznych

Bioinformatyka. Podsumowanie algorytmów dynamicznych Bioinformatyka Wykład 5 E. Banachowicz Zakład Biofizyki Molekularnej IF UAM Podsumowanie algorytmów dynamicznych Algorytmy porównywania sekwencji oparte na programowaniu dynamicznym

Bardziej szczegółowo

Przyrównanie sekwencji. Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu

Przyrównanie sekwencji. Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Przyrównanie sekwencji Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Sequence alignment - przyrównanie sekwencji Poszukiwanie ciągów znaków (zasad nukleotydowych lub reszt aminokwasowych),

Bardziej szczegółowo


PODSTAWY BIOINFORMATYKI WYKŁAD 4 DOPASOWANIE SEKWENCJI PODSTAWY BIOINFORMATYKI WYKŁAD 4 DOPASOWANIE SEKWENCJI DOPASOWANIE SEKWENCJI 1. Dopasowanie sekwencji - definicja 2. Wizualizacja dopasowania sekwencji 3. Miary podobieństwa sekwencji 4. Przykłady programów

Bardziej szczegółowo

Spis treści 8 Ewolucja molekularna... 87. 9 Ewolucyjne podstawy porównywania sekwencji... 87. 9.1 Identyfikacja sekwencji i jej funkcji...

Spis treści 8 Ewolucja molekularna... 87. 9 Ewolucyjne podstawy porównywania sekwencji... 87. 9.1 Identyfikacja sekwencji i jej funkcji... Spis treści 8 Ewolucja molekularna... 87 9 Ewolucyjne podstawy porównywania sekwencji... 87 9.1 Identyfikacja sekwencji i jej funkcji... 87 9.2 Homologia... 88 9.3 Modele ewolucji sekwencji białkowej...

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

Wykład 10 2008-04-30. Bioinformatyka. Wykład 9. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM

Wykład 10 2008-04-30. Bioinformatyka. Wykład 9. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM Bioinformatyka Wykład 9 E. Banachowicz Zakład Biofizyki Molekularnej IF UAM 1 Konsekwencje zestawieo wielu sekwencji - rodziny białkowe, domeny, motywy i wzorce 2 Bioinformatyka,

Bardziej szczegółowo

Dopasowywanie sekwencji (ang. sequence alignment) Metody dopasowywania sekwencji. Homologia a podobieństwo sekwencji. Rodzaje dopasowania

Dopasowywanie sekwencji (ang. sequence alignment) Metody dopasowywania sekwencji. Homologia a podobieństwo sekwencji. Rodzaje dopasowania Wprowadzenie do Informatyki Biomedycznej Wykład 2: Metody dopasowywania sekwencji Wydział Informatyki PB Dopasowywanie sekwencji (ang. sequence alignment) Dopasowywanie (przyrównywanie) sekwencji polega

Bardziej szczegółowo

Przyrównywanie sekwencji

Przyrównywanie sekwencji Instytut Informatyki i Matematyki Komputerowej UJ, opracowanie: mgr Ewa Matczyńska, dr Jacek Śmietański Przyrównywanie sekwencji 1. Porównywanie sekwencji wprowadzenie Sekwencje porównujemy po to, aby

Bardziej szczegółowo

Porównywanie i dopasowywanie sekwencji

Porównywanie i dopasowywanie sekwencji Porównywanie i dopasowywanie sekwencji Związek bioinformatyki z ewolucją Wraz ze wzrostem dostępności sekwencji DNA i białek narodziła się nowa dyscyplina nauki ewolucja molekularna Ewolucja molekularna

Bardziej szczegółowo



Bardziej szczegółowo

Dopasowanie par sekwencji

Dopasowanie par sekwencji BIOINFORMTYK edycja 2016 / 2017 wykład 3 Dopasowanie par sekwencji dr Jacek Śmietański Plan wykładu 1. Idea i cele dopasowania sekwencji 2. Definicje

Bardziej szczegółowo

dopasowanie sekwencji Porównywanie sekwencji Etapy dopasowywania sekwencji Homologia, podobieństwo i analogia

dopasowanie sekwencji Porównywanie sekwencji Etapy dopasowywania sekwencji Homologia, podobieństwo i analogia Porównywanie sekwencji Homologia, podobieństwo i analogia dopasowanie sekwencji Dopasowanie/porównywanie Uliniowienie Alignment W bioinformatyce, dopasowanie sekwencji jest sposobem dopasowania struktur

Bardziej szczegółowo

Generator testów 1.3.1 Bioinformatyka_zdalne wer. 1.0.13 / 0 Strona: 1

Generator testów 1.3.1 Bioinformatyka_zdalne wer. 1.0.13 / 0 Strona: 1 Przedmiot: Bioinformatyka Nazwa testu: Bioinformatyka_zdalne wer. 1.0.13 Nr testu 0 Klasa: WNB UZ Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Model Markowa substytucji aminokwasów w mutagenezie białek zakłada...

Bardziej szczegółowo

Motywy i podobieństwo

Motywy i podobieństwo Motywy i podobieństwo Całość funkcja Modularna budowa białek Elementy składowe czyli miejsca wiązania, domeny 1 Motywy Motyw jest opisem określonej części trójwymiarowej struktury zawierającym charakterystyczny

Bardziej szczegółowo

Bioinformatyka 2 (BT172) Progresywne metody wyznaczania MSA: T-coffee

Bioinformatyka 2 (BT172) Progresywne metody wyznaczania MSA: T-coffee Bioinformatyka 2 (BT172) Wykład 5 Progresywne metody wyznaczania MSA: T-coffee Krzysztof Murzyn 14.XI.2005 PLAN WYKŁADU Ostatnio : definicje, zastosowania MSA, złożoność obliczeniowa algorytmu wyznaczania

Bardziej szczegółowo

Generator testów Bioinformatyka wer / 0 Strona: 1

Generator testów Bioinformatyka wer / 0 Strona: 1 Przedmiot: Nazwa przedmiotu Nazwa testu: Bioinformatyka wer. 1.0.6 Nr testu 0 Klasa: V zaoczne WNB UZ Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Analiza porównawcza białek zwykle zaczyna się na badaniach

Bardziej szczegółowo

Dopasowanie sekwencji c.d. Sequence alignment. Bioinformatyka, wykład 5 (16.XI.2010)

Dopasowanie sekwencji c.d. Sequence alignment. Bioinformatyka, wykład 5 (16.XI.2010) Dopasowanie sekwencji c.d. Sequence alignment Bioinformatyka, wykład 5 (16.XI.2010) dopasowanie - metody dopasowanie par sekwencji: Macierz punktów - dot matrix, dotplot Programowanie

Bardziej szczegółowo

Dopasowanie sekwencji c.d. Sequence alignment. Bioinformatyka, wykład 5 (6.XI.2012)

Dopasowanie sekwencji c.d. Sequence alignment. Bioinformatyka, wykład 5 (6.XI.2012) Dopasowanie sekwencji c.d. Sequence alignment Bioinformatyka, wykład 5 (6.XI.2012) Dopasowanie sekwencji - znaczenie Podobieństwo porównywanych sekwencji (similarity) może świadczyć

Bardziej szczegółowo

Genomika Porównawcza. Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski

Genomika Porównawcza. Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski Genomika Porównawcza Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski 1 Plan prezentacji 1. Rodzaje i budowa drzew filogenetycznych 2. Metody ukorzeniania drzewa

Bardziej szczegółowo

Algorytmy kombinatoryczne w bioinformatyce

Algorytmy kombinatoryczne w bioinformatyce lgorytmy kombinatoryczne w bioinformatyce wykład 4: dopasowanie sekwencj poszukiwanie motywów prof. dr hab. inż. Marta Kasprzak Instytut Informatyk Politechnika Poznańska Dopasowanie sekwencji Badanie

Bardziej szczegółowo

Wykład Bioinformatyka 2012-09-24. Bioinformatyka. Wykład 7. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM. Ewolucyjne podstawy Bioinformatyki

Wykład Bioinformatyka 2012-09-24. Bioinformatyka. Wykład 7. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM. Ewolucyjne podstawy Bioinformatyki Bioinformatyka Wykład 7 E. Banachowicz Zakład Biofizyki Molekularnej IF UAM 1 Plan Bioinformatyka Ewolucyjne podstawy Bioinformatyki Filogenetyka Bioinformatyczne narzędzia

Bardziej szczegółowo

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański BIOINFORMATYKA edycja 2016 / 2017 wykład 11 RNA dr Jacek Śmietański Plan wykładu 1. Rola i rodzaje RNA 2. Oddziaływania wewnątrzcząsteczkowe i struktury

Bardziej szczegółowo

MultiSETTER: web server for multiple RNA structure comparison. Sandra Sobierajska Uniwersytet Jagielloński

MultiSETTER: web server for multiple RNA structure comparison. Sandra Sobierajska Uniwersytet Jagielloński MultiSETTER: web server for multiple RNA structure comparison Sandra Sobierajska Uniwersytet Jagielloński Wprowadzenie Budowa RNA: - struktura pierwszorzędowa sekwencja nukleotydów w łańcuchu: A, U, G,

Bardziej szczegółowo

Statystyczna analiza danych

Statystyczna analiza danych Statystyczna analiza danych ukryte modele Markowa, zastosowania Anna Gambin Instytut Informatyki Uniwersytet Warszawski plan na dziś Ukryte modele Markowa w praktyce modelowania rodzin białek multiuliniowienia

Bardziej szczegółowo

Bioinformatyka 2 (BT172) Struktura i organizacja kursu

Bioinformatyka 2 (BT172) Struktura i organizacja kursu Bioinformatyka 2 (BT172) Wykład 1 Struktura i organizacja kursu dr Krzysztof Murzyn adiunkt w Zakładzie Biofizyki WBtUJ pok. B028, tel. 664-6379 10.X.2005 PODSTAWOWE INFORMACJE 9 godz. wykładów (45 min,

Bardziej szczegółowo

Bioinformatyka wykład 3.I.2008

Bioinformatyka wykład 3.I.2008 Bioinformatyka wykład 3.I.2008 Białkowa bioinformatyka strukturalna c.d. 2008-01-03 1 Plan wykładu analiza i porównywanie struktur białek. doświadczalne metody badania struktur

Bardziej szczegółowo

Generator testów bioinformatyka wer / Strona: 1

Generator testów bioinformatyka wer / Strona: 1 Przedmiot: wyklad monograficzny Nazwa testu: bioinformatyka wer. 1.0.6 Nr testu 10469906 Klasa: 5 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Aminokwas jest to związek organiczny zawierający A) grupę

Bardziej szczegółowo

Księgarnia PWN: A.D. Baxevanis, B.F.F. Ouellette Bioinformatyka

Księgarnia PWN: A.D. Baxevanis, B.F.F. Ouellette Bioinformatyka Księgarnia PWN: A.D. Baxevanis, B.F.F. Ouellette Bioinformatyka Słowo wstępne XIII Przedmowa XV 1. Bioinformatyka i Internet Andreas D. Baxevanis 1 1.1. Podstawy Internetu 2 1.2. Połączenie z Internetem

Bardziej szczegółowo

W kierunku równoległej implementacji pakietu T-Coffee

W kierunku równoległej implementacji pakietu T-Coffee W kierunku równoległej implementacji pakietu T-Coffee Adrian Rospondek 1 1 Wydział Inżynierii Mechanicznej i Informatyki Kierunek Informatyka, Rok V Streszczenie Artykuł ten prezentuje

Bardziej szczegółowo

Bioinformatyka wykład 8, 27.XI.2012

Bioinformatyka wykład 8, 27.XI.2012 Bioinformatyka wykład 8, 27.XI.2012 białkowa bioinformatyka strukturalna c.d. 2013-01-21 1 Plan wykładu regiony nieuporządkowane sposoby przedstawienia struktur białkowych powierzchnia

Bardziej szczegółowo

Bioinformatyka Bioinformatyka. Wykład 6. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM

Bioinformatyka Bioinformatyka. Wykład 6. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM Bioinformatyka Wykład 6 E. Banachowicz Zakład Biofizyki Molekularnej IF UAM 1 Algorytmy macierze punktowe (DotPlot) programowanie dynamiczne metody heurystyczne (BLAST, FASTA)

Bardziej szczegółowo


BIOLOGICZNE BAZY DANYCH SYLABUS BIOLOGICZNE BAZY DANYCH SYLABUS Elementy składowe sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod Język Rodzaj Rok studiów /semestr

Bardziej szczegółowo

MSA i analizy filogenetyczne

MSA i analizy filogenetyczne Instytut Informatyki i Matematyki Komputerowej UJ, opracowanie: mgr Ewa Matczyńska, dr Jacek Śmietański MSA i analizy filogenetyczne 1. Dopasowania wielosekwencyjne - wprowadzenie Dopasowanie wielosekwencyjne

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta

Bioinformatyka Laboratorium, 30h. Michał Bereta Laboratorium, 30h Michał Bereta Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecność Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna

Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna Przedmowa...................................................... 1 1. Rewolucja informatyczna w naukach biomedycznych...........................

Bardziej szczegółowo

Metody przeszukiwania

Metody przeszukiwania Metody przeszukiwania Co to jest przeszukiwanie Przeszukiwanie polega na odnajdywaniu rozwiązania w dyskretnej przestrzeni rozwiązao. Zwykle przeszukiwanie polega na znalezieniu określonego rozwiązania

Bardziej szczegółowo

Bioinformatyka wykład 11, 11.I.2011 Białkowa bioinformatyka strukturalna c.d.

Bioinformatyka wykład 11, 11.I.2011 Białkowa bioinformatyka strukturalna c.d. Bioinformatyka wykład 11, 11.I.2011 Białkowa bioinformatyka strukturalna c.d. 11.01.11 1 Dopasowanie strukturalne (alignment) odległość: d ij = (x i -x J ) 2 + (y i -y J ) 2

Bardziej szczegółowo

2014-03-26. Analiza sekwencji promotorów

2014-03-26. Analiza sekwencji promotorów 2014-03-26 Analiza sekwencji promotorów 1 2014-03-26 TFy tworzą zawiły układ regulacyjny, na który składają się różne oddziaływania białko białko poprzez wytworzenie PĘTLI Specyficzne TFy Ogólne TFy Benfey,

Bardziej szczegółowo

Wstęp do programowania

Wstęp do programowania Wstęp do programowania Algorytmy zachłanne, programowanie dynamiczne Paweł Daniluk Wydział Fizyki Jesień 2014 P. Daniluk(Wydział Fizyki) WP w. IX Jesień 2014 1 / 26 Algorytmy zachłanne Strategia polegająca

Bardziej szczegółowo

Na czym skończyliśmy BLACK BOX. Sekwencjonowanie polega na odczytaniu sekwencji liter DNA/RNA badanego fragmentu genomu

Na czym skończyliśmy BLACK BOX. Sekwencjonowanie polega na odczytaniu sekwencji liter DNA/RNA badanego fragmentu genomu ALEKSANDRA ŚWIERCZ Na czym skończyliśmy BLACK BOX AAATGCCTGCCCTGAAGGCCTGCGTA GTTTTGGGAGAAGACCCACGGATA AAGGTGTAGCCCCGTAGC GGGGGGTATTATTTATTTTATACCCAC.. ACAGGAUCGUUGGAUGGTGGGA. Sekwencjonowanie polega na

Bardziej szczegółowo



Bardziej szczegółowo

Podstawy bioinformatyki dla biotechnologów

Podstawy bioinformatyki dla biotechnologów dla biotechnologów Wykład 3 alignment Wykład 2 Porównywanie sekwencji Homologia, podobieństwo i analogia Wykład 2; slajd 2 Duplikacja, specjacja Wykład 2; slajd 3 Homologi Ortologi homologiczne geny, których

Bardziej szczegółowo

Acknowledgement. Drzewa filogenetyczne

Acknowledgement. Drzewa filogenetyczne Wykład 8 Drzewa Filogenetyczne Lokalizacja genów Some figures from: Acknowledgement M. Zvelebil, J.O. Baum, Introduction to Bioinformatics, Garland Science 2008 Tradycyjne drzewa pokrewieństwa Drzewa oparte

Bardziej szczegółowo

Porównywanie sekwencji białek i kwasów nukleinowych

Porównywanie sekwencji białek i kwasów nukleinowych Porównywanie sekwencji białek i kwasów nukleinowych Krzysztof Lewiński 1. Podobieństwo i jego miara Wprawdzie podobieństwo jest pojęciem często używanym w życiu codziennym ale nie oznacza to, że możemy

Bardziej szczegółowo

Bioinformatyka. Rodzaje Mutacji

Bioinformatyka. Rodzaje Mutacji Bioinformatyka (wykład monograficzny) wykład 3. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM Rodzaje Mutacji zmienność sekwencji (sequence variation) mutacje polimorfizm

Bardziej szczegółowo

Heurystyki. Strategie poszukiwań

Heurystyki. Strategie poszukiwań Sztuczna inteligencja Heurystyki. Strategie poszukiwań Jacek Bartman Zakład Elektrotechniki i Informatyki Instytut Techniki Uniwersytet Rzeszowski DLACZEGO METODY PRZESZUKIWANIA? Sztuczna Inteligencja

Bardziej szczegółowo

Bioinformatyka II Modelowanie struktury białek

Bioinformatyka II Modelowanie struktury białek Bioinformatyka II Modelowanie struktury białek 1. Który spośród wymienionych szablonów wybierzesz do modelowania? Dlaczego? Struktura krystaliczną czy NMR (to samo białko, ta sama rozdzielczość)? Strukturę

Bardziej szczegółowo

Bioinformatyka. Bazy danych. Wykład 3. E. Banachowicz. Wykład monograficzny Bioinformatyka. Wykład 3, Zakład Biofizyki Molekularnej IF UAM

Bioinformatyka. Bazy danych. Wykład 3. E. Banachowicz. Wykład monograficzny Bioinformatyka. Wykład 3, Zakład Biofizyki Molekularnej IF UAM Bioinformatyka Wykład 3. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM Bazy danych Wykład 3, 2008 1 Niesekwencyjne BazyDanych bibliograficzne kliniczne ścieżek metabolicznych

Bardziej szczegółowo

FILOGENETYKA. Bioinformatyka, wykład. 8 c.d. 0)

FILOGENETYKA. Bioinformatyka, wykład. 8 c.d. 0) FILOGENETYKA Bioinformatyka, wykład 8 c.d. (7.XII.2010) 0) Filogenetyka Cel rekonstrukcja historii ewolucji wszystkich organizmów. Klasyczne podejście: historia ewolucji jest

Bardziej szczegółowo


PODSTAWY BIOINFORMATYKI PODSTAWY BIOINFORMATYKI Prowadzący: JOANNA SZYDA ADRIAN DROśDś WSTĘP 1. Katedra Genetyki badania bioinformatyczne 2. Tematyka przedmiotu 3. Charakterystyka wykładów 4. Charakterystyka ćwiczeń 5. Informacje

Bardziej szczegółowo

Wstęp do programowania

Wstęp do programowania Wstęp do programowania Programowanie dynamiczne Paweł Daniluk Wydział Fizyki Jesień 2013 P. Daniluk(Wydział Fizyki) WP w. X Jesień 2013 1 / 21 Dziel i zwyciężaj przypomnienie 1 Podział problemu na 2 lub

Bardziej szczegółowo

Wstęp do programowania

Wstęp do programowania Wstęp do programowania Algorytmy zachłanne, algoritme Dijkstry Paweł Daniluk Wydział Fizyki Jesień 2013 P. Daniluk(Wydział Fizyki) WP w. XI Jesień 2013 1 / 25 Algorytmy zachłanne Strategia polegająca na

Bardziej szczegółowo

Porównanie szeregów czasowych z wykorzystaniem algorytmu DTW

Porównanie szeregów czasowych z wykorzystaniem algorytmu DTW Zlot użytkowników R Porównanie szeregów czasowych z wykorzystaniem algorytmu DTW Paweł Teisseyre Instytut Podstaw Informatyki, Polska Akademia Nauk 21 września 2010 Miary podobieństwa między szeregami

Bardziej szczegółowo

Wybrane podstawowe rodzaje algorytmów

Wybrane podstawowe rodzaje algorytmów Wybrane podstawowe rodzaje algorytmów Tomasz Głowacki Zajęcia finansowane z projektu "Rozwój i doskonalenie kształcenia na Politechnice Poznańskiej w zakresie technologii informatycznych

Bardziej szczegółowo

RMSD - Ocena jakości wybranych molekularnych struktur przestrzennych

RMSD - Ocena jakości wybranych molekularnych struktur przestrzennych RMSD - Ocena jakości wybranych molekularnych struktur przestrzennych Joanna Wiśniewska Promotor: dr inż. P. Łukasiak Spis treści 1. Zakres pracy magisterskiej 2. Struktura białka 3. Struktura kwasów nukleionowych

Bardziej szczegółowo

Podobieństwo semantyczne w ontologiach biomedycznych

Podobieństwo semantyczne w ontologiach biomedycznych Podobieństwo semantyczne w ontologiach biomedycznych Bogumił Konopka Politechnika Wrocławska Wydział Podstawowych Problemów Techniki Instytut Inżynierii Biomedycznej i Pomiarowej KN Bio Nanopor Plan prezentacji

Bardziej szczegółowo

Techniki optymalizacji

Techniki optymalizacji Techniki optymalizacji Algorytm kolonii mrówek Idea Smuga feromonowa 1 Sztuczne mrówki w TSP Sztuczna mrówka agent, który porusza się z miasta do miasta Mrówki preferują miasta połączone łukami z dużą

Bardziej szczegółowo

Budowa kwasów nukleinowych

Budowa kwasów nukleinowych Bioinformatyka (wykład monograficzny) wykład 2. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM Budowa kwasów nukleinowych Kwasy nukleinowe (DA i RA) zbudowane są z nukleotydów

Bardziej szczegółowo


PODSTAWY BIOINFORMATYKI 6 BAZA DANYCH NCBI - II PODSTAWY BIOINFORMATYKI 6 BAZA DANYCH NCBI - II BAZA DANYCH NCBI 1. NCBI 2. Dane gromadzone przez NCBI 3. Przegląd baz danych NCBI: Publikacje naukowe Projekty analizy genomów OMIM: fenotypy człowieka

Bardziej szczegółowo

Sekwencjonowanie Nowej Generacji ang. Next Generation Sequencing

Sekwencjonowanie Nowej Generacji ang. Next Generation Sequencing Sekwencjonowanie Nowej Generacji ang. Next Generation Sequencing Wykład 7 Etapy analizy NGS Dr Wioleta Drobik-Czwarno Etapy analizy NGS Kontrola jakości surowych danych (format fastq) Jakość odczytów,

Bardziej szczegółowo

Działanie algorytmu oparte jest na minimalizacji funkcji celu jako suma funkcji kosztu ( ) oraz funkcji heurystycznej ( ).

Działanie algorytmu oparte jest na minimalizacji funkcji celu jako suma funkcji kosztu ( ) oraz funkcji heurystycznej ( ). Algorytm A* Opracowanie: Joanna Raczyńska 1.Wstęp Algorytm A* jest heurystycznym algorytmem służącym do znajdowania najkrótszej ścieżki w grafie. Jest to algorytm zupełny i optymalny, co oznacza, że zawsze

Bardziej szczegółowo

Ćwiczenia nr 5. Wykorzystanie baz danych i narzędzi analitycznych dostępnych online

Ćwiczenia nr 5. Wykorzystanie baz danych i narzędzi analitycznych dostępnych online Techniki molekularne ćw. 5 1 z 13 Ćwiczenia nr 5. Wykorzystanie baz danych i narzędzi analitycznych dostępnych online I. Zasoby NCBI Strona: stanowi punkt startowy dla eksploracji

Bardziej szczegółowo

Mitochondrialna Ewa;

Mitochondrialna Ewa; Mitochondrialna Ewa; jej sprzymierzeńcy i wrogowie Lien Dybczyńska Zakład genetyki, Uniwersytet Warszawski 01.05.2004 Milion lat temu Ale co dalej??? I wtedy wkracza biologia molekularna Analiza różnic

Bardziej szczegółowo

Spokrewnienie prawdopodobieństwo, że dwa losowe geny od dwóch osobników są genami IBD. IBD = identical by descent, geny identycznego pochodzenia

Spokrewnienie prawdopodobieństwo, że dwa losowe geny od dwóch osobników są genami IBD. IBD = identical by descent, geny identycznego pochodzenia prawdopodobieństwo, że dwa losowe geny od dwóch osobników są genami ID. Relationship Relatedness Kinship Fraternity ID = identical by descent, geny identycznego pochodzenia jest miarą względną. Przyjmuje

Bardziej szczegółowo

Bioinformatyka II Modelowanie struktury białek

Bioinformatyka II Modelowanie struktury białek Bioinformatyka II Modelowanie struktury białek 1. Który spośród wymienionych szablonów wybierzesz do modelowania dla każdego z podanych przypadków? Dlaczego? Struktura krystaliczną czy NMR (to samo białko,

Bardziej szczegółowo

Sztuczne sieci neuronowe. Krzysztof A. Cyran POLITECHNIKA ŚLĄSKA Instytut Informatyki, p. 311

Sztuczne sieci neuronowe. Krzysztof A. Cyran POLITECHNIKA ŚLĄSKA Instytut Informatyki, p. 311 Sztuczne sieci neuronowe Krzysztof A. Cyran POLITECHNIKA ŚLĄSKA Instytut Informatyki, p. 311 Wykład 7 PLAN: - Repetitio (brevis) -Algorytmy miękkiej selekcji: algorytmy ewolucyjne symulowane wyżarzanie

Bardziej szczegółowo

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność Wersja 1.05 Wprowadzenie do Informatyki Biomedycznej Wykład 3: Wyszukiwanie w bazach sekwencji Przewidywanie genów Wydział Informatyki PB Marek Krętowski pokój 206 e-mail:

Bardziej szczegółowo


PRZEWODNIK PO PRZEDMIOCIE Nazwa przedmiotu: Kierunek: Informatyka Rodzaj przedmiotu: przedmiot obowiązkowy w ramach treści kierunkowych, moduł kierunkowy ogólny Rodzaj zajęć: wykład, ćwiczenia I KARTA PRZEDMIOTU CEL PRZEDMIOTU

Bardziej szczegółowo

Heurystyczne metody przeszukiwania

Heurystyczne metody przeszukiwania Heurystyczne metody przeszukiwania Dariusz Banasiak Katedra Informatyki Technicznej W4/K9 Politechnika Wrocławska Pojęcie heurystyki Metody heurystyczne są jednym z ważniejszych narzędzi sztucznej inteligencji.

Bardziej szczegółowo

Bioinformatyka wykład 10.I.2008

Bioinformatyka wykład 10.I.2008 Bioinformatyka wykład 10.I.2008 Przewidywanie struktur białek 2008-01-10 1 Plan wykładu pole siłowe - opis energetyczny struktur białka proces zwijania się białek przewidywanie

Bardziej szczegółowo

Definicja pliku kratowego

Definicja pliku kratowego Pliki kratowe Definicja pliku kratowego Plik kratowy (ang grid file) jest strukturą wspierająca realizację zapytań wielowymiarowych Uporządkowanie rekordów, zawierających dane wielowymiarowe w pliku kratowym,

Bardziej szczegółowo

Przewodnik do planowania programu kształcenia na II roku studiów I stopnia. Kierunek: Bioinformatyka. 17 czerwca 2013 r.

Przewodnik do planowania programu kształcenia na II roku studiów I stopnia. Kierunek: Bioinformatyka. 17 czerwca 2013 r. Przewodnik do planowania programu kształcenia na II roku studiów I stopnia Kierunek: Bioinformatyka Przeznaczony dla studentów, którzy w roku 2012/13 studiują na I roku studiów I stopnia 17 czerwca 2013

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta

Bioinformatyka Laboratorium, 30h. Michał Bereta Laboratorium, 30h Michał Bereta Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecnośd Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Scenariusz lekcji z biologii w szkole ponadgimnazjalnej

Scenariusz lekcji z biologii w szkole ponadgimnazjalnej Scenariusz lekcji z biologii w szkole ponadgimnazjalnej Temat lekcji: Planowanie doświadczeń biologicznych jak prawidłowo zaplanować próbę kontrolną? Cele kształcenia IV etap edukacyjny: 1. Wymagania ogólne:

Bardziej szczegółowo

Bioinformatyka wykład 9

Bioinformatyka wykład 9 Bioinformatyka wykład 9 14.XII.21 białkowa bioinformatyka strukturalna 211-1-17 1 Plan wykładu struktury białek dlaczego? struktury białek geometria i fizyka modyfikacje kowalencyjne

Bardziej szczegółowo


SZTUCZNA INTELIGENCJA SZTUCZNA INTELIGENCJA WYKŁAD 13. PROBLEMY OPTYMALIZACYJNE Częstochowa 2014 Dr hab. inż. Grzegorz Dudek Wydział Elektryczny Politechnika Częstochowska PROBLEMY OPTYMALIZACYJNE Optymalizacja poszukiwanie

Bardziej szczegółowo

Podstawy Sztucznej Inteligencji (PSZT)

Podstawy Sztucznej Inteligencji (PSZT) Podstawy Sztucznej Inteligencji (PSZT) Paweł Wawrzyński Przeszukiwanie Przeszukiwanie przestrzeni stanów Motywacja Rozwiązywanie problemów: poszukiwanie sekwencji operacji prowadzącej do celu poszukiwanie

Bardziej szczegółowo


ALGORYTMICZNA I STATYSTYCZNA ANALIZA DANYCH 1 ALGORYTMICZNA I STATYSTYCZNA ANALIZA DANYCH WFAiS UJ, Informatyka Stosowana II stopień studiów 2 Wnioskowanie statystyczne dla zmiennych numerycznych Porównywanie dwóch średnich Boot-strapping Analiza

Bardziej szczegółowo

Przewidywanie struktury kanału białkowego z wykorzystaniem probabilistycznych gramatyk formalnych oraz modelu ciągłego przepływu jonów

Przewidywanie struktury kanału białkowego z wykorzystaniem probabilistycznych gramatyk formalnych oraz modelu ciągłego przepływu jonów Przewidywanie struktury kanału białkowego z wykorzystaniem probabilistycznych gramatyk formalnych oraz modelu ciągłego przepływu jonów Witold Dyrka Instytut Inżynierii Biomedycznej i Pomiarowej, Politechnika

Bardziej szczegółowo

ALHE Z11 Jarosław Arabas wykład 11

ALHE Z11 Jarosław Arabas wykład 11 ALHE Z11 Jarosław Arabas wykład 11 algorytm ewolucyjny inicjuj P 0 {x 1, x 2... x } t 0 while! stop for i 1: if a p c O t,i mutation crossover select P t, k else O t,i mutation select P t,1 P t 1 replacement

Bardziej szczegółowo

S YL AB US MODUŁ U ( PRZEDMIOTU) I nforma cje ogólne. Podstawy genetyki w psychiatrii. 4 Wykłady 24 Ćwiczenia 10. Prof. Dr hab.

S YL AB US MODUŁ U ( PRZEDMIOTU) I nforma cje ogólne. Podstawy genetyki w psychiatrii. 4 Wykłady 24 Ćwiczenia 10. Prof. Dr hab. S YL AB US MODUŁ U ( PRZEDMIOTU) I nforma cje ogólne Kod modułu Rodzaj modułu Wydział PUM Kierunek studiów Specjalność Poziom studiów Forma studiów Rok studiów Nazwa modułu Podstawy genetyki w psychiatrii

Bardziej szczegółowo


PODSTAWY BIOINFORMATYKI 11 BAZA DANYCH HAPMAP PODSTAWY BIOINFORMATYKI 11 BAZA DANYCH HAPMAP WSTĘP 1. SNP 2. haplotyp 3. równowaga sprzężeń 4. zawartość bazy HapMap 5. przykłady zastosowań Copyright 2013, Joanna Szyda HAPMAP BAZA DANYCH HAPMAP - haplotypy

Bardziej szczegółowo

Detekcja motywów w złożonych strukturach sieciowych perspektywy zastosowań Krzysztof Juszczyszyn

Detekcja motywów w złożonych strukturach sieciowych perspektywy zastosowań Krzysztof Juszczyszyn Detekcja motywów w złożonych strukturach sieciowych perspektywy zastosowań Krzysztof Juszczyszyn Instytut Informatyki Technicznej PWr MOTYWY SIECIOWE -NETWORK MOTIFS 1. Co to jest? 2. Jak mierzyć? 3. Gdzie

Bardziej szczegółowo

Metody Ilościowe w Socjologii

Metody Ilościowe w Socjologii Metody Ilościowe w Socjologii wykład 2 i 3 EKONOMETRIA dr inż. Maciej Wolny AGENDA I. Ekonometria podstawowe definicje II. Etapy budowy modelu ekonometrycznego III. Wybrane metody doboru zmiennych do modelu

Bardziej szczegółowo

Rycina 1. Zasięg i zagęszczenie łosi (liczba osobników/1000 ha) w Polsce w roku 2010 oraz rozmieszczenie 29 analizowanych populacji łosi.

Rycina 1. Zasięg i zagęszczenie łosi (liczba osobników/1000 ha) w Polsce w roku 2010 oraz rozmieszczenie 29 analizowanych populacji łosi. Ryciny 193 Rycina 1. Zasięg i zagęszczenie łosi (liczba osobników/1000 ha) w Polsce w roku 2010 oraz rozmieszczenie 29 analizowanych populacji łosi. Na fioletowo zaznaczone zostały populacje (nr 1 14)

Bardziej szczegółowo

KARTA PRZEDMIOTU. (pieczęć wydziału)

KARTA PRZEDMIOTU. (pieczęć wydziału) (pieczęć wydziału) KARTA PRZEDMIOTU 1. Nazwa przedmiotu: Eksploracja danych w bioinformatyce 2. Kod przedmiotu: EksDaBio 3. Karta przedmiotu ważna od roku akademickiego: 2017/2018 4. Forma kształcenia:

Bardziej szczegółowo

Filogenetyka molekularna I. Krzysztof Spalik

Filogenetyka molekularna I. Krzysztof Spalik Filogenetyka molekularna I Krzysztof Spalik Literatura Krzysztof Spalik, Marcin Piwczyński (2009), Rekonstrukcja filogenezy i wnioskowanie filogenetyczne w badaniach ewolucyjnych, Kosmos 58(3-4): 485-498

Bardziej szczegółowo

Teoria ewolucji. Podstawowe pojęcia. Wspólne pochodzenie.

Teoria ewolucji. Podstawowe pojęcia. Wspólne pochodzenie. Teoria ewolucji Podstawowe pojęcia. Wspólne pochodzenie. Ewolucja Znaczenie ogólne: zmiany zachodzące stopniowo w czasie W biologii ewolucja biologiczna W astronomii i kosmologii ewolucja gwiazd i wszechświata

Bardziej szczegółowo

LABORATORIUM 4: Algorytmy ewolucyjne cz. 2 wpływ operatorów krzyżowania i mutacji na skuteczność poszukiwań AE

LABORATORIUM 4: Algorytmy ewolucyjne cz. 2 wpływ operatorów krzyżowania i mutacji na skuteczność poszukiwań AE Instytut Mechaniki i Inżynierii Obliczeniowej Wydział Mechaniczny Technologiczny, Politechnika Śląska METODY HEURYSTYCZNE LABORATORIUM 4: Algorytmy ewolucyjne cz. 2 wpływ operatorów krzyżowania

Bardziej szczegółowo

Analizy filogenetyczne

Analizy filogenetyczne BIOINFORMATYKA edycja 2016 / 2017 wykład 6 Analizy filogenetyczne dr Jacek Śmietański Plan wykładu 1. Cele i zastosowania 2. Podstawy ewolucyjne

Bardziej szczegółowo

Algorytm Genetyczny. zastosowanie do procesów rozmieszczenia stacji raportujących w sieciach komórkowych

Algorytm Genetyczny. zastosowanie do procesów rozmieszczenia stacji raportujących w sieciach komórkowych Algorytm Genetyczny zastosowanie do procesów rozmieszczenia stacji raportujących w sieciach komórkowych Dlaczego Algorytmy Inspirowane Naturą? Rozwój nowych technologii: złożone problemy obliczeniowe w

Bardziej szczegółowo

FILOGENETYKA. Bioinformatyka, wykład 7 (24.XI.200..XI.2008)

FILOGENETYKA. Bioinformatyka, wykład 7 (24.XI.200..XI.2008) FILOGENETYKA Bioinformatyka, wykład 7 (24.XI.200.XI.2008) Filogenetyka Cel rekonstrukcja historii ewolucji wszystkich organizmów. Klasyczne podejście: historia ewolucji jest

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Podstawy biologii. Informacja genetyczna. Co to jest ewolucja.

Podstawy biologii. Informacja genetyczna. Co to jest ewolucja. Podstawy biologii Informacja genetyczna. Co to jest ewolucja. Materiał genetyczny Materiałem genetycznym są kwasy nukleinowe Materiałem genetycznym organizmów komórkowych jest kwas deoksyrybonukleinowy

Bardziej szczegółowo

Genetyka populacji. Ćwiczenia 7

Genetyka populacji. Ćwiczenia 7 Genetyka populacji Ćwiczenia 7 Rodowody wraz z wynikami kontroli użytkowości stanowią podstawową informację potrzebną do doskonalenia zwierząt C F X S D C F C F S D strzałka oznacza przepływ genów między

Bardziej szczegółowo

Synteza i eksploracja danych sekwencyjnych

Synteza i eksploracja danych sekwencyjnych Synteza i eksploracja danych sekwencyjnych Definicja problemu i wstępne wyniki eksperymentalne Projekt finansowany z grantu nr DEC-2011/03/D/ST6/01621 otrzymanego z Narodowego Centrum Nauki Plan prezentacji

Bardziej szczegółowo