Generator testów bioinformatyka wer / Strona: 1

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "Generator testów bioinformatyka wer / Strona: 1"

Transkrypt

1 Przedmiot: wyklad monograficzny Nazwa testu: bioinformatyka wer Nr testu Klasa: 5 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Aminokwas jest to związek organiczny zawierający A) grupę aminową i grupę kwasową B) co najmniej jedną grupę karboksylową C) wiązanie peptydowe D) grupę aminową i grupę karboksylową E) co najmniej jedną grupę aminową F) grupę aminową i grupę hydroksylową 2. Strukturę tzw. zgięcia łańcucha białkowego, charakteryzuje występowanie A) dwóch seryn B) seryny i cysteiny C) dwóch glicyn D) cysteiny i glicyny E) glicyny i seryny F) dwóch cystein 3. Do aminokwasów hydrofobowych zalicza się A) L, I oraz V B) Q oraz N C) W, P oraz S D) D oraz E E) A, L oraz T F) K, R oraz H 4. W stabilizacji struktury alfa-helikalnej znacząco uczestniczą takie aminokwasy, jak... A) I, V oraz P B) L, I oraz V C) L, W oraz H D) V, K, oraz G E) I, S, oraz L F) A, G oraz C 5. Wśród metod zależnych od wzorcowego DNA kodującego za najczulszą i najdokładniejszą uważa się metodę A) opartą na modelach Markowa B) opartą na zdefiniowaniu prototypu kodonu C) analizującą preferencje wśród kodonów synonimicznych D) częstości używania kodonu E) częstości używania heksamerów F) częstości używania aminokwasu 6. Tranzycja jest to... A) przesunięcie całego kodonu w genie o jeden B) przesunięcie pozycji nukleotydów w kodonie o jedną C) mutacja punktowa polegająca na substytucji nukleotydu innym, pochodzącym z odrębnej podgrupy zasad azotowych (np. wymiana puryna-pirymidyna) D) mutacja punktowa polegająca na substytucji nukleotydu innym, w obrębie tej samej podgrupy zasad azotowych (np. wymiana puryna-puryna) E) wzajemne przemieszczenie pozycji dwóch kodonów w genie F) zamiana miejsc dwóch nukleotydów w kodonie (np. zamiana pozycji 1 i 2) 7. W odcinkach kodujących genomu człowieka, w pierwszej pozycji kodonu najczęściej występują A) guanina i tymina B) adenina i cytozyna C) pirymidyny D) adenina i tymina E) puryny F) guanina i cytozyna 8. Podobna funkcja biologiczna białek A) obserwowana jest jedynie w przypadku enzymów B) może być związana z ich podobieństwem strukturalnym C) nie ma związku z ich strukturą przestrzenną D) świadczy o ich wspólnym pochodzeniu filogenetycznym E) żadna z odpowiedzi nie jest poprawna F) zawsze wiąże się z dużym podobieństwem ich sekwencji aminokwasowej 9. Do aminokwasów siarkowych zalicza się A) Q oraz N B) W, P oraz S C) D oraz E D) L, I oraz V Generator testów bioinformatyka wer / Strona: 1

2 E) A, L oraz T F) M oraz C 10. Struktura łańcucha beta stabilizowana jest... A) resztami aminokwasów, tworzącymi mieszane pary hydrofilowo-hydrofobowe B) tymi samymi czynnikami, które destabilizują alfa-helisę oraz zgięcia C) mostkami disiarczkowymi D) pozytywnymi oddziaływaniami reszt aminokwasowych tworzacych pary 1-5 E) pozytywnymi oddziaływaniami reszt aminokwasowych tworzacych pary 1-3 F) hydrofobowymi oddziaływaniami łańcuchów bocznych aminokwasów położonych w bliskim sąsiedztwie 11. Mutacje punktowe prowadzące do zmiany aminokwasu w danej pozycji białka na inny... A) są procesem markowowskim z wyjątkiem białek homologicznych B) są procesem markowowskim tylko w przypadku białek homologicznych C) są procesem markowowskim tylko dla aminokwasów sześciokodonowych D) są procesem markowowskim z wyjątkiem aminokwasów sześciokodonowych E) są procesem markowowskim F) nie są procesem markowowskim 12. Topologia mostków disiarczkowych w białku jest elementem struktury... A) drugorzędowej B) ponaddrugorzędowej C) domenowej D) czwartorzędowej E) trzeciorzędowej F) pierwszorzędowej 13. O pokrewieństwie porównywanych sekwencji białkowych może świadczyć procentowy udział pozycji identycznych przekraczający pewną wartość progową, która jest A) tym większa, im dłuższe są porównywane sekwencje B) możliwa do określenia tylko w przypadku znanej sekwencji nukleotydowej genów kodujących te białka C) żadna z odpowiedzi nie jest poprawna D) taka sama dla sekwencji aminokwasowych i nukleotydowych E) tym mniejsza im dłuższe są porównywane sekwencje F) stała i niezależna od długości porównywanych sekwencji 14. Wiązanie peptydowe tworzą atomy H, N, C oraz O A) nieleżące w jednej płaszczyźnie B) żadna z odpowiedzi nie jest poprawna C) leżące w jednej płaszczyźnie D) przy czym atom węgla określany jest jako węgiel beta E) przy czym atom węgla określany jest jako węgiel alfa F) gdzie atomy O i H tworzą grupę hydroksylową 15. Struktura przestrzenna białka A) może się zmieniać jedynie na skutek obecności czynników niebiałkowych jak np. jony metali B) jest zawsze zwinięta helikalnie C) jest zawsze sztywna i niezmienna, co jest warunkiem jego stabilności w ustroju D) jest zmienna i przyjmuje różne konformacje przestrzenne E) jest zawsze stabilizowana mostkami disiarczkowymi F) jest liniowa 16. Strukturę beta-zgięcia tworzy krótka sekwencja A) 4-8 aminokwasów B) 4-5 aminokwasów C) 3-6 aminokwasów D) 3-4 aminokwasów E) 4-6 aminokwasów F) 3-5 aminokwasów 17. Model Markowa substytucji aminokwasów w mutagenezie białek zakłada... A) ścisły związek między częstością występowania aminokwasu, a liczbą różnych kodonów dla tego aminokwasu B) takie samo prawdopodobieństwo dla wszystkich substytucji między dowolnymi dwoma aminokwasami C) niezależność prawdopodobieństwa wystąpienia tych substytucji od historii przemian zachodzących w danej pozycji D) zależność prawdopodobieństwa substytucji od właściwości fizyko-chemicznych i występowania białka E) istotne znaczenie aminokwasów wystepujących w danej pozycji w przeszłości na prawdopodobieństwo wystąpienia nowych aminokwasów w wyniku kolejnych mutacji F) istotną rolę aminokwasów sześciokodonowych w pozycjach wykazujących szczególnie wysoki stopień zmienności mutacyjnej 18. Trzy identyczności występujące w porównywanych sekwencjach bezpośrednio obok siebie A) są tak samo istotne co trzy pojedyncze pozycje identyczne oddzielone fragmentami nieidentycznymi B) są istotniejsze niż trzy pojedyncze pozycje identyczne oddzielone fragmentami nieidentycznymi C) są efektem pojedynczej tranzycji/transwersji D) są mniej istotne niż trzy pojedyncze pozycje identyczne oddzielone fragmentami nieidentycznymi E) świadczą o kodowaniu przez różne rodzaje kodonów F) świadczą o kodowaniu przez ten sam rodzaj kodonu 19. Łańcuch polipeptydowy przyjmuje konformację helikalną, jeśli... Generator testów bioinformatyka wer / Strona: 2

3 A) jest to tylko możliwe B) posiada co najmniej dwie reszty seryny C) nie może przyjąć żadnego innego typu struktury drugorzędowej D) nie występuje w nim ani jedna reszta tryptofanu E) zbudowany jest wyłącznie z aminokwasów hydrofobowych F) jest schowany wewnątrz cząsteczki białka 20. Struktura spinki do włosów (hairpin) jest przykładem struktury A) ponaddrugorzędowej C) trzeciorzędowej D) pierwszorzędowej F) czwartorzędowej 21. Prototyp kodonu jest to A) kodon najczęsciej występujacy w danym genomie B) pierwszy kodon rozpoczynający odcinek sekwencji kodującej C) jedyny kodon w odcinkach kodujących genomu, który nie koduje żadnego aminokwasu D) kodon zawierający wyłącznie ten sam rodzaj nukleotydu (np. GGG) E) wzorzec kodonu definiujący reguły obsadzenia kolejnych pozycji w kodonach genomu danego gatunku F) pierwotny kodon, z którego powstały wszystkie kodony w części kodującej genomu danego gatunku 22. Według klasyfikacji Creightona wyróżnia się A) 4 poziomy strukturalne białek B) 5 poziomów strukturalnych białek C) 6 poziomów strukturalnych białek D) 2 poziomy strukturalne białek E) 3 poziomy strukturalne białek F) 8 poziomów strukturalnych białek 23. Topologia mostków disiarczkowych w białkach jest elementem struktury A) trzeciorzędowej B) ponaddrugorzędowej C) czwartorzędowej D) domenowej F) pierwszorzędowej 24. Do aminokwasów kwaśnych zalicza się A) D oraz E B) Q oraz N C) K oraz R D) A, L oraz T E) W, P oraz S F) L, I oraz V 25. Przy oszacowaniu stopnia istotności podobieństwa porównywanych sekwencji, rozkład (dystrybucja) pozycji identycznych wzdłuż porównywanych sekwencji A) ma znaczenie jedynie dla sekwencji aminokwasowych B) jest ważnym kryterium oceny i im bardzej jest on nierównomierny (tworzący skupiska pozycji identycznych), tym bardziej świadczy to o potencjalnym pokrewieństwie C) jest ważnym kryterium oceny i im bardzej jest on nierównomierny (tworzący skupiska pozycji identycznych), tym mniej świadczy to o potencjalnym pokrewieństwie D) nie ma znaczenia i nie musi być brany pod uwagę E) ma znaczenie jedynie dla sekwencji nukleotydowych F) ma znaczenie jedynie dla sekwencji kodujących organizmów eukariotycznych 26. Analiza odpowiadających sobie fragmentów nieidentycznych w porównywanych sekwencjach białkowych A) powinna być uwzględniona tylko, jeśli występują w tych fragmentach przynajmniej trzy pozycje identyczne B) świadczy o braku wzajemnego pokrewieństwa porównywanych sekwencji C) powinna być uwzględniona tylko, jeśli występuje w tych fragmentach przynajmniej jedna pozycja identyczna D) jest ważnym kryterium przy oszacowaniu ich potencjalnego pokrewieństwa E) nie stanowi kryterium oszacowania ich potencjalnego podobieństwa F) jest możliwa dopiero po wstawieniu przerw w odpowiednich miejscach, obrazujących proces delecji/insercji 27. Tzw. hydrofobowe pary 1-5 są warunkiem przyjęcia przez łańcuch polipeptydowy... A) struktury alfa-helikalnej B) struktury beta-łańcucha C) struktury "spinki do włosów" (tzw. hairpin) D) struktury zgięcia E) struktury beta-kartki F) struktury globularnej 28. Alfa-helisa jest przykładem struktury A) pierwszorzędowej C) trzeciorzędowej Generator testów bioinformatyka wer / Strona: 3

4 D) drugorzędowej E) czwartorzędowej F) ponaddrugorzędowej 29. Im większe jest prawdopodobieństwo losowego trafienia na dany stopień identyczności przy danej długości porównywanych sekwencji A) tym bardziej świadczy to o potencjalnym pokrewieństwie między tymi sekwencjami B) tym bardziej świadczy to o nierównomiernej dystrybucji pozycji identycznych wzdłuż porównywanych sekwencji C) tym bardziej świadczy to o równomiernej dystrybucji pozycji identycznych wzdłuż porównywanych sekwencji D) tym mniej świadczy to o potencjalnym pokrewieństwie między tymi sekwencjami E) tym trudniej jest znaleźć sekwencje wykazujące taki stopień identyczności F) tym bardziej to świadczy o nienaturalnym pochodzeniu tych sekwencji 30. Metody identyfikacji sekwencji kodujących w genomie można podzielić na dwie główne grupy różniące się kryterium A) podejścia statystycznego i niestatystycznego B) wykorzystania rodzaju macierzy stochastycznych częstości substytucji nukleotydów (PAM lub BLOSUM) C) wymagania wzorcowego DNA kodującego D) pochodzenia taksonomicznego badanych genomów E) wykorzystania rodzaju macierzy stochastycznych częstości substytucji kodonów (PAM lub BLOSUM) F) podejścia markowowskiego lub niemarkowowskiego 31. Jedynym biogennym aminokwasem, który nie posiada wolnej grupy alfa aminowej jest... A) W B) G C) R D) Y E) P F) C 32. Układ "klucza greckiego" jest przykładem struktury A) czwartorzędowej B) pierwszorzędowej C) drugorzędowej D) domenowej E) ponaddrugorzędowej F) trzeciorzędowej 33. Rodzaj aminokwasów występujących w pozycjach identycznych porównywanych sekwencji białkowych A) świadczy zawsze o tym, że są one kodowane przez taki sam kodon B) jest ważniejszym kryterium oceny istotności podobieństwa sekwencji niż procentowy udział pozycji identycznych C) pozwala określić, który z kodonów synonimicznych koduje te aminokwasy w danej konkretnej pozycji D) nie jest istotny przy oszacowaniu ich potencjalnego podobieństwa E) jest ważniejszym kryterium oceny istotności podobieństwa sekwencji niż ich bezwzględna długość F) jest istotny przy oszacowaniu ich potencjalnego pokrewieństwa 34. Do aminokwasów aromatycznych zalicza się A) D oraz E B) A, L oraz T C) Y, F oraz W D) G, P oraz S E) Q oraz N F) L, I oraz V 35. W metodach identyfikacji sekwencji kodujących niewymagających DNA kodującego A) przeprowadza się analizę sekwencji dla wszystkich trzech możliwych ramek odczytu B) ważne jest ustalenie otwartej ramki odczytu C) wykorzystuje się definicję prototypu kodonu D) analizuje się częstość występowania kodonów synonimicznych E) wykorzystuje sie modele Markowa F) otwarta ramka odczytu nie jest ani ustalana, ani uwzględniana 36. Niektóre białka nie posiadają A) struktury trzeciorzędowej B) wiązań peptydowych C) mostków disiarczkowych D) punktu izoelektrycznego E) grup karbonylowych F) struktury drugorzędowej 37. Łańcuch beta jest przykładem struktury A) czwartorzędowej B) drugorzędowej C) pierwszorzędowej D) ponaddrugorzędowej E) trzeciorzędowej F) domenowej 38. Kodony synonimiczne, są to A) kodony różniące się jedną pozycją nukleotydową Generator testów bioinformatyka wer / Strona: 4

5 B) identyczne kodony występujące na przeciwnych niciach cząsteczki DNA C) różne kodony, lecz kodujące ten sam aminokwas D) identyczne kodony, lecz odczytywane porzy różnych ramkach odczytu E) takie same kodony, lecz występujące w różnych miejscach sekwencji kodujacej F) kodony kodujące aminokwasy semihomologiczne 39. Dwie sekwencje o długości N i M, można ustawić względem siebie A) na N lub M sposobów, w zależności od tego, która sekwencja jest dłuższa B) na N+M+1 sposobów C) na N+M-1 sposobów D) na M sposobów E) na N+M sposobów F) na N sposobów 40. Czy hydrofobowa para 1-5, zawierająca reszty W-W będzie stabilizować alfa-helisę? A) Nie, z uwagi na hydrofobowy charakter tego aminokwasu B) Nie, ze względu na zbyt duże rozmiary pierścienia indolowego, stanowiącego grupę boczną C) Tak, z uwagi na hydrofobowy charakter tego aminokwasu D) Nie, z uwagi na hydrofilny charakter tego aminokwasu E) Tak, z uwagi na hydrofilny charakter tego aminokwasu F) Tak, z uwagi na duże wzajemne powinowactwo pierścieni indolowych 41. Specyficznym destabilizatorem alfa-helikalnej struktury łańcucha białkowego jest... A) C B) S C) P D) W E) G F) A 42. Tylko niektóre białka posiadają A) strukturę drugorzędową B) strukturę pierwszorzędową C) sekwencję trzeciorzędową D) wiązania peptydowe E) żadna z odpowiedzi nie jest poprawna F) strukturę czwartorzędową 43. Mostki disiarczkowe odgrywają istotną rolę w stabilizacji struktury A) trzeciorzędowej i czwartorzędowej C) ponaddrugorzędowej D) drugorzędowej E) pierwszorzędowej F) żadna z odpowiedzi nie jest poprawna 44. W alfa helisie powtarzalna jednostka strukturalna zawiera A) 3 reszty aminokwasowe B) 4 reszty aminokwasowe C) 3.6 reszty aminokwasowej D) 3.5 reszty aminokwasowej E) 3.4 reszty aminokwasowej F) 3.2 reszty aminokwasowej 45. W przyrodzie występuje A) 23 rodzaje aminokwasów B) 24 rodzaje aminokwasów C) ponad 96 rodzajów aminokwasów D) 21 rodzajów aminokwasów E) 22 rodzaje aminokwasów F) 20 rodzajów aminokwasów 46. W obecnie przyjętej klasyfikacji Creightona poziomów strukturalnych, struktura pierwszorzędowa białek definiowana jest jako... A) sekwencja aminokwasowa B) przestrzenne zwinięcie całego łańcucha białkowego C) kod genetyczny genu dla danego białka D) sekwencja aminokwasowa wraz z topologią mostków disiarczkowych E) skład aminokwasowy F) pierwotny sposób zwinięcia węgli alfa w łańcuchu polipeptydowym 47. Układ czterech helis typu "helical bundle" jest przykładem struktury A) ponaddrugorzędowej C) czwartorzędowej D) pierwszorzędowej F) trzeciorzędowej Generator testów bioinformatyka wer / Strona: 5

6 48. Beta-kartka może powstać z A) beta-łańcuchów ułożonych wyłącznie antyrównolegle względem siebie B) beta-łańcuchów ułożonych skośnie względem siebie C) beta-łańcuchów ułożonych prostopadle względem siebie D) beta-łańcuchów ułożonych wyłącznie równolegle względem siebie E) beta-łańcuchów ułożonych równolegle lub antyrównolegle względem siebie F) fragmentów łańcucha białkowego, wśród których m.in. występuje konformacja beta-łańcucha 49. Asymetria częstości występowania danego rodzaju nukleotydu w co trzeciej pozycji w sekwencji DNA wykorzystywana jest w A) metodach identyfikacji sekwencji kodujących opartych na modelach Markowa B) metodach identyfikacji sekwencji kodujących opartych na prototypie kodonu C) metodach identyfikacji sekwencji kodujących analizujących preferencje kodonów D) metodach identyfikacji sekwencji kodujących analizujących częstość występowania heksamerów E) metodach identyfikacji sekwencji kodujących zależnych od DNA wzorcowego F) metodach identyfikacji sekwencji kodujących niezależnych od DNA wzorcowego 50. Pierwotnym czynnikiem stabilizującym strukturę alfa-helikalną łańcucha polipeptydowego są... A) oddziaływania jonowe między resztami aminokwasów obdarzonymi przeciwnym ładunkiem B) pozycje poprzedzające odcinek helikalny, stanowiące czynnik inicjujący helikalne zwinięcie łańcucha C) mostki disiarczkowe D) tworzenie tzw. hydrofobowych par 1-5 E) żadna z podanych odpowiedzi nie jest prawidłowa F) oddziaływania wodorowe między atomami co czwartego wiązania peptydowego 51. Do aminokwasów zasadowych zalicza się A) L, I oraz V B) Q oraz N C) D oraz E D) K oraz R E) W, P oraz S F) A, L oraz T 52. Białka złożone to takie białka, które zawierają A) łańcuch białkowy o złożonej strukturze ponaddrugorzędowej B) komponentę niebiałkową C) wiele form izomerycznych D) żadna z odpowiedzi nie jest poprawna E) więcej niż jeden łańcuch polipeptydowy F) więcej niż jeden rodzaj aminokwasu % identyczność dla pary sekwencji o długości 100 pozycji A) jest wystarczającym dowodem ich pokrewieństwa B) bardziej świadczy o ich potencjalnym pokrewieństwie, niż 20% identyczność dla pary sekwencji o długości 200 pozycji C) świadczy mniej o ich potencjalnym pokrewieństwie, niż 20% identyczność dla pary sekwencji o długości 200 pozycji D) jest wystarczającym dowodem braku pokrewieństwa między nimi E) świadczy tak samo o ich potencjalnym pokrewieństwie, co 20% identyczność dla pary sekwencji o długości 200 pozycji F) świadczy o 20% podobieństwie ich struktury trzeciorzędowej 54. Algorytm semihomologii genetycznej oparty jest na... A) macierzy stochastycznej BLOSUM substytucji aminokwasów B) danych statystycznych występowania aminokwasów w poszczególnych typach struktur drugorzędowych C) trójwymiarowym diagramie relacji genetycznych między aminokwasami D) danych na temat własności fizyko-chemicznych aminokwasów E) markowowskim modelu przemian mutacyjnych aminokwasów w białkach F) macierzy stochastycznej PAM substytucji aminokwasów 55. Beta-zgięcie jest przykładem struktury A) trzeciorzędowej B) pierwszorzędowej C) czwartorzędowej D) domenowej F) ponaddrugorzędowej Generator testów bioinformatyka wer / Strona: 6

Generator testów Bioinformatyka wer / 0 Strona: 1

Generator testów Bioinformatyka wer / 0 Strona: 1 Przedmiot: Nazwa przedmiotu Nazwa testu: Bioinformatyka wer. 1.0.6 Nr testu 0 Klasa: V zaoczne WNB UZ Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Analiza porównawcza białek zwykle zaczyna się na badaniach

Bardziej szczegółowo

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1 Przedmiot: Biochemia Nazwa testu: Biochemia wer. 1.0.5 Nr testu 14883078 Klasa: zaoczni_2007 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Do aminokwasów aromatycznych zalicza się A) G, P oraz S B) L,

Bardziej szczegółowo

Generator testów 1.3.1 Bioinformatyka_zdalne wer. 1.0.13 / 0 Strona: 1

Generator testów 1.3.1 Bioinformatyka_zdalne wer. 1.0.13 / 0 Strona: 1 Przedmiot: Bioinformatyka Nazwa testu: Bioinformatyka_zdalne wer. 1.0.13 Nr testu 0 Klasa: WNB UZ Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Model Markowa substytucji aminokwasów w mutagenezie białek zakłada...

Bardziej szczegółowo

Materiały pochodzą z Platformy Edukacyjnej Portalu www.szkolnictwo.pl

Materiały pochodzą z Platformy Edukacyjnej Portalu www.szkolnictwo.pl Materiały pochodzą z Platformy Edukacyjnej Portalu www.szkolnictwo.pl Wszelkie treści i zasoby edukacyjne publikowane na łamach Portalu www.szkolnictwo.pl mogą byd wykorzystywane przez jego Użytkowników

Bardziej szczegółowo

etyloamina Aminy mają właściwości zasadowe i w roztworach kwaśnych tworzą jon alkinowy

etyloamina Aminy mają właściwości zasadowe i w roztworach kwaśnych tworzą jon alkinowy Temat: Białka Aminy Pochodne węglowodorów zawierające grupę NH 2 Wzór ogólny amin: R NH 2 Przykład: CH 3 -CH 2 -NH 2 etyloamina Aminy mają właściwości zasadowe i w roztworach kwaśnych tworzą jon alkinowy

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI 8 DOPASOWYWANIE SEKWENCJI AMINOKWASÓW

PODSTAWY BIOINFORMATYKI 8 DOPASOWYWANIE SEKWENCJI AMINOKWASÓW PODSTAWY BIOINFORMATYKI 8 DOPASOWYWANIE SEKWENCJI AMINOKWASÓW DOPASOWYWANIE SEKWENCJI 1. Miary podobieństwa sekwencji aminokwasów 2. Zastosowanie programów: CLUSTAL OMEGA BLAST Copyright 2013, Joanna Szyda

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

Aminokwasy, peptydy i białka. Związki wielofunkcyjne

Aminokwasy, peptydy i białka. Związki wielofunkcyjne Aminokwasy, peptydy i białka Związki wielofunkcyjne Aminokwasy, peptydy i białka Aminokwasy, peptydy i białka: - wiadomości ogólne Aminokwasy: - ogólna charakterystyka - budowa i nazewnictwo - właściwości

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI WYKŁAD 4 DOPASOWANIE SEKWENCJI

PODSTAWY BIOINFORMATYKI WYKŁAD 4 DOPASOWANIE SEKWENCJI PODSTAWY BIOINFORMATYKI WYKŁAD 4 DOPASOWANIE SEKWENCJI DOPASOWANIE SEKWENCJI 1. Dopasowanie sekwencji - definicja 2. Wizualizacja dopasowania sekwencji 3. Miary podobieństwa sekwencji 4. Przykłady programów

Bardziej szczegółowo

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II 10 października 2013: Elementarz biologii molekularnej www.bioalgorithms.info Wykład nr 2 BIOINFORMATYKA rok II Komórka: strukturalna i funkcjonalne jednostka organizmu żywego Jądro komórkowe: chroniona

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

Bioinformatyka wykład 9

Bioinformatyka wykład 9 Bioinformatyka wykład 9 14.XII.21 białkowa bioinformatyka strukturalna krzysztof_pawlowski@sggw.pl 211-1-17 1 Plan wykładu struktury białek dlaczego? struktury białek geometria i fizyka modyfikacje kowalencyjne

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta

Bioinformatyka Laboratorium, 30h. Michał Bereta Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecność Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

Przegląd budowy i funkcji białek

Przegląd budowy i funkcji białek Przegląd budowy i funkcji białek Co piszą o białkach? Wyraz wprowadzony przez Jönsa J. Berzeliusa w 1883 r. w celu podkreślenia znaczenia tej grupy związków. Termin pochodzi od greckiego słowa proteios,

Bardziej szczegółowo

Bioinformatyka II Modelowanie struktury białek

Bioinformatyka II Modelowanie struktury białek Bioinformatyka II Modelowanie struktury białek 1. Który spośród wymienionych szablonów wybierzesz do modelowania? Dlaczego? Struktura krystaliczną czy NMR (to samo białko, ta sama rozdzielczość)? Strukturę

Bardziej szczegółowo

Substancje o Znaczeniu Biologicznym

Substancje o Znaczeniu Biologicznym Substancje o Znaczeniu Biologicznym Tłuszcze Jadalne są to tłuszcze, które może spożywać człowiek. Stanowią ważny, wysokoenergetyczny składnik diety. Z chemicznego punktu widzenia głównym składnikiem tłuszczów

Bardziej szczegółowo

protos (gr.) pierwszy protein/proteins (ang.)

protos (gr.) pierwszy protein/proteins (ang.) Białka 1 protos (gr.) pierwszy protein/proteins (ang.) cząsteczki życia materiał budulcowy materii ożywionej oraz wirusów wielkocząsteczkowe biopolimery o masie od kilku tysięcy do kilku milionów jednostek

Bardziej szczegółowo

4.1 Hierarchiczna budowa białek

4.1 Hierarchiczna budowa białek Spis treści 4.1 ierarchiczna budowa białek... 51 4.1.1 Struktura pierwszorzędowa... 51 4.1.2 Struktura drugorzędowa... 53 4.1.3 Struktura trzeciorzędowa... 60 4.1.4 Rodzaje oddziaływań stabilizujących

Bardziej szczegółowo

Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne)

Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne) Joanna Wieczorek Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne) Strona 1 Temat: Budowa i funkcje kwasów nukleinowych Cel ogólny lekcji: Poznanie budowy i funkcji: DNA i RNA Cele szczegółowe:

Bardziej szczegółowo

Informacje. W sprawach organizacyjnych Slajdy z wykładów

Informacje. W sprawach organizacyjnych Slajdy z wykładów Biochemia Informacje W sprawach organizacyjnych malgorzata.dutkiewicz@wum.edu.pl Slajdy z wykładów www.takao.pl W sprawach merytorycznych Takao Ishikawa (takao@biol.uw.edu.pl) Kiedy? Co? Kto? 24 lutego

Bardziej szczegółowo

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier.

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier. ID Testu: F5679R8 Imię i nazwisko ucznia Klasa Data 1. Na indywidualne cechy danego osobnika ma (maja) wpływ A. wyłacznie czynniki środowiskowe. B. czynniki środowiskowe i materiał genetyczny. C. wyłacznie

Bardziej szczegółowo

Bioinformatyka II Modelowanie struktury białek

Bioinformatyka II Modelowanie struktury białek Bioinformatyka II Modelowanie struktury białek 1. Który spośród wymienionych szablonów wybierzesz do modelowania dla każdego z podanych przypadków? Dlaczego? Struktura krystaliczną czy NMR (to samo białko,

Bardziej szczegółowo

Struktura i funkcja białek (I mgr)

Struktura i funkcja białek (I mgr) Struktura i funkcja białek (I mgr) Dr Filip Jeleń fj@protein.pl http://www.protein.pl/ Jeremy M. Berg, John L. Tymoczko, Lubert Stryer Biochemia Carl Branden, John Tooze Introduction to Protein Structure

Bardziej szczegółowo

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

Porównywanie i dopasowywanie sekwencji

Porównywanie i dopasowywanie sekwencji Porównywanie i dopasowywanie sekwencji Związek bioinformatyki z ewolucją Wraz ze wzrostem dostępności sekwencji DNA i białek narodziła się nowa dyscyplina nauki ewolucja molekularna Ewolucja molekularna

Bardziej szczegółowo

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A...

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A... 1. Zadanie (0 2 p. ) Porównaj mitozę i mejozę, wpisując do tabeli podane określenia oraz cyfry. ta sama co w komórce macierzystej, o połowę mniejsza niż w komórce macierzystej, gamety, komórki budujące

Bardziej szczegółowo

Przyrównanie sekwencji. Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu

Przyrównanie sekwencji. Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Przyrównanie sekwencji Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Sequence alignment - przyrównanie sekwencji Poszukiwanie ciągów znaków (zasad nukleotydowych lub reszt aminokwasowych),

Bardziej szczegółowo

Skrypt Bioinformatyka DRAFT Strona 67

Skrypt Bioinformatyka DRAFT Strona 67 Spis treści 5 Budowa kwasów nukleinowych... 68 5.1 Nukleotydy... 68 5.2 Łaocuch polinukleotydowy... 71 5.3 Nić komplementarna... 71 6 Centralny dogmat Biologii Molekularnej... 74 7 Przepływ informacji

Bardziej szczegółowo

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej Wprowadzenie do Informatyki Biomedycznej Wykład 1: Podstawy bioinformatyki Wydział Informatyki PB Podstawy biologiczne - komórki Wszystkie organizmy zbudowane są z komórek komórka jest skomplikowanym systemem

Bardziej szczegółowo

Kwasy nukleinowe i białka

Kwasy nukleinowe i białka Metody bioinformatyki Kwasy nukleinowe i białka prof. dr hab. Jan Mulawka Kwasy nukleinowe DNA Kwas dezoksyrybonukleinowy jest to należący do kwasów nukleinowych wielkocząsteczkowy organiczny związek chemiczny,

Bardziej szczegółowo

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU KSZTAŁT BIAŁEK.

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU KSZTAŁT BIAŁEK. SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU KSZTAŁT BIAŁEK. SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

Slajd 1. Slajd 2. Proteiny. Peptydy i białka są polimerami aminokwasów połączonych wiązaniem amidowym (peptydowym) Kwas α-aminokarboksylowy aminokwas

Slajd 1. Slajd 2. Proteiny. Peptydy i białka są polimerami aminokwasów połączonych wiązaniem amidowym (peptydowym) Kwas α-aminokarboksylowy aminokwas Slajd 1 Proteiny Slajd 2 Peptydy i białka są polimerami aminokwasów połączonych wiązaniem amidowym (peptydowym) wiązanie amidowe Kwas α-aminokarboksylowy aminokwas Slajd 3 Aminokwasy z alifatycznym łańcuchem

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 4 Jak działają geny?

Bardziej szczegółowo

DNA musi współdziałać z białkami!

DNA musi współdziałać z białkami! DNA musi współdziałać z białkami! Specyficzność oddziaływań między DNA a białkami wiążącymi DNA zależy od: zmian konformacyjnych wzdłuż cząsteczki DNA zróżnicowania struktury DNA wynikającego z sekwencji

Bardziej szczegółowo

Właściwości fizykochemiczne białek

Właściwości fizykochemiczne białek Białka Definicja Wielkocząsteczkowe związki zbudowane wyłącznie lub w dużej mierze z aminokwasów, a które stanowią największą część występujących w żywej komórce związków organicznych. Białka Podziały

Bardziej szczegółowo

Budowa i funkcje białek

Budowa i funkcje białek Budowa i funkcje białek Białka Wszystkie organizmy zawierają białko Każdy organizm wytwarza własne białka Podstawowe składniki białek - aminokwasy Roślinne mogą wytwarzać aminokwasy ze związków nieorganicznych

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecnośd Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

Nośnikiem informacji genetycznej są bardzo długie cząsteczki DNA, w których jest ona zakodowana w liniowej sekwencji nukleotydów A, T, G i C

Nośnikiem informacji genetycznej są bardzo długie cząsteczki DNA, w których jest ona zakodowana w liniowej sekwencji nukleotydów A, T, G i C MATERIAŁ GENETYCZNY KOMÓRKI BIOSYNTEZA BIAŁEK MATERIAŁ GENETYCZNY KOMÓRKI Informacja genetyczna - instrukcje kierujące wszystkimi funkcjami komórki lub organizmu zapisane jako określone, swoiste sekwencje

Bardziej szczegółowo

Dopasowywanie sekwencji (ang. sequence alignment) Metody dopasowywania sekwencji. Homologia a podobieństwo sekwencji. Rodzaje dopasowania

Dopasowywanie sekwencji (ang. sequence alignment) Metody dopasowywania sekwencji. Homologia a podobieństwo sekwencji. Rodzaje dopasowania Wprowadzenie do Informatyki Biomedycznej Wykład 2: Metody dopasowywania sekwencji Wydział Informatyki PB Dopasowywanie sekwencji (ang. sequence alignment) Dopasowywanie (przyrównywanie) sekwencji polega

Bardziej szczegółowo

Budowa kwasów nukleinowych

Budowa kwasów nukleinowych Bioinformatyka (wykład monograficzny) wykład 2. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas Budowa kwasów nukleinowych Kwasy nukleinowe (DA i RA) zbudowane są z nukleotydów

Bardziej szczegółowo

Budowa aminokwasów i białek

Budowa aminokwasów i białek Biofizyka Ćwiczenia 1. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas Budowa aminokwasów i białek E.Banachowicz 1 Ogólna budowa aminokwasów α w neutralnym p α N 2 COO N

Bardziej szczegółowo

Dr. habil. Anna Salek International Bio-Consulting 1 Germany

Dr. habil. Anna Salek International Bio-Consulting 1 Germany 1 2 3 Drożdże są najprostszymi Eukariontami 4 Eucaryota Procaryota 5 6 Informacja genetyczna dla każdej komórki drożdży jest identyczna A zatem każda komórka koduje w DNA wszystkie swoje substancje 7 Przy

Bardziej szczegółowo

2. Produkty żywnościowe zawierające białka Mięso, nabiał (mleko, twarogi, sery), jaja, fasola, bób (rośliny strączkowe)

2. Produkty żywnościowe zawierające białka Mięso, nabiał (mleko, twarogi, sery), jaja, fasola, bób (rośliny strączkowe) BIAŁKA 1. Funkcja białek w organizmie Budulcowa mięśnie (miozyna), krew (hemoglobina, fibrynogen), włosy (keratyna), skóra, chrząstki, ścięgna (kolagen), białka współtworzą wszystkie organelle komórkowe

Bardziej szczegółowo

Przewidywanie genów i budowa białek

Przewidywanie genów i budowa białek Instytut Informatyki i Matematyki Komputerowej UJ, opracowanie: mgr Ewa Matczyńska, dr Jacek Śmietański Przewidywanie genów i budowa białek Pytanie na dzisiaj: Jak odnaleźć gen w sekwencji DNA? CTTACTTCGAAGGCTGTGCTCCGCTCACCATCCAGAGCGGAGGTGCGGACCTTAAACTCACTCCTGGAGA

Bardziej szczegółowo

Białka - liniowe kopolimery. złożone z aminokwasów. Liczba rodzajów białek - nieznana

Białka - liniowe kopolimery. złożone z aminokwasów. Liczba rodzajów białek - nieznana Białka - liniowe kopolimery złożone z aminokwasów Liczba rodzajów białek - nieznana Cechy wspólne białek 1. wielk1cząsteczk1wy charakter niedializują, r1ztw1ry k1l1idalne 2. wywierają ciśnienie 1sm1tyczne

Bardziej szczegółowo

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :.

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :. CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A imię i nazwisko :. klasa :.. ilość punktów :. Zadanie 1 Przeanalizuj schemat i wykonaj polecenia. a. Wymień cztery struktury występujące zarówno w komórce roślinnej,

Bardziej szczegółowo

Bioinformatyka. (wykład monograficzny) wykład 5. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM

Bioinformatyka. (wykład monograficzny) wykład 5. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM Bioinformatyka (wykład monograficzny) wykład 5. E. Banachowicz Zakład Biofizyki Molekularnej IF UM http://www.amu.edu.pl/~ewas lgorytmy macierze punktowe (DotPlot) programowanie dynamiczne metody heurystyczne

Bardziej szczegółowo

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański BIOINFORMATYKA edycja 2016 / 2017 wykład 11 RNA dr Jacek Śmietański jacek.smietanski@ii.uj.edu.pl http://jaceksmietanski.net Plan wykładu 1. Rola i rodzaje RNA 2. Oddziaływania wewnątrzcząsteczkowe i struktury

Bardziej szczegółowo

Ćwiczenie 4. Reakcja aminokwasów z ninhydryną. Opisz typy reakcji przebiegających w tym procesie i zaznacz ich miejsca przebiegu.

Ćwiczenie 4. Reakcja aminokwasów z ninhydryną. Opisz typy reakcji przebiegających w tym procesie i zaznacz ich miejsca przebiegu. azwisko i imię grupa data Protokół z ćwiczenia: eakcje chemiczne związków biologicznych: aminokwasy i peptydy. Definicja punktu izoelektrycznego pi. Formy jonowe aminokwasów w różnym ph. ph < pi ph = pi

Bardziej szczegółowo

Repetytorium z wybranych zagadnień z chemii

Repetytorium z wybranych zagadnień z chemii Repetytorium z wybranych zagadnień z chemii Mol jest to liczebność materii występująca, gdy liczba cząstek (elementów) układu jest równa liczbie atomów zawartych w masie 12 g węgla 12 C (równa liczbie

Bardziej szczegółowo

WĘGLOWODORY. Uczeń: Przykłady wymagań nadobowiązkowych Uczeń:

WĘGLOWODORY. Uczeń: Przykłady wymagań nadobowiązkowych Uczeń: WĘGLOWODORY Wymagania na ocenę dopuszczającą dostateczną dobrą bardzo dobrą pisze wzory sumaryczne, zna nazwy czterech początkowych węglowodorów nasyconych; zna pojęcie: szereg homologiczny; zna ogólny

Bardziej szczegółowo

Dopasowanie par sekwencji

Dopasowanie par sekwencji BIOINFORMTYK edycja 2016 / 2017 wykład 3 Dopasowanie par sekwencji dr Jacek Śmietański jacek.smietanski@ii.uj.edu.pl http://jaceksmietanski.net Plan wykładu 1. Idea i cele dopasowania sekwencji 2. Definicje

Bardziej szczegółowo

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe Promotory genu Promotor bliski leży w odległości do 40 pz od miejsca startu transkrypcji, zawiera kasetę TATA. Kaseta TATA to silnie konserwowana sekwencja TATAAAA, występująca w większości promotorów

Bardziej szczegółowo

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten proces. Na schemacie przedstawiono etapy przekazywania

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

Konspekt lekcji biologii w kl. III gimnazjum

Konspekt lekcji biologii w kl. III gimnazjum Konspekt lekcji biologii w kl. III gimnazjum Jolanta Paziewska ZSO Nr3 w Leopoldowie Dział programu: Dziedziczność i zmienność genetyczna Temat lekcji: DNA jako nośnik informacji genetycznej 1 godz. lekcyjna

Bardziej szczegółowo

Kombinatoryczna analiza widm 2D-NOESY w spektroskopii Magnetycznego Rezonansu Jądrowego cząsteczek RNA. Marta Szachniuk

Kombinatoryczna analiza widm 2D-NOESY w spektroskopii Magnetycznego Rezonansu Jądrowego cząsteczek RNA. Marta Szachniuk Kombinatoryczna analiza widm 2D-NOESY w spektroskopii Magnetycznego Rezonansu Jądrowego cząsteczek RNA Marta Szachniuk Plan prezentacji Wprowadzenie do tematyki badań Teoretyczny model problemu Złożoność

Bardziej szczegółowo

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI

Bardziej szczegółowo

Biomolekuły (3) Bogdan Walkowiak. Zakład Biofizyki Instytut Inżynierii Materiałowej Politechnika Łódzka. piątek, 7 listopada 2014 Biofizyka

Biomolekuły (3) Bogdan Walkowiak. Zakład Biofizyki Instytut Inżynierii Materiałowej Politechnika Łódzka. piątek, 7 listopada 2014 Biofizyka Wykład 3 Biomolekuły (3) Bogdan Walkowiak Zakład Biofizyki Instytut Inżynierii Materiałowej Politechnika Łódzka 1 Monomery i Polimery (1) Biomolekuły dzielimy na 4 klasy: białka kwasy nukleinowe wielocukry

Bardziej szczegółowo

Badanie doboru naturalnego na poziomie molekularnym

Badanie doboru naturalnego na poziomie molekularnym Badanie doboru naturalnego na poziomie molekularnym Podstawy ewolucji molekulanej Jak ewoluują sekwencje Zmiany genetyczne w ewolucji Mutacje tworzą nowe allele genów Inwersje zmieniają układ genów na

Bardziej szczegółowo

Numer pytania Numer pytania

Numer pytania Numer pytania KONKURS BIOLOGICZNY ZMAGANIA Z GENETYKĄ 2016/2017 ELIMINACJE SZKOLNE I SESJA GENETYKA MOLEKULARNA KOD UCZNIA. IMIĘ i NAZWISKO. DATA... GODZINA.. Test, który otrzymałeś zawiera 20 pytań zamkniętych. W każdym

Bardziej szczegółowo

WPROWADZENIE DO GENETYKI MOLEKULARNEJ

WPROWADZENIE DO GENETYKI MOLEKULARNEJ WPROWADZENIE DO GENETYKI MOLEKULARNEJ Replikacja organizacja widełek replikacyjnych Transkrypcja i biosynteza białek Operon regulacja ekspresji genów Prowadzący wykład: prof. dr hab. Jarosław Burczyk REPLIKACJA

Bardziej szczegółowo

Kwasy Nukleinowe. Rys. 1 Struktura typowego dinukleotydu

Kwasy Nukleinowe. Rys. 1 Struktura typowego dinukleotydu Kwasy Nukleinowe Kwasy nukleinowe są biopolimerami występującymi w komórkach wszystkich organizmów. Wyróżnia się dwa główne typy kwasów nukleinowych: Kwas deoksyrybonukleinowy (DNA) Kwasy rybonukleinowe

Bardziej szczegółowo

Przyrównywanie sekwencji

Przyrównywanie sekwencji Instytut Informatyki i Matematyki Komputerowej UJ, opracowanie: mgr Ewa Matczyńska, dr Jacek Śmietański Przyrównywanie sekwencji 1. Porównywanie sekwencji wprowadzenie Sekwencje porównujemy po to, aby

Bardziej szczegółowo

SEMINARIUM 8:

SEMINARIUM 8: SEMINARIUM 8: 24.11. 2016 Mikroelementy i pierwiastki śladowe, definicje, udział w metabolizmie ustroju reakcje biochemiczne zależne od aktywacji/inhibicji przy udziale mikroelementów i pierwiastków śladowych,

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Budowa i rola DNA. 1. Cele lekcji. a) Wiadomości. b) Umiejętności. 2. Metoda i forma pracy. 3. Środki dydaktyczne. Metadane scenariusza

Budowa i rola DNA. 1. Cele lekcji. a) Wiadomości. b) Umiejętności. 2. Metoda i forma pracy. 3. Środki dydaktyczne. Metadane scenariusza Metadane scenariusza Budowa i rola DNA 1. Cele lekcji a) Wiadomości Uczeń: zna nazwy związków chemicznych budujących cząsteczkę DNA i wie, jak są ze sobą powiązane, wie, jak wygląda model przestrzenny

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

MACIERZE MUTACYJNE W ANALIZIE GENOMÓW czy możliwa jest rekonstrukcja filogenetyczna? Aleksandra Nowicka

MACIERZE MUTACYJNE W ANALIZIE GENOMÓW czy możliwa jest rekonstrukcja filogenetyczna? Aleksandra Nowicka MAIERZE MUTAYJNE W ANALIZIE GENOMÓW czy możliwa jest rekonstrukcja filogenetyczna? Aleksandra Nowicka Zadaniem FILOGENETYKI jest : zrekonstruowanie ewolucyjnej historii wszystkich organizmów odkrycie przodka

Bardziej szczegółowo

Geometria wiązania hemu w oksymioglobinie

Geometria wiązania hemu w oksymioglobinie Białka wiążące tlen Geometria wiązania hemu w oksymioglobinie Hem Hb A tetrametr zbudowany z dwóch identycznych łańcuchów α (141 reszt aminokwasowych, N koniec stanowi walina, a C koniec arginina) i dwóch

Bardziej szczegółowo

Nowoczesne systemy ekspresji genów

Nowoczesne systemy ekspresji genów Nowoczesne systemy ekspresji genów Ekspresja genów w organizmach żywych GEN - pojęcia podstawowe promotor sekwencja kodująca RNA terminator gen Gen - odcinek DNA zawierający zakodowaną informację wystarczającą

Bardziej szczegółowo

Mutacje jako źródło różnorodności wewnątrzgatunkowej

Mutacje jako źródło różnorodności wewnątrzgatunkowej Mutacje jako źródło różnorodności wewnątrzgatunkowej Zajęcia terenowe: Zajęcia w klasie: Poziom nauczania oraz odniesienie do podstawy programowej: Liceum IV etap edukacyjny zakres rozszerzony: Różnorodność

Bardziej szczegółowo

Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii

Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii 1. Technologia rekombinowanego DNA jest podstawą uzyskiwania genetycznie zmodyfikowanych organizmów 2. Medycyna i ochrona zdrowia

Bardziej szczegółowo

Jak analizować widmo IR?

Jak analizować widmo IR? Jak analizować widmo IR? Literatura: W. Zieliński, A. Rajca, Metody spektroskopowe i ich zastosowanie do identyfikacji związków organicznych. WNT. R. M. Silverstein, F. X. Webster, D. J. Kiemle, Spektroskopowe

Bardziej szczegółowo

Statystyczna analiza danych

Statystyczna analiza danych Statystyczna analiza danych ukryte modele Markowa, zastosowania Anna Gambin Instytut Informatyki Uniwersytet Warszawski plan na dziś Ukryte modele Markowa w praktyce modelowania rodzin białek multiuliniowienia

Bardziej szczegółowo

Motywy i podobieństwo

Motywy i podobieństwo Motywy i podobieństwo Całość funkcja Modularna budowa białek Elementy składowe czyli miejsca wiązania, domeny 1 Motywy Motyw jest opisem określonej części trójwymiarowej struktury zawierającym charakterystyczny

Bardziej szczegółowo

Generator testów Biochemia wer / Strona: 1

Generator testów Biochemia wer / Strona: 1 Przedmiot: Biochemia Odpowiedzi zaznaczamy TYLKO w tabeli! Nazwa testu: Biochemia wer. 1.0.4 Nr testu 14702843 Klasa: 3 IBOS 1. Insulina jest niewielkim białkiem horomonalnym A) nieposiadającym struktury

Bardziej szczegółowo

CHEMIA 12. Wzorcem konfiguracji względnej H C * OH HO C * H (odmiany L i D) jest aldehyd glicerynowy CH 2 OH CH 2 OH

CHEMIA 12. Wzorcem konfiguracji względnej H C * OH HO C * H (odmiany L i D) jest aldehyd glicerynowy CH 2 OH CH 2 OH INSTYTUT MEDICUS Kurs przygotowawczy do matury i rekrutacji na studia medyczne Rok 2017/2018 www.medicus.edu.pl tel. 501 38 39 55 CHEMIA 12 SACHARYDY. AMINOKWASY I BIAŁKA. IZOMERIA OPTYCZNA. IZOMERIA OPTYCZNA

Bardziej szczegółowo

Genomika Porównawcza. Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski

Genomika Porównawcza. Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski Genomika Porównawcza Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski 1 Plan prezentacji 1. Rodzaje i budowa drzew filogenetycznych 2. Metody ukorzeniania drzewa

Bardziej szczegółowo

Filogenetyka molekularna I. Krzysztof Spalik

Filogenetyka molekularna I. Krzysztof Spalik Filogenetyka molekularna I Krzysztof Spalik Literatura Krzysztof Spalik, Marcin Piwczyński (2009), Rekonstrukcja filogenezy i wnioskowanie filogenetyczne w badaniach ewolucyjnych, Kosmos 58(3-4): 485-498

Bardziej szczegółowo

Elementy bioinformatyki. Aminokwasy, białka, receptory. Andrzej Bąk Instytut Chemii UŚ chemoinformatyka wykład 1

Elementy bioinformatyki. Aminokwasy, białka, receptory. Andrzej Bąk Instytut Chemii UŚ chemoinformatyka wykład 1 Elementy bioinformatyki. Aminokwasy, białka, receptory Andrzej Bąk Instytut Chemii UŚ chemoinformatyka wykład 1 Tematy istoria odkrywania białek Budowa białek Budowa aminokwasów Właściwości aminokwasów

Bardziej szczegółowo

Ćwiczenie 1. Właściwości aminokwasów i białek

Ćwiczenie 1. Właściwości aminokwasów i białek Ćwiczenie 1. Właściwości aminokwasów i białek el ćwiczenia elem ćwiczenia jest poznanie niektórych reakcji charakterystycznych stosowanych przy wykrywaniu aminokwasów i białek. eakcje te umoŝliwiają odróŝnienie

Bardziej szczegółowo

Bezpośrednia embriogeneza somatyczna

Bezpośrednia embriogeneza somatyczna Bezpośrednia embriogeneza somatyczna Zarodki somatyczne formują się bezpośrednio tylko z tych komórek roślinnych, które są kompetentne już w momencie izolowania z rośliny macierzystej, czyli z proembriogenicznie

Bardziej szczegółowo

Do zapisu danych w pliku PDB używa się znaków ASCII o graficznej reprezentacji czyli:

Do zapisu danych w pliku PDB używa się znaków ASCII o graficznej reprezentacji czyli: plik PDB Do zapisu danych w pliku PDB używa się znaków ASCII o graficznej reprezentacji czyli: abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyz 1234567890 ` - = [ ] \ ; ',. / ~! @ # $ % ^ & * ( ) _

Bardziej szczegółowo

Właściwości błony komórkowej

Właściwości błony komórkowej Właściwości błony komórkowej płynność asymetria selektywna przepuszczalność Transport przez błony Cząsteczki < 150Da Błony - selektywnie przepuszczalne RóŜnice składu jonowego między wnętrzem komórki ssaka

Bardziej szczegółowo

Interfaza to niemal 90% cyklu komórkowego. Dzieli się na 3 fazy: G1, S i G2.

Interfaza to niemal 90% cyklu komórkowego. Dzieli się na 3 fazy: G1, S i G2. W wyniku podziału komórki powstaje komórka potomna, która ma o połowę mniej DNA od komórki macierzystej i jest o połowę mniejsza. Aby komórka potomna była zdolna do kolejnego podziału musi osiągnąć rozmiary

Bardziej szczegółowo

Bioinformatyka. z sylabusu... (wykład monograficzny) wykład 1. E. Banachowicz. Wykład monograficzny Bioinformatyka.

Bioinformatyka. z sylabusu... (wykład monograficzny) wykład 1. E. Banachowicz. Wykład monograficzny Bioinformatyka. Bioinformatyka (wykład monograficzny) wykład 1. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas z sylabusu... Wykład 1, 2006 1 Co to jest Bioinformatyka? Zastosowanie technologii

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

1. SACHARYDY W ŻYWNOŚCI - BUDOWA I PRZEKSZTAŁCENIA

1. SACHARYDY W ŻYWNOŚCI - BUDOWA I PRZEKSZTAŁCENIA Chemia żywności : praca zbiorowa. T. 2, Sacharydy, lipidy i białka / pod red. Zdzisława E. Sikorskiego ; aut. Bronisław Drozdowski [et al.]. wyd. 6, dodr. 2. Warszawa, 2014 Spis treści PRZEDMOWA 11 1.

Bardziej szczegółowo

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów Zawartość 139585 Wstęp 1. Historia wirusologii 2. Klasyfikacja wirusów 3. Struktura cząstek wirusowych 3.1. Metody określania struktury cząstek wirusowych 3.2. Budowa cząstek wirusowych o strukturze helikalnej

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Chromosomy - przypomnienie

Bardziej szczegółowo

Komputerowe wspomaganie projektowanie leków

Komputerowe wspomaganie projektowanie leków Komputerowe wspomaganie projektowanie leków wykład VI Prof. dr hab. Sławomir Filipek Grupa BIOmodelowania Uniwersytet Warszawski, Wydział Chemii oraz Centrum Nauk Biologiczno-Chemicznych Cent-III www.biomodellab.eu

Bardziej szczegółowo

Aminokwasy, peptydy, białka

Aminokwasy, peptydy, białka Aminokwasy, peptydy, białka Aminokwasy KWAS 1-AMINOCYKLOPROPANOKARBOKSYLOWY α AMINOKWAS KWAS 3-AMINOPROPANOWY β AMINOKWAS KWAS 4-AMINOPROPANOWY γ AMINOKWAS KWAS 2-AMINOETANOSULFONOWY β AMINOKWAS Aminokwasy

Bardziej szczegółowo

The influence of N-methylation on conformational properties of peptides with Aib residue. Roksana Wałęsa, Aneta Buczek, Małgorzata Broda

The influence of N-methylation on conformational properties of peptides with Aib residue. Roksana Wałęsa, Aneta Buczek, Małgorzata Broda The influence of N-methylation on conformational properties of peptides with ib residue. Roksana Wałęsa, neta Buczek, Małgorzata Broda Konformacje peptydów w W W w 2 Budowa białek 3 Modyfikacje peptydów

Bardziej szczegółowo

Azotowe związki organiczne

Azotowe związki organiczne strona 1/1 Azotowe związki organiczne Krystyna Bogdanowicz-Szwed Procesy zachodzące w żywych organizmach są ściśle związane z chemią wielofunkcyjnych związków organicznych zawierających w swoich cząsteczkach

Bardziej szczegółowo

Scenariusz lekcji chemii w klasie III gimnazjum. Temat lekcji: Białka skład pierwiastkowy, budowa, właściwości i reakcje charakterystyczne

Scenariusz lekcji chemii w klasie III gimnazjum. Temat lekcji: Białka skład pierwiastkowy, budowa, właściwości i reakcje charakterystyczne Scenariusz lekcji chemii w klasie III gimnazjum Temat lekcji: Białka skład pierwiastkowy, budowa, właściwości i reakcje charakterystyczne Czas trwania lekcji: 2x 45 minut Cele lekcji: 1. Ogólny zapoznanie

Bardziej szczegółowo

Zaoczne Liceum Ogólnokształcące Pegaz

Zaoczne Liceum Ogólnokształcące Pegaz WYMAGANIA EGZAMINACYJNE ROK SZKOLNY 2015/2016 Semestr jesienny TYP SZKOŁY: liceum ogólnokształcące PRZEDMIOT: biologia SEMESTR: II LICZBA GODZIN W SEMESTRZE: 15 PROGRAM NAUCZANIA: Program nauczania biologii

Bardziej szczegółowo

TEORIA KOMÓRKI (dlaczego istnieją osobniki?)

TEORIA KOMÓRKI (dlaczego istnieją osobniki?) Wstęp do biologii 2. TEORIA KOMÓRKI (dlaczego istnieją osobniki?) Jerzy Dzik Instytut Paleobiologii PAN Instytut Zoologii UW 2017 WSPÓLNE WŁAŚCIWOŚCI dzisiejszych organizmów procesy życiowe katalizowane

Bardziej szczegółowo