PODSTAWY BIOINFORMATYKI WYKŁAD 4 DOPASOWANIE SEKWENCJI

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "PODSTAWY BIOINFORMATYKI WYKŁAD 4 DOPASOWANIE SEKWENCJI"

Transkrypt

1 PODSTAWY BIOINFORMATYKI WYKŁAD 4 DOPASOWANIE SEKWENCJI

2 DOPASOWANIE SEKWENCJI 1. Dopasowanie sekwencji - definicja 2. Wizualizacja dopasowania sekwencji 3. Miary podobieństwa sekwencji 4. Przykłady programów 5. Podsumowanie

3 DOPASOWANIE SEKWENCJI Dopasowanie = przyrównanie (sequence alignment) Poszukiwanie ciągów znaków (zasad nukleotydowych lub reszt aminokwasowych), które posiadają to samo ułożenie w przyrównywanych sekwencjach gap, indel, match, mismatch ACAAAATGTA A C A - - A A A T G T A ACACTAGATA A C A C T A G A T - - A Stwierdzone różnice pomiędzy sekwencjami świadczą o mutacjach, które zaszły po rozdzieleniu się sekwencji od wspólnego przodka delecja, insercja, substytucja

4 DOPASOWANIE SEKWENCJI Podobieństwo sekwencji może wynikać z homologii lub homoplazji (konwergencji)

5 DOPASOWANIE SEKWENCJI

6 DOPASOWANIE (LICZBA SEKWENCJI) Pair-wise alignment (dwie sekwencje) Multiple sequence alignment (wiele sekwencji)

7 DOPASOWANIE (POKRYCIE SEKWENCJI) GLOBALNE Obejmuje całe sekwencje Sekwencje podobne na całej długości Bliskie pokrewieństwo, podobna długość LOKALNE Identyfikacja podobnych regionów w obrębie przyrównanych sekwencji Sekwencje o różnych długościach Sekwencje o niskim poziomie podobieństwa Wiele możliwych dopasowań

8 SEKWENCJE NUKLOETYDÓW

9 DOPASOWANIE SEKWENCJI NUKLEOTYDÓW WYBÓR NAJLEPSZEGO DOPASOWANIA g c t g a a c g c t a t a a t c g c t g a a c g c t a t a a t c g c t g a a c g c t a t a a t c g c t g a - a - - c g - - c t - a t a a t c g c t g - a a - c g - c t a t a a t c -

10 WYBÓR NAJLEPSZEGO DOPASOWANIA Miary określające jakość dopasowania miary zróżnicowania sekwencji miary podobieństwa sekwencji wizualizacja podobieństwa (dot-matrix)

11 MIARA ZRÓŻNICOWANIA SEKWENCJI NUKLEOTYDÓW ODLEGŁOŚĆ HAMMINGA: Liczba pozycji różniących się literami Łańcuchy o równych długościach g c t g a a c g c t a t a a t c = 6 ODLEGŁOŚĆ LEVENSHTEINA: Minimalna liczba operacji potrzebna do zmiany jednego łańcucha w drugi Dozwolone operacje: insercja, delecja, mutacja punktowa - zmiana litery Łańcuchy o różnych długościach c - - t g a a c c t a t a a t c = 4

12 MIARA PODOBIEŃSTWA SEKWENCJI NUKLEOTYDÓW PROSTA: np. Różne litery -1 Jednakowe litery +1 ZŁOŻONA np.: g c t g a a c g c t a t a a t c Tranzwersja (a,g) (t,c) 0 Tranzycja (a g lub c t) 1 Jednakowe 2 g c t g a a c g c t a t a a t c = -4 Model Kimury = 6

13 PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW TABELE KODOWANIA ZDARZEŃ Jednakowe litery Różne litery Rozpoczęcie przerwy Kontynuacja przerwy Penalizacja afiniczna łatwiej poszerzyć przerwę niż otworzyć nową -12/-1 pkt

14 WYBÓR NAJLEPSZEGO DOPASOWANIA Algorytmy dopasowania sekwenecji 1. macierze punktowe (dot-matrix) 2. programowanie dynamiczne (dynamic programming) 3. metody słowne (k tuple methods)

15 DOT-MATRIX P O D S T A W Y B I O I N F O R M A T Y K I B I O I N F O R M A T Y K A P O D S T A W Y B I O I N F O R M A T Y K I B I O I N F O R M A T Y K A P O D S T A W Y B I O I N F O R M A T Y K I B B I I O O I I N N F F O O R R M M A A T T Y Y K K A

16 DOT-MATRIX B I O L O G I A P O D S T A W Y B I O I N F O R M A T Y K I B I O L O G I A B I O I N F O R M A T Y K A B I O L O G I A P O D S T A W Y B I O I N F O R M A T Y K I B I O L O G I A B I O I N F O R M A T Y K A B I O L O G I A P O D S T A W Y B I O I N F O R M A T Y K I B I O L O G I A B I O I N F O R M A T Y K A

17 DOT-MATRIX DOPASOWANIE: Leptyna Homo sapiens Leptyna Mus musculus

18 DOT-MATRIX DOPASOWANIE: Leptyna Homo sapiens Leptyna Mus musculus

19 DOT-MATRIX DOPASOWANIE: Leptyna Homo sapiens Leptyna Mus musculus

20 DOT-MATRIX DOPASOWANIE: Leptyna Homo sapiens Leptyna Mus musculus

21 Leptyna Mus musculus DOT-MATRIX DOPASOWANIE: Leptyna Homo sapiens

22 DOT-MATRIX DOPASOWANIE: Leptyna Homo sapiens Leptyna Takifugu rubripes

23 Leptyna Homo sapiens DOT-MATRIX DOPASOWANIE: Leptyna Homo sapiens Leptyna Takifugu rubripes Leptyna Takifugu rubripes

24 DOT-MATRIX DOPASOWANIE: Leptyna Homo sapiens Leptyna Mus musculus DOPASOWANIE: Leptyna Homo sapiens Leptyna Takifugu rubripes

25 Analiza dwuwymiarowej macierzy z naniesionymi wartościami ocen dopasowania danych reszt wyznaczenie ścieżki Ścieżka reprezentująca najlepsze przyrównanie, ma najwyższą możliwą wartość punktacji Identyczne reszty = 1 Brak skojarzenia = 0 Kara = -1 Jaki jest score? Xiong J., Podstawy bioinformatyki 25

26 METODY HEURYSTYCZNE WYKORZYSTANIE METODY SŁOWNEJ Sprawdzenie tylko części przyrównań, które byłyby analizowane zwykłymi metodami programowania dynamicznego znaczne przyspieszenie (50-100x)! Zmniejszenie czułości i specyficzności Nie gwarantuje poprawnego wygenerowania przyrównania Użyteczna, gdy pełny algorytm jest z przyczyn technicznych zbyt kosztowny lub gdy jest nieznany Magda Mielczarek Podstawy bioinformatyki

27 LOKALNE PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW BLAST Basic Local Alignment Search Tool BLASTN przyrównanie nukleotydów blast.ncbi.nlm.nih.gov poszukuje regionów genomu o wysokim dopasowaniu do danej sekwencji

28 LOKALNE PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW BLAST Przeszukuje połączone światowe bazy danych sekwencji kwasów nukleinowych (lub białkowych) wykorzystując podaną sekwencję jako zapytanie Przyrównuje sekwencję z innymi sekwencjami dostępnymi w bazie Poszukuje wysoko punktowanych, ciągłych segmentów pokrewnych sekwencji

29 BLAST Etapy działania: Tworzenie listy słów analizowanej sekwencji (słowo to np. 10 nukleotydów) Wyszukanie słów w sekwencyjnej bazie danych (identyfikacja sekwencji, z którymi zapytanie będzie skojarzone) Ocena (macierz substytucji) Przyrównanie parami poprzez rozszerzanie słów w obu kierunkach, ocena (wartość graniczna) Podstawy bioinformatyki

30 GLOBALNE PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW CLUSTAL-OMEGA

31 GLOBALNE PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW

32 PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW

33 PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW DOPASOWANIE SEKWENCJI NUKLEOTYDÓW: Leptyna Homo sapiens Leptyna Mus musculus

34 PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW DOPASOWANIE SEKWENCJI NUKLEOTYDÓW: Leptyna Homo sapiens Leptyna Mus musculus

35 PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW DOPASOWANIE SEKWENCJI NUKLEOTYDÓW: Leptyna Homo sapiens Leptyna Mus musculus

36 PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW DOPASOWANIE: Leptyna Homo sapiens Leptyna Takifugu rubripes

37 PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW DOPASOWANIE: Leptyna Homo sapiens Leptyna Takifugu rubripes

38 PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW DOPASOWANIE: Homo sapiens Mus musculus Takifugu rubripes Copyright 2014, Joanna Szyda

39 RODZINA PROGRAMÓW CLUSTAL Metoda progresywna etapowe składanie przyrównania na podstawie podobieństwa par sekwencji

40 LOKALNE PRZYRÓWNANIE SEKWENCJI NUKLEOTYDÓW Andy Baxevanis Biological Sequence Analysis https://www.youtube.com/watch?v=z72nvsuteng

41 MIARY PODOBIEŃSTWA SEKWENCJI AMINOKWASÓW

42 DOPASOWYWANIE SEKWENCJI 1. Miary podobieństwa sekwencji aminokwasów 2. Zastosowanie programów: CLUSTAL BLAST

43 MIARA PODOBIEŃSTWA SEKWENCJI AMINOKWASÓW KODOWANIE ZDARZEŃ odzwierciedlenie właściwości fizykochemicznych 1. Sekwencje różnicują się na drodze ewolucji uwzględnienie prawdopodobieństwa poszczególnych mutacji wśród wszystkich białek o znanej sekwencji i odległości ewolucyjnej 2. Konsekwencje metaboliczne mutacji uwzględnienie czy zmiana aminokwasu powoduje zmianę konformacji = funkcji białka 3. Najczęściej wykorzystywane tabele PAM BLOSUM

44 MIARA PODOBIEŃSTWA SEKWENCJI AMINOKWASÓW TABELE PAM 1. Point Accepted Mutation (akceptowane mutacje punktowe) 2. Tabele opracowano dla różnych odległości ewolucyjnych między sekwencjami, np. PAM1 sekwencje różniące się 1% aminokwasów = blisko spokrewnionych PAM250 - sekwencje różniące się 80% aminokwasów = daleko spokrewnionych

45 MIARA PODOBIEŃSTWA SEKWENCJI AMINOKWASÓW TABELA PAM250 C 12 G -3 5 P S A T D E N Q H K R V M I L F Y W C G P S A T D E N Q H K R V M I L Copyright F 2017, Y J. WSzyda & M. Mielczarek

46 MIARA PODOBIEŃSTWA SEKWENCJI AMINOKWASÓW TABELE BLOSUM 1. Blocks Substitution Matrix 2. Tabele opracowano na podstawie danych z bazy danych BLOCKS wykorzystując prawdopodobieństwo mutacji w zakonserwowanych regionach 3. przy różnych założeniach dotyczących interpretacji sekwencji o dużym podobieństwie BLOSUM62 sekwencje o ponad 62% aminokwasów identycznych są traktowane jako wspólna grupa ewolucyjna BLOSUM45 sekwencje o ponad 45% aminokwasów identycznych są traktowane jako wspólna grupa ewolucyjna

47 MIARA PODOBIEŃSTWA SEKWENCJI AMINOKWASÓW TABELA BLOSUM45 G 7 P -2 9 D E N H Q K R S T A M V I L F Y W C G P D E N H Q K R S T A M V I L F Copyright Y 2017, W J. CSzyda & M. Mielczarek

48 MIARA PODOBIEŃSTWA SEKWENCJI AMINOKWASÓW INTERPRETACJA WARTOŚCI W TABELACH PAM i BLOSUM I L F Y W C G P D E N H Q K R S T A M V I L F Y W C 1. Mutacja Izoleucyna Valina jest bardziej prawdopodobna = +3, niż Izoleucyna Cysteina = Mutacja Izoleucyna Valina zachodzi = częściej niż średni poziom mutacji dla wszystkich aminokwasów 3. Mutacja Izoleucyna Cysteina zachodzi = rzadziej niż średni poziom mutacji dla wszystkich aminokwasów

49 MIARA PODOBIEŃSTWA SEKWENCJI AMINOKWASÓW 1. BLOSUM90 krótkie, bardzo podobne fragmenty 2. BLOSUM61 ogólne przyrównanie 3. BLOSUM30 mniej podobne sekwencje

50 PORÓWNANIE PAM I BLOSUM 1. PAM (oprócz PAM1) opracowane na podstawie danych wyprowadzonych z modli ewolucyjnych / BLOSUM wyniki bezpośrednich obserwacji 2. PAM zalecane do rekonstrukcji drzew filogenetycznych / BLOSUM przeszukiwanie baz danych i poszukiwanie konserwatywnych domen białkowych

51 DOPASOWANIE SEKWENCJI AMINOKWASÓW

52 DOPASOWANIE SEKWENCJI AMINOKWASÓW DOPASOWANIE SEKWENCJI AMINOKWASÓW: Beta-2-mikroglobulina Homo sapiens Beta-2- mikroglobulina Mus musculus 1. Gen zaliczany do tzw. Houskeeping genes wysoki poziom zakonserwowania sekwencji 2. Baza danych UniProt: Homo sapiens Mus musculus

53 DOPASOWANIE SEKWENCJI AMINOKWASÓW

54 DOPASOWANIE SEKWENCJI AMINOKWASÓW CLUSTAL-OMEGA

55 DOPASOWANIE SEKWENCJI AMINOKWASÓW Beta-2-mikroglobulina: Homo sapiens Mus musculus KODY KOLORÓW: KODY DOPASOWANIA: małe [ * ] identyczne kwasowe [ : ] substytucja konserwatywna wymiana w obrębie podstawowy grupy o podobnej strukturze i właściwościach grupa hydroksylowa [. ] substytucja semikonserwatywna wymiana w obrębie inne grupy tylko o podobnej strukturze

56 DOPASOWANIE SEKWENCJI AMINOKWASÓW Beta-2-mikroglobulina: Homo sapiens Mus musculus Danio rerio Gallus gallus

57 DOPASOWANIE SEKWENCJI AMINOKWASÓW Beta-2-mikroglobulina: Homo sapiens Mus musculus Danio rerio Gallus gallus

58 DOPASOWANIE SEKWENCJI AMINOKWASÓW BLAST

59 DOPASOWANIE SEKWENCJI AMINOKWASÓW BLAST

PODSTAWY BIOINFORMATYKI 8 DOPASOWYWANIE SEKWENCJI AMINOKWASÓW

PODSTAWY BIOINFORMATYKI 8 DOPASOWYWANIE SEKWENCJI AMINOKWASÓW PODSTAWY BIOINFORMATYKI 8 DOPASOWYWANIE SEKWENCJI AMINOKWASÓW DOPASOWYWANIE SEKWENCJI 1. Miary podobieństwa sekwencji aminokwasów 2. Zastosowanie programów: CLUSTAL OMEGA BLAST Copyright 2013, Joanna Szyda

Bardziej szczegółowo

Przyrównanie sekwencji. Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu

Przyrównanie sekwencji. Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Przyrównanie sekwencji Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Sequence alignment - przyrównanie sekwencji Poszukiwanie ciągów znaków (zasad nukleotydowych lub reszt aminokwasowych),

Bardziej szczegółowo

Dopasowywanie sekwencji (ang. sequence alignment) Metody dopasowywania sekwencji. Homologia a podobieństwo sekwencji. Rodzaje dopasowania

Dopasowywanie sekwencji (ang. sequence alignment) Metody dopasowywania sekwencji. Homologia a podobieństwo sekwencji. Rodzaje dopasowania Wprowadzenie do Informatyki Biomedycznej Wykład 2: Metody dopasowywania sekwencji Wydział Informatyki PB Dopasowywanie sekwencji (ang. sequence alignment) Dopasowywanie (przyrównywanie) sekwencji polega

Bardziej szczegółowo

Dopasowanie sekwencji Sequence alignment. Bioinformatyka, wykłady 3 i 4 (19, 26.X.2010)

Dopasowanie sekwencji Sequence alignment. Bioinformatyka, wykłady 3 i 4 (19, 26.X.2010) Dopasowanie sekwencji Sequence alignment Bioinformatyka, wykłady 3 i 4 (19, 26.X.2010) krzysztof_pawlowski@sggw.pl terminologia alignment 33000 dopasowanie sekwencji 119 uliniowienie sekwencji 82 uliniowianie

Bardziej szczegółowo

Porównywanie i dopasowywanie sekwencji

Porównywanie i dopasowywanie sekwencji Porównywanie i dopasowywanie sekwencji Związek bioinformatyki z ewolucją Wraz ze wzrostem dostępności sekwencji DNA i białek narodziła się nowa dyscyplina nauki ewolucja molekularna Ewolucja molekularna

Bardziej szczegółowo

Bioinformatyka. (wykład monograficzny) wykład 5. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM

Bioinformatyka. (wykład monograficzny) wykład 5. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM Bioinformatyka (wykład monograficzny) wykład 5. E. Banachowicz Zakład Biofizyki Molekularnej IF UM http://www.amu.edu.pl/~ewas lgorytmy macierze punktowe (DotPlot) programowanie dynamiczne metody heurystyczne

Bardziej szczegółowo

Przyrównywanie sekwencji

Przyrównywanie sekwencji Instytut Informatyki i Matematyki Komputerowej UJ, opracowanie: mgr Ewa Matczyńska, dr Jacek Śmietański Przyrównywanie sekwencji 1. Porównywanie sekwencji wprowadzenie Sekwencje porównujemy po to, aby

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

dopasowanie sekwencji Porównywanie sekwencji Etapy dopasowywania sekwencji Homologia, podobieństwo i analogia

dopasowanie sekwencji Porównywanie sekwencji Etapy dopasowywania sekwencji Homologia, podobieństwo i analogia Porównywanie sekwencji Homologia, podobieństwo i analogia dopasowanie sekwencji Dopasowanie/porównywanie Uliniowienie Alignment W bioinformatyce, dopasowanie sekwencji jest sposobem dopasowania struktur

Bardziej szczegółowo

Dopasowanie par sekwencji

Dopasowanie par sekwencji BIOINFORMTYK edycja 2016 / 2017 wykład 3 Dopasowanie par sekwencji dr Jacek Śmietański jacek.smietanski@ii.uj.edu.pl http://jaceksmietanski.net Plan wykładu 1. Idea i cele dopasowania sekwencji 2. Definicje

Bardziej szczegółowo

Generator testów Bioinformatyka wer / 0 Strona: 1

Generator testów Bioinformatyka wer / 0 Strona: 1 Przedmiot: Nazwa przedmiotu Nazwa testu: Bioinformatyka wer. 1.0.6 Nr testu 0 Klasa: V zaoczne WNB UZ Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Analiza porównawcza białek zwykle zaczyna się na badaniach

Bardziej szczegółowo

Dopasowanie sekwencji c.d. Sequence alignment. Bioinformatyka, wykład 5 (16.XI.2010) krzysztof_pawlowski@sggw.pl

Dopasowanie sekwencji c.d. Sequence alignment. Bioinformatyka, wykład 5 (16.XI.2010) krzysztof_pawlowski@sggw.pl Dopasowanie sekwencji c.d. Sequence alignment Bioinformatyka, wykład 5 (16.XI.2010) krzysztof_pawlowski@sggw.pl dopasowanie - metody dopasowanie par sekwencji: Macierz punktów - dot matrix, dotplot Programowanie

Bardziej szczegółowo

Generator testów bioinformatyka wer / Strona: 1

Generator testów bioinformatyka wer / Strona: 1 Przedmiot: wyklad monograficzny Nazwa testu: bioinformatyka wer. 1.0.6 Nr testu 10469906 Klasa: 5 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Aminokwas jest to związek organiczny zawierający A) grupę

Bardziej szczegółowo

Generator testów 1.3.1 Bioinformatyka_zdalne wer. 1.0.13 / 0 Strona: 1

Generator testów 1.3.1 Bioinformatyka_zdalne wer. 1.0.13 / 0 Strona: 1 Przedmiot: Bioinformatyka Nazwa testu: Bioinformatyka_zdalne wer. 1.0.13 Nr testu 0 Klasa: WNB UZ Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Model Markowa substytucji aminokwasów w mutagenezie białek zakłada...

Bardziej szczegółowo

Bioinformatyka. Porównywanie sekwencji

Bioinformatyka. Porównywanie sekwencji Bioinformatyka Wykład 5 E. Banachowicz Zakład Biofizyki Molekularnej IF UM 1 http://www.amu.edu.pl/~ewas Porównywanie sekwencji Pierwsze pytanie biologa molekularnego, kiedy odkryje nową sekwencję: zy

Bardziej szczegółowo

Algorytmy kombinatoryczne w bioinformatyce

Algorytmy kombinatoryczne w bioinformatyce lgorytmy kombinatoryczne w bioinformatyce wykład 4: dopasowanie sekwencj poszukiwanie motywów prof. dr hab. inż. Marta Kasprzak Instytut Informatyk Politechnika Poznańska Dopasowanie sekwencji Badanie

Bardziej szczegółowo

Dopasowanie sekwencji c.d. Sequence alignment. Bioinformatyka, wykład 5 (6.XI.2012) krzysztof_pawlowski@sggw.pl

Dopasowanie sekwencji c.d. Sequence alignment. Bioinformatyka, wykład 5 (6.XI.2012) krzysztof_pawlowski@sggw.pl Dopasowanie sekwencji c.d. Sequence alignment Bioinformatyka, wykład 5 (6.XI.2012) krzysztof_pawlowski@sggw.pl Dopasowanie sekwencji - znaczenie Podobieństwo porównywanych sekwencji (similarity) może świadczyć

Bardziej szczegółowo

Analizy filogenetyczne

Analizy filogenetyczne BIOINFORMATYKA edycja 2016 / 2017 wykład 6 Analizy filogenetyczne dr Jacek Śmietański jacek.smietanski@ii.uj.edu.pl http://jaceksmietanski.net Plan wykładu 1. Cele i zastosowania 2. Podstawy ewolucyjne

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI 6 BAZA DANYCH NCBI - II

PODSTAWY BIOINFORMATYKI 6 BAZA DANYCH NCBI - II PODSTAWY BIOINFORMATYKI 6 BAZA DANYCH NCBI - II BAZA DANYCH NCBI 1. NCBI 2. Dane gromadzone przez NCBI 3. Przegląd baz danych NCBI: Publikacje naukowe Projekty analizy genomów OMIM: fenotypy człowieka

Bardziej szczegółowo

Bioinformatyka 2 (BT172) Struktura i organizacja kursu

Bioinformatyka 2 (BT172) Struktura i organizacja kursu Bioinformatyka 2 (BT172) Wykład 1 Struktura i organizacja kursu dr Krzysztof Murzyn adiunkt w Zakładzie Biofizyki WBtUJ pok. B028, tel. 664-6379 10.X.2005 PODSTAWOWE INFORMACJE 9 godz. wykładów (45 min,

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta

Bioinformatyka Laboratorium, 30h. Michał Bereta Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecność Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

Motywy i podobieństwo

Motywy i podobieństwo Motywy i podobieństwo Całość funkcja Modularna budowa białek Elementy składowe czyli miejsca wiązania, domeny 1 Motywy Motyw jest opisem określonej części trójwymiarowej struktury zawierającym charakterystyczny

Bardziej szczegółowo

Ewolucja molekularna człowieka okiem bioinformatyka. Justyna Wojtczak Jarosław Jeleniewicz

Ewolucja molekularna człowieka okiem bioinformatyka. Justyna Wojtczak Jarosław Jeleniewicz Ewolucja molekularna człowieka okiem bioinformatyka Justyna Wojtczak Jarosław Jeleniewicz Informatyka w biologii - bioinformatyka Jest to szeroka dziedzina zajmująca się tworzeniem zaawansowanych baz danych,

Bardziej szczegółowo

Porównywanie sekwencji białkowych

Porównywanie sekwencji białkowych Bioinformatyka -9 Bioinformatyka Wykład 4. E. Banachowicz Zakład Biofizyki Molekularnej http://www.amu.edu.pl/~ewas Porównywanie sekwencji białkowych Wykład 4, Bioinformatyka -9 Porównywanie sekwencji

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI

PODSTAWY BIOINFORMATYKI PODSTAWY BIOINFORMATYKI Prowadzący: JOANNA SZYDA ADRIAN DROśDś WSTĘP 1. Katedra Genetyki badania bioinformatyczne 2. Tematyka przedmiotu 3. Charakterystyka wykładów 4. Charakterystyka ćwiczeń 5. Informacje

Bardziej szczegółowo

Bioinformatyka II Modelowanie struktury białek

Bioinformatyka II Modelowanie struktury białek Bioinformatyka II Modelowanie struktury białek 1. Który spośród wymienionych szablonów wybierzesz do modelowania? Dlaczego? Struktura krystaliczną czy NMR (to samo białko, ta sama rozdzielczość)? Strukturę

Bardziej szczegółowo

Genomika Porównawcza. Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski

Genomika Porównawcza. Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski Genomika Porównawcza Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski 1 Plan prezentacji 1. Rodzaje i budowa drzew filogenetycznych 2. Metody ukorzeniania drzewa

Bardziej szczegółowo

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność Wersja 1.05 Wprowadzenie do Informatyki Biomedycznej Wykład 3: Wyszukiwanie w bazach sekwencji Przewidywanie genów Wydział Informatyki PB Marek Krętowski pokój 206 e-mail: m.kretowski@pb.edu.pl http://aragorn.pb.bialystok.pl/~mkret

Bardziej szczegółowo

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański BIOINFORMATYKA edycja 2016 / 2017 wykład 11 RNA dr Jacek Śmietański jacek.smietanski@ii.uj.edu.pl http://jaceksmietanski.net Plan wykładu 1. Rola i rodzaje RNA 2. Oddziaływania wewnątrzcząsteczkowe i struktury

Bardziej szczegółowo

Samouczek: Konstruujemy drzewo

Samouczek: Konstruujemy drzewo ROZDZIAŁ 2 Samouczek: Konstruujemy drzewo Po co nam drzewa filogenetyczne? Drzewa filogenetyczne często pojawiają się dzisiaj w pracach z dziedziny biologii molekularnej, które nie mają związku z filogenetyką

Bardziej szczegółowo

Księgarnia PWN: A.D. Baxevanis, B.F.F. Ouellette Bioinformatyka

Księgarnia PWN: A.D. Baxevanis, B.F.F. Ouellette Bioinformatyka Księgarnia PWN: A.D. Baxevanis, B.F.F. Ouellette Bioinformatyka Słowo wstępne XIII Przedmowa XV 1. Bioinformatyka i Internet Andreas D. Baxevanis 1 1.1. Podstawy Internetu 2 1.2. Połączenie z Internetem

Bardziej szczegółowo

MSA i analizy filogenetyczne

MSA i analizy filogenetyczne Instytut Informatyki i Matematyki Komputerowej UJ, opracowanie: mgr Ewa Matczyńska, dr Jacek Śmietański MSA i analizy filogenetyczne 1. Dopasowania wielosekwencyjne - wprowadzenie Dopasowanie wielosekwencyjne

Bardziej szczegółowo

Spis treści 8 Ewolucja molekularna... 87. 9 Ewolucyjne podstawy porównywania sekwencji... 87. 9.1 Identyfikacja sekwencji i jej funkcji...

Spis treści 8 Ewolucja molekularna... 87. 9 Ewolucyjne podstawy porównywania sekwencji... 87. 9.1 Identyfikacja sekwencji i jej funkcji... Spis treści 8 Ewolucja molekularna... 87 9 Ewolucyjne podstawy porównywania sekwencji... 87 9.1 Identyfikacja sekwencji i jej funkcji... 87 9.2 Homologia... 88 9.3 Modele ewolucji sekwencji białkowej...

Bardziej szczegółowo

Porównywanie sekwencji białek i kwasów nukleinowych

Porównywanie sekwencji białek i kwasów nukleinowych Porównywanie sekwencji białek i kwasów nukleinowych Krzysztof Lewiński 1. Podobieństwo i jego miara Wprawdzie podobieństwo jest pojęciem często używanym w życiu codziennym ale nie oznacza to, że możemy

Bardziej szczegółowo

Bioinformatyka wykład 8, 27.XI.2012

Bioinformatyka wykład 8, 27.XI.2012 Bioinformatyka wykład 8, 27.XI.2012 białkowa bioinformatyka strukturalna c.d. krzysztof_pawlowski@sggw.pl 2013-01-21 1 Plan wykładu regiony nieuporządkowane sposoby przedstawienia struktur białkowych powierzchnia

Bardziej szczegółowo

MACIERZE MUTACYJNE W ANALIZIE GENOMÓW czy możliwa jest rekonstrukcja filogenetyczna? Aleksandra Nowicka

MACIERZE MUTACYJNE W ANALIZIE GENOMÓW czy możliwa jest rekonstrukcja filogenetyczna? Aleksandra Nowicka MAIERZE MUTAYJNE W ANALIZIE GENOMÓW czy możliwa jest rekonstrukcja filogenetyczna? Aleksandra Nowicka Zadaniem FILOGENETYKI jest : zrekonstruowanie ewolucyjnej historii wszystkich organizmów odkrycie przodka

Bardziej szczegółowo

W kierunku równoległej implementacji pakietu T-Coffee

W kierunku równoległej implementacji pakietu T-Coffee W kierunku równoległej implementacji pakietu T-Coffee Adrian Rospondek 1 1 Wydział Inżynierii Mechanicznej i Informatyki Kierunek Informatyka, Rok V a.rospondek@poczta.fm Streszczenie Artykuł ten prezentuje

Bardziej szczegółowo

ANALIZA DANYCH POCHODZĄCYCH Z SEKWENCJONOWANIA NASTĘPNEJ GENERACJI

ANALIZA DANYCH POCHODZĄCYCH Z SEKWENCJONOWANIA NASTĘPNEJ GENERACJI ANALIZA DANYCH POCHODZĄCYCH Z SEKWENCJONOWANIA NASTĘPNEJ GENERACJI JOANNA SZYDA MAGDALENA FRĄSZCZAK MAGDA MIELCZAREK WSTĘP 1. Katedra Genetyki 2. Pracownia biostatystyki 3. Projekty NGS 4. Charakterystyka

Bardziej szczegółowo

Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna

Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna Przedmowa...................................................... 1 1. Rewolucja informatyczna w naukach biomedycznych...........................

Bardziej szczegółowo

Bioinformatyka 2 (BT172) Progresywne metody wyznaczania MSA: T-coffee

Bioinformatyka 2 (BT172) Progresywne metody wyznaczania MSA: T-coffee Bioinformatyka 2 (BT172) Wykład 5 Progresywne metody wyznaczania MSA: T-coffee Krzysztof Murzyn 14.XI.2005 PLAN WYKŁADU Ostatnio : definicje, zastosowania MSA, złożoność obliczeniowa algorytmu wyznaczania

Bardziej szczegółowo

RMSD - Ocena jakości wybranych molekularnych struktur przestrzennych

RMSD - Ocena jakości wybranych molekularnych struktur przestrzennych RMSD - Ocena jakości wybranych molekularnych struktur przestrzennych Joanna Wiśniewska Promotor: dr inż. P. Łukasiak Spis treści 1. Zakres pracy magisterskiej 2. Struktura białka 3. Struktura kwasów nukleionowych

Bardziej szczegółowo

MultiSETTER: web server for multiple RNA structure comparison. Sandra Sobierajska Uniwersytet Jagielloński

MultiSETTER: web server for multiple RNA structure comparison. Sandra Sobierajska Uniwersytet Jagielloński MultiSETTER: web server for multiple RNA structure comparison Sandra Sobierajska Uniwersytet Jagielloński Wprowadzenie Budowa RNA: - struktura pierwszorzędowa sekwencja nukleotydów w łańcuchu: A, U, G,

Bardziej szczegółowo

Wykład 10 2008-04-30. Bioinformatyka. Wykład 9. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM

Wykład 10 2008-04-30. Bioinformatyka. Wykład 9. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM Bioinformatyka Wykład 9 E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas 1 Konsekwencje zestawieo wielu sekwencji - rodziny białkowe, domeny, motywy i wzorce 2 Bioinformatyka,

Bardziej szczegółowo

Statystyczna analiza danych

Statystyczna analiza danych Statystyczna analiza danych ukryte modele Markowa, zastosowania Anna Gambin Instytut Informatyki Uniwersytet Warszawski plan na dziś Ukryte modele Markowa w praktyce modelowania rodzin białek multiuliniowienia

Bardziej szczegółowo

FILOGENETYKA. Bioinformatyka, wykład 7 (24.XI.200..XI.2008)

FILOGENETYKA. Bioinformatyka, wykład 7 (24.XI.200..XI.2008) FILOGENETYKA Bioinformatyka, wykład 7 (24.XI.200.XI.2008) krzysztof_pawlowski@sggw.pl Filogenetyka Cel rekonstrukcja historii ewolucji wszystkich organizmów. Klasyczne podejście: historia ewolucji jest

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Bioinformatyka II Modelowanie struktury białek

Bioinformatyka II Modelowanie struktury białek Bioinformatyka II Modelowanie struktury białek 1. Który spośród wymienionych szablonów wybierzesz do modelowania dla każdego z podanych przypadków? Dlaczego? Struktura krystaliczną czy NMR (to samo białko,

Bardziej szczegółowo

FILOGENETYKA. Bioinformatyka, wykład. 8 c.d. 0)

FILOGENETYKA. Bioinformatyka, wykład. 8 c.d. 0) FILOGENETYKA Bioinformatyka, wykład 8 c.d. (7.XII.2010) 0) krzysztof_pawlowski@sggw.pl Filogenetyka Cel rekonstrukcja historii ewolucji wszystkich organizmów. Klasyczne podejście: historia ewolucji jest

Bardziej szczegółowo

FILOGENETYKA. Bioinformatyka,, wykład 7 (29.XI.2007)

FILOGENETYKA. Bioinformatyka,, wykład 7 (29.XI.2007) FILOGENETYKA Bioinformatyka,, wykład 7 (29.XI.2007) krzysztof_pawlowski@sggw.pl Filogenetyka Cel rekonstrukcja historii ewolucji wszystkich organizmów. Klasyczne podejście: historia ewolucji jest odtwarzana

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Wykład Bioinformatyka 2012-09-24. Bioinformatyka. Wykład 7. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM. Ewolucyjne podstawy Bioinformatyki

Wykład Bioinformatyka 2012-09-24. Bioinformatyka. Wykład 7. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM. Ewolucyjne podstawy Bioinformatyki Bioinformatyka Wykład 7 E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas 1 Plan Bioinformatyka Ewolucyjne podstawy Bioinformatyki Filogenetyka Bioinformatyczne narzędzia

Bardziej szczegółowo

Filogenetyka molekularna I. Krzysztof Spalik

Filogenetyka molekularna I. Krzysztof Spalik Filogenetyka molekularna I Krzysztof Spalik Literatura Krzysztof Spalik, Marcin Piwczyński (2009), Rekonstrukcja filogenezy i wnioskowanie filogenetyczne w badaniach ewolucyjnych, Kosmos 58(3-4): 485-498

Bardziej szczegółowo

Ćwiczenia nr 5. Wykorzystanie baz danych i narzędzi analitycznych dostępnych online

Ćwiczenia nr 5. Wykorzystanie baz danych i narzędzi analitycznych dostępnych online Techniki molekularne ćw. 5 1 z 13 Ćwiczenia nr 5. Wykorzystanie baz danych i narzędzi analitycznych dostępnych online I. Zasoby NCBI Strona: http://www.ncbi.nlm.nih.gov/ stanowi punkt startowy dla eksploracji

Bardziej szczegółowo

Bioinformatyka wykład 3.I.2008

Bioinformatyka wykład 3.I.2008 Bioinformatyka wykład 3.I.2008 Białkowa bioinformatyka strukturalna c.d. krzysztof_pawlowski@sggw.pl 2008-01-03 1 Plan wykładu analiza i porównywanie struktur białek. doświadczalne metody badania struktur

Bardziej szczegółowo

Filogenetyka molekularna I. Krzysztof Spalik Zakład Filogenetyki Molekularnej i Ewolucji

Filogenetyka molekularna I. Krzysztof Spalik Zakład Filogenetyki Molekularnej i Ewolucji Filogenetyka molekularna I Krzysztof Spalik Zakład Filogenetyki Molekularnej i Ewolucji 3 Literatura Krzysztof Spalik, Marcin Piwczyński (2009), Rekonstrukcja filogenezy i wnioskowanie filogenetyczne w

Bardziej szczegółowo

Urszula Poziomek, doradca metodyczny w zakresie biologii Materiał dydaktyczny przygotowany na konferencję z cyklu Na miarę Nobla, 14 stycznia 2010 r.

Urszula Poziomek, doradca metodyczny w zakresie biologii Materiał dydaktyczny przygotowany na konferencję z cyklu Na miarę Nobla, 14 stycznia 2010 r. Ćwiczenie 1 1 Wstęp Rozważając możliwe powiązania filogenetyczne gatunków, systematyka porównuje dane molekularne. Najskuteczniejszym sposobem badania i weryfikacji różnych hipotez filogenetycznych jest

Bardziej szczegółowo

Podstawy bioinformatyki dla biotechnologów

Podstawy bioinformatyki dla biotechnologów dla biotechnologów Wykład 3 alignment Wykład 2 Porównywanie sekwencji Homologia, podobieństwo i analogia Wykład 2; slajd 2 Duplikacja, specjacja Wykład 2; slajd 3 Homologi Ortologi homologiczne geny, których

Bardziej szczegółowo

Acknowledgement. Drzewa filogenetyczne

Acknowledgement. Drzewa filogenetyczne Wykład 8 Drzewa Filogenetyczne Lokalizacja genów Some figures from: Acknowledgement M. Zvelebil, J.O. Baum, Introduction to Bioinformatics, Garland Science 2008 Tradycyjne drzewa pokrewieństwa Drzewa oparte

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecnośd Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

WIZUALIZACJA ALGORYTMÓW OPTYMALNEGO DOPASOWANIA SEKWENCJI NUKLEOTYDÓW I AMINOKWASÓW

WIZUALIZACJA ALGORYTMÓW OPTYMALNEGO DOPASOWANIA SEKWENCJI NUKLEOTYDÓW I AMINOKWASÓW STUDIA INFORMATICA 2011 Volume 32 Number 2A (96) Adam SKOWRON, Dariusz MROZEK Politechnika Śląska, Instytut Informatyki WIZUALIZACJA ALGORYTMÓW OPTYMALNEGO DOPASOWANIA SEKWENCJI NUKLEOTYDÓW I AMINOKWASÓW

Bardziej szczegółowo

Bioinformatyka wykład 9

Bioinformatyka wykład 9 Bioinformatyka wykład 9 14.XII.21 białkowa bioinformatyka strukturalna krzysztof_pawlowski@sggw.pl 211-1-17 1 Plan wykładu struktury białek dlaczego? struktury białek geometria i fizyka modyfikacje kowalencyjne

Bardziej szczegółowo

Badanie doboru naturalnego na poziomie molekularnym

Badanie doboru naturalnego na poziomie molekularnym Badanie doboru naturalnego na poziomie molekularnym Podstawy ewolucji molekulanej Jak ewoluują sekwencje Zmiany genetyczne w ewolucji Mutacje tworzą nowe allele genów Inwersje zmieniają układ genów na

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE

PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE WSTĘP 1. Mikromacierze ekspresyjne tworzenie macierzy przykłady zastosowań 2. Mikromacierze SNP tworzenie macierzy przykłady zastosowań MIKROMACIERZE EKSPRESYJNE

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 4 Jak działają geny?

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

Wyróżniamy dwa typy zadań projektowych.

Wyróżniamy dwa typy zadań projektowych. Obowiązkowymi do zaliczenia projektu jest realizacja 2-3 zadań programistycznych. Zadania realizowane są w grupach 2-3 osobowych (zależnie od stopnia trudności zadania i liczebności całej klasy laboratoryjnej).

Bardziej szczegółowo

Co można odczytać z sekwencji nukleotydowej? Bioinformatyka na przykładzie ryb akwariowych. Piotr Łapa 1

Co można odczytać z sekwencji nukleotydowej? Bioinformatyka na przykładzie ryb akwariowych. Piotr Łapa 1 Co można odczytać z sekwencji nukleotydowej? Bioinformatyka na przykładzie ryb akwariowych Piotr Łapa 1 1 Towarzystwo Naukowe Branży Zoologicznej Animalian Wiek XX był okresem dynamicznego postępu techniki

Bardziej szczegółowo

Rycina 1. Zasięg i zagęszczenie łosi (liczba osobników/1000 ha) w Polsce w roku 2010 oraz rozmieszczenie 29 analizowanych populacji łosi.

Rycina 1. Zasięg i zagęszczenie łosi (liczba osobników/1000 ha) w Polsce w roku 2010 oraz rozmieszczenie 29 analizowanych populacji łosi. Ryciny 193 Rycina 1. Zasięg i zagęszczenie łosi (liczba osobników/1000 ha) w Polsce w roku 2010 oraz rozmieszczenie 29 analizowanych populacji łosi. Na fioletowo zaznaczone zostały populacje (nr 1 14)

Bardziej szczegółowo

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej Wprowadzenie do Informatyki Biomedycznej Wykład 1: Podstawy bioinformatyki Wydział Informatyki PB Podstawy biologiczne - komórki Wszystkie organizmy zbudowane są z komórek komórka jest skomplikowanym systemem

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI 11 BAZA DANYCH HAPMAP

PODSTAWY BIOINFORMATYKI 11 BAZA DANYCH HAPMAP PODSTAWY BIOINFORMATYKI 11 BAZA DANYCH HAPMAP WSTĘP 1. SNP 2. haplotyp 3. równowaga sprzężeń 4. zawartość bazy HapMap 5. przykłady zastosowań Copyright 2013, Joanna Szyda HAPMAP BAZA DANYCH HAPMAP - haplotypy

Bardziej szczegółowo

Bioinformatyka wykład 11, 11.I.2011 Białkowa bioinformatyka strukturalna c.d.

Bioinformatyka wykład 11, 11.I.2011 Białkowa bioinformatyka strukturalna c.d. Bioinformatyka wykład 11, 11.I.2011 Białkowa bioinformatyka strukturalna c.d. krzysztof_pawlowski@sggw.pl 11.01.11 1 Dopasowanie strukturalne (alignment) odległość: d ij = (x i -x J ) 2 + (y i -y J ) 2

Bardziej szczegółowo

Budowanie drzewa filogenetycznego

Budowanie drzewa filogenetycznego Szkoła Festiwalu Nauki 134567 Wojciech Grajkowski Szkoła Festiwalu Nauki, ul. Ks. Trojdena 4, 02-109 Warszawa www.sfn.edu.pl sfn@iimcb.gov.pl Budowanie drzewa filogenetycznego Cel Ćwiczenie polega na budowaniu

Bardziej szczegółowo

Podstawy biologii. Informacja genetyczna. Co to jest ewolucja.

Podstawy biologii. Informacja genetyczna. Co to jest ewolucja. Podstawy biologii Informacja genetyczna. Co to jest ewolucja. Materiał genetyczny Materiałem genetycznym są kwasy nukleinowe Materiałem genetycznym organizmów komórkowych jest kwas deoksyrybonukleinowy

Bardziej szczegółowo

Teoria ewolucji. Losy gatunków: specjacja i wymieranie. Podstawy ewolucji molekularnej

Teoria ewolucji. Losy gatunków: specjacja i wymieranie. Podstawy ewolucji molekularnej Teoria ewolucji. Losy gatunków: specjacja i wymieranie. Podstawy ewolucji molekularnej Specjacja } Pojawienie się bariery reprodukcyjnej między populacjami dające początek gatunkom } Specjacja allopatryczna

Bardziej szczegółowo

Bioinformatyczne bazy danych

Bioinformatyczne bazy danych Bioinformatyczne bazy danych Czym jest bioinformatyka? Bioinformatyka jest nauką integrującą różne dziedziny wiedzy Gruca (2010) Czym jest bioinformatyka? Bioinformatyka obejmuje technologie wykorzystujące

Bardziej szczegółowo

Przewidywanie struktury białek: od modelowania opartego o szablony. do rekombinacji fragmentów metodą dr Frankensteina

Przewidywanie struktury białek: od modelowania opartego o szablony. do rekombinacji fragmentów metodą dr Frankensteina Przewidywanie struktury białek: od modelowania opartego o szablony do rekombinacji fragmentów metodą dr Frankensteina Iwona A. Cymerman, Joanna M. Sasin, Janusz M. Bujnicki Pracownia Bioinformatyki i Inżynierii

Bardziej szczegółowo

9. Metody dydaktyczne 10. Podstawowe informacje i zaliczone kursy z genetyki i biologii molekularnej oraz dobra znajom angielskiego.

9. Metody dydaktyczne 10. Podstawowe informacje i zaliczone kursy z genetyki i biologii molekularnej oraz dobra znajom angielskiego. Lp. Opis sylabusu 1. Nazwa przedmiotu Bioinformatyka i genomika 3. Kod przedmiotu BioGenom1 5. - - 6. Typ przedmiotu 7. Rok studiów, semestr Studia II stopnia, semestr I 8. 9. Metody dydaktyczne 10. Podstawowe

Bardziej szczegółowo

Na czym skończyliśmy BLACK BOX. Sekwencjonowanie polega na odczytaniu sekwencji liter DNA/RNA badanego fragmentu genomu

Na czym skończyliśmy BLACK BOX. Sekwencjonowanie polega na odczytaniu sekwencji liter DNA/RNA badanego fragmentu genomu ALEKSANDRA ŚWIERCZ Na czym skończyliśmy BLACK BOX AAATGCCTGCCCTGAAGGCCTGCGTA GTTTTGGGAGAAGACCCACGGATA AAGGTGTAGCCCCGTAGC GGGGGGTATTATTTATTTTATACCCAC.. ACAGGAUCGUUGGAUGGTGGGA. Sekwencjonowanie polega na

Bardziej szczegółowo

Modelowanie homologiczne

Modelowanie homologiczne Modelowanie homologiczne Struktura trzeciorzędowa ułatwia planowanie eksperymentów oraz interpretację otrzymanych wyników Struktura trzeciorzędowa Hemoglobiny - na 226 białek z tej rodziny zawsze grupa

Bardziej szczegółowo

Komputerowe wspomaganie projektowanie leków

Komputerowe wspomaganie projektowanie leków Komputerowe wspomaganie projektowanie leków wykład VI Prof. dr hab. Sławomir Filipek Grupa BIOmodelowania Uniwersytet Warszawski, Wydział Chemii oraz Centrum Nauk Biologiczno-Chemicznych Cent-III www.biomodellab.eu

Bardziej szczegółowo

Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne)

Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne) Joanna Wieczorek Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne) Strona 1 Temat: Budowa i funkcje kwasów nukleinowych Cel ogólny lekcji: Poznanie budowy i funkcji: DNA i RNA Cele szczegółowe:

Bardziej szczegółowo

Wstęp do programowania

Wstęp do programowania Wstęp do programowania Programowanie dynamiczne Paweł Daniluk Wydział Fizyki Jesień 2013 P. Daniluk(Wydział Fizyki) WP w. X Jesień 2013 1 / 21 Dziel i zwyciężaj przypomnienie 1 Podział problemu na 2 lub

Bardziej szczegółowo

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1 Przedmiot: Biochemia Nazwa testu: Biochemia wer. 1.0.5 Nr testu 14883078 Klasa: zaoczni_2007 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Do aminokwasów aromatycznych zalicza się A) G, P oraz S B) L,

Bardziej szczegółowo

Sekwencjonowanie Nowej Generacji ang. Next Generation Sequencing

Sekwencjonowanie Nowej Generacji ang. Next Generation Sequencing Sekwencjonowanie Nowej Generacji ang. Next Generation Sequencing Wykład 7 Etapy analizy NGS Dr Wioleta Drobik-Czwarno Etapy analizy NGS Kontrola jakości surowych danych (format fastq) Jakość odczytów,

Bardziej szczegółowo

Przewidywanie struktury kanału białkowego z wykorzystaniem probabilistycznych gramatyk formalnych oraz modelu ciągłego przepływu jonów

Przewidywanie struktury kanału białkowego z wykorzystaniem probabilistycznych gramatyk formalnych oraz modelu ciągłego przepływu jonów Przewidywanie struktury kanału białkowego z wykorzystaniem probabilistycznych gramatyk formalnych oraz modelu ciągłego przepływu jonów Witold Dyrka Instytut Inżynierii Biomedycznej i Pomiarowej, Politechnika

Bardziej szczegółowo

Mutacje jako źródło różnorodności wewnątrzgatunkowej

Mutacje jako źródło różnorodności wewnątrzgatunkowej Mutacje jako źródło różnorodności wewnątrzgatunkowej Zajęcia terenowe: Zajęcia w klasie: Poziom nauczania oraz odniesienie do podstawy programowej: Liceum IV etap edukacyjny zakres rozszerzony: Różnorodność

Bardziej szczegółowo

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP WYNALAZKI BIOTECHNOLOGICZNE W POLSCE Ewa Waszkowska ekspert UPRP Źródła informacji w biotechnologii projekt SLING Warszawa, 9-10.12.2010 PLAN WYSTĄPIENIA Umocowania prawne Wynalazki biotechnologiczne Statystyka

Bardziej szczegółowo

Kombinatoryczna analiza widm 2D-NOESY w spektroskopii Magnetycznego Rezonansu Jądrowego cząsteczek RNA. Marta Szachniuk

Kombinatoryczna analiza widm 2D-NOESY w spektroskopii Magnetycznego Rezonansu Jądrowego cząsteczek RNA. Marta Szachniuk Kombinatoryczna analiza widm 2D-NOESY w spektroskopii Magnetycznego Rezonansu Jądrowego cząsteczek RNA Marta Szachniuk Plan prezentacji Wprowadzenie do tematyki badań Teoretyczny model problemu Złożoność

Bardziej szczegółowo

Metody teoretyczne przewidywania struktury białek oraz ich kompleksów z peptydami

Metody teoretyczne przewidywania struktury białek oraz ich kompleksów z peptydami Maciej Błaszczyk Metody teoretyczne przewidywania struktury białek oraz ich kompleksów z peptydami Praca doktorska wykonana w Pracowni Teorii Biopolimerów Wydziału Chemii Uniwersytetu Warszawskiego Promotor

Bardziej szczegółowo

Wstęp do programowania

Wstęp do programowania Wstęp do programowania Algorytmy zachłanne, programowanie dynamiczne Paweł Daniluk Wydział Fizyki Jesień 2014 P. Daniluk(Wydział Fizyki) WP w. IX Jesień 2014 1 / 26 Algorytmy zachłanne Strategia polegająca

Bardziej szczegółowo

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 ALEKSANDRA ŚWIERCZ Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 Ekspresja genów http://genome.wellcome.ac.uk/doc_wtd020757.html A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH

Bardziej szczegółowo

Bioinformatyczne bazy danych - część 2. -przeszukiwanie baz danych -pobieranie danych

Bioinformatyczne bazy danych - część 2. -przeszukiwanie baz danych -pobieranie danych Bioinformatyczne bazy danych - część 2 -przeszukiwanie baz danych -pobieranie danych Numery dostępowe baz danych (accession number) to ciąg liter i cyfr służących jako etykieta identyfikująca sekwencję

Bardziej szczegółowo

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka Wstęp do obsługi biologicznych baz danych i analizy porównawczej białek i genów Katedra Fizjologii i Biotechnologii Roślin Pok. 113 CB jan.jastrzebski@uwm.edu.pl bioinformatyka@gmail.com www.ebiology.net

Bardziej szczegółowo

Metody przeszukiwania

Metody przeszukiwania Metody przeszukiwania Co to jest przeszukiwanie Przeszukiwanie polega na odnajdywaniu rozwiązania w dyskretnej przestrzeni rozwiązao. Zwykle przeszukiwanie polega na znalezieniu określonego rozwiązania

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo

Tworzenie drzew filogenetycznych

Tworzenie drzew filogenetycznych 1 Tworzenie drzew filogenetycznych Wyszukiwanie pokrewnych sekwencji za pomocą programu BLAST Załóżmy, że dysponujemy już interesującą nas sekwencją białka lub kwasu nukleinowego i chcemy znaleźć inne,

Bardziej szczegółowo

BUDOWA I FUNKCJA GENOMU LUDZKIEGO

BUDOWA I FUNKCJA GENOMU LUDZKIEGO BUDOWA I FUNKCJA GENOMU LUDZKIEGO Magdalena Mayer Katedra i Zakład Genetyki Medycznej UM w Poznaniu 1. Projekt poznania genomu człowieka: Cele programu: - skonstruowanie szczegółowych map fizycznych i

Bardziej szczegółowo

Algorytm genetyczny (genetic algorithm)-

Algorytm genetyczny (genetic algorithm)- Optymalizacja W praktyce inżynierskiej często zachodzi potrzeba znalezienia parametrów, dla których system/urządzenie będzie działać w sposób optymalny. Klasyczne podejście do optymalizacji: sformułowanie

Bardziej szczegółowo

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe Promotory genu Promotor bliski leży w odległości do 40 pz od miejsca startu transkrypcji, zawiera kasetę TATA. Kaseta TATA to silnie konserwowana sekwencja TATAAAA, występująca w większości promotorów

Bardziej szczegółowo

Bioinformatyka. Rodzaje Mutacji

Bioinformatyka. Rodzaje Mutacji Bioinformatyka (wykład monograficzny) wykład 3. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas Rodzaje Mutacji zmienność sekwencji (sequence variation) mutacje polimorfizm

Bardziej szczegółowo