Budowa kwasów nukleinowych

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "Budowa kwasów nukleinowych"

Transkrypt

1 Bioinformatyka (wykład monograficzny) wykład 2. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM Budowa kwasów nukleinowych Kwasy nukleinowe (DA i RA) zbudowane są z nukleotydów ukleotyd: zasada cukier reszta kwasu fosforowego Wykład 2,

2 Budowa kwasów nukleinowych zasada Purynowa: A adenina G guanina Pirymidynowa: C U T cytozyna uracyl tymina Budowa kwasów nukleinowych Kwasy nukleinowe (DA i RA) zbudowane są z nukleotydów cukier cukier ryboza deoxyryboza Wykład 2,

3 Budowa kwasów nukleinowych ukleozyd: zasada wiązanie β-glikozydowe cukier Budowa kwasów nukleinowych łańcuch polinukleotydowy: Wykład 2,

4 Pary zasad Budowa kwasów nukleinowych Wiązanie wodorowe pk a = 3.8 pk a =9.5 H H O CH 3 H C-1 Wiązanie wodorowe C-1 A=T O O H H pk a =9.4 H pk a =4.5 H O C-1 C-1 H G C Budowa kwasów nukleinowych B-DA A-DA Z-DA Wykład 2,

5 ZŁOŻOOŚĆ I POZORA IEJASOŚĆ PROCESÓW KOMÓRKOWYCH CZŁOWIEK KOMÓREK! każda ma identyczny skład DA o długości około 3,2x10 9 pz... identyczny skład, ale zróżnicowane typy komórek i funkcje tkanek... z 3,2x10 9 pz tylko 2% koduje białka! [Paulina Błażejewska] GEOM... cała informacja genetyczna organizmu - eukariota: chromosomy w jądrze komórkowym i mitochondria/chloroplasty - prokariota: chromosom bakteryjny (genofor) [Paulina Błażejewska] Wykład 2,

6 GEOM... wielkość genomu nie koreluje się ze złożonością organizmu - wśród bezkręgowców i kręgowców można znaleźć większe genomy od ludzkiego - jeden z gatunków ameby ma aż 100x więcej DA niż człowiek - na ogół genomy prokariotyczne są mniejsze od eukariotycznych - genom prokariotyczny ma wielkość poniżej 5Mpz (np. Escherichia coli 4,64 Mpz) - eukariotyczny genom jądrowy od 10Mpz do ponad Mpz (np. Drosophila melanogaster 140Mpz) [Paulina Błażejewska] Centralny dogmat Biologii Molekularnej informacja genetyczna przechowywana jest w sekwencji zasad polimeru DA trójki (tryplety) zasad DA kodują 20 naturalnych aminokwasów sekwencja aminokwasów w białku determinuje jego strukturę sekwencja i struktura determinują funkcję Wykład 2,

7 Przepływ informacji genetycznej Wykład 2,

8 Przepływ informacji genetycznej -transkrypcja mra DA matrycowy DA kodujący Szukanie sekwencji kodującej Metody ab ab initio initio Metody oparte na na homologii Podejście połączone promotor 5 -UTR ekson początkowy intron ekson wewnętrzny TATA-box ATG GT AC GT intron ekson wewnętrzny intron ekson końcowy 3 -UTR AC GT AC TAG Poli-A miejsca splicingu kodon stop Wykład 2,

9 Ab initio Szukanie charakterystycznych elementów strukturalnych, sygnałów: TATA-box (5 -TATAAA-3 ), CAAT-box (5 -GGGCAATCT-3 ), Wyspy CpG Kodon ATG i kodony STOP (TAG,TGA) Poli-A Regiony niekodujące UTR Statystyka użycia kodonów (w obszarach niekodujących występują równe proporcje tripletów), pary [G-C] przeważają w obszarach kodujących lista i opis: PP - eural etwork Promoter Prediction (Reese, 2001), (inne programy: GRAIL, SPLICE ) HMMgene (Krogh, 1994) używa tzw. ukrytych modeli Markowa (Hidden Markov Models HMM). (inne programy:gesca, TWISCA, Genie ) Metody oparte na homologii bazy ekspresjonowanych fragmentów eksonów - EST (Expressed Sequence Tags, Adams, 1991). Obecne w nich krótkie fragmenty CDS zawierające często np. miejsca splicingu, porównywane są z nieznanym genem. Wykład 2,

10 Podejście połączone GrailEXP Kombinacja metod ab initio i opartych na homologii. Składa się z 3 modułów: Perceval pierwotny moduł GRAIL (sieci neuronowe), odszukuje w sekwencji charakterystyczne sygnały i na ich podstawie określa położenie eksonów. Galahad Identyfikuje w odpowiedniej bazie genomowej eksony jako miejsca pokrywające się z bazą końcówek eksonów (tzw. EST-ów). a taką matrycę nakłada nieznany gen i przez homologię rozpoznaje w nim eksony Gawain Składa wyniki dwóch pierwszych modułów w jedną całość. Gdy występują między nimi niezgodności, optymalizuje wynik, bądź podaje wyniki alternatywne (w szczególności: inną wersję splicingu). Buduje model genu i podaje sekwencję kodującą Gen CFTR Sekwencja DA dostępna w GenBank w CBI, pary zasad DA >gi gb AH SEG_HUMCFTRG Human cystic fibrosis transmembrane conductance regulator (CFTR) gene CTAGAAACCGTATGCTATATAATTATGTACTATAAAGTAATAATGTATACAGTGTAATGGATCATGGGCC ATGTGCTTTTCAAACTAATTGTACATAAAACAAGCATCTATTGAAAATATCTGACAAACTCATCTTTTAT TTTTGATGTGTGTGTGTGTGTGTGTGTGTGTTTTTTTAACAGGGATTTGGGG AGCAGGCAAGGTAGTTCTTTTGTTCTTCACTATTAAGAACTTAATTTGGTGTCCATGTCTCTTTTTTTTT CTAGTTTGTAGTGCTGGAAGGTATTTTTGGAGAAATTCTTACATGAGCATTAGGAGAATGTATGGGTGTA GTGTCTTGTATAATAGAAATTGTTCCACTGATAATTTACTCTAGTTTTTTATTTCCTCATATTATTTTCA GTGGCTTTTTCTTCCACATCTTTATATTTTGCACCACATTCAACACTGTATCTTGCACATGGCGAGCATT CAATAACTTTATTGAATAAACAAAT... Wykład 2,

11 Sequence: >gene_grailexp PID=12820 (22846 bp) GAWAI Gene Predictions (1 predicted, 1 with database similarity) Genes with Database Similarity (1 predicted, 0 with alternative splices) Gene 1, Variant 1 Strand: + Bounds: Exons: 27 Start Codon: Yes Stop Codon: Yes Top-Scoring Reference: HT2294 (6159 bp) (98% id, ) >human HT2294 tigr_egad cystic fibrosis transmembrane conductance regu lator, 3' Reference Path: M28668 (6129 bp) (98%, ) HT2294 (6159 bp) (98%, ) Matrycowy RA: 6129 par zasad, Po Po odszukaniu sekwencji kodującej (CDS): 4443 par zasad Znaleziona sekwencja odpowiada sekwencji M_ zdeponowanej w CBI Sekwencja gotowa do translacji Wykład 2,

12 Kod genetyczny Otwarte ramki odczytu (ORF) otwarte ramki odczytu ORF (Open Reading Frame). wszystkie możliwe sekwencje DA rozpoczynające się kodonem ATG (kodon inicjujący translację) i kończące TAG, TAA lub TGA (kodony stop ) w tej samej fazie odczytu. Wykład 2,

13 Otwarte ramki odczytu (ORF) 1 mra 2 3 Wykład 2,

14 Wykład 2,

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność

Wyszukiwanie podobnych sekwencji w bazach danych. Wyszukiwanie w sekwencji nukleotydów czy aminokwasów? Czułość i selektywność Wersja 1.05 Wprowadzenie do Informatyki Biomedycznej Wykład 3: Wyszukiwanie w bazach sekwencji Przewidywanie genów Wydział Informatyki PB Marek Krętowski pokój 206 e-mail: m.kretowski@pb.edu.pl http://aragorn.pb.bialystok.pl/~mkret

Bardziej szczegółowo

Statystyczna analiza danych

Statystyczna analiza danych Statystyczna analiza danych ukryte modele Markowa, zastosowania Anna Gambin Instytut Informatyki Uniwersytet Warszawski plan na dziś Ukryte modele Markowa w praktyce modelowania rodzin białek multiuliniowienia

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo

Numer pytania Numer pytania

Numer pytania Numer pytania KONKURS BIOLOGICZNY ZMAGANIA Z GENETYKĄ 2016/2017 ELIMINACJE SZKOLNE I SESJA GENETYKA MOLEKULARNA KOD UCZNIA. IMIĘ i NAZWISKO. DATA... GODZINA.. Test, który otrzymałeś zawiera 20 pytań zamkniętych. W każdym

Bardziej szczegółowo

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI

Bardziej szczegółowo

DNA musi współdziałać z białkami!

DNA musi współdziałać z białkami! DNA musi współdziałać z białkami! Specyficzność oddziaływań między DNA a białkami wiążącymi DNA zależy od: zmian konformacyjnych wzdłuż cząsteczki DNA zróżnicowania struktury DNA wynikającego z sekwencji

Bardziej szczegółowo

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier.

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier. ID Testu: F5679R8 Imię i nazwisko ucznia Klasa Data 1. Na indywidualne cechy danego osobnika ma (maja) wpływ A. wyłacznie czynniki środowiskowe. B. czynniki środowiskowe i materiał genetyczny. C. wyłacznie

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej Wprowadzenie do Informatyki Biomedycznej Wykład 1: Podstawy bioinformatyki Wydział Informatyki PB Podstawy biologiczne - komórki Wszystkie organizmy zbudowane są z komórek komórka jest skomplikowanym systemem

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A...

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A... 1. Zadanie (0 2 p. ) Porównaj mitozę i mejozę, wpisując do tabeli podane określenia oraz cyfry. ta sama co w komórce macierzystej, o połowę mniejsza niż w komórce macierzystej, gamety, komórki budujące

Bardziej szczegółowo

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1 Przedmiot: Biochemia Nazwa testu: Biochemia wer. 1.0.5 Nr testu 14883078 Klasa: zaoczni_2007 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Do aminokwasów aromatycznych zalicza się A) G, P oraz S B) L,

Bardziej szczegółowo

Generator testów bioinformatyka wer / Strona: 1

Generator testów bioinformatyka wer / Strona: 1 Przedmiot: wyklad monograficzny Nazwa testu: bioinformatyka wer. 1.0.6 Nr testu 10469906 Klasa: 5 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Aminokwas jest to związek organiczny zawierający A) grupę

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

Transkrypcja i obróbka RNA. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Transkrypcja i obróbka RNA. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Transkrypcja i obróbka RNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Centralny dogmat biologii molekularnej: sekwencja DNA zostaje

Bardziej szczegółowo

Przedmiotowe zasady oceniania:

Przedmiotowe zasady oceniania: Przedmiotowe zasady oceniania: Przedmiotowe Zasady Oceniania z biologii obowiązujący w roku szkolnym 2012/13 r. w VIII LO realizowany przez nauczycieli przedmiotu Justynę Baranowską, Mirosławę Drażniuk,

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

GENOM I JEGO STRUKTURA

GENOM I JEGO STRUKTURA GENOM I JEGO STRUKTURA GENOM Ogół materiału genetycznego (kwasu nukleinowego niosącego informację genetyczną) zawartego w pojedynczej części składowej (komórce, cząstce wirusa) organizmu 1 Genom eukariotyczny

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecnośd Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Bioinformatyka Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl 1 Bazy danych biologicznych Bazy danych sekwencji nukleotydowych Pierwotne bazy danych (ang. primary database) Wykorzystywane do zbierania

Bardziej szczegółowo

Zaoczne Liceum Ogólnokształcące Pegaz

Zaoczne Liceum Ogólnokształcące Pegaz WYMAGANIA EGZAMINACYJNE ROK SZKOLNY 2015/2016 Semestr jesienny TYP SZKOŁY: liceum ogólnokształcące PRZEDMIOT: biologia SEMESTR: II LICZBA GODZIN W SEMESTRZE: 15 PROGRAM NAUCZANIA: Program nauczania biologii

Bardziej szczegółowo

Wykład 10 2008-04-30. Bioinformatyka. Wykład 9. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM

Wykład 10 2008-04-30. Bioinformatyka. Wykład 9. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM Bioinformatyka Wykład 9 E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas 1 Konsekwencje zestawieo wielu sekwencji - rodziny białkowe, domeny, motywy i wzorce 2 Bioinformatyka,

Bardziej szczegółowo

INFORMACJA GENETYCZNA: WYROK CZY MOŻLIWOŚĆ

INFORMACJA GENETYCZNA: WYROK CZY MOŻLIWOŚĆ ARTYKUŁY Zagadnienia Filozoficzne w Nauce XXXIII / 2003, s. 64 73 Magdalena FIKUS Instytut Biochemii i Biofizyki PAN Warszawa INFORMACJA GENETYCZNA: WYROK CZY MOŻLIWOŚĆ Mówimy o terapii genowej, jak gdyby

Bardziej szczegółowo

MARKERY MIKROSATELITARNE

MARKERY MIKROSATELITARNE MARKERY MIKROSATELITARNE Badania laboratoryjne prowadzone w Katedrze Genetyki i Ogólnej Hodowli Zwierząt SGGW w ramach monitoringu genetycznego wykorzystują analizę genetyczną markerów mikrosatelitarnych.

Bardziej szczegółowo

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :.

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :. CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A imię i nazwisko :. klasa :.. ilość punktów :. Zadanie 1 Przeanalizuj schemat i wykonaj polecenia. a. Wymień cztery struktury występujące zarówno w komórce roślinnej,

Bardziej szczegółowo

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz.

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. 1 ROZDZIAŁ 1. KOMÓRKI WPROWADZENIE 1 Jedność i różnorodność komórek 1

Bardziej szczegółowo

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3 Księgarnia PWN: Terry A. Brown - Genomy Przedmowa Przedmowa do drugiego wydania polskiego Wstęp Spis rozdziałów Skróty V VI VII XI XIX Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań dopuszczający

Bardziej szczegółowo

PRZEBIEG EGZAMINU LICENCJACKIEGO DLA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE

PRZEBIEG EGZAMINU LICENCJACKIEGO DLA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE PRZEBIEG EGZAMINU LICENCJACKIEGO DLA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE specjalność PROJEKTOWANIE MOLEKULARNE I BIOINFORMATYKA W trakcie egzaminu licencjackiego student udziela ustnych

Bardziej szczegółowo

Profaza I wykształcenie się wrzeciona podziałowego, kondensacja chromatyny do chromosomów jest długa i składa się z 5 stadiów:

Profaza I wykształcenie się wrzeciona podziałowego, kondensacja chromatyny do chromosomów jest długa i składa się z 5 stadiów: Cykl komórkowy Podział komórki - proces zachodzący u wszystkich żywych organizmów, w którym komórka macierzysta dzieli się na dwie lub więcej komórek potomnych. Najpierw następuje podział jądra komórkowego

Bardziej szczegółowo

Wymagania edukacyjne. Poziomy oczekiwanych osiągnięć ucznia. Stopnie szkolne

Wymagania edukacyjne. Poziomy oczekiwanych osiągnięć ucznia. Stopnie szkolne Wymagania edukacyjne zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń powinien opanować po omówieniu poszczególnych lekcji z podręcznika Biologia na czasie zakres podstawowy. Jest on

Bardziej szczegółowo

PRZEBIEG EGZAMINU LICENCJACKIEGO DLA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE specjalność BIOFIZYKA MOLEKULARNA

PRZEBIEG EGZAMINU LICENCJACKIEGO DLA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE specjalność BIOFIZYKA MOLEKULARNA PRZEBIEG EGZAMINU LICENCJACKIEGO DLA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE specjalność BIOFIZYKA MOLEKULARNA W trakcie egzaminu licencjackiego student udziela ustnych odpowiedzi na pytania

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) I. Od genu do cechy Budowa i funkcje kwasów

Bardziej szczegółowo

Bioinformatyka. (wykład monograficzny) wykład 5. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM

Bioinformatyka. (wykład monograficzny) wykład 5. E. Banachowicz. Zakład Biofizyki Molekularnej IF UAM Bioinformatyka (wykład monograficzny) wykład 5. E. Banachowicz Zakład Biofizyki Molekularnej IF UM http://www.amu.edu.pl/~ewas lgorytmy macierze punktowe (DotPlot) programowanie dynamiczne metody heurystyczne

Bardziej szczegółowo

Biologia Liceum Ogólnokształcące zakres podstawowy

Biologia Liceum Ogólnokształcące zakres podstawowy Zespół Szkół im. Ignacego Łukasiewicza w Policach PRZEDMIOTOWY SYSTEM OCENIANIA Biologia Liceum Ogólnokształcące zakres podstawowy I. Formy i metody sprawdzania i oceniania osiągnięć ucznia: Osiągnięcia

Bardziej szczegółowo

Analiza danych pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego. - część I -

Analiza danych pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego. - część I - pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego - część I - Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Plan wykładów --------------------------------------------------------

Bardziej szczegółowo

Zapis w nowej podstawie programowej. Proponowane procedury osiągania celów. Proponowane środki dydaktyczne. Dział programu.

Zapis w nowej podstawie programowej. Proponowane procedury osiągania celów. Proponowane środki dydaktyczne. Dział programu. Rozkład materiału Dział programu I. Od genu do cechy Treści nauczania 1. Budowa i funkcje kwasów nukleinowych DNA jako materiał genetyczny budowa DNA rodzaje zasad azotowych komplementarność zasad azotowych

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna.

... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna. Zadanie 1. (2 pkt.) W tabeli przedstawiono kodony kodu genetycznego. Poniżej przedstawiono dwie sekwencje nukleotydów w mrna. Ustal czy koduja takie same czy inne odcinki polipeptydów. Uzasadnij jednym

Bardziej szczegółowo

IZOLACJA CHROMOSOMALNEGO DNA Z KOMÓREK BAKTERYJNYCH

IZOLACJA CHROMOSOMALNEGO DNA Z KOMÓREK BAKTERYJNYCH Wydział Chemiczny Politechniki Gdańskiej Katedra Technologii Leków i Biochemii Kultury tkankowe i komórkowe roślin i zwierząt IZOLACJA CHROMOSOMALNEGO DNA Z KOMÓREK BAKTERYJNYCH Organizacja DNA u Procaryota

Bardziej szczegółowo

Wydział Przyrodniczo-Techniczny UO Kierunek studiów: Biotechnologia licencjat Rok akademicki 2009/2010

Wydział Przyrodniczo-Techniczny UO Kierunek studiów: Biotechnologia licencjat Rok akademicki 2009/2010 Kierunek studiów: Biotechnologia licencjat 6.15 BCH2 II Typ studiów: stacjonarne Semestr: IV Liczba punktow ECTS: 5 Jednostka organizacyjna prowadząca przedmiot: Samodzielna Katedra Biotechnologii i Biologii

Bardziej szczegółowo

BIOLOGIA POZIOM PODSTAWOWY. Wymagania ogólne na poszczególne oceny śródroczne/roczne

BIOLOGIA POZIOM PODSTAWOWY. Wymagania ogólne na poszczególne oceny śródroczne/roczne BIOLOGIA POZIOM PODSTAWOWY Wymagania ogólne na poszczególne oceny śródroczne/roczne na ocenę celującą: Uczeń posiada wiedzę wykraczającą poza podstawę programową, opanował treści wykraczające poza informacje

Bardziej szczegółowo

PODSTAWY GENETYKI ... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna.

PODSTAWY GENETYKI ... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna. Zadanie 1. (2 pkt.) W tabeli przedstawiono kodony kodu genetycznego. Poniżej przedstawiono dwie sekwencje nukleotydów w mrna. Ustal czy koduja takie same czy inne odcinki polipeptydów. Uzasadnij jednym

Bardziej szczegółowo

Bioinformatyka. Wykład 2 (12.X.2010) I r. studiów magisterskich, biologia (SGGW) Krzysztof Pawłowski

Bioinformatyka. Wykład 2 (12.X.2010) I r. studiów magisterskich, biologia (SGGW) Krzysztof Pawłowski Bioinformatyka Wykład 2 (12.X.2010) I r. studiów magisterskich, biologia (SGGW) Krzysztof Pawłowski tydzień temu Co to jest bioinformatyka Sekwencjonowanie genomów historia Metagenomika Wykład 2 spis treści

Bardziej szczegółowo

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją).

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Czym jest życie? metabolizm + informacja (replikacja) 2 Cząsteczki organiczne mog y powstać w atmosferze pierwotnej

Bardziej szczegółowo

THE UNFOLDED PROTEIN RESPONSE

THE UNFOLDED PROTEIN RESPONSE THE UNFOLDED PROTEIN RESPONSE Anna Czarnecka Źródło: Intercellular signaling from the endoplasmatic reticulum to the nucleus: the unfolded protein response in yeast and mammals Ch. Patil & P. Walter The

Bardziej szczegółowo

KARTA KURSU. Biotechnology in Environmental Protection. Kod Punktacja ECTS* 1

KARTA KURSU. Biotechnology in Environmental Protection. Kod Punktacja ECTS* 1 KARTA KURSU Nazwa Nazwa w j. ang. Biotechnologia w ochronie środowiska Biotechnology in Environmental Protection Kod Punktacja ECTS* 1 Koordynator Prof. dr hab. Maria Wędzony Zespół dydaktyczny: Prof.

Bardziej szczegółowo

ODDZIAŁYWANIE KSENOBIOTYKÓW Z DNA

ODDZIAŁYWANIE KSENOBIOTYKÓW Z DNA Wydział Chemiczny olitechniki Gdańskiej Katedra Technologii Leków i Biochemii Biochemia DDZIAŁYWAIE KSEBITYKÓW Z DA Struktura DA DA, kwas deoksyrybonukleinowy, może być docelowym miejscem działania ksenobiotyku

Bardziej szczegółowo

podstawowy. Jest on niezastąpiony przy obiektywnej ocenie postępów ucznia w nauce.

podstawowy. Jest on niezastąpiony przy obiektywnej ocenie postępów ucznia w nauce. Wymagania edukacyjne zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń powinien opanować po omówieniu poszczególnych lekcji z podręcznika Biologia na czasie zakres podstawowy. Jest on

Bardziej szczegółowo

Genom człowieka a środowisko

Genom człowieka a środowisko Jerzy Jaśkiewicz 1, Anna Goździalska 1,3, Dorota Lizak 2 Genom człowieka a środowisko Abstract Human genom is s ll under muta ons. The most important muta on is releated with metyla on of nucleo des. Effect

Bardziej szczegółowo

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten proces. Na schemacie przedstawiono etapy przekazywania

Bardziej szczegółowo

Zadania maturalne z biologii - 2

Zadania maturalne z biologii - 2 Koło Biologiczne Liceum Ogólnokształcące nr II w Gliwicach 2015-2016 Zadania maturalne z biologii - 2 Zadania: Zad. 1(M. Borowiecki, J. Błaszczak 3BL) Na podstawie podanych schematów określ sposób w jaki

Bardziej szczegółowo

Wykorzystując go wykonał doświadczenie, a następnie na podstawie obserwacji spod mikroskopu sporządził rysunek:

Wykorzystując go wykonał doświadczenie, a następnie na podstawie obserwacji spod mikroskopu sporządził rysunek: Budowa komórkowa Zadanie 1 (1 pkt) Uzasadnij, za pomocą jednego argumentu, że: lizosomy są grabarzami obumarłych składników cytoplazmy lub całych komórek. Zadanie 2 (2 pkt.) W komórkach roślinnych i zwierzęcych

Bardziej szczegółowo

ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ

ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ Paweł Bortkiewicz UAM bortpa@amu.edu.pl INŻYNIERIA GENETYCZNA (REKOMBINACJA DNA IN VITRO) zespół technik pozwalających na zamierzone, kontrolowane, przewidziane przez

Bardziej szczegółowo

19. KWASY NUKLEINOWE Iwona Koniec-5' polinukleotydu Koniec-3' polinukleotydu

19. KWASY NUKLEINOWE Iwona Koniec-5' polinukleotydu Koniec-3' polinukleotydu 19. KWASY UKLEIWE Iwona śak Kwasy nukleinowe, deoksyrybonukleinowy (DA) i rybonukleinowy (RA), są chemicznymi nośnikami informacji genetycznej w komórkach. Informację genetyczną stanowi chemicznie zapisana

Bardziej szczegółowo

Bazy danych i R/Bioconductor

Bazy danych i R/Bioconductor Bazy danych i R/Bioconductor wizualizacja danych genomicznych cz. 2 ggbio Yin T, Cook D and Lawrence M (2012). ggbio: an R package for extending the grammar of graphics for genomic data. Genome Biology,

Bardziej szczegółowo

Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna

Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna Przedmowa...................................................... 1 1. Rewolucja informatyczna w naukach biomedycznych...........................

Bardziej szczegółowo

Wymagania edukacyjne z biologii (poziom podstawowy) dla klasy Ia, Ib LO i II c technikum, rok szkolny 2014/2015 Dzia ł

Wymagania edukacyjne z biologii (poziom podstawowy) dla klasy Ia, Ib LO i II c technikum, rok szkolny 2014/2015 Dzia ł Wymagania edukacyjne z biologii (poziom podstawowy) dla klasy Ia, Ib LO i II c technikum, rok szkolny 2014/2015 Dzia ł Temat lekcji Wymagania konieczne Wymagania podstawowe Wymagania rozszerzające Wymagania

Bardziej szczegółowo

Wymagania edukacyjne z biologii nauczanej dwujęzycznie. Poziomy oczekiwanych osiągnięć ucznia. Stopnie szkolne

Wymagania edukacyjne z biologii nauczanej dwujęzycznie. Poziomy oczekiwanych osiągnięć ucznia. Stopnie szkolne Wymagania edukacyjne z biologii nauczanej dwujęzycznie zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń powinien opanować po omówieniu poszczególnych lekcji z podręcznika Biologia na

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

Karolina Cynk ETYCZNE I SPOŁECZNE KONSEKWENCJE OSIĄGNIĘĆ NOWOCZESNEJ BIOTECHNOLOGII

Karolina Cynk ETYCZNE I SPOŁECZNE KONSEKWENCJE OSIĄGNIĘĆ NOWOCZESNEJ BIOTECHNOLOGII Karolina Cynk ETYCZNE I SPOŁECZNE KONSEKWENCJE OSIĄGNIĘĆ NOWOCZESNEJ BIOTECHNOLOGII Wydawnictwo Uniwersytetu Rzeszowskiego Rzeszów 2013 2 SPIS TREŚCI WSTĘP 4 Rozdział I 11 MODYFIKACJE GENETYCZNE ORGANIZMÓW

Bardziej szczegółowo

XCII LO Z ODDZIAŁAMI INTEGRACYJNYMI I SPORTOWYMI ROZKŁAD MATERIAŁU Z BIOLOGII. Zapis w nowej podstawie programowej

XCII LO Z ODDZIAŁAMI INTEGRACYJNYMI I SPORTOWYMI ROZKŁAD MATERIAŁU Z BIOLOGII. Zapis w nowej podstawie programowej XCII LO Z ODDZIAŁAMI INTEGRACYJNYMI I SPORTOWYMI ROZKŁAD MATERIAŁU Z BIOLOGII Dział programu I. Od genu do cechy Treści nauczania 1. Budowa i funkcje kwasów nukleinowych DNA jako materiał genetyczny budowa

Bardziej szczegółowo

Plan wynikowy z biologii - zakres podstawowy. Biologia na czasie

Plan wynikowy z biologii - zakres podstawowy. Biologia na czasie Plan wynikowy z biologii - zakres podstawowy iologia na czasie ział programu Lp. Temat ocena dopuszczający dostateczny dobry bardzo dobry I. Od genu do cechy 1 udowa i funkcje kwasów nukleinowych określa

Bardziej szczegółowo

PLAN TESTU DZIEDZICZNOŚĆ I ZMIENNOŚĆ ORGANIZMÓW

PLAN TESTU DZIEDZICZNOŚĆ I ZMIENNOŚĆ ORGANIZMÓW PLN TEST DZIEDZIZNOŚĆ I ZMIENNOŚĆ ORNIZMÓW Numer zadania Sprawdzana czynność czeń potrafi: Kategoria celów Poziom wymagań Punktacja 1 Określić istotę procesu replikacji B P 1 2 Potrafi określić liczbę

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: , PCT/US99/21960 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: , PCT/US99/21960 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 197408 (21) Numer zgłoszenia: 346772 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 21.09.1999 (86) Data i numer zgłoszenia

Bardziej szczegółowo

Związki heterocykliczne w codziennym życiu

Związki heterocykliczne w codziennym życiu Związki heterocykliczne w codziennym życiu a podstawie: J. A. Joule, K. Mills eterocyclic chemistry at a glace 2nd ed., Wiley 2013.. Rolski Chemia środków leczniczych wyd. III, PZWL 1968. 1 eterocykliczne

Bardziej szczegółowo

Podstawy bioinformatyki - biologiczne bazy danych

Podstawy bioinformatyki - biologiczne bazy danych Podstawy bioinformatyki - biologiczne bazy danych Czym jest bioinformatyka? Bioinformatyka Bioinformatyka jest interdyscyplinarną dziedziną nauki obejmującą wykorzystanie metod obliczeniowych do badania

Bardziej szczegółowo

FORMY OCENY WIADOMOŚCI I UMIEJĘTNOŚCI UCZNIÓW BIOLOGIA. liceum ogólnokształcące, technikum

FORMY OCENY WIADOMOŚCI I UMIEJĘTNOŚCI UCZNIÓW BIOLOGIA. liceum ogólnokształcące, technikum Opracowane dla nowej podstawy programowej Rok szkolny 2013/2014 FORMY OCENY WIADOMOŚCI I UMIEJĘTNOŚCI UCZNIÓW BIOLOGIA liceum ogólnokształcące, technikum I. PODSTAWA PRAWNA - Rozporządzenie MEN z dn. 20

Bardziej szczegółowo

Zadanie 4 (0-2p) A.. Powyższy schemat przedstawia: a) łańcuch troficzny b) łańcuch pokarmowy c) obieg materii d) sieć pokarmową D G.

Zadanie 4 (0-2p) A.. Powyższy schemat przedstawia: a) łańcuch troficzny b) łańcuch pokarmowy c) obieg materii d) sieć pokarmową D G. Zadanie 1 (0-1p) Przedmiotem zainteresowania ekologii są a) działania mające na celu właściwe wykorzystanie i odnawianie zasobów przyrody b) relacje między organizmami i zależności między organizmami a

Bardziej szczegółowo

Biologia molekularna wirusów. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Biologia molekularna wirusów. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Biologia molekularna wirusów Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Co to jest wirus? Cząsteczka złożona z kwasu nukleinowego (DNA

Bardziej szczegółowo

WSTĘP - dla nauczycieli

WSTĘP - dla nauczycieli 2 J.W. Garvin 1996. Wilbert Garvin jest prawowitym wynalazcą i konstruktorem niniejszego modelu, zgodnie z prawem autorskim i Designs and Patents Act 1988, jak również jest autorem niniejszego przewodnika.

Bardziej szczegółowo

białka wiążące specyficzne sekwencje DNA czynniki transkrypcyjne

białka wiążące specyficzne sekwencje DNA czynniki transkrypcyjne białka wiążące specyficzne sekwencje DNA czynniki transkrypcyjne http://www.umass.edu/molvis/bme3d/materials/jtat_080510/exploringdna/ch_flex/chapter.htm czynniki transkrypcyjne (aktywatory/represory)

Bardziej szczegółowo

Informatyka w medycynie Punkt widzenia kardiologa

Informatyka w medycynie Punkt widzenia kardiologa Informatyka w medycynie Punkt widzenia kardiologa Lech Poloński Mariusz Gąsior Informatyka medyczna Dział informatyki zajmujący się jej zastosowaniem w ochronie zdrowia (medycynie) Stymulacja rozwoju informatyki

Bardziej szczegółowo

POZIOMY WYMAGAŃ EDUKACYJNYCH Z BIOLOGII DLA UCZNIÓW Z UPOŚLEDZENIEM W STOPNIU LEKKIM

POZIOMY WYMAGAŃ EDUKACYJNYCH Z BIOLOGII DLA UCZNIÓW Z UPOŚLEDZENIEM W STOPNIU LEKKIM DLA UCZNIÓW Z UPOŚLEDZENIEM W STOPNIU LEKKIM DZIAŁ I, II i III: RÓŻNORODNOŚĆ ŻYCIA Uczeń umie wymienić niektóre czynności żywego organizmu. Uczeń wie, co to jest komórka. Uczeń umie wymienić niektóre czynności

Bardziej szczegółowo

II WYDZIAŁ LEKARSKI, II ROK

II WYDZIAŁ LEKARSKI, II ROK II WYDZIAŁ LEKARSKI, II ROK PRZEDMIOT: BIOLOGIA MEDYCZNA (CZĘŚĆ 1 GENETYKA) PROGRAM ĆWICZEŃ 2009/2010 L.p. Data zajęć Temat zajęć 1. 15.02 18.02 Podstawy genetyki klasycznej (podstawowe pojęcia i definicje

Bardziej szczegółowo

Uczeń potrafi. Dział Rozdział Temat lekcji

Uczeń potrafi. Dział Rozdział Temat lekcji Plan wynikowy z biologii- zakres podstawowy, dla klasy III LO i III i IV Technikum LO im.ks. Jerzego Popiełuszki oraz Technikum w Suchowoli Nauczyciel: Katarzyna Kotiuk Nr programu: DKOS-4015-5/02 Dział

Bardziej szczegółowo

Generator testów 1.3.1 Bioinformatyka_zdalne wer. 1.0.13 / 0 Strona: 1

Generator testów 1.3.1 Bioinformatyka_zdalne wer. 1.0.13 / 0 Strona: 1 Przedmiot: Bioinformatyka Nazwa testu: Bioinformatyka_zdalne wer. 1.0.13 Nr testu 0 Klasa: WNB UZ Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Model Markowa substytucji aminokwasów w mutagenezie białek zakłada...

Bardziej szczegółowo

Zastosowanie teorii węzłów w biologii molekularnej. Piotr Krzywda Gr. 10B2

Zastosowanie teorii węzłów w biologii molekularnej. Piotr Krzywda Gr. 10B2 Zastosowanie teorii węzłów w biologii molekularnej Piotr Krzywda Gr. 10B2 Na początku trochę biologii. Biologia molekularna Biologia molekularna jest to dziedzina nauki z pogranicza kilku nauk biologicznych,

Bardziej szczegółowo

Przewidywanie struktur białek

Przewidywanie struktur białek Łukasz Ołdziejewski Wydział Chemii UW Przewidywanie struktur białek czyli droga do projektowania indywidualnych leków Sprawozdanie studenckie 2007/2008 1 Indywidualność jednostki KaŜdy człowiek jest indywidualnym

Bardziej szczegółowo

Dryf genetyczny i jego wpływ na rozkłady próbek z populacji - modele matematyczne. Adam Bobrowski, IM PAN Katowice

Dryf genetyczny i jego wpływ na rozkłady próbek z populacji - modele matematyczne. Adam Bobrowski, IM PAN Katowice Dryf genetyczny i jego wpływ na rozkłady próbek z populacji - modele matematyczne Adam Bobrowski, IM PAN Katowice 1 Tematyka cyklu referatów Dryf genetyczny Matematyczne modele równowagi między mutacja

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

Mutacje. Michał Pszczółkowski

Mutacje. Michał Pszczółkowski Mutacje Michał Pszczółkowski IIIc Mutacja to nagła,trwała zmiana w materiale genetycznym komórki, który może być dziedziczny. Jest ona zjawiskiem losowym-może pojawić się w dowolnym miejscu nici DNA. Termin

Bardziej szczegółowo

* * * cecha recesywna rośliny wysokie. rośliny karłowate kwiaty rozmieszczone wzdłuŝ łodyg kwiaty tylko w górnej części łodygi

* * * cecha recesywna rośliny wysokie. rośliny karłowate kwiaty rozmieszczone wzdłuŝ łodyg kwiaty tylko w górnej części łodygi Witam Wszystkich po wakacjach. To nasz drugi i ostatni semestr. Będą 4 spotkania dotyczące 4 działów: 1. genetyka 2. ekologia 3. ochrona przyrody i środowiska 4. ewolucjonizm i bioróŝnorodność. Będą więc

Bardziej szczegółowo

POLSKA AKADEMIA NAUK. »Życie dało życie, ale jak? w inwentaryzacji zadrzewień śródpolnych. »Patentowanie w biotechnologii

POLSKA AKADEMIA NAUK. »Życie dało życie, ale jak? w inwentaryzacji zadrzewień śródpolnych. »Patentowanie w biotechnologii POLSKA AKADEMIA NAUK»Życie dało życie, ale jak?»patentowanie w biotechnologii»magnetyczne metale molekularne»gis w inwentaryzacji zadrzewień śródpolnych»jak pisano w średniowiecznym Poznaniu?...www.pan.poznan.pl

Bardziej szczegółowo

Translacja czyli biosynteza białek. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Translacja czyli biosynteza białek. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Translacja czyli biosynteza białek Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Centralny dogmat biologii molekularnej. Potrzeba istnienia

Bardziej szczegółowo

1. DNA - podstawowy nośnik informacji genetycznej

1. DNA - podstawowy nośnik informacji genetycznej Elementy genetyki 1. DNA - podstawowy nośnik informacji genetycznej 1.1. Informacja o budowie i funkcjonowaniu organizmu zapisana w DNA początki genetyki jako nauki doświadczenia na bakteriach wywołujących

Bardziej szczegółowo

Bioinformatyka. Formaty danych - GenBank

Bioinformatyka. Formaty danych - GenBank Bioinformatyka Wykład 4. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas Formaty danych - GenBank Poco wprowadza się dane do komputerów? 1. żeby je pobrać 2. żeby coś odkryć

Bardziej szczegółowo

Genetyka. Krótkie wykłady H. Fletcher, I. Hickey, P. Winter,

Genetyka. Krótkie wykłady H. Fletcher, I. Hickey, P. Winter, Genetyka. Krótkie wykłady H. Fletcher, I. Hickey, P. Winter, Wydanie trzecie, zmienione, Wydawnictwo Naukowe PWN 2011 Genetyka ogólna. Skrypt do ćwiczeń dla studentów biologii A. Sadakierska-Chudy, G.

Bardziej szczegółowo

Plan wykładu: Budowa chromatyny - nukleosomy. Wpływ nukleosomów na replikację i transkrypcję

Plan wykładu: Budowa chromatyny - nukleosomy. Wpływ nukleosomów na replikację i transkrypcję Nukleosomy 1 Plan wykładu: Budowa chromatyny - nukleosomy Wpływ nukleosomów na replikację i transkrypcję Metody pozwalające na wyznaczanie miejsc wiązania nukleosomów Charakterystyka obsadzenia nukleosomów

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

Olsztyn, 12 listopada 2015 r.

Olsztyn, 12 listopada 2015 r. Prof. dr hab. Zbigniew Wieczorek Katedra Fizyki i Biofizyki Uniwersytet Warmińsko-Mazurski w Olsztynie Ul. Oczapowskiego 4 10-917 Olsztyn Olsztyn, 12 listopada 2015 r. Recenzja rozprawy doktorskiej mgr

Bardziej szczegółowo

Kwasy nukleinowe i białka

Kwasy nukleinowe i białka Metody bioinformatyki Kwasy nukleinowe i białka prof. dr hab. Jan Mulawka Kwasy nukleinowe DNA Kwas dezoksyrybonukleinowy jest to należący do kwasów nukleinowych wielkocząsteczkowy organiczny związek chemiczny,

Bardziej szczegółowo