Testy. Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN

Wielkość: px
Rozpocząć pokaz od strony:

Download "Testy. Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN"

Transkrypt

1 Testy Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN

2 Test Genetyczny? Analiza ludzkiego DNA, RNA, chromosomów, białek lub metabolitów w celu wykrycia zaburzeń związanych z chorobą dziedziczną

3 Coraz więcej testów GeneTests/ testów na 3600 chorób i 5000 genów!

4 Informacja jest, ale bez genetyki nie da się jej zrozumieć ile genów związanych ze schizofrenią? OMIM - Online Mendelian Inheritance in Man Welcome to OMIM, Online Mendelian Inheritance in Man. OMIM is a comprehensive, authoritative, and timely compendium of human genes and genetic phenotypes. The full-text, referenced overviews in OMIM contain information on all known mendelian disorders and over 12,000 genes. OMIM focuses on the relationship between phenotype and genotype. It is updated daily, and the entries contain copious links to other genetics resources. : # SCHIZOPHRENIA; SCZD Gene map locus 1p36.2, 15q15, 14q32.3, 13q34, 13q32, 13q14-q21, 12q24, 11q14-q21, 11p14- p13, 10q22.3, 8p21, 6q13-q26, 1p36.3, 6p22.3, 6p23, 5q23-q35, 3q13.3, 3p25, 1q42.1, 1q42.1, 22q12.3, 22q12.3, 22q11.2, 22q11, 1q32.1, 11p36.2, 15q15, 14q32.3, 13q34, 13q32, 13q14-q21, 12q24, 11q14-q21, 11p14-p13, 10q22.3, 8p21, 6q13-q26, 1p36.3, 6p22.3, 6p23, 5q23-q35, 3q13.3, 3p25, 1q42.1, 1q42.1, 22q12.3, 22q12.3, 22q11.2, 22q11, 1q32.1,

5 Przed DNA testowano fenotypy i/lub metabolity a także oglądano chromosomy. 1. Słony pot/skóra -mukowiscydoza 2. Czarny mocz - alkaptonuria 3. Zielony pierścień wokół źrenicy nagromadzanie miedzi, choroba Wilsona 4. Test wysokiego poziomu fenyloalaniny w krwi 5. Chromosomy zespół Downa, trisomie chr. 13 i 18; XO, XXY)

6 Oznaczanie aktywności enzymów galaktozemia Fenyloketonuria Metabolizm puryn Gromadzenie żelaza Metabolizm lipidów I wiele wiele innych

7 Test cytogenetyczny zespół Downa dwa trzy Images from:

8 Bezpośrednie testy genetyczne Szukanie mutacji w DNA (lub RNA)

9 Typy testów 1. Diagnostyczne 2. Predykcyjne 3. Nosicielstwo 4. Prenatalne 5. Preimplantacyjne 6. Skrining noworodków

10 Choroba Huntingtona n Ruchy n Psychiatryczne zaburzenia n Zaburzenia poznawcze

11 HD n Różny początek; średnio ok. 40 lat n Forma młodzieńcza <21 lat 5-10% n Późny początek >60 lat 10%

12 Gen huntingtyny powtórzenia CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG Unaffected Mutable Unaffected Reduced Penetrance Affected Repeat may be unstable when larger than 26 repeats

13 Diagnostyczne Służy potwierdzeniu diagnozy u osoby z objawami choroby Czasem tylko wiedza, jeśli choroby nie można leczyć; czasem dopasowane leczenie, choć czasem dość archaiczne (hemochromatoza) Wykrycie mutacji u osoby może mieć konsekwencje dla całej rodziny

14 Testy Genetyczne? Diagnostyczne = choroba Huntingtona Przedobjawowe? Prenatalne

15 Choroby dla których istnieje terapia/ nie istnieje terapia: diagnoza zawsze ma sens u chorego Choroba Huntingtona Rak piersi

16 Testy predykcyjne Osoby bez objawów, ale obciążający wywiad rodzinny Dwa typy Przedobjawowe rozwój choroby jest pewny jeśli jest obecna mutacja (HD) Predyspozycji rozwój choroby jest możliwy (różne prawdopodobieństwa) (rak piersi, TP53, HNPCC) Parę problemów: nieletni HD, rak piersi, rak tarczycy może wpływać na wiele rzeczy może być bardzo trudne do zniesienia (psycholog itp.)

17 Badanie nosicielstwa Choroby o recesywnym sposobie dziedziczenia 1 mutacja nie daje efektu ale może być przekazywana potomstwu Proponuje się osobom, z rodzin w których wystąpiła taka choroba Jeśli testuje się oboje przyszłych rodziców można określić ryzyko urodzenia chorego dziecka (lub jeśli badana osoba nie jest nosicielem wykluczyć) WYMAGA PORADNICTWA GENETYCZNEGO BY WYNIK BYŁ ZROZUMIANY

18 Prenatalne Kobiety powyżej pewnego wieku (na ogół 35 lat); osoby z rodzin z obciążonym wywiadem; czasem po badaniu przesiewowym (genetyczne USG, testy potrójne itp.) Płyn owodniowy lub kosmki

19 Preimplantacyjne 1-2 blastomery

20 Badania przesiewowe noworodków Wczesne wykrywanie potencjalnych problemów Kropla krwi z pięty niemowlaka Rodzice informowani tylko przy wyniku dodatnim Dodatni wynik nie przesądza, że dziecko chore; wymagane dalsze testy Od kilku do kilkudziesięciu chorób

21 Testy teraz i w przyszłości Cały genom incidental findings Dorosłego Noworodka Płodu 1 blastomeru przy IVF Wyniki ciekawy przykład dla superstulatków BRCA1 i choroba serca

22 Koszt sekwencjonowania DNA Maxim- Gilbert(chemical) Sanger (dideoxy) FLX G - Illumina ABI-SOLiD Heliscope Comp. Genom Automated Fluorescent sequencer (dideoxy) Pyrosequencing (SBS) Sequencing by Synthesis (SBS) Sequencing by LigaYon (SBL) PacBio $10M genome x- prize 100 human genomes in <=10 days % accurate with 98% coverage $10K/genome 22 Modified from UBS 2007

23 Medycyna personalizowana Więcej zastosowań technologii Cel zindywidualizowane podejście Dobrać terapię do choroby Nature 24 kwietnia 2014 tylko około 60 wariantów głównie u małych dzieci stosowanych w praktyce *Kathyrn Phillips, UCSF

24 Przykład bardzo dobry Fenyloketonuria Niemowlęta na całym świecie Wczesne wykrycie i dieta chronią przed niepełnosprawnością umysłową

25 DaKo HercepTest HercepYn targets cancer cells overexpressing Her2 Salmon et. al. NEJM 2001, 344:783 25% of breast cancers overexpress Her2 Her2 overexpression in breast tumors idenyfied (NIH) in 1986 First any- body therapy approved by FDA for cancer in 1998

26 Dziedziczne neuropatie ruchowo czuciowe Deformacja stóp Zanik mięśni strzałkowych Chód brodzący Osłabienie odruchów skokowych Taniej sekwencjonować genom niż badać około 35 genów

27 Czułość i specyficzność Czułość (sensitivity) jaka część chorych wychodzi jako chorzy w teście Specyficzność jaka część zdrowych wychodzi jako zdrowi w teście Jeśli jedno i drugie 99% powinno być bosko. Ale jak jest naprawdę zależy od CZĘSTOŚCI CHOROBY

28 Positive predictive value dodatnia wartość predykcyjna - prawdopodobieństwo, że ktoś jest chory jeśli test jest dodatni Negative predictive value ujemna wartość predykcyjna prawdopodobieństwo, że ktoś jest zdrowy jeśli test jest ujemny

29 TEST na AIDS US częstość 1%, czułość i spec. Po 99%; badamy Wynik + Wynik - Liczba osób Naprawdę chory Naprawdę zdrowy Razem 198 pred 99/

30 TEST na costam US częstość 11%, czułość i spec. Po 99%; badamy Wynik + Wynik - Liczba osób Naprawdę chory Naprawdę zdrowy Razem 1189 Pred 1100/

31 Fig 1 Key to symbols Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

32 Fig 2 Hypothetical population Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

33 Fig 3 Results of diagnostic test on hypothetical population Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

34 Czułośc: 24/30 = 80%

35 Fig 4 Sensitivity of test Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

36 Fig 5 Specificity of test Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

37 Specyficznośc = 56/70 = 80%

38 Fig 6 Test with 100% sensitivity Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

39 Fig 7 Perfect test Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

40 Fig 8 Positive predictive value Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

41 Poztytywna wartość predykcji 24 z 38 wyników jest prawidłowych czyli 63%

42 Fig 9 Negative predictive value Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

43 Negatywna wartość predykcji 56/62 = 90%

44 Fig 10 Results of testing population with disease prevalence of 10% Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

45 Przy tej samej czułości wartości Pozytywna = 31% (było 63) Negatywna = 97% (było 90%)

46 Fig 11 Prevalence of systemic lupus erythematosus Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

47 Fig 12 (top) Results of antibody nuclear test in systemic lupus erythematosus; (bottom) negative and positive predictive values Loong, T.-W. BMJ 2003;327: Copyright 2003 BMJ Publishing Group Ltd.

48 Dla lupus (toczeń rumieniowaty) przy częstości 33/ Czułość 94% Specyficzność 97% Pozytywna wartość predykcyjna 1% Negatywna 99,99%

49 Copyright 2003 BMJ Publishing Group Ltd. Loong, T.-W. BMJ 2003;327:

50 Copyright 2003 BMJ Publishing Group Ltd. Loong, T.-W. BMJ 2003;327:

51 DEFINICJA BADAŃ PRZESIEWOWYCh PRZYPUSZCZALNE WYKRYCIE choroby za pomocą testów, badania czy innych procedur, które można stosować SZYBKO by oddzielić (przypuszczalnie) chorych od (przypuszczalnie) zdrowych Co potrzebne: choroba/zaburzenie/itp test populacja *Commission on Chronic Illness, 195

52

53 Co Badać -Choroba/zaburzenie powinno być istotne Wysoka częstość Poważne -Możliwe wczesne wykrywanie u osób bezobjawowych -Wczesne wykrycie może wpłynąć na przebieg choroby (dyskusje o CFTR - mukowiscydoza)

54 Test idealnie dzieli na OK. i nie OK Screening Test Normal Abnormal

55 Parametry testu - Czułość: Idealnie 100% - ile procent przypadków osób chorych jest wykrywanych -Specyficzność: Idealnie 100% -- czy test wyklucza osoby zdrowe

56

57 -Dużo fałszywie dodatnich przeciążenie systemu, stres dla badanych - Ważne ustwienie punktu odcięcia tak by nie przegapić żadnego chorego dla chorób dla których można coś zrobić

58 Wynik skriningu wartości predykcyjne Relationship between Sensitivity, Specificity, and Częstość choroby Jeśli częstość choroby jest niska, nawet wysoka specyficzność da dużo wyników fałszywie pozytywnych Predictive Value of a Positive Test (PPV): (Pozytywna wartość predykcyjna) : Prawdopodobieństwo, że osoba o dodatnim wyniku jest chora Predictive Value of a Negative Test (NPV): (Negatywna wartość predykcyjna) Prawdopodobieństwo, że osoba z ujemnym wynikiem jest zdrowa

59 Screening for Glaucoma using IOP True Cases of Glaucoma Yes No IOP > 22: Yes No (total) Specificity = 95% (1900/2000) False Positive=5% Positive Predictive Value =33%

60 Zasady programów przesiewowych 1. Badana choroba powinna być poważna 2. Powinno dać się wykryć stadium wczesne czy bezobjawowe 3. Powinno być możliwe leczenie 4. Test jest wiarygodny, z odpowiednimi parametrami 5. Powinien być akceptowany przez populację, która ma być badana (ahem niemowlęta??) 6. Koszt skriningu powinien być uzasadniony

61 This is about Uncertainty!

62 Technical vs. Clinical Precision Baby Jeff : The case of screening for muscular dystrophy at HH Technical Precision of CPK test: Sensitivity (ability to identify disease): 100% Specificity (ability to rule out disease): 99.98% But, The prevalence of MD is 1 in 5000 (0.02%)

63 Does Baby Jeff have M.D.? Of 100,000 males, 20 will have M.D. (1 in 5,000, or 0.02% prevalence) The test will correctly identify all 20 who have the disease (sensitivity = 100%)

64 Does Baby Jeff have M.D.? Of the 99,980 without M.D. Specificity = 99.98% 99,980 x = 99,960 will be negative Therefore, false positives = 20

65 HARM!... The Rest of the Story Therefore, Out of 100,000 infants, 20 will be truly positive and 20 will be false positive Positive predictive value = 50% The child with a positive screening test only has a 50/50 chance of actually having MD!

66 Another Example: Mammography Mammography in women between yrs If 100,000 women are screened: 6,034 mammograms will be abnormal 5,998 (99.4%) will be false-positive 36 will actually have breast cancer Why? Prevalence = 0.04% (including 4 false negatives) Hamm RM, Smith SL. The accuracy of patients' judgments of disease probability and test sensitivity and specificity J Fam Pract 1998;47: Kerlikowske K, et al. Likelihood ratios for modern screening mammography. Risk of breast

67 THE CLASSIC 2x2 TABLE TEST + TEST - DISEASE TRUE POSITIVE (TP) a c FALSE NEGATIVE (FN) NO DISEASE FALSE POSITIVE (FP) b d TRUE NEGATIVE (TN)

68 Sensitivity DISEASE NO DISEASE TEST + TEST - TRUE POSITIVE (TP) a c FALSE NEGATIVE (FN) FALSE POSITIVE (FP) b d TRUE NEGATIVE (TN)

69 Specificity DISEASE NO DISEASE TEST + TEST - TRUE POSITIVE (TP) a c FALSE NEGATIVE (FN) FALSE POSITIVE (FP) b d TRUE NEGATIVE (TN)

70 Positive Predictive Value DISEASE NO DISEASE TEST + TEST - TRUE POSITIVE (TP) a c FALSE NEGATIVE (FN) FALSE POSITIVE (FP) b d TRUE NEGATIVE (TN)

71 Negative Predictive Value DISEASE NO DISEASE TEST + TEST - TRUE POSITIVE (TP) a c FALSE NEGATIVE (FN) FALSE POSITIVE (FP) b d TRUE NEGATIVE (TN)

72 Specificity Putting it all together DISEASE NO DISEASE TEST + TEST - TRUE POSITIVE (TP) Sensitivity Positive Predictive Value a c FALSE NEGATIVE (FN) FALSE POSITIVE (FP) b d TRUE NEGATIVE (TN) Negative Predictive Value

73 Ważne Przy niskiej częstości np. skrining nawet świetne testy mogą dawać dużo fałszywie pozytywnych Przy wysokiej częstości (test by sprawdzić podejrzewaną chorobę) nawet świetne testy mogą dawać dużo fałszywie negatywnych Odpowiedzialność lekarza przypadek prolaktyny

74 Practice

75 The serum test screens pregnant women for babies with Down s syndrome. The test is a very good one, but not perfect. Roughly 1% of babies have Down s syndrome. If the baby has Down s syndrome, there is a 90% chance that the result will be positive. If the baby is unaffected, there is still a 1% chance that the result will be positive. A pregnant woman has been tested and the result is positive. What is the chance her baby actually has Down s syndrome? Answer: 47.4% Answered incorrectly by 20/21 OBs, 22/22 midwives, 21/22 pregnant women, and 17/20 companions

76 1% of 1, women 990 Assuming 1,000 pregnant women are screened Down s Normal TEST + (TP) 90% Positive 9 identified Predictive Value = 47.4% (FP) 1% 10 of 990 TEST - (FN) 1 a c b d (TN) 980

77 Positive Predictive Value DISEASE NO DISEASE TEST + TEST - TRUE POSITIVE (TP) a c FALSE NEGATIVE (FN) FALSE POSITIVE (FP) b d TRUE NEGATIVE (TN)

78 Negative Predictive Value DISEASE NO DISEASE TEST + TEST - TRUE POSITIVE (TP) a c FALSE NEGATIVE (FN) FALSE POSITIVE (FP) b d TRUE NEGATIVE (TN)

79 Specificity Putting it all together DISEASE NO DISEASE TEST + TEST - TRUE POSITIVE (TP) Sensitivity Positive Predictive Value a c FALSE NEGATIVE (FN) FALSE POSITIVE (FP) b d TRUE NEGATIVE (TN) Negative Predictive Value

80 Czułość i specyficzność Konsekwencje wyniku fałszywie dodatniego Nawet 3-5% może być dużo na poziomie populacji Dalsze testy, koszt, problemy, niepokój Konsekwencje wyniku fałszywie ujemnego Nawet 1 osoba może być tragedią Fałszywe poczucie bezpieczeństwa

Testy. Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN

Testy. Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN Testy Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN Test Genetyczny? Analiza ludzkiego DNA, RNA, chromosomów, białek lub metabolitów w celu wykrycia zaburzeń związanych

Bardziej szczegółowo

Zapytaj swojego lekarza.

Zapytaj swojego lekarza. Proste, bezpieczne badanie krwi, zapewniające wysoką czułość diagnostyczną Nieinwazyjne badanie oceniające ryzyko wystąpienia zaburzeń chromosomalnych, takich jak zespół Downa; opcjonalnie umożliwia również

Bardziej szczegółowo

Test BRCA1. BRCA1 testing

Test BRCA1. BRCA1 testing Test BRCA1 BRCA1 testing 2 Streszczenie Za najczęstszą przyczynę występowania wysokiej, genetycznie uwarunkowanej predyspozycji do rozwoju raka piersi i/lub jajnika w Polsce uznaje się nosicielstwo trzech

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

NIPT Nieinwazyjny Test Prenatalny (ang. Non-Invasive Prenatal Test)

NIPT Nieinwazyjny Test Prenatalny (ang. Non-Invasive Prenatal Test) NIPT Nieinwazyjny Test Prenatalny (ang. Non-Invasive Prenatal Test) Nieinwazyjne badanie krwi kobiety ciężarnej w kierunku wykluczenia najczęstszych trisomii u płodu Cel testu NIPT Celem testu NIPT jest

Bardziej szczegółowo

Wstęp ARTYKUŁ REDAKCYJNY / LEADING ARTICLE

Wstęp ARTYKUŁ REDAKCYJNY / LEADING ARTICLE Dzieciństwo w cieniu schizofrenii przegląd literatury na temat możliwych form pomocy i wsparcia dzieci z rodzin, gdzie jeden z rodziców dotknięty jest schizofrenią Childhood in the shadow of schizophrenia

Bardziej szczegółowo

Czym jest medycyna personalizowana w kontekście wyzwań nowoczesnej onkologii?

Czym jest medycyna personalizowana w kontekście wyzwań nowoczesnej onkologii? Czym jest medycyna personalizowana w kontekście wyzwań nowoczesnej onkologii? Wykorzystanie nowych technik molekularnych w badaniach nad genetycznymi i epigenetycznymi mechanizmami transformacji nowotworowej

Bardziej szczegółowo

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie Sekwencyjność występowania zaburzeń molekularnych w niedrobnokomórkowym raku płuca

Bardziej szczegółowo

Informacje na temat badań prenatalnych

Informacje na temat badań prenatalnych Informacje na temat badań prenatalnych PODSTAWOWE INFORMACJE Z ZAKRESU BIOLOGII BIOLOGIA Nasz organizm zbudowany jest z miliardów komórek. W każdej z nich zawarty jest materiał genetyczny, czyli DNA (ang.

Bardziej szczegółowo

diagnostyka raka piersi

diagnostyka raka piersi diagnostyka raka piersi Jedyne w Polsce badanie genetyczne połączone z badaniem obrazowym piersi 1 Czy jesteś pewna, że nie grozi Ci zachorowanie na raka piersi? Aktualny stan wiedzy medycznej umożliwia

Bardziej szczegółowo

NIFTY TM Nieinwazyjny, Genetyczny Test Prenataly określający ryzyko wystąpienia zespołu Downa, Edwardsa i Patau

NIFTY TM Nieinwazyjny, Genetyczny Test Prenataly określający ryzyko wystąpienia zespołu Downa, Edwardsa i Patau NIFTY TM Nieinwazyjny, Genetyczny Test Prenataly określający ryzyko wystąpienia zespołu Downa, Edwardsa i Patau Nieinwazyjne badania prenatalne, polegające na ocenia parametrów biochemicznych, takie jak

Bardziej szczegółowo

NIFTY nieinwazyjny test prenatalny wykorzystujący sekwencjonowanie nowej generacji mgr inż. Łukasz Brejnakowski Country Sales Manager www.

NIFTY nieinwazyjny test prenatalny wykorzystujący sekwencjonowanie nowej generacji mgr inż. Łukasz Brejnakowski Country Sales Manager www. NIFTY nieinwazyjny test prenatalny wykorzystujący sekwencjonowanie nowej generacji mgr inż. Łukasz Brejnakowski Country Sales Manager www. test-nifty.com.pl BGI Beijing Genomics Institute Największe centrum

Bardziej szczegółowo

Dziedziczenie recesywne

Dziedziczenie recesywne 12 Zakład Genetyki Medycznej Instytut "Pomnik-Centrum Zdrowia Dziecka" telefon 022 815 74 50 (sekretariat) 022 815 74 51 (poradnia) Dziedziczenie recesywne, Szpital Dziecięcy, Dziekanów Leśny k/o Warszawy

Bardziej szczegółowo

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10.

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10. Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016 Ćwiczenie nr 1 (06-07.10.2015) Temat: Wprowadzenie 1. Omówienie regulaminu zajęć Temat: Wprowadzenie

Bardziej szczegółowo

Noworodek z wrodzoną wadą metabolizmu - analiza przypadku klinicznego

Noworodek z wrodzoną wadą metabolizmu - analiza przypadku klinicznego Noworodek z wrodzoną wadą metabolizmu - analiza przypadku klinicznego Marcin Kalisiak Klinika Neonatologii i Intensywnej Terapii Noworodka Kierownik Kliniki: prof. Ewa Helwich 1 Plan prezentacji co to

Bardziej szczegółowo

Genetyka kliniczna nowe wyzwanie dla opieki pediatrycznej. Jacek J. Pietrzyk Klinika Chorób Dzieci Katedra Pediatrii Collegium Medicum UJ

Genetyka kliniczna nowe wyzwanie dla opieki pediatrycznej. Jacek J. Pietrzyk Klinika Chorób Dzieci Katedra Pediatrii Collegium Medicum UJ Genetyka kliniczna nowe wyzwanie dla opieki pediatrycznej Jacek J. Pietrzyk Klinika Chorób Dzieci Katedra Pediatrii Collegium Medicum UJ Kraków, czerwiec 2005 Genetyka kliniczna Kierunki rozwoju Choroby

Bardziej szczegółowo

Podstawy genetyki człowieka. Cechy wieloczynnikowe

Podstawy genetyki człowieka. Cechy wieloczynnikowe Podstawy genetyki człowieka Cechy wieloczynnikowe Dziedziczenie Mendlowskie - jeden gen = jedna cecha np. allele jednego genu decydują o barwie kwiatów groszku Bardziej złożone - interakcje kilku genów

Bardziej szczegółowo

Nowa generacja nieinwazyjnych badań prenatalnych. www.neobona.pl

Nowa generacja nieinwazyjnych badań prenatalnych. www.neobona.pl Nowa generacja nieinwazyjnych badań prenatalnych www.neobona.pl Aberracje chromosomowe występują u około 1% wszystkich płodów. Diagnostyka prenatalna obejmuje testy opracowane w celu badania prawidłowego

Bardziej szczegółowo

Test genetyczny Łuszczycowe Zapalenie Stawów

Test genetyczny Łuszczycowe Zapalenie Stawów Test genetyczny Łuszczycowe Zapalenie Stawów W dokumencie tym omówiono wartość i przydatność kliniczną testu genetycznego Łuszczycowe Zapalenie Stawów (ŁZS). WPROWADZENIE: GENETYCZNE BADANIA PRZESIEWOWE

Bardziej szczegółowo

Krakowska Akademia im. Andrzeja Frycza Modrzewskiego. Karta przedmiotu. obowiązuje studentów, którzy rozpoczęli studia w roku akademickim 2014/2015

Krakowska Akademia im. Andrzeja Frycza Modrzewskiego. Karta przedmiotu. obowiązuje studentów, którzy rozpoczęli studia w roku akademickim 2014/2015 Krakowska Akademia im. Andrzeja Frycza Modrzewskiego Karta przedmiotu Wydział Zdrowia i Nauk Medycznych obowiązuje studentów, którzy rozpoczęli studia w roku akademickim 014/015 Kierunek studiów: Dietetyka

Bardziej szczegółowo

Badania przesiewowe z kropli krwi dla twojego dziecka

Badania przesiewowe z kropli krwi dla twojego dziecka Badania przesiewowe z kropli krwi dla twojego dziecka W pierwszym tygodniu po porodzie zaproponujemy Ci badanie przesiewowe z kropli krwi Twojego dziecka (test bibułkowy). Dlaczego powinnam poddać moje

Bardziej szczegółowo

MUTACJE GENETYCZNE. Wykonane przez Malwinę Krasnodębską kl III A

MUTACJE GENETYCZNE. Wykonane przez Malwinę Krasnodębską kl III A MUTACJE GENETYCZNE Wykonane przez Malwinę Krasnodębską kl III A Mutacje - rodzaje - opis Mutacje genowe powstają na skutek wymiany wypadnięcia lub dodatnia jednego albo kilku nukleotydów. Zmiany w liczbie

Bardziej szczegółowo

Dziedziczenie dominujące

Dziedziczenie dominujące 12 Zakład Genetyki Medycznej Instytut "Pomnik-Centrum Zdrowia Dziecka" telefon 022 815 74 50 (sekretariat) 022 815 74 51 (poradnia) Dziedziczenie dominujące, Szpital Dziecięcy, Dziekanów Leśny k/o Warszawy

Bardziej szczegółowo

Warsztaty Ocena wiarygodności badania z randomizacją

Warsztaty Ocena wiarygodności badania z randomizacją Warsztaty Ocena wiarygodności badania z randomizacją Ocena wiarygodności badania z randomizacją Każda grupa Wspólnie omawia odpowiedź na zadane pytanie Wybiera przedstawiciela, który w imieniu grupy przedstawia

Bardziej szczegółowo

GIMNAZJUM SPRAWDZIANY SUKCES W NAUCE

GIMNAZJUM SPRAWDZIANY SUKCES W NAUCE GIMNAZJUM SPRAWDZIANY BIOLOGIA klasa III SUKCES W NAUCE II GENETYKA CZŁOWIEKA Zadanie 1. Cechy organizmu są warunkowane przez allele dominujące i recesywne. Uzupełnij tabelę, wykorzystując poniższe określenia,

Bardziej szczegółowo

Kto powinien być przebadany w kierunku BRCA1/2? Zalecenia dla kobiet nosicielek BRCA1/2 i CHEK2.

Kto powinien być przebadany w kierunku BRCA1/2? Zalecenia dla kobiet nosicielek BRCA1/2 i CHEK2. Kto powinien być przebadany w kierunku BRCA1/2? Zalecenia dla kobiet nosicielek BRCA1/2 i CHEK2. Dorota Nowakowska Poradnia Genetyczna Zakład Profilaktyki Nowotworów Jakie jest znaczenie nosicielstwa mutacji

Bardziej szczegółowo

Jednostka chorobowa. 235200 HFE HFE 235200 Wykrycie mutacji w genie HFE odpowiedzialnych za heterochromatozę. Analiza mutacji w kodonach: C282Y, H63D.

Jednostka chorobowa. 235200 HFE HFE 235200 Wykrycie mutacji w genie HFE odpowiedzialnych za heterochromatozę. Analiza mutacji w kodonach: C282Y, H63D. Jednostka chorobowa Jednostka Oznaczenie Chorobowa testu OMIM TM Badany Gen Literatura Gen OMIM TM Opis/cel badania Zakres analizy Materiał biologiczny Czas analizy [dni roboczych] Cena [PLN] HEMOCHROMATOZA

Bardziej szczegółowo

Hipercholesterolemia rodzinna - co warto wiedzieć

Hipercholesterolemia rodzinna - co warto wiedzieć I Katedra i Klinika Kardiologii Gdański Uniwersytet Medyczny Hipercholesterolemia rodzinna - co warto wiedzieć Dlaczego to takie ważne? Marcin Gruchała Czynniki ryzyka zawału serca 15 152 osób z pierwszym

Bardziej szczegółowo

Ciąża po poronieniu. Jakie badania genetyczne warto zrobić?

Ciąża po poronieniu. Jakie badania genetyczne warto zrobić? Ciąża po poronieniu Jakie badania genetyczne warto zrobić? Po poronieniu nadal masz szansę na urodzenie dziecka. Ważna jest wtedy właściwa diagnostyka, w której dużą rolę odgrywają badania genetyczne.

Bardziej szczegółowo

Jak zasada Pareto może pomóc Ci w nauce języków obcych?

Jak zasada Pareto może pomóc Ci w nauce języków obcych? Jak zasada Pareto może pomóc Ci w nauce języków obcych? Artykuł pobrano ze strony eioba.pl Pokazuje, jak zastosowanie zasady Pareto może usprawnić Twoją naukę angielskiego. Słynna zasada Pareto mówi o

Bardziej szczegółowo

II WYDZIAŁ LEKARSKI, II ROK

II WYDZIAŁ LEKARSKI, II ROK II WYDZIAŁ LEKARSKI, II ROK PRZEDMIOT: BIOLOGIA MEDYCZNA (CZĘŚĆ 1 GENETYKA) PROGRAM ĆWICZEŃ 2009/2010 L.p. Data zajęć Temat zajęć 1. 15.02 18.02 Podstawy genetyki klasycznej (podstawowe pojęcia i definicje

Bardziej szczegółowo

Terapie dla kobiet z zaawansowanym rakiem piersi w Polsce

Terapie dla kobiet z zaawansowanym rakiem piersi w Polsce Warszawa, 27.01.2016 Seminarium naukowe: Terapie przełomowe w onkologii i hematoonkologii a dostępność do leczenia w Polsce na tle Europy Terapie dla kobiet z zaawansowanym rakiem piersi w Polsce Dr n.

Bardziej szczegółowo

Krakowska Akademia im. Andrzeja Frycza Modrzewskiego. Karta przedmiotu. obowiązuje studentów, którzy rozpoczęli studia w roku akademickim 2016/2017

Krakowska Akademia im. Andrzeja Frycza Modrzewskiego. Karta przedmiotu. obowiązuje studentów, którzy rozpoczęli studia w roku akademickim 2016/2017 Krakowska Akademia im. Andrzeja Frycza Modrzewskiego Karta przedmiotu WydziałZdrowia i Nauk Medycznych obowiązuje studentów, którzy rozpoczęli studia w roku akademickim 016/017 Kierunek studiów: Dietetyka

Bardziej szczegółowo

POLITYKA PRYWATNOŚCI / PRIVACY POLICY

POLITYKA PRYWATNOŚCI / PRIVACY POLICY POLITYKA PRYWATNOŚCI / PRIVACY POLICY TeleTrade DJ International Consulting Ltd Sierpień 2013 2011-2014 TeleTrade-DJ International Consulting Ltd. 1 Polityka Prywatności Privacy Policy Niniejsza Polityka

Bardziej szczegółowo

Badania. przesiewowe stosowane w celu wczesnego wykrycia raka jelita grubego. zalecenia National Comprehensive Cancer Network (NCCN)

Badania. przesiewowe stosowane w celu wczesnego wykrycia raka jelita grubego. zalecenia National Comprehensive Cancer Network (NCCN) Badania przesiewowe stosowane w celu wczesnego wykrycia raka jelita grubego zalecenia National Comprehensive Cancer Network (NCCN) Badania przesiewowe stosowane w celu wykrycia raka jelita grubego Ocena

Bardziej szczegółowo

Badania. przesiewowe stosowane w celu wczesnego wykrycia raka sutka. zalecenia National Comprehensive Cancer Network (NCCN)

Badania. przesiewowe stosowane w celu wczesnego wykrycia raka sutka. zalecenia National Comprehensive Cancer Network (NCCN) Badania przesiewowe stosowane w celu wczesnego wykrycia raka sutka zalecenia National Comprehensive Cancer Network (NCCN) Cel wykonywania badań przesiewowych Jak powinna postępować każda kobieta? U jakich

Bardziej szczegółowo

ERASMUS + : Trail of extinct and active volcanoes, earthquakes through Europe. SURVEY TO STUDENTS.

ERASMUS + : Trail of extinct and active volcanoes, earthquakes through Europe. SURVEY TO STUDENTS. ERASMUS + : Trail of extinct and active volcanoes, earthquakes through Europe. SURVEY TO STUDENTS. Strona 1 1. Please give one answer. I am: Students involved in project 69% 18 Student not involved in

Bardziej szczegółowo

RAK JAJNIKA CZYLI RZECZ O WYBRCA-OWANYCH (WYBRAKOWANYCH) GENACH

RAK JAJNIKA CZYLI RZECZ O WYBRCA-OWANYCH (WYBRAKOWANYCH) GENACH RAK JAJNIKA CZYLI RZECZ O WYBRCA-OWANYCH (WYBRAKOWANYCH) GENACH Dr hab. n. med. Lubomir Bodnar Klinika Onkologii Wojskowy Instytut Medyczny w Warszawie PORUSZANE TEMATY Budowa genów odpowiedzialnych za

Bardziej szczegółowo

Podstawy genetyki człowieka

Podstawy genetyki człowieka Podstawy genetyki człowieka Dziedziczenie Mendlowskie - jeden gen = jedna cecha np. allele jednego genu decydują o barwie kwiatów groszku Bardziej złożone - interakcje kilku genów Wieloczynnikowe - interakcje

Bardziej szczegółowo

Przewodnik po chorobie Wilsona

Przewodnik po chorobie Wilsona Przewodnik po chorobie Wilsona 1 / 11 Czym jest choroba Wilsona? Choroba Wilsona jest wrodzonym zaburzeniem prawidłowego usuwania miedzi z organizmu. Pozostająca w ciele miedź odkłada się w wątronie i/lub

Bardziej szczegółowo

Składniki jądrowego genomu człowieka

Składniki jądrowego genomu człowieka Składniki jądrowego genomu człowieka Genom człowieka 3 000 Mpz (3x10 9, 100 cm) Geny i sekwencje związane z genami (900 Mpz, 30% g. jądrowego) DNA pozagenowy (2100 Mpz, 70%) DNA kodujący (90 Mpz ~ ok.

Bardziej szczegółowo

KWESTIONARIUSZ OCENY RYZYKA / INSURANCE QUESTIONNAIRE

KWESTIONARIUSZ OCENY RYZYKA / INSURANCE QUESTIONNAIRE Ubezpieczenie odpowiedzialności cywilnej z tytułu prowadzenia badań klinicznych/ Clinical trials liability insurance KWESTIONARIUSZ OCENY RYZYKA / INSURANCE QUESTIONNAIRE ZEZWOLENIA PUNU NR 1098/02 I NR

Bardziej szczegółowo

10/15/2016. Reguła. Czułość PV(+) Bayesa. Swoistość PV(-)

10/15/2016. Reguła. Czułość PV(+) Bayesa. Swoistość PV(-) A=symptom B= choroba Czułość Swoistość A ~ A ~ Reguła Bayesa ~ B ~ A) PV(+) PV(-) 1 / 2016_10_13 PV ( ) A PV ( ) A A ~ ~ sensitivity * PV ( ) sensitivity * (1 specificity)(1- ) specificity *(1- ) specificity

Bardziej szczegółowo

ANKIETA ŚWIAT BAJEK MOJEGO DZIECKA

ANKIETA ŚWIAT BAJEK MOJEGO DZIECKA Przedszkole Nr 1 w Zabrzu ANKIETA ul. Reymonta 52 41-800 Zabrze tel./fax. 0048 32 271-27-34 p1zabrze@poczta.onet.pl http://jedyneczka.bnet.pl ŚWIAT BAJEK MOJEGO DZIECKA Drodzy Rodzice. W związku z realizacją

Bardziej szczegółowo

6. Uzupełnij zdanie, wstawiajac w odpowiednie miejsce wyrażenie ujawni się lub nie ujawni się :

6. Uzupełnij zdanie, wstawiajac w odpowiednie miejsce wyrażenie ujawni się lub nie ujawni się : ID Testu: 9S6C1A4 Imię i nazwisko ucznia Klasa Data 1. Allelami nazywamy A. takie same formy jednego genu. B. różne formy różnych genów. C. takie same formy różnych genów. D. różne formy jednego genu.

Bardziej szczegółowo

Polska Szkoła Weekendowa, Arklow, Co. Wicklow KWESTIONRIUSZ OSOBOWY DZIECKA CHILD RECORD FORM

Polska Szkoła Weekendowa, Arklow, Co. Wicklow KWESTIONRIUSZ OSOBOWY DZIECKA CHILD RECORD FORM KWESTIONRIUSZ OSOBOWY DZIECKA CHILD RECORD FORM 1. Imię i nazwisko dziecka / Child's name... 2. Adres / Address... 3. Data urodzenia / Date of birth... 4. Imię i nazwisko matki /Mother's name... 5. Adres

Bardziej szczegółowo

Domy inaczej pomyślane A different type of housing CEZARY SANKOWSKI

Domy inaczej pomyślane A different type of housing CEZARY SANKOWSKI Domy inaczej pomyślane A different type of housing CEZARY SANKOWSKI O tym, dlaczego warto budować pasywnie, komu budownictwo pasywne się opłaca, a kto się go boi, z architektem, Cezarym Sankowskim, rozmawia

Bardziej szczegółowo

W dniu 09.01.2004 odbyło się posiedzenie grupy ekspertów powołanych przez Zarząd

W dniu 09.01.2004 odbyło się posiedzenie grupy ekspertów powołanych przez Zarząd W dniu 09.01.2004 odbyło się posiedzenie grupy ekspertów powołanych przez Zarząd Główny Polskiego Towarzystwa Ginekologicznego wraz z reprezentantami genetyków polskich. W wyniku dwudniowej dyskusji opracowano

Bardziej szczegółowo

Załącznik nr 5 do zarządzenia Nr 53/2006 Prezesa Narodowego Funduszu Zdrowia. Program badań prenatalnych

Załącznik nr 5 do zarządzenia Nr 53/2006 Prezesa Narodowego Funduszu Zdrowia. Program badań prenatalnych Program badań prenatalnych 1 I. UZASADNIENIE CELOWOŚCI WDROŻENIA PROGRAMU BADAŃ PRENATALNYCH, zwanego dalej Programem. 1. Opis problemu zdrowotnego W ostatnich latach wzrasta systematycznie średni wiek

Bardziej szczegółowo

CLINICAL GENETICS OF CANCER 2015

CLINICAL GENETICS OF CANCER 2015 International Conference CLINICAL GENETICS OF CANCER 2015 Szczecin, 24-25 September 2015 (Center for New Medical Technologies, Unii Lubelskiej 1, Szczecin) Thursday (24 September 2015) 9:00-9:15 Conference

Bardziej szczegółowo

Materiał i metody. Wyniki

Materiał i metody. Wyniki Abstract in Polish Wprowadzenie Selen jest pierwiastkiem śladowym niezbędnym do prawidłowego funkcjonowania organizmu. Selen jest wbudowywany do białek w postaci selenocysteiny tworząc selenobiałka (selenoproteiny).

Bardziej szczegółowo

POMORSKI UNIWERSYTET MEDYCZNY W SZCZECINIE OŚRODEK NOWOTWORÓW DZIEDZICZNYCH ZAKŁAD GENETYKI I PATOMORFOLOGII

POMORSKI UNIWERSYTET MEDYCZNY W SZCZECINIE OŚRODEK NOWOTWORÓW DZIEDZICZNYCH ZAKŁAD GENETYKI I PATOMORFOLOGII POMORSKI UNIWERSYTET MEDYCZNY W SZCZECINIE OŚRODEK NOWOTWORÓW DZIEDZICZNYCH ZAKŁAD GENETYKI I PATOMORFOLOGII STRUKTURA OŚRODKA NOWOTWORÓW DZIEDZICZNYCH Onkologiczna Poradnia Genetyczna SPSK2 w Szczecinie

Bardziej szczegółowo

Spersonalizowana medycyna

Spersonalizowana medycyna Spersonalizowana medycyna Kluczowe terminy Genom: pełna informacja genetyczna organizmu zakodowana w DNA, obecna we wszystkich komórkach. DNA: związek chemiczny przenoszący informację genetyczną, złożony

Bardziej szczegółowo

SG-MICRO... SPRĘŻYNY GAZOWE P.103

SG-MICRO... SPRĘŻYNY GAZOWE P.103 SG-MICRO... SG-MICRO 19 SG-MICRO SG-MICRO H SG-MICRO R SG-MICRO 32 SG-MICRO 32H SG-MICRO 32R SG-MICRO SG-MICRO H SG-MICRO R SG-MICRO 45 SG-MICRO SG-MICRO SG-MICRO 75 SG-MICRO 95 SG-MICRO 0 cylindra body

Bardziej szczegółowo

Człowiek mendlowski? Genetyka człowieka w XX i XXI w.

Człowiek mendlowski? Genetyka człowieka w XX i XXI w. Człowiek mendlowski? Genetyka człowieka w XX i XXI w. Informacje Kontakt: Paweł Golik Instytut Genetyki i Biotechnologii, Pawińskiego 5A pgolik@igib.uw.edu.pl Informacje, materiały: http://www.igib.uw.edu.pl/

Bardziej szczegółowo

CENNIK DIAGNOSTYKA NIEPŁODNOŚCI MĘSKIEJ

CENNIK DIAGNOSTYKA NIEPŁODNOŚCI MĘSKIEJ CENNIK DIAGNOSTYKA NIEPŁODNOŚCI MĘSKIEJ AZOOSPERMIA badanie wykrywa delecje w regionie długiego ramienia chromosomu Y w fragmencie zwanym AZF, będące często przyczyną azoospermii lub oligospermii o podłożu

Bardziej szczegółowo

Tranquility. Najdokładniejszenieinwazyjnebadanietrisomii Pozwalauniknądryzykaamniopunkcji

Tranquility. Najdokładniejszenieinwazyjnebadanietrisomii Pozwalauniknądryzykaamniopunkcji Tranquility Najdokładniejszenieinwazyjnebadanietrisomii Pozwalauniknądryzykaamniopunkcji BezpieczneiwysoceczułebadanieDNAzkrwiwykonywane przyużyciusekwencjonowanianastępnejgeneracji Wystarczyproste pobraniekrwi,aby

Bardziej szczegółowo

Odrębności diagnostyki i leczenia raka piersi u młodych kobiet

Odrębności diagnostyki i leczenia raka piersi u młodych kobiet Odrębności diagnostyki i leczenia raka piersi u młodych kobiet Barbara Radecka Opolskie Centrum Onkologii Amadeo Modigliani (1884-1920) 1 Młode chore Kto to taki??? Daniel Gerhartz (1965-) 2 3 Grupy wiekowe

Bardziej szczegółowo

Genetyka kliniczna - opis przedmiotu

Genetyka kliniczna - opis przedmiotu Genetyka kliniczna - opis przedmiotu Informacje ogólne Nazwa przedmiotu Genetyka kliniczna Kod przedmiotu 12.9-WL-Lek-GK Wydział Wydział Lekarski i Nauk o Zdrowiu Kierunek Lekarski Profil praktyczny Rodzaj

Bardziej szczegółowo

European Crime Prevention Award (ECPA) Annex I - new version 2014

European Crime Prevention Award (ECPA) Annex I - new version 2014 European Crime Prevention Award (ECPA) Annex I - new version 2014 Załącznik nr 1 General information (Informacje ogólne) 1. Please specify your country. (Kraj pochodzenia:) 2. Is this your country s ECPA

Bardziej szczegółowo

Dr hab. n. med. Paweł Blecharz

Dr hab. n. med. Paweł Blecharz BRCA1 zależny rak piersi i jajnika odmienności diagnostyczne i kliniczne (BRCA1 dependent breast and ovarian cancer clinical and diagnostic diversities) Paweł Blecharz Dr hab. n. med. Paweł Blecharz Dr

Bardziej szczegółowo

Przesiewowe badanie chorób dziedzicznych u noworodków

Przesiewowe badanie chorób dziedzicznych u noworodków Puola 19.3.2008 Przesiewowe badanie chorób dziedzicznych u noworodków Informacje na temat badania NeoPilot Szanowni przyszli rodzice! Pragniemy poinformować Was o projekcie badawczym rozpoczętym w szpitalu

Bardziej szczegółowo

MIARY OCENY RYZYKA. zatem

MIARY OCENY RYZYKA. zatem MIARY OCENY RYZYKA Samą wartość statystyki 2 i powiązaną z nią wartość p nie możemy przyjąć, jako miarę siły powiązania i wielkości efektu, zależy ona bowiem od liczebności próby N. Im większe N tym większa

Bardziej szczegółowo

DZIEŃ. 50-69 lat. 20-49 lat EUROPEJSKI. Walki z Rakiem Piersi

DZIEŃ. 50-69 lat. 20-49 lat EUROPEJSKI. Walki z Rakiem Piersi Europejski Dzień (Breast Health Day) to ustanowione 15 października święto, którego istotą jest przypominanie i uświadamianie o tym jak zapobiegać występowaniu nowotworów piersi oraz o olbrzymim znaczeniu

Bardziej szczegółowo

Angielski bezpłatne ćwiczenia - gramatyka i słownictwo. Ćwiczenie 4

Angielski bezpłatne ćwiczenia - gramatyka i słownictwo. Ćwiczenie 4 Angielski bezpłatne ćwiczenia - gramatyka i słownictwo. Ćwiczenie 4 Przetłumacz na język angielski.klucz znajdziesz w drugiej części ćwiczenia. 1. to be angry with somebody gniewać się na kogoś Czy gniewasz

Bardziej szczegółowo

Załącznik nr 4 do zarządzenia Nr 53/2006 Prezesa Narodowego Funduszu Zdrowia. Program profilaktyki raka piersi

Załącznik nr 4 do zarządzenia Nr 53/2006 Prezesa Narodowego Funduszu Zdrowia. Program profilaktyki raka piersi Program profilaktyki raka piersi 1 I. UZASADNIENIE CELOWOŚCI WDROŻENIA PROGRAMU PROFILAKTYKI RAKA PIERSI, zwanego dalej Programem. 1. Opis problemu zdrowotnego. Rak piersi jest najczęściej występującym

Bardziej szczegółowo

B IURO B ADAWCZE DS. J AKOŚCI

B IURO B ADAWCZE DS. J AKOŚCI ISO 9001 Q Ref. Certif. No. PL 2 IEC SYSTEM FOR MUTUAL RECOGNITION OF TEST CERTIFICATES FOR ELECTRICAL EQUIPMENT (IECEE) CB SCHEME SYSTEME CEI D ACCEPTATION MUTUELLE DE CERTIFICATS D ESSAIS DES EQUIPEMENTS

Bardziej szczegółowo

Podejmowanie decyzji klinicznych zgodnie z zasadami medycyny opartej na dowodach (EBM)

Podejmowanie decyzji klinicznych zgodnie z zasadami medycyny opartej na dowodach (EBM) 33 Podejmowanie decyzji klinicznych zgodnie z zasadami medycyny opartej na dowodach (EBM) 5 Garth Davis, Mark C. Henderson, Gerald W. Smetana Studenci sądzą, że zbieranie wywiadu lekarskiego jest procesem

Bardziej szczegółowo

PAMIĘTAJ O ZDROWIU! ZBADAJ SIĘ

PAMIĘTAJ O ZDROWIU! ZBADAJ SIĘ PAMIĘTAJ O ZDROWIU! ZBADAJ SIĘ Przewodnik po programach profilaktycznych finansowanych przez NFZ Lepiej zapobiegać niż leczyć Program profilaktyki chorób układu krążenia Choroby układu krążenia są główną

Bardziej szczegółowo

TEMAT: Pozytywny wynik testu diagnostycznego czy zawsze wyrok?

TEMAT: Pozytywny wynik testu diagnostycznego czy zawsze wyrok? 1 TEMAT: Pozytywny wynik testu diagnostycznego czy zawsze wyrok? Imię i nazwisko ucznia Klasa.. I. Fragment tekstu opisującego dokumenty niezbędne do otrzymania wizy bezterminowej, uprawniającej do przekroczenia

Bardziej szczegółowo

Polskie Forum Psychologiczne, 2013, tom 18, numer 4, s. 441-456

Polskie Forum Psychologiczne, 2013, tom 18, numer 4, s. 441-456 Polskie Forum Psychologiczne, 2013, tom 18, numer 4, s. 441-456 Anna Ratajska 1 2 1 1 Instytut Psychologii, Uniwersytet Kazimierza Wielkiego Institute of Psychology, Kazimierz Wielki University in Bydgoszcz

Bardziej szczegółowo

Komputerowa diagnoza medyczna tworzenie i interpretowanie. prof. dr hab. inż. Andrzej Walczak

Komputerowa diagnoza medyczna tworzenie i interpretowanie. prof. dr hab. inż. Andrzej Walczak Komputerowa diagnoza medyczna tworzenie i interpretowanie prof. dr hab. inż. Andrzej Walczak Agenda 1. Po co budujemy komputerowe wspomaganie diagnostyki medycznej? 2. Wymagania na IT wdrażane w medycynie

Bardziej szczegółowo

Badania. przesiewowe stosowane w celu wczesnego wykrycia raka szyjki macicy. zalecenia National Comprehensive Cancer Network (NCCN)

Badania. przesiewowe stosowane w celu wczesnego wykrycia raka szyjki macicy. zalecenia National Comprehensive Cancer Network (NCCN) Badania przesiewowe stosowane w celu wczesnego wykrycia raka szyjki macicy zalecenia National Comprehensive Cancer Network (NCCN) Zalecenia dotyczące badań przesiewowych stosowanych w celu wczesnego wykrycia

Bardziej szczegółowo

Testy DNA umiarkowanie zwiększonego ryzyka zachorowania na nowotwory złośliwe

Testy DNA umiarkowanie zwiększonego ryzyka zachorowania na nowotwory złośliwe Grzegorz Kurzawski, Janina Suchy, Cezary Cybulski, Joanna Trubicka, Tadeusz Dębniak, Bohdan Górski, Tomasz Huzarski, Anna Janicka, Jolanta Szymańska-Pasternak, Jan Lubiński Testy DNA umiarkowanie zwiększonego

Bardziej szczegółowo

Profilowanie somatyczne BRCA1, BRCA2

Profilowanie somatyczne BRCA1, BRCA2 Profilowanie somatyczne BRCA1, BRCA2 Nowotwór złośliwy rozwija się w momencie, gdy w DNA komórek nagromadzone zostaną liczne mutacje. Od rodzaju tych mutacji zależy dobór właściwego schematu leczenia,

Bardziej szczegółowo

Is there a relationship between age and side dominance of tubal ectopic pregnancies? A preliminary report

Is there a relationship between age and side dominance of tubal ectopic pregnancies? A preliminary report Is there a relationship between age and side dominance of tubal ectopic pregnancies? A preliminary report Czy istnieje zależność pomiędzy wiekiem i stroną, po której umiejscawia się ciąża ektopowa jajowodowa?

Bardziej szczegółowo

S YL AB US MODUŁ U ( PRZEDMIOTU) I nforma cje ogólne. Genetyka Kliniczna. Wydział Lekarsko-Stomatologiczny(WLS)

S YL AB US MODUŁ U ( PRZEDMIOTU) I nforma cje ogólne. Genetyka Kliniczna. Wydział Lekarsko-Stomatologiczny(WLS) S YL AB US MODUŁ U ( PRZEDMIOTU) I nforma cje ogólne Kod modułu Rodzaj modułu Wydział PUM Kierunek studiów Specjalność Poziom studiów Forma studiów Rok studiów Nazwa modułu Genetyka Kliniczna Obowiązkowy

Bardziej szczegółowo

144010 HCR-APOB Analiza. Wykrycie charakterystycznych mutacji genu APOB warunkujących występowanie hipercholesterolemii rodzinnej.

144010 HCR-APOB Analiza. Wykrycie charakterystycznych mutacji genu APOB warunkujących występowanie hipercholesterolemii rodzinnej. Badany Gen Literatura OMIM TM Gen Jednostka chorobowa Literatura OMIM TM Jednostka chorobowa Oznaczenie testu Opis/cel badania Zakres analizy Czas analizy Materiał [dni biologiczny roboczy ch] APOB 7730

Bardziej szczegółowo

WIEDZA. wskazuje lokalizacje przebiegu procesów komórkowych

WIEDZA. wskazuje lokalizacje przebiegu procesów komórkowych Załącznik nr 7 do zarządzenia nr 12 Rektora UJ z 15 lutego 2012 r. Opis zakładanych efektów kształcenia na studiach podyplomowych Nazwa studiów: Medycyna Molekularna w Praktyce Klinicznej Typ studiów:

Bardziej szczegółowo

NIEPEŁNOSPRAWNOŚĆ INTELEKTUALNA. Anna Materna-Kiryluk Katedra i Zakład Genetyki Medycznej UM w Poznaniu. Niepełnosprawność intelektualna - definicja

NIEPEŁNOSPRAWNOŚĆ INTELEKTUALNA. Anna Materna-Kiryluk Katedra i Zakład Genetyki Medycznej UM w Poznaniu. Niepełnosprawność intelektualna - definicja NIEPEŁNOSPRAWNOŚĆ INTELEKTUALNA Anna Materna-Kiryluk Katedra i Zakład Genetyki Medycznej UM w Poznaniu Niepełnosprawność intelektualna - definicja Istotnie niższe od przeciętnego funkcjonowanie intelektualne

Bardziej szczegółowo

Przedmowa do wydania polskiego 11 Wstęp 13 Podziękowania 14

Przedmowa do wydania polskiego 11 Wstęp 13 Podziękowania 14 Spis treści Przedmowa do wydania polskiego 11 Wstęp 13 Podziękowania 14 1. Wstęp i ustalanie rozpoznania 15 Co to jest mukowiscydoza? 15 Skąd nazwa mukowiscydoza? 16 Kiedy można podejrzewać występowanie

Bardziej szczegółowo

Czym jest mukowiscydoza?

Czym jest mukowiscydoza? Czym jest mukowiscydoza? Mukowiscydoza (z ang. cystic fibrosis, CF) jest najczęściej występującą chorobą genetyczną w ludzkiej populacji. Według najnowszych badań, co 25 osoba jest nosicielem nieprawidłowego

Bardziej szczegółowo

Informacje dla pacjentów i rodzin

Informacje dla pacjentów i rodzin 12 Zakład etyki Medycznej Instytut "Pomnik-Centrum Zdrowia Dziecka" telefon 022 815 74 50 (sekretariat) 022 815 74 51 (poradnia) Dziedziczenie sprzężone z chromosomem X, Szpital Dziecięcy, Dziekanów Leśny

Bardziej szczegółowo

Test Prenatalny Harmony. przesiewowe badanie prenatalne nowej generacji w kierunku trisomii chromosomowych

Test Prenatalny Harmony. przesiewowe badanie prenatalne nowej generacji w kierunku trisomii chromosomowych Test Prenatalny Harmony przesiewowe badanie prenatalne nowej generacji w kierunku trisomii chromosomowych Test Harmony Co wykrywa Dla kogo jest przeznaczony Zasada działania testu Jak i gdzie można wykonać

Bardziej szczegółowo

DTC itd. Direct to consumer tests. Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN

DTC itd. Direct to consumer tests. Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN DTC itd. Direct to consumer tests Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN Test Genetyczny? Analiza ludzkiego DNA, RNA, chromosomów, białek lub metabolitów w celu wykrycia

Bardziej szczegółowo

Znaczenie wczesnej interwencji we wspomaganiu rozwoju dziecka z zaburzeniami ze spektrum autyzmu i strategie terapii.

Znaczenie wczesnej interwencji we wspomaganiu rozwoju dziecka z zaburzeniami ze spektrum autyzmu i strategie terapii. Michał Wroniszewski Fundacja SYNAPSIS Znaczenie wczesnej interwencji we wspomaganiu rozwoju dziecka z zaburzeniami ze spektrum autyzmu i strategie terapii. Otrębusy, 8.11.2011 r. SKALA ZJAWISKA 1. Epidemiologa

Bardziej szczegółowo

Służba Zdrowia nr 24-26 z 23 marca 2000. Znaczenie badań przesiewowych w zwalczaniu raka piersi. Zbigniew Wronkowski, Wiktor Chmielarczyk

Służba Zdrowia nr 24-26 z 23 marca 2000. Znaczenie badań przesiewowych w zwalczaniu raka piersi. Zbigniew Wronkowski, Wiktor Chmielarczyk Służba Zdrowia nr 24-26 z 23 marca 2000 Znaczenie badań przesiewowych w zwalczaniu raka piersi Zbigniew Wronkowski, Wiktor Chmielarczyk Korzystny wpływ skryningu na zmniejszenie umieralności z powodu raka

Bardziej szczegółowo

Ankiety Nowe funkcje! Pomoc magda.szewczyk@slo-wroc.pl. magda.szewczyk@slo-wroc.pl. Twoje konto Wyloguj. BIODIVERSITY OF RIVERS: Survey to students

Ankiety Nowe funkcje! Pomoc magda.szewczyk@slo-wroc.pl. magda.szewczyk@slo-wroc.pl. Twoje konto Wyloguj. BIODIVERSITY OF RIVERS: Survey to students Ankiety Nowe funkcje! Pomoc magda.szewczyk@slo-wroc.pl Back Twoje konto Wyloguj magda.szewczyk@slo-wroc.pl BIODIVERSITY OF RIVERS: Survey to students Tworzenie ankiety Udostępnianie Analiza (55) Wyniki

Bardziej szczegółowo

Testy jednostkowe - zastosowanie oprogramowania JUNIT 4.0 Zofia Kruczkiewicz

Testy jednostkowe - zastosowanie oprogramowania JUNIT 4.0  Zofia Kruczkiewicz Testy jednostkowe - zastosowanie oprogramowania JUNIT 4.0 http://www.junit.org/ Zofia Kruczkiewicz 1. Aby utworzyć test dla jednej klasy, należy kliknąć prawym przyciskiem myszy w oknie Projects na wybraną

Bardziej szczegółowo

Cennik badań genetycznych oferowanych przez serwis www.e-manus.pl. Obowiązuje od dnia 01.08.2006r. Nazwa testu Cena Czas realizacji. 1400zł.

Cennik badań genetycznych oferowanych przez serwis www.e-manus.pl. Obowiązuje od dnia 01.08.2006r. Nazwa testu Cena Czas realizacji. 1400zł. Cennik badań genetycznych oferowanych przez serwis www.e-manus.pl. Obowiązuje od dnia 01.08.2006r. Ustalenie ojcostwa T-03P T-03 T-02 T-02N T-OD T-OMW T-OMK ustalenia ojcostwa dla 3 osób: dziecka, matki

Bardziej szczegółowo

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A...

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A... 1. Zadanie (0 2 p. ) Porównaj mitozę i mejozę, wpisując do tabeli podane określenia oraz cyfry. ta sama co w komórce macierzystej, o połowę mniejsza niż w komórce macierzystej, gamety, komórki budujące

Bardziej szczegółowo

OFERTA BADAŃ GENETYCZNYCH

OFERTA BADAŃ GENETYCZNYCH OFERTA BADAŃ GENETYCZNYCH Obowiązuje od stycznia 2014 GINEKOLOGIA Załącznik nr 5 Kod badania Jednostka chorobowa Opis badania Materiał do badań Cena GIN-001 Badanie screeningowe HPV Wykrywanie onkogennych

Bardziej szczegółowo

NARODOWY FUNDUSZ ZDROWIA

NARODOWY FUNDUSZ ZDROWIA Załącznik nr do Zarządzenia nr 17/2004 Prezesa NFZ NARODOWY FUNDUSZ ZDROWIA SZCZEGÓŁOWE MATERIAŁY INFORMACYJNE O PRZEDMIOCIE POSTĘPOWANIA W SPRAWIE ZAWIERANIA UMÓW O UDZIELANIE ŚWIADCZEŃ OPIEKI ZDROW0TNEJ

Bardziej szczegółowo

Medgenetix sp. z o.o.

Medgenetix sp. z o.o. Medgenetix sp. z o.o. Medycyna spersonalizowana medycyną przyszłości Jacek Wojciechowicz- Prezes Zarządu Agenda 1. Kilka słów o pomysłodawcach i dokonaniach 2. Przedmiot działalności 3. Innowacyjność 4.

Bardziej szczegółowo

STATYSTYKA MATEMATYCZNA WYKŁAD 1

STATYSTYKA MATEMATYCZNA WYKŁAD 1 STATYSTYKA MATEMATYCZNA WYKŁAD 1 Wykład wstępny Teoria prawdopodobieństwa Magda Mielczarek wykłady, ćwiczenia Copyright 2017, J. Szyda & M. Mielczarek STATYSTYKA MATEMATYCZNA? ASHG 2011 Writing Workshop;

Bardziej szczegółowo

ZARZĄDZANIE POPULACJAMI ZWIERZĄT

ZARZĄDZANIE POPULACJAMI ZWIERZĄT ZARZĄDZANIE POPULACJAMI ZWIERZĄT Ćwiczenia 1 mgr Magda Kaczmarek-Okrój magda_kaczmarek_okroj@sggw.pl 1 ZAGADNIENIA struktura genetyczna populacji obliczanie frekwencji genotypów obliczanie frekwencji alleli

Bardziej szczegółowo

Rozkład materiału z biologii do klasy III.

Rozkład materiału z biologii do klasy III. Rozkład materiału z biologii do klasy III. L.p. Temat lekcji Treści programowe Uwagi 1. Nauka o funkcjonowaniu przyrody. 2. Genetyka nauka o dziedziczności i zmienności. -poziomy różnorodności biologicznej:

Bardziej szczegółowo

STATYSTYKA W EPIDEMIOLOGII KLINICZNEJ. dr hab. inż. Aleksander Owczarek

STATYSTYKA W EPIDEMIOLOGII KLINICZNEJ. dr hab. inż. Aleksander Owczarek STATYSTYKA W EPIDEMIOLOGII KLINICZNEJ dr hab. inż. Aleksander Owczarek Zakład Statystyki Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej Śląski Uniwersytet Medyczny w Katowicach TESTY PRZESIEWOWE

Bardziej szczegółowo

BADANIA GENETYCZNE W HODOWLI KOTÓW: CHOROBA SPICHRZENIOWA GLIKOGENU TYPU IV (GLYCOGEN STORAGE DISEASE TYPE IV - GSD IV)

BADANIA GENETYCZNE W HODOWLI KOTÓW: CHOROBA SPICHRZENIOWA GLIKOGENU TYPU IV (GLYCOGEN STORAGE DISEASE TYPE IV - GSD IV) BADANIA GENETYCZNE W HODOWLI KOTÓW: OBOWIĄZKOWE CHOROBA SPICHRZENIOWA GLIKOGENU TYPU IV (NFO) GANGLIOZYDOZA (KOR, BUR) ZALECANE RDZENIOWY ZANIK MIĘŚNI (MCO) NIEDOBÓR KINAZY PIROGRONIANOWEJ (ABY, SOM) POSTĘPUJĄCY

Bardziej szczegółowo

UE przyjmuje nowy program Bezpieczny Internet : 55 mln euro, aby Internet stał się bezpieczny dla dzieci

UE przyjmuje nowy program Bezpieczny Internet : 55 mln euro, aby Internet stał się bezpieczny dla dzieci IP/8/899 Bruksela, dnia 9 grudnia 8 r. UE przyjmuje nowy program Bezpieczny Internet : mln euro, aby Internet stał się bezpieczny dla dzieci Od dnia stycznia 9 r. UE będzie miała nowy program Bezpieczny

Bardziej szczegółowo