STAWONOGI PASOŻYTNICZE I ALERGENNE

Transkrypt

1 STAWONOGI PASOŻYTNICZE I ALERGENNE Tom I Pod Redakcją Alicji Buczek Katedra i Zakład Biologii Parazytologii Uniwersytet Medyczny w Lublinie Czesława Błaszaka Zakład Morfologii Zwierząt Uniwersytet im. Adama Mickiewicza w Poznaniu LUBLIN 2019 ISSN

2 Wydawca: KOLIBER- Oficyna Wydawnicza Fundacji na Rzecz Zwalczania Kleszczy i Profilaktyki w Chorobach Odkleszczowych w Lublinie, Lublin, ul. W. Chodźki 5 lok. 74, mjb@onet.pl Recenzenci Tomu I: dr hab. Katarzyna Bartosik prof. dr hab. Czesław Błaszak prof. dr hab. Alicja Buczek prof. dr hab. Ewa Dzika ISSN

3 Stawonogi na początku wieku Arthropods At the begining of the New Century

4

5 Spis treści The long-term study on Ixodes ricinus (L. 1758) as a vector of Borrelia burgdorferi s.l. in the Ślęża Landscape Park, SW Poland Dorota Kiewra, Dagmara Dyczko, Remigiusz Zieliński Tick-borne diseases multifaceted problems Krzysztof Jasik, Maria Styblińska, Danuta Psota, Marta Albertyńska, Urszula Mazurek Risk of exposure to parasitic and zoonosic diseases in the Malopolska voivodeship in Anna Kocoń, Magdalena Nowak-Chmura, Małgorzata Kłyś, Natalia Malejky Microbiome of Dermacentor reticulatus collecting from chase game in Podlasie district (Poland) - preliminary study Justyna Dunaj, Anna Moniuszko, Henryk Grześ and Sławomir Pancewicz Koinfekcje Babesia microti i Borrelia burgdorferi sensu lato w kleszczach z terenu województwa śląskiego w latach Marta Albertyńska, Beata Rozwadowska, Agnieszka Kubala, Krzysztof P. Jasik Molecular identification of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from dogs in Olsztyn-city agglomeration Magdalena Szczotko, Małgorzata Dmitryjuk, Mirosław M. Michalski Diagnostyka boreliozy - dlaczego należy zbadać kleszcza Beata Wodecka Profil ekspresji genów kodujących białka opiekuńcze w komórkach fibroblastów zakażonych krętkami Borrelia burgdorferi Martyna Bednarczyk, Nikola Zmarzły, Agata Kaźmierczak, Beniamin Grabarek, Sławomir Dudek, Urszula Mazurek, Małgorzata Muc-Wierzgoń Influence of Borrelia afzelii on hepatocytes in cell culture conditions Marta Łoboziak, Hubert Okła, Krzysztof P. Jasik Profil ekspresji genów kodujących czynniki restrykcyjne w komórkach zakażonych krętkami Borrelia. Expression profile of genes coding restriction factors in cells infected with Borrelia spirochete Emilia Wojdas, Aleksandra Skubis, Bartosz Sikora, Sławomir Dudek, Urszula Mazurek Zależność między profilem ekspresji IL12/23 a receptorami histaminowymi (HRH1-4) w przebiegu zakażenia Borrelia sp Beniamin Grabarek, Nikola Zmarzły, Emilia Wojdas, Martyna Bednarczyk, Barbara Strzałka- Mrozik, Karol Juszczyk, Marek Asman, Urszula Mazurek 5

6 Ocena profilu metabolicznego krętków Borrelia afzelii, Borrelia garinii i Borrelia burgdorferi sensu stricto Sławomir Dudek, Izabela Biedroń, Beata Rozwadowska, Ilona Kaczmarczyk-Sedlak Expression profile of genes associated with epithelial-mesenchymal transition in patients with Lyme disease Nikola Zmarzły, Beniamin Grabarek, Emilia Wojdas, Martyna Bednarczyk, Ewelina Hermyt, Joanna Gola, Jolanta Adamska, Marek Asman, Urszula Mazurek Obecność Anaplasma phagocytophilum u kleszczy z terenu województwa śląskiego Beata Rozwadowska, Marta Albertyńska, Sławomir Dudek, Krzysztof P. Jasik, Urszula Mendera- Bożek Ornithophilic ticks (Ixodida: Argasidae, Ixodidae) occurring in the south-eastern Poland and their role in pathogens circulation in environment Alicja Buczek, Katarzyna Bartosik, Alicja M. Buczek, Weronika Buczek, Joanna Kulisz, Aneta Woźniak, Dorota Kulina, Dariusz Ciura, Halina Cios, Zbigniew Zając Human lice Pediculus humanus and pediculosis in the past and present - occurrence, diagnostics and controlling Joanna N. Izdebska, Paulina Kozina, Karolina Cierocka, Łukasz Mierzyński Obligation to report pediculosis and scabies in Poland - own observations Andrzej Tytuła, Katarzyna Bartosik, Alicja M. Buczek, Zbigniew Zając, Ewa Kulbaka, Dariusz Ciura, Adam Borzęcki Demodex infestation in aesthetic medicine patients preliminary study Renata Przydatek-Tyrajska, Katarzyna Bartosik, Aleksandra Sędzikowska, Monika Dybicz, Weronika Buczek, Alicja Buczek The influence of various repellents on the migration activity of storage pests and human harmful beetles Aleksandra Izdebska, Natalia Malejky, Małgorzata Kłyś What bites a dog and a cat? a review of selected ectoparasites atacking dogs and domestic cats Anna Kocoń 1, Magdalena Nowak-Chmura, Małgorzata Kłyś, Natalia Malejky Mite fauna (Parasitiformes: Gamasida) associated with nests of selected species of native bumblebees (Hymenoptera: Apidae: Bombus spp.) Elżbieta Rożej-Pabijan, Wojciech Witaliński, Waldemar Celary_Toc Beetles from the Chrysomelidae family harmful to urban trees Natalia Malejky, Małgorzata Kłyś, Anna Kocoń, Aleksandra Izdebska Medicinal plants and their impact on Oryzaephilus surinamensis (Linnaeus, 1758) (Coleoptera, Silvanidae) Natalia Malejky, Małgorzata Kłyś, Lidia Chomicz, Wanda Baltaza Medicinal plants with repellent effect on Rhyzopertha dominica (FABRICIUS, 1792) (Coleoptera; Bostrichidae) a dangerous pest of the stored food products Natalia Malejky, Małgorzata Kłyś, Anna Kocoń Awareness of human health threats caused by food pests Plodia interpunctella (Arthropoda, Insecta) among high school and medical school students Wanda Baltaza, Monika Dybicz, Konrad Perkowski, Marcin Padzik, Małgorzata Kłyś, Natalia Malejky, Milena Żerańska, Marcin Wieliczko, Lidia Chomicz 6

7 Millipedes (Diplopoda) their parasites, hosts, predators and symbionts. Part I Grzegorz Kania Millipedes (Diplopoda) their parasites, host, predators and symbionts. Part II Grzegorz Kania Some aspects of millipede s biology (Diplopoda) Grzegorz Kania, Monika Jung 7

8 8

9 Preface Diseases caused by parasitic arthropods, i.e. lice, mosquitoes, black flies, fleas and ticks and pathogens transmitted by those insects and arachnids, were already known by civilizations of ancient world. However, only in modern times, especially in XX century, thanks to scientific researches and clinical observations, there has been progress in determining of reasons and environmental determinants of those diseases, and also in understanding of their pathogenesis. Furthermore, new diagnostic methods and procedures of treatment were introduced. Although, some biological phenomena are still not fully explained and some medical problems are not solved there are new intriguing topics that have been already appeared. New tasks for scientists are related i.e. with detection of new emerging pathogens that were not previously stated in arthropods and their hosts, high increase of prevalence of infection rate, environmental changes that have an impact on distribution of pathogens and vectors of contagious diseases and with alterations of hosts immunity and with existence of complex arthropod-host-pathogen relationships. The challenge for researchers, especially for biologists, chemists, toxicologists is to prepare efficient acaricides, insecticides and/or repellents against ticks, mosquitoes and black flies vectors of numerous pathogens occurring worldwide and against arthropods found in stored products, dust and powders causing allergies in humans and animals. World s literature of the last 20 years indicates how strongly our point of view of many biological phenomena and of methods of clinical management has been changed. Dynamic progress in researches has been documented also by papers published in our 19 monographies, prepared by scientists and professionals doctors, diagnosticians, workers of sanitary and epidemiological services from many national and abroad centers. Achievements of numerous authors in arthropod studies and their harmful impact on other organisms have been presented during 20 editions of international symposia Parasitic and allergic arthropods - medical and sanitary significance, organized in years At the beginning of the new century there are still current topics in public health preservation, i.e. prevalence of pathogens in arthropods and their hosts, diverse routes of pathogens circulation in environment, pathogenicity of arthropods and transmitted pathogens, factors influencing on pathogenicity of viruses, bacteria and protozoans, and mechanisms of their spreading in organisms. Further studies on improvement of diagnostic methods and unification of standards in clinical and diagnostic management are indispensable. They may contribute to increase in detection of infections caused by pathogens and improvement of laboratory tests quality. Laborious and time-consuming researches on fauna of parasitic and allergic arthropods and their biology are gaining more importance. They are foundation for other researches, i.e. clinical, epidemiological, chemical and for forecasting of health threats caused by those pathogenic agents. Due to global climate and weather changes, anthropogenisation of diverse ecosystems and increase of migrations in human population, studies on arthropods and their role in transmission of human and animal diseases gain a lot of importance and relevance. We encourage to read papers published in monography titled Arthropods at the beginning of the new century, that have been prepared by scientists from prestigious research centers investigating parasitic and allergic arthropods, pathogens and tick-borne diseases. Alicja Buczek Czesław Błaszak Lublin, May 16 th,

10 10

11 Ticks and tick-borne pathogens Kleszcze i patogeny odkleszczowe 11

12 12

13 The long-term study on Ixodes ricinus (L. 1758) as a vector of Borrelia burgdorferi s.l. in the Ślęża Landscape Park, SW Poland Dorota Kiewra, Dagmara Dyczko, Remigiusz Zieliński Department of Microbial Ecology and Environmental Protection, Institute of Genetics and Microbiology, University of Wroclaw, Przybyszewskiego str. 63/77, Wroclaw, Poland. Abstract Ixodes ricinus, one of the most important from a medical and veterinary point of view tick species in Europe, is the main vector of the spirochetes Borrelia burgdorferi s.l. At the risk of Lyme disease are especially forest workers, mushroom pickers as well as people visiting tick habitats for recreational purposes. The aim of the study was to assess the tick-borne risk with a special focus on LD in recreational areas on the example of the Ślęża Landscape Park on the basis of the long-term study. In years a total of specimens, identified as I. ricinus, were caught, including 1647 larvae (14.2%), 8408 nymphs (72.2%), 780 females (6.7%) and 799 (6.9% males). The seasonal activity of I. ricinus varied between years, however, usually two picks of activity were observed (higher pick in May, and lower in September-October). The average minimum prevalence of spirochetes infection was 12.6%, with the highest level of infection (16.4%) detected using the nested PCR method. The RFLP method showed that genospecies of Borrelia spp. involved B. afzelii (the most frequently recorded), B. garinii, B. valaisiana, B. burgdorferi sensu stricto, and B. miyamotoi as well as coinfection B. garinii/b. valaisiana and B. garinii/b. afzelii. Introduction Ixodes ricinus is one of the most important from a medical and veterinary point of view tick species in Europe, both due to the direct effects of parasitism and, above all, the possibility of transmission of viruses, bacteria, protozoa, and nematodes (Nowak-Chmura, 2012). The most often recorded tick-borne disease, caused by the spirochetes Borrelia burgdorferi s.l., is Lyme disease (LD), which poses a growing health problem in Northern Hemisphere. In Poland, since the beginning of the obligation to register cases of Lyme disease, there has been a systematic increase in the number of cases which reached a record number of over 22,000 in 2017 of which 852 cases were recorded in Lower Silesia ( In Europe, LD is transmitted to humans mainly by the bite of infected I. ricinus. At the risk of LD are especially forest workers, mushroom pickers as well as people visiting tick habitats for recreational purposes (Cisak et al. 2001, 2005, Rizzoli et al. 2011). In a research conducted by Adamek et al. (2004), among patients diagnosed with LD in years in the province of Silesia, it was found that 87% of spirochete infections occurred during recreation. The aim of the study was to assess the tick-borne risk with a special focus on Lyme disease in recreational areas on the example on the Ślęża Landscape Park on the basis of the long-term study of the population structure and seasonal activity of ticks and the level of their infection with spirochetes Borrelia burgdorferi s.l. Material and methods Study area. The study included the area of the Ślęża Landscape Park (SLP). SLP is located about 35 km south-west of Wrocław. According to Kondracki (2002) SLP is part of the 13

14 Sudeten Foreland macroregion. SLP was created in 1988 to protect and preserve the natural environment of the Ślęża Massif, and its cultural and historical values. A protection plan has been developed in 2010 (effective from ) for recommendations for protection of the lithosphere, water resources, and ecosystems, plant communities, plants, fungi, animals and landscapes (Krajewski 2012). The region has a unique climate, similar to that of the mountains, characterized by heavy cloudiness and precipitation. The predominant habitats of SLP are mixed deciduous and coniferous forests. The forests are dominated by spruce (Picea abies), beech (Fagus sylvatica), pine (Pinus sylvestris) birch (Betula pendula) and common oak (Quercus robur) (Kwiatkowski 1995). The environment diversity of SLP is conducive to the life of many animals, including rodents (Myodes glareolus, Apodemus flavicollis, A. agrarius, A. sylvaticus), deer (Cervus elaphus), foxes (Vulpes vulpes), wild boars (Sus scrofa), pine martens (Martes martes) which are potential hosts of ticks (Kiewra and Modrzejewska 2004, Fabiszewski 2005). SLP is a perfect area for recreation, tourism and sports activities. Through the area of SLP is leading 5 marked walking tourist trail. Additionally, there are cycling and educational paths. To the most attractive tourist areas belong the highest summit of SLP - Ślęża (718 m; with a tourist mountain hut, a church, an observation tower, an ancient cult sculpture of a bear), the second one - Radunia (573 m), the Wieżyca (415 m, with an observation tower built in ), Będkowice (an archaeological reserve), Sulistrowiczki (a church), and the Tąpadła Pass (384 m, with a large car park, and a designated place for a bonfire). Ticks collection. The ticks were collected from 1998 to 2016 using the standard flagging method in sites located in different parts of SLP, including sites along popular tourist trails. The sites differ in the type of vegetation, height as well as the direction of the slope. Only in 2016 ticks were collected from 13 sites (Fig. 1), of which seven were located along a north (in the vicinity of Wieżyca) and six along south (from the Tąpadła Pass) slope of Ślęża. The identification of the collected ticks was carried out using a stereomicroscope according to the key contained in the monograph of Siuda (1993). Only ticks identified as Ixodes ricinus were included in the research for the presence of spirochetes. Spirochetes detection. In order to detect spirochetes, three methods were used: dark field microscopy (DFM) in years , and 2008; immunofluorescence assay (IFA) in years , and nested-pcr in 2009 and Additionally, in 2009 and 2016 to determine the genotype of Borrelia burgdorferi s.l. nested PCR-RFLP was used. Dark field microscopy (DFM). DFM method allows observing the movement and shape of spirochetes without specifying the species (Žákovska 2000). Ticks were prepared under a stereomicroscope, the contents of the intestine were carefully rubbed in a drop of sterile physiological saline (0.9% NaCl), covered with a coverslip, and viewed at 40x and 60x magnification. Immunofluorescence assay (IFA). Ticks separately were rinsed in 70% ethanol, squashed and macerated in10 µl of PBS buffer on a microscope slide. Slide preparations were air-dried and then fixed in acetone for 15 min. B. burgdorferi s.l. was detected using anti-b. burgdorferi rabbit antibodies and goat anti-rabbit IgG conjugated with fluorescein isocyanate (FITC) (Kosik-Bogacka et al. 2002). Nested PCR. DNA isolation was carried out using the ammonia method (NH 4OH) (Rijpkema et al. 1996). The lysates were stored at 20 C. To detect Borrelia burgdorferi s.l. nested PCR targeting the fla gene was used (Wodecka et al. 2009). In the first reaction, outer primers 132f (5'-TGGTATGGGAGTTTCTGG-3') and 905r (5'-TCTGTCATTGTAGCATCTTT-3') were used which gave a product with a length of 774 bp. In the second round, primers 220f (5'- CAGACAACAGAGGAAAT-3) and 824r (5'-TCAAGTCTATTTTGGAAAGCACC-3') were used to give a product with a length of 605 bp. The PCR reaction was performed in a thermocycler (BioRad T100 TM ) and included initial denaturation (95 o C, 3 min) and a further 35 cycles, including denaturation (95 o C, 45 s), attachment (55 o C, 45 s), elongation (72 o C, 60 s), and 14

15 final elongation (72 o C, 5 min). The separation of nested PCR products was performed on a 1% agarose gel with the addition of Midori Green DNA Stain. RFLP. The positive samples obtained from nested PCR was digested with a restriction enzyme HpyF3I that recognizes the sequence of CTNAG (Wodecka 2011). The applied method allowed to detect genospecies from the complex of B. burgdorferi s.l. and additionally Borrelia miyamotoi. Selected nested PCR products, which differ in restriction patterns, have been sequenced to confirm the genospecies identity. Statistical analysis. To compare a seasonal activity between years, the average number of collected ticks per one site within one hour in one month was calculated. A seasonal activity was determined for years 1998, , 2008, and The Chi-square test was used to compare the prevalence of infection between developmental stages of I. ricinus Results Ticks were present in each of collecting sites and each year of collection. All collected ticks were identified as Ixodes ricinus (L. 1758). A total of specimens were caught, including 1647 larvae (14.2%), 8408 nymphs (72.2%), 780 females (6.7%) and 799 (6.9% males). The share of individual development stages varied between years ranging from 0 to 55.2% for larvae, % for nymphs, % for females, and % for males (Tab. 1). The seasonal activity of I. ricinus varied between years (Fig. 2). In each year of the study, we observed a clear peak of spring activity, which occurred mainly in May. The second pick of activity was usually lower and fell on September-October. Unusual, very high activity in August, was recorded in A total of 3814 (145 larvae, 2880 nymphs, 408 females, and 381 males) ticks were examined for spirochetes occurrence, including 2121 (145 larvae, 1601 nymphs, 207 females, and 168 males) tested using DFM, 907 (754 nymphs, 75 females, and 78 males) using IFA, and 786 (525 nymphs, 126 females, and 135 males) using nested PCR (Tab. 2). The average minimum prevalence of spirochetes infection was 12.6%, with the highest level of infection (16.4%) detected using the nested PCR method. Larvae were tested only using DFM, and the infection rate was 1.4%. Other developmental stages were tested using all methods, and average minimal infection rate was 11.0% for nymphs, 21.8% for females, and 19.2% for males. Conducted in 2016, the study of individual specimens (not in pools) using nested PCR showed the presence of Borrelia in 15.6% of I. ricinus, with no statistically significant differences in the infection level between females, males, and nymphs (χ 2 = 3.841, df = 2, p = 0.146). The RFLP method showed that genospecies of Borrelia spp. involved B. afzelii, B. garinii, B. valaisiana, B. burgdorferi sensu stricto (detected only in 2016) and B. miyamotoi (Fig. 3). Additional coinfections were recorded (B. garinii/b. valaisiana and B. garinii/b. afzelii). Ticks infected with B. afzelii were most frequently recorded in both 2009 and Discussion In surveys of people diagnosed with Lyme disease (LD) by Clinic for Infectious Diseases in Wrocław, the Ślęża Landscape Park (SLP) was one of the most frequently indicated areas, as a place where contact with an infected tick may have occurred before LD diagnosis (Kiewra et al. 2004a, b). Own research carried out since 1998 confirmed the widespread occurrence of Ixodes ricinus in each of collecting sites located in SLP and each year of collection. The presence of I. ricinus also in the areas most frequented by tourists has been confirmed since the first research conducted in 1998 and 2000 (Buczek et al. 1999, Lonc et al. 2001). I. ricinus was also noted in other landscape and national parks such as: Roztocze National Park (Cisak et al. 2005), Ojców National Park (Stańczak et al. 1999), Białowieża National Park (Spausta et al. 2003), Słowiński National Park (Asman et al. 2017), Karkonosze National Park (Kiewra et al. 2014), Kampinos National Park (Stańczak et. al. 2016), Masurian Landscape Park (Pawełczyk and Siński 2005), Słupia Valley Landscape Park (Humiczewska and Rajski 2006), 15

16 Szczecin Landscape Park (Wodecka and Sawczuk 2004), Ińsko Landscape Park (Humiczewska 2001), Kozłówka Landscape Park (Stańczak et al. 1999), Bug Landscaped Park (Ciepiela et al. 2006). Dominant development stage of I. ricinus in SLP were nymphs, which constituted 72.2% of collected specimens. A large share of nymphs is particularly dangerous from an epidemiological point of view. Nymphs, because of their relatively small size, can be overlooked when watching the body after staying in the forest, so they can parasitize for a longer period of time which helps increase the probability of pathogen transmission. Nymphs as a dominant development stage in the population structure were reported also by other researchers (Wegner et al. 1997, Skotarczak et al. 1999, Hajdul et al. 2006, Tagliaptera et al. 2011). Otherwise, the results of research carried out in other recreational areas like for example in the Tricity and the Kashubian Lake District showed that the dominant stage were adults (Stańczak et al. 2012). The percentage share of females and males are usually similar (Černý 1977), which was also found in our studies, in which females and males accounted for 6.7% and 6.9% of the collection, respectively. In Poland, I. ricinus show usually the bimodal seasonal activity (Siuda 1993), although depending on the geographical location, seasonality may be different (Nowak-Chmura 2013). In our research we observed varied activity between years, however, usually two picks of activity were noted (higher pick in May, and lower one in September-October). Typical bimodal activity (with a peak in May and September) was also observed, for example by Humiczewska (2001). In Europe, I. ricinus plays the role of a competent and main vector of B. burgdorferi s.l. To estimate the level of infection with spirochetes, in our research three methods were used (DFM, IFA, and nested PCR). The average level of infection I. ricinus with spirochetes, based on ten years study using different methods, was 12.6%. In 2016, when tested individual specimens using nested PCR, the presence of Borrelia was 15.6%, with no statistically significant differences in the infection level between females, males, and nymphs. I. ricinus infected with B. burgdorferi s.l was also found in other recreational areas, including urban parks and protected areas (Stańczak et al. 1999, Cisak et al. 2005, Ciepiela et. al. 2006, Humiczewska and Rajski 2006), and the level of infection varied and between areas and year of study. In Europe, according to Rauter and Hartung (2005), the overall mean prevalence of Borrelia in ticks was 13.7%. In our research, we observed four genospecies from B. burgdorferi s.l. complex: B. garinii, B. afzelii, B. lusitaniae, B. burgdorferi s.s. and additionally B. miyamotoi. In the previous study conducted in Lowe Silesia also B. valaisiana was detected (Kiewra and Zaleśny 2013, Kiewra et al. 2014). In SLP B. afzelii was the dominant genospecies in both years (2009, 2016) when genospecies identification was performed. Genospecies share and the presence of coinfection should be taken into account in the diagnosis of LD due to the possibility of different symptoms. Our study showed that recreational areas are a potential tick-borne risk. SLP turned out to be an area abundant in ticks, including ticks infected with Borrelia burgdorferi s.l. 16

17 Table 1. Ixodes ricinus developmental stages in the Ślęża Landscape Park in years Number of collected ticks (%) Year larvae nymphs females males Total (73.3) 73(15.2) 55(11.5) (3.4) 640(84.7) 44(5.8) 46(6.1) (22.3) 938(61.8) 101(6.7) 139(9.2) (55.2) 910(41.7) 37(1.7) 30(1.4) (2.2) 1205(86.7) 78(5.6) 77(5.5) (3.9) 613(69.4) 117(13.2) 119(13.5) (72.4) 26(12.0) 34(15.6) (4.7) 273(85.8) 18(5.7) 12(3.8) (85.6) 33(7.1) 34(7.3) (73.5) 111(13.8) 103(12.7) (62.5) 36(16.7) 45(20.8) (91.2) 106(4.4) 105(4.4) 2408 Total 1647(14.2) 8408(72.2) 780(6.7) 799(6.9) Table 2. Prevalence of Borrelia burgdorferi s.l. in Ixodes ricinus collected from 2001 to 2016 in the Sleza Landscape Park (n - number of examined specimens, x - positive specimens; *-DFM, **- IFA, ^- nested-pcr, # - nymphs were tested in pools of 2-5 specimens - minimal infection rate) Developmental stage of ticks Total number Year larvae nymphs females males of ticks of study x x x x n n n x (%) n n (%) (%) (%) (%) 2001* (0.0) (5.1 # ) (21.4) (7.7) (4.4 # ) 2002* (4.8 # ) (4.9 # ) (9.4) (8.0) (5.3 # ) 2003* (13.8 # ) (0.0) (28.6) (14.0 # ) 2004* (15.3 # ) (15.7) (15.6) (15.4 # ) 2008* (12.7 # ) (21.7) (19.2) (14.4 # ) Total DFM (1.4 # ) (10.3 # ) (15.9) (16.1) (10.7 # ) 2005** (8.9) (34.6) (23.5) (14.3) 2006** (6.6) (33.3) (25.0) (8.9) 17

18 2007** Total IFA 52 (16.0) (11.1) ^ ^ Total nested PCR TOTAL (11.1 # ) 53 (13.6) (13.0) (1.4) (11.0) (19.4) 21 (28.0) 17 (47.2) 18 (20.0) 35 (27.8) 89 (21.8) (28.1) 20 (25.6) 8 (17.8) 18 (20.0) 26 (19.3) 73 (19.2) (17.3) 125 (13.8) 40 (18.5 # ) 89 (15.6) 129 (16.4) 481 (12.6) Fig. 1. Sites of tick collection in the Ślęża Landscape Park in

19 III IV V VI VII VIII IX X XI Fig. 2. Seasonal activity of Ixodes ricinus collected in the Ślęża Landscape Park Fig. 3. HpyF3I restriction patterns of the amplified flab DNA (604 bp) from Borrelia strains. Lanes: M - marker DNA; 1, 2, 4, 8 and 10 - B. afzelii; 5 and 9 - B. miyamotoi; 3 and 6 - B. garinii; 7 - B. valaisiana Acknowledgements We thank the students of the Faculty of Biological Sciences, University of Wroclaw, who took part in the field and laboratory work for tick collection and spirochetes detection. References 1. Adamek B., Książek A., Szczerba-Sachs A., Wilczkowski A Analiza uwarunkowań epidemiologicznych zachorowań na boreliozę z Lyme zarejestrowanych na terenie województwa śląskiego w latach In: Buczek A., Błaszak C. (eds.). Stawonogi. Interakcje pasożyt-żywiciel. Wyd. Liber Lublin Asman M., Nowak-Chmura M., Solarz K., Szilman E., Semla M., Zyśk B Anaplasma phagocytophilum, Babesia microti, Borrelia burgdorferi sensu lato, and Toxoplasma gondii in Ixodes ricinus (Acari, Ixodida) ticks collected from Slowinski 19

20 National Park (Northern Poland). J. Vector. Ecol. 42(1): doi: /jvec Buczek A., Lonc E., Kucharczyk K Seasonal and diurnal activity of ticks Ixodes ricinus (Linnaeus, 1758) in Masyw Sleza (Lower Silesia). Wiad. Parazytol. 45(4): Černý V The sex ratio in the common tick Ixodes ricinus (L.). Folia. Parasitol. (Praha) 24: Ciepiela A.P., Komoń T., Sytykiewicz H Preliminary studies on the prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus (L.) within Nadbużański Landscape Park. In: Buczek A., Błaszak C. (eds.). Stawonogi. Znaczenie epidemiologiczne. Wyd. Koliber, Lublin Cisak E., Chmielewska-Badora J., Dutkiewicz J., Zwoliński J Preliminary studies on the relationship between Ixodes ricinus activity and tick-borne infection among occupationally-exposed inhabitants of eastern Poland. Ann. Agric. Environ. Med. 8: Cisak E.J., Chmielewska-Badora J., Zwoliński A., Wójcik-Fatla A., Polak J., Dutkiewicz J Risk of tickborne bacterial diseases among workers of Roztocze National Park (south-eastern Poland). Ann. Agric. Envir. Med. 12: Fabiszewski J Przyroda Dolnego Śląska. PAN, Wrocław. 9. Hajdul M., Zaręba M., Karbowiak G., Siński E Ryzyko zakażenia krętkami Borrelia burgdoeferi s.l. w biotopach leśnych okolic Warszawy. In: Buczek A., Błaszak C. (eds.). Stawonogi. Znaczenie epidemiologiczne. Wyd. Koliber, Lublin Humiczewska M Aktywność sezonowa kleszczy Ixodes ricinus w biotopach nadwodnych i leśnych Szczecina i okolic oraz ich zakażenie krętkami Borrelia burgdorferi. Wiad. Parazytol. 47(3): Humiczewska M., Rajski K Liczebność populacji Ixodes ricinus oraz zakażenie ich krętkami Borrelia burgdorferi na zalesionych terenach doliny Słupi. In: Buczek A., Błaszak C. (eds.). Stawonogi. Znaczenie epidemiologiczne. Wyd. Koliber, Lublin Kiewra D., Dobracki W., Lonc E., Dobracka B. 2004a. Ekspozycja na ukłucia przez kleszcze a występowanie rumienia wędrującego u pacjentów z boreliozą z Lyme na terenie Dolnego Śląska. Przegl. Epidemiol. 58: Kiewra D., Dobracki W., Lonc E., Dobracka B. 2004b. Zagrożenie boreliozą z Lyme na Dolnym Śląsku. In: Buczek A, Błaszak C. (eds.). Stawonogi. Interakcje pasożytżywiciel. Wyd. Drukarnia LIBER. Lublin Kiewra D., Modrzejewska M Kleszcze gryzoni z Masywu Ślęży (Dolny Śląsk). Wiad. Parazytol. 50 (Supp): Kiewra D., Stańczak J., Richter M Ixodes ricinus ticks (Acari, Ixodidae) as a vector of Borrelia burgdorferi sensu lato and Borrelia miyamotoi in Lower Silesia, Poland - Preliminary study. Ticks. Tick-borne. Dis. 5(6): Kiewra D., Zaleśny G Relationship between temporal abundance of ticks and incidence of Lyme borreliosis in Lower Silesia regions of Poland. J. Vector. Ecol. 38(2): Kondracki J Geografia regionalna Polski. Warszawa. PWN. ISBN Kosik-Bogacka D., Bukowska K., Kuźna-Grygiel W Detection of Borrelia burgdorferi sensu lato in mosquitoes (Culicidae) in recreational areas of the city of Szczecin. Ann. Agric. Environ. Med. 9: Krajewski P Ślężański Park Krajobrazowy. Dolnośląski Zespół Parków Krajobrazowych we Wrocławiu. ISBN: Kwiatkowski P Szata roślinna rezerwatu "Góra Sobótka Ślęża". Acta Universitatis Wratislaviensis Prace Botaniczne. 62:

21 21. Lonc E., Buczek A., Kiewra D., Ciosek K Występowanie kleszczy Ixodes ricinus (L.) na Ślęży (Dolny Śląsk). In: Buczek A, Błaszak C. (eds.). Stawonogi. Pasożyty i nosiciele. Wyd. KGM Lublin Nowak-Chmura M Fauna kleszczy (Ixodida) Europy Środkowej. Wyd. Naukowe Uniwersytetu pedagogicznego. Kraków. 23. Nowak-Chmura M., Siuda K Ticks of Poland. Review of contemporary issues and latest research. Ann. Parasitol. 58(3): Pawełczyk A., Siński E Czynniki środowiskowe warunkujące infekcje Borrelia burgdorferi na Pojezierzu Mazurskim w Polsce. In: Buczek A., Błaszak C. (eds.). Stawonogi. Różnorodność form i oddziaływań. Wyd. Koliber Lublin Rijpkema S., Golubić D., Molkenboer M., Verbeek-De Kurif M., Schellekens J Identification of four genomic groups of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in a Lyme borreliosis endemic region of northern Croatia. Exp. Appl. Acarol. 20: Rizzoli A., Hauffe H.C., Carpi G., Vourc h G.I., Neteler M., Rosà R Lyme borreliosis in Europe. Euro. Surveill. 16(27): Rauter C., Hartung T Prevalence of Borrelia burgdorferi sensu lato genospecies in Ixodes ricinus ticks in Europe: a metaanalysis. Appl. Environ. Microbiol. 71(11): Siuda K Kleszcze Polski. Acari (Ixodida). Część II. Systematyka i rozmieszczenie. Warszawa. Polskie Towarzystwo Parazytologiczne. ISBN X. 29. Skotarczak B., Soroka M., Wodecka B Występowanie Ixodes ricinus na wybranych terenach rekreacyjnych województwa szczecińskiego. Part I. Wiad. Parazytol. 45(4): Spausta G., Wiczkowski A., Ciarkowska J., Strzelczyk J., Trapp G., Adamek B., Zalewska-Ziob M Częstość występowania Borrelia burgdorferi sensu lato u kleszczy Ixodes ricinus z okolic Tarnowskich Gór. Wiad. Parazytol. 49(1): Stańczak J., Biernat B., Matyjasek A., Racewicz M., Zalewska M., Lewandowska D Kampinos National Park: a risk area for spotted fever group rickettsioses, central Poland? Exp. Appl. Acarol. 70(3): Stańczak J., Cieniuch S., Racewicz M., Kubica-Biernat B Występowanie, aktywność i zagrożenie atakami kleszczy Ixodes ricinus na rekreacyjnych terenach Trójmiasta i Pojezierza Kaszubskiego. In: A. Buczek, C. Błaszak (eds.). Stawonogi. Znaczenie medyczne i gospodarcze. Wyd. AKAPIT. Lublin Stańczak J., Racewicz M., Kubica-Biernat B., Kruminis-Lozowska W., Dabrowski J., Adamczyk A., Markowska M Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks (Acari, Ixodidae) in different Polish woodlands. Ann. Agric. Environ. Med. 6(2): Tagliapietra V., Rosà R., Arnoldi D., Cagnacci F., Capelli G., Montarsi F., Hau e H.C., Rizzoli A Saturation deficit and deer density affect questing activity and local abundance of Ixodes ricinus (Acari, Ixodidae) in Italy. Vet. Parasitol. 183(1-2): Wegner Z., Racewicz M., Kubica-Biernat B., Kruminis-Lozowska W., Stańczak J Występowanie kleszczy Ixodes ricinus (Acari, Ixodidae) na zalesionych obszarach Trójmiasta i ich zakażenie krętkami Borrelia burgdorferi. Przeg. Epid. 51(1-2): Wodecka B flab Gene as a Molecular Marker for Distinct Identification of Borrelia Species in Environmental Samples by the PCR-Restriction Fragment Length Polymorphism Method. Appl. Environ. Microbiol. 77(19): Wodecka B., Rymaszewska A., Sawczuk M., Skotarczak B Detectability of tickborne agents DNA in the blood of dogs, undergoing treatment for borreliosis. Ann. Agric. Environ. Med. 16:

22 38. Wodecka B., Sawczuk M Występowanie chorobotwórczych genogatunków z obrębu Borrelia burgdorferi sensu lato w kleszczach Ixodes ricinus odławianych z północno-zachodniej Polski. Wiad. Parazytol. 50(3): Žákovská A Seasonal distribution of borreliae in Ixodes ricinus ticks in Brno park Pisárky. Scripta. Fac. Sci. Nat. Univ. Masaryk Brun. 26:

23 Tick-borne diseases multifaceted problems Krzysztof Jasik 2, Maria Styblińska 1, Danuta Psota 2, Marta Albertyńska 2,3, Urszula Mazurek 1 1 Department of Molecular Biology, 2 Department of Skin Structural Studies, School of Pharmacy with Division of Laboratory Medicine in Sosnowiec Medical University of Silesia in Katowice, 3. Provincial Sanitary and Epidemiological Station in Katowice, Poland Introduction The alarm for tick-borne diseases appearing in the media at the beginning of the Spring each year brings more confusions than the truth. In the first place the new items given to the public often lack some basic facts, such as the following ones: the term tick-borne diseases (TBD) refers not only to Lyme disease but also many other diseases. Available vaccinations relate only to tick-born encephalitis. Ticks bites may develop infections with various pathogens or you may get infected with some typically tick-borne pathogens, not only by a tick bite but by a way of digestive track or through placenta. Indeed, the problem is serious and from a scientific point of view requires multilateral treatment, which is argued by the frequent disagreement of views among clinicians, diagnostics and pharmacists. Therefore there is a need to work out and developed a universal analysis panel that will take into consideration not only TBD infection frequency, but also pathogenesis mechanism and a number of factors that may potentially affect diagnostic errors and inefficiency of therapy. The inefficiency may arise from a specific effect of ticks saliva, relatively long contact of Ixodidae representatives and hosts, and the fact that ticks are often vectors of many microorganisms. Some of them are evident pathogens, etiological factors of tick-borne diseases, some are endosymbionts of ticks, that have not been found pathogenic for tick hosts. What also matters is the fact that ticks often feed on various hosts performing phoresis functions between different vertebrates and humans. Biome found on/in ticks may also be relevant to the pathogenesis process. Co-existence of potentially pathogenic and nonpathogenic microorganisms may constitute a factor modifying the phenotype of typical tickborne pathogens. The study draws attention to the problem of co-infections, which even in selective analyses i.e. those including a small number od specimen, occurs very often. A possibility of vertical transmission of detected microbes has also been mentioned. Material and Methods The research material comprised 13 full engorged female of Ixodes ricinus collected in the Myslowice area (Silesian region). The females were placed in a breeding culture in chambers of high air humidity (90%) and at constant temperature (28 o C). From egg-laying, individual packets were isolated and kept as separate embryo cultures. The cultures were kept at constant temperature (28 o C) and relative air humidity of %. After hatching of larvae, females were analyzed with real-time PCR. Larvae were analyzed with microscopic methods (fluorescence microscope) and analysis RT-PCR) Fluorescence microscope analysis Larvae destined for fluorescence microscope examination were cut in a freezing microtome. Sections of about 10μm were fixed in 4% paraformaldehyde solution in PBS for 30 23

24 minutes. Following rising in the buffer the sections were stained with the solution of 4,6- diamidino-2-phenylindole (DAPI). Transmission Electron Microscopy Females and larvae ticks, for ultrastructural studies ware fixed in 2,5% paraformaldehyde solution at 4 o C. After rinsing in 0.1 M of phosphate buffer (ph 7.4), the tissues were fixed again in 1% buffered osmium tetroxide solution (Sigma - Aldrich, St. Louis, MO, USA) for 2 hours. At the next stage samples were rinsed in phosphate buffer and dehydrated in an ethyl alcohol and acetone series according to standard histological procedure. Dehydrated tissues were embedded in epoxy resin Poly/Bed 812 Embedding Media/DMP-30 Kit (Polyscience, Inc.,Warrington, PA, USA). Resin polymerization was conducted at 60oCfor 72 hours. The semi-thin sections (0.5-Fm thick) were stained with methylene blue (AppliedChem, Darmstadt, Germany) and observed by means of light microscopy. The ultrathin sections (80-nm thick) were contrasted with uranyl acetate (Polyscience, Inc., Warrington, PA, USA) and citrate lead (Sigma- Aldrich, St. Louis, MO, USA). The ultrastructural observations were performed with a transmission electron microscope Hitachi H500 at an accelerating voltage of 75 kv. Real-Time PCR Extraction of genetic material The isolation of genetic material of the explored pathogens was carried out using High Pure PCR Template Preparation Kit (Roche Diagnostics, Mannheim, Germany). Reverse transcription Reverse transcription reaction of isolated RNA E. chaffeensis/e. muris and TBEV was carried out using REVERTA L. RT reagents kit (Federal Budget Institution of Science Central Research Institute for Epidemiology, Moscow, Russia). Detection B. burgdorferi sensu lato, E. chaffeensis/e. muris, TBEV and A. phagocytophilum Detection of genetic material of B. burgdorferi sensu lato, E. chaffeensis/e. muris, TBEV and A. phagocytophilum was carried out using the Roche LightCycler 480 II. Real-time amplification reaction was carried out using AmpliSens TBEV, B. burgdorferi s.l., A. phagocytophilum, E. chaffeensis / E. muris-frt (Federal Budget Institution of Science, Central Research Institute for Epidemiology, Moscow, Russia). Amplification reaction was based on connecting complementary primers to a specific fragments of pathogen s genome used in the kit. Detection Babesia microti Real-time polimerase chain reaction conducted in Roche LightCycler 2.0 using the special pair of primers 5 -CAGGGAGGTAGTGACAAGAAATAACA-3 and 5 - GGTTTAGATTCCCATCATTCCAAT- 3 (DNA Sequencing Laboratory PAN, Warsaw, Poland) and probe 5-6FAM-TACAGGGCTTAAAGTCT BBQ (TIB MOLBIOL, Berlin, Germany). The positive control was the isolated DNA of B. microti. Reagents such as LightCycler TaqMan Master (Roche Diagnostics, Mannheim, Germany) were used in real time PCR reaction. The reaction was carried out with the following parameters: 1 cycle of preincubation at 95 C for 10 min.; 45 cycles of amplification denaturation at 95 C for 10 sec., annealing at 60 C for 30 sec., elongation at 72 C for 1 sec.; 1 cooling cycle at 40 C for 30 sec. Differentiation of genostrains Borrelia burgdorferi sensu lato Finding of Borrelia spp. genetics material involved the detection of genome s fragment of length of 160 bp using real time PCR. The fragment is amplified thanks by to connecting appropriate primers to it. The reaction product is defined by after melting point (Tm) analysis which is sensu stricto 62 o C for Borrelia burgdorferi, 71 C for Borrelia afzelii, 67 o C for Borrelia garinii and 58 o C for Borrelia spielmanii. Two kits were used for analysis LightCycler FastStart DNA Master HybProbe (Roche Diagnostics, Mannheim, Germany) and specific primers and LightMix Kit for detection of Borrelia spp. probe (TibMolBiol, Berlin, Germany). Amplification reaction was carried out using Roche LightCycler

25 Results The analysis of microscopic and ultrastructural images of ticks revealed the presence of various microorganisms in hemolimph, salivary glands and midgut of various microorganisms that may or may not be pathogenic. Among them, spirochetes, rods and intracellular rods - definitely representatives of Rickettsiales were detected. [Figs 1, 2]. Molecular studies aimed at detecting specific TBD pathogens in Ixodes ricinus females and their offspring showed only the presence of B. burgdorferi s. l. [Fig 3, 4, 5] Other analyses aiming at showing the presence of pathogens such as TBEV, A. phagocytophilum, E. chaffeensis/e. muris and Babesia microti, gave a negative result both in females and larvae. Differentiation analyses of the found B. burgdorferi genostrains in I. ricinus females demonstrated the appearance of many genostrains in the analyzed ticks [Fig. 6]. A detailed analysis of genostrains present in individual I. ricinus females was carried out with sample isolate melting point detection. In real time PCR method an additional cycle with an appropriate temperature (the so called melting) was introduced at the end. Under the influence of appropriate temperature, the amplified DNA melted. The melting point is characteristic of a specific genostrain: Borrelia burgdorferi sensu strict: 62 o C Borrelia afzelii: 71 o C Borrelia garinii: 67 o C Borrelia spielmanii: 58 o C On this basis it was concluded that the analyzed females were infected with various borrellia spp. genostrains; tick no 1 was infected with Borrelia burgdorferi sensu strict and Borrelia afzelii, tick no 5 with Borrelia afzeli, tick no 6 with Borrelia burgdorferi sensu strict and Borrelia afzelii, tick no 9 with Borrelia afzelii and tick no 12 with Borrelia garinii and Borrelia spielmanii. Presence of spirochaetes in larvae deriving from the infected females was not detected by molecular s methods. Up till now there has been a lot of unclarity and imprecision concerning the problem of transovarial pathogen transmission in ticks. As for Borrelia burgdorferii s.l., it has been negated in many research studies. The analysis results of the above study validate this approach. However, it does not change the tact, that there are some causes that may obstruct molecular detection; thus Borellia spp. transovarial transmission requires a different research methodology. Discussion Although many people perceive tick-borne diseases mainly as Lyme disease and tickborn encephalitis, the list of pathogens transferred by Ixodidae is very long. We cannot forget that apart from microorganisms typically transferred by ticks, there are also others that may be transported accidentally and they are not on the list of those, for which ticks are vectors (Okła et al. 2012). As it is known, hard ticks act in a protective way on microorganism development in the infected organism by immunomodulatory influence of saliva (Liu and Bonnet 2014, Kotál et al. 2015). The effect of these phenomena is the disorganization of homeostasis of tick hosts and the modification of the immune system's response. Various components of thick saliva have influence on different immunological factors. On the one hand, a tick bite provokes an increase in the number of leucocytes, macrophages, Langerhans cells (LCs), mast cells, as well as proinflammatory mediators released by endothelial cells and keratinocytes (Heath and Carbone 2013). On the other hand, there are big differences in the way saliva of different tick species influences specific immunological factors (Kotál et al. 2015). Individual pathogens affect the differentiation of tick cell gene expression. However, global analysis of both transcription level and protein structure and function does not make it clear whether molecular reactions of tick cells are caused by specific pathogens or whether the phenomena observed in ticks can be treated as an inborn 25

26 immunological response to any attacking microorganism. Though we still have a limited understanding of how ticks interact with pathogens, there is progress in this field as more and more data is collected concerning genome functioning including metabolomics, transcriptomic and proteomics of different tick and tick-borne pathogens (TBP) (de la Fuente 2017). Therefore it is impossible to disregard the fact that pathogenic microbes coevolved with the given species of ticks, which could cause endosymbionts for vector organisms and do not cause any defense reactions (Liu and Bonnet 2014). Interactions between tick proteins and intermediary proteins play a key role in infection, survival and pathogen transmission. Analyzes of A. phagocytophilum proteins differently represented during infection in ticks revealed that heat shock protein 70 (HSP70) and the main surface protein 4 (MSP4) interact by binding to tick cells, thus playing an important role in binding pathogens to ticks. It is suggested that the type IV secretion system (T4SS) will be involved in the secretion of HSP70, and the interaction of MSP4 with tick cells may induce the secretion of adhesins, important for infection of tick cells with rickettsias (Villar et al., 2015). The anchoring of B. burgdorferi in ticks occurs with the participation of external surface proteins A (OspA), involved in the colonization of the central intestine by binding to the tick receptor for OspA - TROSPA (ticker OspA receptor) (de la Fuente et al. 2017). Contact of microorganisms with host tissues induces many biochemical reactions related to transcription modifications, epigenetic mechanisms, and even reconstruction of the cytoskeleton of infected cells (Gómez-Díaz et al 2011, Gómez-Díaz et al. 2012, Ireton 2013). Intracellular pathogens manipulate host cell transcription processes and lead to stress and inflammatory responses due to various epigenetic mechanisms. A. phagocytophilum has been shown to influence epigenetic processes within tick cells by increasing the levels of histone modifying enzymes (HMEs), histone acetyltransferases (HATs; 300 / CBP) and histone deacetylases (HDACs). This causes inhibition of cell apoptosis, which promotes the development of infection and multiplication of the pathogen (Cabezas-Cruz et al., 2016). Among the biochemical mechanisms of the interaction of A. phagocytophilum on the epigenetic processes occurring in tick cells probably should be controlled by effector proteins, such as AnkA, secreted by T4SS. It is unknown whether AnkA proteins also play the same role in vertebrate neutrophils. (Rennoll-Bankert et al., 2015). Each of the pathogens transmitted by Ixodidae possesses a distinctive system of factors enabling the colonization of the vector and vertebrate organisms. According to the analyzes, the pathogenicity of B. burgdorferi s.l. Essential cord-binding proteins with endothelial cells are very important (Niddam et al., 2017). Babesia microti has a number of factors that allow contact with erythrocytes, penetration to them, as well as those that cause blood clots and clogging (Albertyńska et al. 2017, Okła et al. 2017). This diversity of pathogenic factors requires to pay attention to another aspect of broadly understood TBD - namely, whether is there any correlation between the effects of various etiological factors in the complex pathogenesis, which is the effect of co-infection. It is well-known that co-infections are a very common phenomenon (Parola and Raoult 2001; Zając 2017), and species belonging to the same genus often show different pathogenesis. Considering B. burgdorferi s.l. diversified pathogenicity is commonly and widely described, and can therefore be expected in the case of co-infections of various pathogenic factors of interference. 26

27 Documentation Fig. 1. Section through the tissue wall of the middle intestine of female Ixodes ricinus infected with Borrelia burgdorferi s.l. In addition to spirochetes (white arrows), numerous sticks are visible (red arrows). DAPI method. Fig. 2. Section through a cell in the fallopian tube of female Ixodes ricinus infected with Borrelia burgdorferi s.l. within the cytoplasm of cells visible numerous bacteria - Rickettsiales spp. (arrows), L - the lipid drop Mt - mitochondria, N - cell nucleus. 27

28 Fig. 3. Amplification curve, tick No. 1 (positive result). PC - positive control. Fig. 4. Amplification curves, ticks No. 5, 6, 9 (positive results). PC - positive control test. 28

29 Fig. 5. Amplification curve of tick No. 12 (positive result). PC - positive control. Fig. 6 Diversity of the genospecies of B. burgdorferi s.l. in ticks found to be present, based on the melting point. 29

30 References 1. Albertyńska M. Rupik W. Hermyt M. Okła H. Jasik K.P Babesia microti Known and Unknown Protists. Glob J Zool 2: Cabezas-Cruz A. Alberdi P. Ayllón N. Valdés J.J. Pierce R. Villar M Anaplasma phagocytophilum increases the levels of histone modifying enzymes to inhibit cell apoptosis and facilitate pathogen infection in the tick vector, Ixodes scapularis. Epigenetics 11: Fuente J. Antunes S. Bonnet S. Cabezas-Cruz A. Domingos A.G. Estrada-Peña A. Johnson N. Kocan K.M. Mansfield K.L. Nijhof A.M. Papa A. Rudenko N. Villar M. Alberdi P. Torina A. Ayllón N. Vancova M. Golovchenko M. Grubhoffer L. Caracappa S. Fooks A.R. Gortazar C. Rego R.O.M Tick-Pathogen Interactions and Vector Competence: Identification of Molecular Drivers for Tick-Borne Diseases. Front. Cell. Infect. Microbiol. 7: Gómez-Díaz E. Boulinier T. Sertour N. Cornet M. Ferquel E. McCoy K.D Genetic structure of marine Borrelia garinii and population admixture with the terrestrial cycle of Lyme borreliosis. Environmental Microbiology 13: Gómez-Díaz E. Jordà M. Peinado M.A. Rivero A Epigenetics of host-pathogen interactions: the road ahead and the road behind. PLoS Pathog. 8:e doi: /journal.ppat Heath W.R. Carbone F.R The skin-resident and migratory immune system in steady state and memory: innate lymphocytes, dendritic cells and T cells. Nat. Immunol. 14: Ireton K Molecular mechanisms of cell-cell spread of intracellular bacterial pathogens. Open Biol. 3: doi: /rsob Kotál J. Langhansová H. Lieskovská J. Andersen J.F. Francischetti I.M.B. Chavakis T. Kopecký J. Pedra J.H.F. Kotsyfakis M. Chmelař J Modulation of host immunity by tick saliva. J Proteomics. 128: Liu X.Y. Bonnet S.I Hard Tick Factors Implicated in Pathogen Transmission. PLoS Negl Trop Dis 8: e2566. doi: /journal.pntd ; 10. Niddam A.F. Ebady R. Bansal A. Koehler A. Hinz B. Moriarty T.J Plasma fibronectin stabilizes Borrelia burgdorferi-endothelial interactions under vascular shear stress by a catch-bond mechanism. Proc Natl Acad Sci USA. 25: 114(17):E3490-E Okła H. Jasik K.P. Rozwadowska B. Słodki J. Urbańska-Jasik D. Grelowski M. Chmielik E. Słodki A. Albertyńska M. Grajoszek A Rat spleen in the course of Babesia microti invasion: histological and submicroscopic studies. Acta Protozool. 56: Okła H. Sosnowska M. Jasik K.P. Słodki J. Wojtyczka R.D Nonspecific Bacterial Flora Isolated from the Body Surface and Inside Ixodes ricinus Ticks. Pol J Microbiol. 28: 61(3): Parola P. Raoult D Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin Infect Dis. 15: Rennoll-Bankert K.E. Garcia-Garcia J.C. Sinclair S.H. Dumler J.S Chromatin bound bacterial effector ankyrin A recruits histone deacetylase 1 and modifies host gene expression. Cell Microbiol. 17: Villar M. Ayllón N. Kocan K.M. Bonzón-Kulichenko E. Alberdi P. Blouin E.F. Weisheit S. Mateos-Hernández L. Cabezas-Cruz A. Bell-Sakyi L. Vancová M. Bílý T. Meyer D.F. Sterba J. Contreras M. Rudenko N. Grubhoffer L. Vázquez J. de la Fuenteet J Identification and characterization of Anaplasma phagocytophilum proteins involved in 30

31 infection of the tick vector, Ixodes scapularis. PLoS ONE 10:e doi: /journal.pone Zając V. Wójcik-Fatla A. Sawczyn A. Cisak E. Sroka J. Kloc A. Zając Z. Buczek A. Dutkiewicz J. Bartosik K Prevalence of infections and co-infections with 6 pathogens in Dermacentor reticulatus ticks collected in eastern Poland. Ann Agric Environ Med 24:

32 32

33 Risk of exposure to parasitic and zoonosic diseases in the Malopolska voivodeship in Anna Kocoń 1, Magdalena Nowak-Chmura 1, Małgorzata Kłyś 2, Natalia Malejky 2 1Institute of Biology, Department of Invertebrate Zoology and Parasitology, Pedagogical University of Cracow, Podchorążych 2, Cracow, a_kocon@wp.pl 2Institute of Biology, Department of Ecology and Environmental Protection, Pedagogical University of Cracow, Podchorążych 2, Cracow, Poland Abstract Diseases transmitted by vectors, as well as zoonoses (anthroposomoses), are now a fairly frequent problem for pet owners, tourists, and people who have contact with nature. Lyme disease, tick-borne encephalitis, malaria, dengue fever, leptospirosis, listeriosis, rabies these are diseases known throughout the world, occurring permanently in Poland, as well as dragged to Poland by travellers. The area of the Lesser Poland province is also not free from the incidence of these diseases, the study analysed data on the number of cases of the diseases mentioned above in the Lesser Poland province in Introduction Foreign and domestic travel, increased contact with nature, are associated not only with rest, sightseeing interesting places, learning about the culture of other countries, they also have their downsides. During a tourist trip, we increase the danger of falling ill, getting infected with infectious and parasitic diseases. To minimize the risk of disease, one must effectively protect oneself depending on the severity of the disease in a given area. The most often effective way to protect against infectious diseases is vaccination and in many cases compliance with hygienic rules. The most common pathways of transmission of infectious and parasitic diseases are: food, respiratory, sexual and direct contact with a sick animal, contact with infected faeces, blood, bite by an infected animal (Tab. 1). The increase in the incidence of vector/zoonotic diseases is attributed not only to travel, but also, among others, growing population of vectors and their spreading to completely new areas or learning about new species of vectors. These factors may also include the expanding habitat and population growth of wild animals, which are a great reservoir of pathogens, as well as continuous weather changes occurring throughout the world that favour the development of many vectors (Gratz 1999). One of the important factors is also the improvement of pathogen detection methods using specialized molecular techniques. Arthropods are vectors of almost every group of pathogens, including: viruses, bacteria, protozoa. Most often, pathogens enter the host s body while sucking its blood. Many vector and zoonotic diseases are found in children playing on lawns, in sandpits; pregnant women are also at risk, as well as people with weakened immunity, elderly people, and every person who has direct contact with domestic or wild animals. The Lesser Poland province is in the south-eastern part of Poland, covering the area of km 2 ( and has 3391,4 thousand persons (data as of ) ( taking the 4 th place in Poland in this respect. Lesser Poland is at the same time a highly economically developed region, where industry dominates; 33

34 an agricultural and fruit farming region, as well as attractive in terms of tourism in ,9 million people visited the Lesser Poland region (study of tourism movement in the Lesser Poland province 2017). Based on data from the National Institute of Public Health National Institute of Hygiene, State Sanitary Inspection, the number of cases of the selected vector/zoonotic diseases (Lyme disease, tick-borne encephalitis, malaria, dengue fever, leptospirosis, listeriosis, rabies) has been analysed in the province of Lesser Poland in ( Lyme borreliosis One of the most common tick-borne diseases in the northern hemisphere is Lyme borreliosis. The Borrelia burgdorferi sensu lato spirochetes are the etiologic factor of borreliosis. Of the more than 20 known genospecies of these bacteria, pathogenic for humans are: Borrelia burgdorferi sensu stricto, B. garini, B. afzeli, B. valaisiana, B. lustianiae, B. bissetti and B. spielmani (Stanek and Strle 2008). The main reservoirs of B. burgdorferi are small rodents, rabbits, hedgehogs, deer, passerine birds, pheasants, gulls, lizards, but it is suspected that each tick host may be a reservoir of these bacteria. In Poland, these spirochetes are found primarily in small rodents, deer, horses and dogs, and Ixodes ricinus is the vector, to a lesser extent Ixodes persulcatus, Ixodes hexagonus, Dermacentor reticulatus (Nowak-Chmura 2013). The infection with spirochetes occurs as a result of a bite through an infected tick, rubbing a crushed tick, its content or faeces into a wounded area on the skin (Kmieciak et al. 2016). Lyme disease is a multi-organ, multi-symptomatic infectious disease. The initial and most frequent symptom of the disease is a skin lesion in the form of a migrating erythema. After a few weeks, the erythema may disappear but the infection may spread to many organs and systems causing neuroborreliosis, arteriosclerosis, arrythmias (Tylewska-Wierzbanowska and Chmielewski 2010). This disease is the most threatening to forestry workers, hunters, farmers, people professionally associated with the environment of ticks occurrence. The current continuous weather changes affecting the rapid spread of ticks may contribute to the increase in Lyme disease occurrences throughout Central Europe. In the Lesser Poland province in a total of reported cases of Lyme disease were registered. The highest number of cases was recorded in the third quarter of the year and the lowest in the first quarter (Tab. 2). Since 2016, a significant increase in the incidence of the Lesser Poland inhabitants to Lyme disease has been noticeable, which confirms the growing spread of this disease in southern Poland. Tick-borne encephalitis (TBE) The disease caused by viruses (Flaviviridae, Flavivirus), transmitted by ticks, in endemic areas, people can become infected with the virus through the intake of infected dairy raw materials (Siuda 1991). The main carriers are two tick species: Ixodes ricinus, Ixodes persulcatus (Heyman et al. 2010) and small rodents are the reservoir. Most human TBE virus infections are asymptomatic. The infection manifests itself mainly in the spring and summer period, fewer cases are recorded in autumn. When the infection occurs, the first symptoms of the illness are flu-like symptoms, nausea, vomiting, diarrhoea, in some people spontaneous cure occurs, temporary improvement of the sick person s condition followed by symptoms from the central nervous system, which leads to meningitis, inflammation of the brain, cerebellum, of the spinal cord (Mucha et al. 2012). In Poland, the areas with particularly high prevalence of antibodies against TBE are the northern and north-eastern areas of the country (Stefanoff et al. 2008), as in the case of Lyme disease, professional groups particularly exposed to infection by TBE are foresters, hunters, farmers. You can protect yourself against the disease by performing vaccinations against TBE. In , a total of 32 cases of tick-born encephalitis were recorded in the Lesser Poland region. The highest number of cases was recorded in the third quarter of each year, no 34

35 cases of TBE were found in the first quarter of the year (Tab. 3). The following data shows that the incidence of this disease in the Lesser Poland region is low. Malaria Malaria is caused by the protozoan, mainly by Plasmodium vivax, to a lesser extent by P. falciparum carried by female Anopheles mosquitoes. In Poland, up to now, there have been 5 species of Anopheles spp. reported, of which 3 belong to the Anopheles maculipennis complex, mosquitoes attacking human beings that may transmit malaria parasite, these are: An. maculipennis, An. messeae and An. atroparvus. Anopheles atroparvus the main carrier of this disease in Western Europe and Anopheles messeae the main vector of malaria in Central and Eastern Europe. Malaria is a tropical parasitic disease. Cases occurring outside tropical and subtropical areas of endemic occurrence of this disease are found in people returning from these regions, as well as sporadically may appear near airports, ports (airport, port malaria), where they are dragged by these dangerous invertebrates (Kubica-Biernat 2005). The main outbreaks of this disease are areas on the African, Asian and South American continents. The first symptoms of malaria are chills, high fever, headaches, nausea, vomiting, diarrhoea, and in the final period of the attack, abundant sweats and a sharp lowering of body temperature. Such attacks appear every 48 hours in the case of an infection with Plasmodium vivax. The protozoan damages erythrocytes and hepatocytes, which leads to haemolytic anaemia, jaundice and haemoglobinuria. In addition, one can observe muscle pain, spine pain, altered consciousness, neurological symptoms, cough, dyspnoea in people (Magdzik et al. 2007). The number of malaria cases in the Lesser Poland region in is similar each year, no significant increase in the incidence of this disease has been noticed. Patients suffering from malaria were primarily tourists, missionaries, and people working seasonally in Africa. A total of 30 cases of malaria were recorded. Most people fell ill in the third quarter within 5 years, the least in the first quarter (Tab. 4). Dengue fever Dengue fever is an infectious disease caused by the dengue virus belonging to the Flaviviridae family, Flavivirus type. The man is the virus reservoir, sporadically it can be monkeys, mainly in the areas of Southeast Asia and in West Africa. The infection vector is mainly the Aedes aegypti mosquito species. In typical cases, the dengue is asymptomatic or mild. The general symptoms of the disease are acute febrile condition appearing additionally with a maculopapular rash and catarrh of the upper respiratory tract, headaches, bone and joint pains, enlargement of the lymph nodes. This disease can lead to a life-threatening haemorrhagic fever with haemorrhages (Korzeniewski 2012). Currently, no vaccine is available; symptomatic treatment. The number of cases in the Lesser Poland province for dengue fever in the years of totalled to 13. The lowest number of cases was recorded in 2014, and the highest in 2016, in previous years there were 2 cases per year. Most people fell ill in the first quarter of each year, least in the fourth quarter (Tab. 5). The following data shows that the incidence of dengue fever in the Lesser Poland province is low. Leptospirosis Leptospirosis is a bacterial infectious disease, occurring all over the world, caused by the spirochete of the Leptospira genus, for humans the pathogenic species is Leptospira interrogans. The main reservoirs of bacteria are especially rodents, cattle, pigs and pets cats and dogs. The infection occurs through the mucous membrane or damaged skin exposed to the body fluids of the infected animal as well as by exposure to water, soil contaminated with urine of infected animals and by being bitten by an animal. When germs get into the blood, the main symptoms of the diseases are: high fever, chills, headaches, muscle and joint pains, 35

36 cold sores, conjunctival hyperaemia, throat mucosa congestion, erythema of the skin, various forms of rash. After the initial symptoms, the fever drops, after some time the spirochetes begin to locate in various organs and tissues. The disease may be mild or severe leading to jaundice with multiple organ dysfunction (Kajfasz 1994). Cases of leptospirosis most often occur among the slaughter workers, farmers, veterinarians, animal breeders, fishermen, miners. The disease is treated with antibiotic, immunity antisera, symptomatic treatment (Gliński and Kostro 2013). In , a total of 15 cases of leptospirosis were recorded in the Lesser Poland region. The highest number of cases was recorded in the third quarter of 2014, no cases of this disease were found in 2013 and 2017 (Tab. 6). The following data shows that the incidence of leptospirosis in the Lesser Poland province is low. Listeriosis An infectious disease caused by bacteria, mainly Listeria monocytogenes, occurring in both humans and animals. They may occur in sheep, pigs, cattle, horses, hares, rabbits, hens, as well as typically domestic animals, in chinchillas and guinea pigs. The infection is most often caused by food containing L. monocytogenes bacteria (dairy products, raw vegetables and fruits, meat, cold meats, ice cream). The symptoms of bacterial infection include: high fever, pain in the joints and muscles, vomiting, diarrhoea, convulsions, temporary loss of consciousness. Undetected listeriosis can lead to meningitis, endocarditis or sepsis. The antibiotic therapy is the treatment method (Jurkiewicz and Oleszczok-Momot 2015). In the years of , 18 people fell ill with listeriosis in the Lesser Poland province. The lowest number of cases was recorded in 2013 and 2015, and the highest in Most people fell ill in the fourth quarter of 2016 and in the third quarter of 2014, 2015 and 2017, the least in the first quarter (Tab. 7). Rabies Rabies is caused by viruses from the Rhabdoviridae family of the Lyssavirus type. It is an acute viral infectious disease that leads to damage in the central nervous system. There are two epidemiological forms of this disease: urban and forest. In Europe and the Americas the forest rabies dominates where the main reservoir of the virus are foxes, as well as raccoon dogs, weasels, wild boars, martens, bats. Urban rabies is characteristic in Asian countries and the primary reservoir of this disease are dogs, cats and monkeys. In Poland, the most common risk of contracting this disease is found in wild animals and stray dogs and cats. The rabies virus enters the human body by biting or putting saliva on the damaged skin or mucous membranes by an infected animal. The most common symptoms of the disease are headaches, insomnia or increased drowsiness, fever, numbness, burning at the bite spot, anxiety, irritability. The next stage of the disease is inflammation of the brain: visual hallucinations, auditory hallucinations, convulsions, hydrophobia. The third phase of the disease is fatal (Sadkowska-Todys 2006). Due to the discovery of the rabies vaccine, there are rare cases of human disease cases. In , there was no rabies found in humans in the Lesser Poland province. Summary Disease pathogens are characterized not only by the ability to cause disease in humans and animals, but also by the ability to adapt to new species, habitats and the properties of crossing the barrier between species which is the barrier between animals and humans. Understanding the aetiology of infectious and parasitic diseases, their ways of spreading, understanding the role of carriers in transmitting dangerous diseases has become the basis for learning about the dangers resulting from contact with vectors of anthropo-zoonotic diseases. Borreliosis, tick-borne encephalitis, malaria, dengue fever, leptospirosis, listeriosis, rabies are the selected but very important diseases on the list of infectious and zoonotic diseases, occurring in Poland and dragged to Poland. The main vectors in the transmission of dangerous 36

37 pathogens are mainly wild animals including forest animals, small rodents, domestic animals, cattle, pigs, sheep. Some of these diseases are rare in Poland, which does not mean that over time, more frequent trips or due to constant changes in weather this will not change. The most common vector disease noted in the Lesser Poland province in the years of is borreliosis. In the case of the other diseases mentioned above, the incidence varies between 32 and 13 cases for a total of 5 years. Most cases were observed in the summer and autumn period (third quarter). In the studies of Frączek (2015) conducted in the years of h , a total of 11 cases of malaria were found and 5 cases of denga fever. The highest number of reports was recorded in 2013, the lowest in 2009, 2010, Among the people who developed the disease were middle-aged people and the majority were men (Frątczak 2015). Adequate protection against attacks from viruses, bacteria, protozoa and the execution of vaccination in some cases, antibiotic therapy will reduce the chances of an increase in the incidence of infectious/zoonotic diseases. In the case of protection against attack from ticks carrying diseases such as, among others, Lyme disease and tick-borne encephalitis, we should avoid the typical places of occurrence of these parasites, i.e.: tall grass, forest paths, thick bushes. Walking in the park, the forest, it is necessary to have appropriate clothes long trousers, long-sleeved shirt, high boots, head protection and the use of repellents to deter the unwanted companions. While in the green areas and after returning home, we should check our body whether it has not become the point of entry of the parasite. Let us also remember to protect our pets: dogs and cats against tick attacks (Nowak-Chmura 2013). When going on a trip abroad, where the threat from mosquitoes is large (Africa, South America, South Asia), remember about adequate protection against mosquito attacks (use of repellents) and taking antimalarial drugs selected individually for each patient. Additionally, mosquitoes should be avoided by securing the accommodation place: using mosquito nets, window covers, appropriate clothing. In the case of the dengue virus, protection against mosquito bites should be taken into account at the time of the greatest activity of these invertebrates and this is the daytime, unlike mosquitoes carrying malaria (Magdzik et al. 2007). In order not to become infected with zoonotic disease leptospirosis, it is necessary to avoid contact with the infected animal, especially through wounded skin or fluids as well as on contaminated water, soil or animal bites. Proper vaccination of animals reduces the chance of contracting this disease (Kajfasz 1994). It is also very important to avoid foods infected with L. monocytogenes bacteria, which live in dairy products, raw vegetables and fruits, in meat, cold cuts and ice cream. The introduction of HACCP system in food production facilities, which guarantees food safety, will significantly reduce the rate of the disease (Jurkiewicz and Oleszczok-Momot 2015). Methods of preventing rabies virus reservoirs in the environment are: elimination of sick animals and those suspected of rabies, vaccination of domestic and wild animals (mainly foxes), periodic vaccine releases, protective vaccination of dogs, cats and preventive of people professionally exposed to rabies. You should also avoid contact with wild animals, do not touch dead animals found, and report this fact to the appropriate services (Sadkowska-Todys 2006). The most important role in all risks in prevention, knowledge about the prevention of infections and correct hygiene habits, especially in people exposed to contact with infected animals and infected food. 37

38 Tab. 1. The selected infectious and parasitic diseases and their pathways Transmission path Infectious/parasitic disease Transmission disease transmitted by mosquitoes Malaria, Denga fever Transmission disease transmitted by ticks Tick-borne encephalitis, Borreliosis Zoonotic disease an animal bite Rabies Contact with infected/contaminated water Leptospirosis Contact with infected/contaminated food Listeriosis Tab. 2. The number of cases of Lyme disease in the years of in the Lesser Poland province Year Number of cases in quarters Number of cases Incidence per 1-- I II III IV in a year thousand , , , , ,1 Tab. 3. The number of cases of TBE in the years of in the Lesser Poland province Year Number of cases in quarters Number of cases Incidence per 1-- I II III IV in a year thousand , , , , ,32 Tab. 4. The number of cases of malaria in the years of in the Lesser Poland province Year Number of cases in quarters Number of cases in Incidence per 1-- I II III IV a year thousand , , , , ,15 Tab. 5. The number of cases of dengue fever in the years of in the Lesser Poland province Year Number of cases in quarters Number of cases in Incidence per 1-- I II III IV a year thousand , , , , ,06 38

39 Tab. 6. The number of cases of leptospirosis in the years of in the Lesser Poland province Year Number of cases in quarters Number of cases in Incidence per 1-- I II III IV a year thousand , , , Tab. 7. The number of cases of listeriosis in the years of in the Lesser Poland province Year Number of cases in quarters Number of cases in Incidence per 1-- I II III IV a year thousand , , , , ,09 References 1. Frączek J Zachorowalność na parazytozy tropikalne wśród mieszkańców Małopolski w okresie od 2009 do Praca magisterska. Uniwersytet Pedagogiczny im. KEN w Krakowie. 2. Gliński Z., Kostro K Leptospiroza groźna choroba zwierząt i zoonoza. Życie weterynaryjne. 88(10): Gratz N. G Emerging and resurging vector-borne diseases. Annu Rev Entomol. 44: Heyman P., Cochez C., Hofhuis A., van der Giessen J., Sprong H., Porter S.R., Losson B., Saegerman C., Donoso-Mantke O., Niedrig M., Papa A A clear and present danger. Tickborne diseases in Europe. Expert Rev. Anti. Infect. Ther. 8(1): Jurkiewicz A., Oleszczok-Momot W Listeria monocytogenes jako problem zdrowia publicznego. Med. Ogólna i Nauki o Zdrowiu. 21(1): Kajfasz P Leptospiroza u ludzi. Mag. Wet. (5): Kmieciak W., Ciszewski M., Szewczyk E. M Choroby odkleszczowe w Polsce występowanie i trudności diagnostyczne. Med. Pr. 67(1): Korzeniewski K Wirusowe gorączki krwotoczne. Forum Med. Rodz. 6(5): Kubica-Biernat B Malaria i jej wektory w Polsce. In: Buczek A., Błaszak C., Stawonogiróżnorodność form i oddziaływań Magdzik W., Naruszewicz-Lesiuk D., Zieliński A Choroby zakaźne i pasożytnicze - epidemiologia i profilaktyka. Alfa Medica Press, Bielsko-Biała. 11. Mucha D., Zielazny P., Karakiewicz B Choroby przenoszone przez kleszcze sytuacja epidemiologiczna w województwie pomorskim. Med. Ogólna i Nauki o Zdrowiu. 18(2): Nowak-Chmura M Fauna kleszczy (Ixodida) Europy Środkowej. Wydawnictwo Naukowe Uniwersytetu Pedagogicznego, Kraków. 13. Narodowy Instytut Zdrowia Publicznego Państwowy Zakład Higieny: Meldunki o zachorowaniach na choroby zakaźne, zakażeniach i zatruciach w Polsce. Adres: 39

40 14. Sadkowska-Todys M Wścieklizna - aktualne problemy epidemiologiczne. Pol. Przegl. Neurol. 2(1): Siuda K Kleszcze Polski (Acari: Ixodida). Część I. Zagadnienia ogólne. Wydawnictwo Naukowe PWN, Warszawa, Wrocław. 16. Stanek G., Strle F Lyme disease. European perspective. Infect. Dis. Clin. North Am [ta]. 22(2): Stefanoff P., Sinnicka J., Kaba J., Nowicki M., Ferenczi E., Gut W Identification of new endemic tick-borne encephalitis foci in Poland a pilot seroprevalence in selected regions. Int. J. of Med. Microbiol. 298(1): Tylewska-Wierzbanowska S., Chmielewski T Post. Mikrobiol. 49: Skr%C3%B3t_raportu_2017.pdf 40

41 Microbiome of Dermacentor reticulatus collecting from chase game in Podlasie district (Poland) - preliminary study Justyna Dunaj, Anna Moniuszko, Henryk Grześ and Sławomir Pancewicz Klinika Chorób Zakaźnych i Neuroinfekcji, Uniwersytet Medyczny w Białymstoku Kierownik Kliniki: prof. dr hab Sławomir Pancewicz ABSTRACT Introduction Dermacentor reticulatus (D. reticulatus) ticks, willingly feeding on many different mammals: rodents, hedgehoges, rabbits, bisons, deers, cattle and others. Also human being might be a host of Dermacentor reticulatus (D. reticulatus) ticks, but usually incidentally. Many pathogens such as: Borrelia burgdorferi sensu lato (B. burgdorferi sl) spirochetes, tick-borne encephalitis virus (TBEV), Babesia species protozoa (Babesia spp.), and also bacteria from Bartonella species, Francisella tularensis or Coxiella burnetti (C. burnetti) and spotted fever rickettsia (Rickettsia conorii, Rickettsia slovaca) are isolated from D. reticulatus organism.. They might be transmitted into human organism during tick feeding. All present in tick microorganism composed its microbiome, which might create ticks medical meaning. Material and methods In conducted research were 6 D. reticulatus ticks collected in January 2018 from two roe deer (females) hunted in areas of Sienkiewicze and Ruszczany (Podlasie). Ticks were cleaning in 70% ethanol and after all were damage in mortar with addition of PBS (without Ca and Mg ions). 1 ml of homogenate was used for microbiological analyses culture on mediums and colony identification with Vitek aparature (Biomerieux, France). Rest part of homogenates were used for DNA extraction with spin columns kits used as a matrix for molecular biology techniques such as end-point PCR for Borrelia burgdorferi sl, Anaplasma phagocytophilum, Babesia spp., Rickettsia spp., Bartonella spp. and Coxiella burnetti detection. Results In 6 ticks collected from roe deer s indicated presence of several variety microorganisms, pathogenic as well as potentially nonpathogenic for people. From roe deer from Sienkiewicze collected two males (T1, T2) and female (T3) Dermacentor reticulatus, in which detected: Staphylococcus vitulinis (T1, T2, T3), Pseudomonas fluorescens (T2, T3), Acinetobacter haemolyticus (T1), Rahnella aquatilis (T2), Facklamia hominis (T3), Brevundimonas diminuta (T3), Pseudomonas aeruginosa (T3). From roe deer from Ruszczan localization collected one male (T4), nymph (T5) and female (T6) Dermacentor reticulatus, from which were isolated: Pseudomonas fluorescens (T5, T6), Aeromonas salmonicida (T4, T6), Sphingomonas pancimobilis (T4), Gemella sanguinis (T4), Brevundimonas diminuta (T4), Dermacoccus nishinomiyaensis (T4), Granulicatella elegans (T5), Candida zeylan oides (T6) Gemella bergeri (T6). There were any detection of Borrelia burgdorferi sl, A. phagocytophilum, C. burnetti, Bartonella spp., Rickettsia spp., Babesia spp. DNA in samples extracted from analyzed D. reticulatus ticks. Conclusions Conducted pilot study on polish ticks, collected from hunted wild animals, microbiome indicates on a presence and co-existence of many and variety microorganisms, also those pathogenic and those with potentially pathogenic meaning for people. Possibility of eventual transmission during tick feeding on human, especially in immuno-non-competent people, 41

42 might be connected with non-standard infection course. INTRODUCTION Dermacentor reticiulatus (D. reticulatus) it is the second most frequently detected tick in Poland. Until recently it was known that D. reticulatus was present only in north-east and east part of Poland, while now its expansion is wider of central and west part of country (Rubel et al. 2016). The same trend is observed in whole central and west-north Europe during last years D. reticulatus distribution is remarkable wider, especially in Poland, Germany, Hungary, Slovakia, Netherlands and Belgium (Rubel et al. 2016). It is connected with spreading in environment main D. reticulatus host elk, and with more often feeding on deer. It was change also D. reticulatus habitat, which primally assume wet areas, swampy mixed forests, forested riverside valley and meadows, while present D. reticulatus is founded with the same frequency on urban and suburban areas, such as wastelands, meadows or parks (Földvári 2016, Buczek et al. 2015, Buczek 2005). On speed for spreading new habitats by D. reticulatus have influence its high reproductive rate and resistant for changing environmental conditions and its vitality. Females are capable after fertilization to lay more than 7 thousands eggs, and adult individuals can survive even 4 years without any meal (Földvári et al. 2016). It was observed that in -10 C temperaturę D. reticulatus is capable to survive by 150 days period (Simo et al. 2004). Because of high adaptation to reach in water habitats this tick species can exist up to one month on partially flood areas, and for more than 100 days D. reticulatus survive in clean and cool water for example in rivers or streams (Földvári et al. 2016). D. reticulatus it is a tick species which willingly feeding on many different mammals what definitely facilitate its survive and taking new habitats. Larves and nymph prefer rodents such as: shrew, vole, birch mouse. Nymphs also choose bigger mammals, as hares, rabbits or even roe deer, deer and sporadically birds. Adult D. reticulatus forms mostly oftenly feeding on elks, deers and also cattle, sheeps, goats, bisons, wild boars, foxes, hares, rabbits, hedgehogs and dogs. Also human being might be a host of D. reticulatus ticks, but usually incidentally (Földvári et al. 2016, Buczek 2005). Many pathogens such as: Borrelia burgdorferi sensu lato (B. burgdorferi sl) spirochetes, tick-borne encephalitis virus (TBEV), Babesia species protozoa (Babesia spp.), and also bacteria from Bartonella species (Bartonella spp.), Francisella tularensis or Coxiella burnetti (C. burnetti) and spotted fever rickettsia (Rickettsia conorii, Rickettsia slovaca) are isolated from D. reticulatus organism. They might be transmitted into human organism during tick feeding causing single infection, as well as co-infections (Dunaj et al. 2018, Moniuszko et al 2014, Földvári et al. 2013, Obsomer et al. 2013). All present in tick microorganism composed its microbiome, which might create ticks medical meaning (Narasimhan and Fikrig 2015). MATERIAL AND METHODS In conducted research were 6 D. reticulatus ticks collected in January 2018 from two roe deer (females) hunted in areas of Sienkiewicze and Ruszczany (Podlasie). From roe deer from Sienkiewicze were collected two males (T1, T2) and one female (T3), while from second roe deer fro Ruszczany area: one male (T4), one nymph (T5) and one female (T6) of D. reticulatus. Each tick was transported separately in sterile Eppendorf type probes in cooling conditions. After identification and morphological evaluation ticks were cleaning in 70% ethanol, ultra-pure water and again in 70% ethanol, and after all were damage in mortar with addition of PBS (without Ca and Mg ions). 1 ml of homogenate was used for microbiological analyses culture on mediums and colony identification with Vitek aparature (Biomerieux, France). Rest part of homogenates was centrifuge and 300 µl of supernatant was used for DNA extraction with spin columns kits (EURx, Poland) according to manufacturer instruction

43 µl of obtained DNA extracts were storage at -20 C. DNA isolates were a matrix for molecular biology techniques such as end-point PCR for Borrelia burgdorferi sl, Anaplasma phagocytophilum, Babesia spp., Rickettsia spp., Bartonella spp. and Coxiella burnetti detection. Methods Borrelia burgdorferi sensu lato PCR The Borrelia burgdorferi PCR kit (GeneProof, Czech Republic) for in vitro diagnostics was used for B. burgdorferi sl molecular detection. In one tube PCR was amplified a 120 bp fragment of the 16S rrna gene encoding small ribosomal subunit. The template DNA extract was added to 30 μl of the MasterMix for final reaction mix volume of 40 μl. Hot start technology used in detection kit, minimized risk of non-specific reactions and maximized sensitivity of procedure. PCR inhibition was controlled by internal standard in reaction mix. Addition of uracil-dna-glycosylase (UDG) eliminated possible contamination during preparation of reaction. PCR was performed on the SensoQuest LabCycler (SensoQuest, Germany) in compatibility to GeneProof instruction with own modifications. The course of the amplification was prepared according to the following reaction program: UDG decontamination at 37 C for 2 min, initial denaturation at 95 C for 10 min, amplification for 45 cycles (denaturation at 95 C for 5 sec, annealing at 60 C for 40 sec, extension at 72 C for 20 sec) and final extension at 72 C for 2 min. Amplification products were separated on 2% agarose gel (Sigma- Aldrich, Germany) containing ethidium bromide (5µg/1ml; Syngen, USA) during course of electrophoresis at 90V for 80 minutes. Amplicons were visualized by means of UV illumination in Gel Logic System 100 (Kodak Imaging System, Inc., USA). Positive samples were those with amplification products with the length of 120 bp - fragments of 16S rrna gene. Additionally, 168 bp long fragments of internal standard were detected in all samples (Dunaj et al. 2018, Moniuszko et al. 2018). Methods Anaplasma phagocytophilum PCR For A. phagoctytophilum in vitro detection was used a fragment of 16S rdna gene encoding small ribosomal 16S RNA subunit. The course of the amplification was performed on the SensoQuest LabCycler (SensoQuest, Germany) with the Anaplasma PCR kit (Blirt-DNA Gdańsk, Poland). Analysis have been conducted in accordance with the manufacturers instruction by nested type of PCR. In first, PCR-OUT 2 μl of the template DNA isolates was added to 42 μl of the Master Mix with 5 μl of dntps and 1 μl of Taq nova polymerase for final reaction mix volume of 50 μl. First amplification was performed in the following PCR program: initial denaturation at 95 C for 2 min, 40 cycles (denaturation at 94 C for 30 sec, annealing at 55 C for 30 sec, extension at 72 C for 60 sec) and final extension at 72 C for 5 min. In second amplification, PCR-IN, despite DNA isolate to 42 μl of the Master Mix with 5 μl of dntps and 1 μl of Taq nova was added 2 μl of PCR product from first reaction. PCR-IN program follows as in PCR-OUT, but in 30 cycles. Separation of PCR products from both reactions was made on 2% agarose gel (Sigma- Aldrich, Germany) stained with ethidium bromide (5µg/1ml; Syngen, USA), by electrophoresis at 90V for 60 minutes. The results of the PCR were viewed under UV light in Gel Logic System 100 (Kodak Imaging System, Inc., USA). Presence of the 16S rdna gene fragments: 932 bp long in PCR-OUT and 546 bp long in PCR-IN attest to A. phagocytophilum infection. Lack of 932 bp long fragments in PCR-OUT does not exclude a positive result of test (Dunaj et al. 2018, Moniuszko et al. 2018). Methods Babesia species PCR For Babesia spp. protozoa molecular detection was used a fragment of 18S rdna gene, encoding a small ribosomal subunit, localised on conservative region V4. For performed a conventional end-point PCR was used a pair of a high specific primers (Sigma-Aldrich, Germany) (Dunaj et al. 2018, Moniuszko et al. 2016, Katargina et al.2011, Kondrusik 2011, 43

44 Pichon et al. 2006): 18S rdna BAB-F2 sens 5' - GAC ACA GGG AGG TAG TGA CAA G - 3' 18S rdna BAB-R2 antisens 5'- CTA AGA ATT TCA CCT CTG ACA GT - 3'. Amplification was performed by using Taq PCR Core Kit (Qiagen, Germany). To reaction mixture, containing: 5 µl of bufforx10 with 15 mm MgCl 2, 2 µl of 25 mm MgCl 2, 1 µl of 10 mm dntps, 1 µl of 20 µm particular primer sequencing (18S rdna BAB-F2 and 18S rdna BAB-R2) and 0,25 µl (5U/µl) of termostable Taq DNA polymerase, was added 2,5 µl of extracted DNA, for final reacion mix volume of 25 µl. Concentration of startering sequencing and conditions of PCR amplification (temperatures and times of particular reaction steps) were constructed experimentally on SensoQuest LabCycler (SensoQuest, Germany) reportedly on previous methods (Piccolin et al. 2006, Pichon et al. 2006). Amplification was performed in the following PCR program: initial denaturation at 94 C for 3 min, 40 cycles (denaturation at 94 C for 40 sec, annealing at 58 C for 60 sec, extension at 72 C for 60 sec) and final extension at 72 C for 10 min. Separation of PCR products on 2% agarose gel (Sigma- Aldrich, Germany) stained with ethidium bromide (5µg/1ml; Syngen, USA) was made by electrophoresis at 90V for 45 minutes. The results of the PCR were viewed under UV light in Gel Logic System 100 (Kodak Imaging System, Inc., USA). Positive results were approximately 420 bp long fragments of the 18S rdna gene (Moniuszko et al. 2016). For A. phagocytophilum and B. burgdorferi sl and Babesia spp. amplicons detection molecular weight markers (M100-M500, M Blirt S.A. Poland) were used. Methods Bartonella species PCR For Bartonella spp. in vitro diagnostic The Hum PCR BARTONELLA. detection kit (Bioingentech Ltd., Chile) was used. To 2.7µl of HumPCR BARTONELLA Premixture was added 6 µl of Free Water and 2µl of sample DNA or negative control or positive control. In one tube PCR total volume of PCR mixture with template DNA was 10.7 µl. Internal control samples was prepared with 2.7µl of Internal Control Mixture, 6 µl of Free Water and 2µl of sample DNA. To all PCR tubes on the top of mixture should be added 8µl of Mineral Oil. PCR was performed on the SensoQuest LabCycler (SensoQuest, Germany) according to Bioingentech instruction. PCR start with initial denaturation at 94 C for 2 min, was continue with amplification for 30 cycles (denaturation at 94 C for 30 sec, annealing at 57 C for 30 sec, extension at 72 C for 30 sec) and final extension at 72 C for 5 min was on the end of course. Amplification products were separated on 1.5% agarose gel (Sigma- Aldrich, Germany) containing ethidium bromide (5µg/1ml; Syngen, USA) during course of electrophoresis at 100V for 45 minutes. Amplicons were visualized by means of UV illumination in Gel Logic System 100 (Kodak Imaging System, Inc., USA). Positive samples were those with amplification products with the length of 358 bp - fragments of Bartonella spp. gene. Additionally, 140 bp long fragments of internal standard were detected in all samples. Methods Coxiella burnetii PCR The Hum PCR C. burnetiid detection kit (Bioingentech Ltd., Chile) for in vitro diagnostics was used for C. burnetii molecular detection. In one tube PCR for samples and for negative and positive probes to 2.7µl of HumPCR C. burnetii Premixture was added 6 µl of Free Water and 2µl of sample DNA, negative control or positive control. Internal control samples was prepared with 2.7µl of Internal Control Mixture, 6 µl of Free Water and 2µl of sample DNA. Total volume of PCR mixture with template DNA is 10.7 µl. To all PCR tubes on the top of mixture should be added 8µl of Mineral Oil. PCR was performed on the SensoQuest LabCycler (SensoQuest, Germany) in compatibility to Bioingentech instruction: initial denaturation at 94 C for 2 min, amplification for 30 cycles (denaturation at 94 C for 30 sec, annealing at 57 C for 30 sec, extension at 72 C for 30 sec) and final extension at 72 C for 5 min. Amplification products were separated on 1.5% agarose gel (Sigma- Aldrich, Germany) containing ethidium bromide (5µg/1ml; Syngen, USA) during course of electrophoresis 44

45 at 100V for 45 minutes. Amplicons were visualized by means of UV illumination in Gel Logic System 100 (Kodak Imaging System, Inc., USA). Positive samples were those with amplification products with the length of 340 bp - fragments of Coxiella burnetii gene. Additionally, 140 bp long fragments of internal standard were detected in all samples. Methods Rickettsia species PCR For Rikettsia spp. in vitro diagnostic the Vet PCR RICKETTSIA detection kit (Bioingentech Ltd., Chile) was used. One tube PCR was performed with 2.7µl of VetPCR RICKETTSIA Premixture, 6 µl of Free Water and 2µl of matrix DNA from smples or negative control or positive control. Final PCR mixture volume was 10.7 µl. Internal control samples was prepared with 2.7µl of Internal Control Mixture, 6 µl of Free Water and 2µl of sample DNA. To all PCR tubes on the top of mixture should be added 8µl of Mineral Oil. Amplification was performed on the SensoQuest LabCycler (SensoQuest, Germany) according to Bioingentech instruction. PCR start with initial denaturation at 94 C for 2 min, was continue with amplification for 30 cycles (denaturation at 94 C for 30 sec, annealing at 56 C for 30 sec, extension at 72 C for 30 sec) and final extension at 72 C for 5 min was on the end of course. Amplification products were separated on 1.5% agarose gel (Sigma- Aldrich, Germany) containing ethidium bromide (5µg/1ml; Syngen, USA) during course of electrophoresis at 100V for 45 minutes. Amplicons were visualized by means of UV illumination in Gel Logic System 100 (Kodak Imaging System, Inc., USA). Positive samples were those with amplification products with the length of 322 bp - fragments of Rickettsia spp. gene. Additionally, 140 bp long fragments of internal standard were detected in all samples. For C. burnetii and Bartonella spp. and Rickettsia spp. amplicons detection Brig Molecular Weight Warker (Brig, Bioingentech, Chile) were used. RESULTS In 6 ticks collected from roe deers indicated presence of several variety microorganisms, pathogenic as well as potentially nonpathogenic for people. From roe deer from Sienkiewicze collected two males (T1, T2) and female (T3) Dermacentor reticulatus, in which detected: Staphylococcus vitulinis (T1, T2, T3), Pseudomonas fluorescens (T2, T3), Acinetobacter haemolyticus (T1), Rahnella aquatilis (T2), Facklamia hominis (T3), Brevundimonas diminuta (T3), Pseudomonas aeruginosa (T3). From roe deer from Ruszczan localization collected one male (T4), nymph (T5) and female (T6) Dermacentor reticulatus, from which were isolated: Pseudomonas fluorescens (T5, T6), Aeromonas salmonicida (T4, T6), Sphingomonas pancimobilis (T4), Gemella sanguinis (T4), Brevundimonas diminuta (T4), Dermacoccus nishinomiyaensis (T4), Granulicatella elegans (T5), Candida zeylanoides (T6) Gemella bergeri (T6). There were any detection of Borrelia burgdorferi sl, A. phagocytophilum, C. burnetti, Bartonella spp., Rickettsia spp., Babesia spp. DNA in samples extracted from analyzed D. reticulatus ticks. DISCUSSION According to preliminary study on D. reticulatus polish ticks microbiome reveal presence of microorganisms, which are isolated from environment sporadically, and have potentially medical meaning for human beings, especially for elderly, week and ill people. According to Földvári et al. (Földvári et al. 2016) diseases agent list of pathogens include 40 microorganisms isolated from D. reticulatus during years. While Czech researchers cultured additionally 38 bacterial strains with mainly medical and veterinary unknown meaning (Rudolf et al. 2009) what we can observed also in our preliminary study. In one tick we detected Pseudomonas aeruginosa Gram-negative bacterium mainly lives in soil, water and plant surface, rarely on animal skin, very rarely skin of immunocompetent people. It is capable to produce colors. It is an opportunistic pathogen, especially dangerous for non-immunocompetent people and it s a great dangerous when causes inside hospital 45

46 infections because of its high resistance to most of antibiotics. P. aeruginosa might create biofilms complicated microcolonies attached to different surfaces (Winstanley and Fothergill 2009, Harrison et al. 2006). Next to Pseudomonas aeruginosa we detected in four ticks Pseudomonas fluorescens a common Gram-negative rod-shaped bacterium and can be found in soil and in water. P. fluorescens culture is a source of antibiotic mupirocin, which might be used for methicillinresistant Staphylococcus aureus strains during infection. P. fluorescens is an unusual cause of disease in humans, and usually affects patients with compromised immune systems, because it is demonstrates hemolytic activity, and as a result, has been known to infect blood transfusions (Čapla et al. 2012, Gershman et al. 2008). In the three ticks from the same localization was isolated Staphylococcus vitulinis a Gram-positive, coagulase-negative bacterium from Staphylococcus genus. Originally it is found in food, especially meet (beef, chicken, lamb or others) and animals (mainly mammals, such as horses, but also voles or whales) (Svec 2004, Webster et al.1994). In two ticks from Ruszczany area was detected Aeromonas salmonicida, which is a pathogenic but especially for fish Gram-negative, facultatively anaerobic, nonmotile bacterium. It has a variety of hosts, multiply, and adapt, make it a prime virulent bacterium (Staley et al. 2001). A. salmonicida is an etiological agent for furunculosis, a disease that causes septicemia, haemorrhages, muscle lesions, inflammation of the lower intestine, spleen enlargement, and death in freshwater fish populations. The main cause of A. salmonicida infection is poor water condition. It is airborne pathogen, can travel 104 cm from its host into the atmosphere and back to the water. In freshwater conditions for 6 9 months can survive without a host, as well as in saltwater conditions for up to 10 days (Reith et al. 2008, Staley et al. 2001). In two ticks from different localization we isolated Brevundimonas diminuta Gramnegative, non-fermenting aerobic bacilli. Originally it was classified under the genus Pseudomonas and Seger re-classified this ubiquitous in the environment but are rarely isolated from clinical samples bacterium. What is interesting, according to some research B. diminuta is one of few bacteria which might survive in conditions similar to those in Mars without high reduction of its population (Ryan and Pembroke 2018, Menuet et al. 2008). In one tick was found Acinetobacter haemolyticus a Gram-negative bacterium widely distributed in nature, and commonly occur in soil and water. Their ability to survive on moist and dry surfaces, as well as to survive exposure to various common disinfectants, allows some Acinetobacter species to survive in a hospital environment, what might be especially dangerous for non-immunocompetent people. Often cause nosocomial infections and what is more important this pathogen is resistant to many types of antibiotics, including penicillin, chloramphenicol, and often aminoglycosides (Doughari et al. 2011, Falagas et al. 2007). There was in one tick also isolated a relatively rare Gram-negative bacteria - Rahnella aquatilis, which is isolated from fresh water, soil, animals (snails), certain beetles and also from human specimens (Broberg et al. 2018, Briones-Roblero et al. 2017). R. aquatilis is pathogenic in humans can be cause of life-threatening infections in infants and adults immunocompromised and organ transplant recipients (Martins et al. 2015, Chang et al. 1999). Various infections, such as bacteremia (from renal infection), sepsis, respiratory infection, and urinary tract infection can be the result. In literature one of the first R. aquatilis case involved an 11-month-old girl with endocarditis (Matsukara et al. 1996) and example of infection a 76- year-old male who had prostatic hyperplasia presenting with acute pyelonephritis (Tash 2005). Facklamia hominis is a Gram-positive, catalase-negative cocci which is hard to distinguish with other bacteria, which was isolated in one of our tick. Microorganism is isolated warm blooded animals and from variety environmental sources. this organism has been implicated in invasive infections and isolated from the blood, bone, gallbladder, and CSF of patients (Parvataneni et al. 2015). 46

47 Sphingomonas paucimobilis is an aerobic Gram-negative soil bacillus that has a single polar flagellum with slow motility, commonly present in environment and in hospital areas. It has been implicated in various types of clinical infection especially in heavy state patients, but rarely with serious course (Bulut et al. 2008). In our ticks we isolated two species of Gemella which was first described as Neisseria hemolysans and in 1960 was reclassified. They are facultatively anaerobic Gram-positive bacteria and give negative reactions to both oxidase and catalase tests. Gemella bacteria are primarily found in the mucous membranes of humans and animals, particularly in the oral cavity and upper digestive tract. About 15 cases of human endocarditis was so far detected, mainly in men with underlying valvular disease and with problematic dental manipulation. In one tick was found G. bergeri and in second G. sanguinis both pathogenic to humans, mostly causing endocarditis (Yang et al. 2014, Gundre et al. 2011). There was also found in one tick Granulicatella elegans a catalase-negative, oxidasenegative, nonmotile, facultative anaerobic gram-positive bacterium, firstly described in 1998 as a member of a family of nutritionally variant streptococci (NVS) - originally known as Abiotrophia elegans ( Roggenkamp et al. 1998). This batecterium might be a natural part of oral microflora (Aas et al. 2005), but also was isolated from patients with infective endocarditis (Gonzales-Martin et al. 2011) and from nosogastrict tract of neonates, and from the vaginal tract of healthy women (Yamamoto et al. 2009). Another but non-pathogenic for human environmental bacteria called Dermacoccus nishinomiyaensis was isolated from one of our ticks. It is found usually in water and on the skin of mammals. D. nishinomiyaensis is a species of aerobic, Gram positive, cocci shaped bacterium in the phylum Actinobacteria. This species is catalase, urease and oxidase positive, coagulase negative (Klein et al. 2017). Not only bacteria were found in microbiome of analyzed ticks there was also in one of D. reticulatus isolated Candida zeylanoides. This fungi was so far found in human beings in Germany, Italy, Finland and Norway and has a pathogenic meaning especially with nonimmunocompetent patients, such as oncological or hemato-oncological ones (Antohe I. et al. 2015). It was also isolated from environment (sea water from Pacific Ocean), animals (skin of dog in Austria, skin of a blue dolphin in Atlantic Ocean) and food (beef in Australia, sausage in Spain) (Liu et al. 2014). CONCLUSIONS Conducted pilot study on polish ticks, collected from hunted wild animals, microbiome indicates on a presence and co-existence of many and variety microorganisms, also those pathogenic and those with potentially pathogenic meaning for people. Possibility of eventual transmission during tick feeding on human, especially in immuno-non-competent people, might be connected with non-standard infection course. LITERTURE 1. Aas J.A., Paster B.J., Stokes L.N., Olsen I., Dewhirst F.E Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43: Antohe I., Dascalescu A., Butura G., Mertcariu A., Danaila C., Bilavski K., Zlei M., Cianga P Concomitant invasive pulmonary aspergilosis and Candida zeylanoides bloodstream infection in an acute myeloblastic leukemia patient. Archive of Clinical Cases. 2(3): Broberg M., Doonan J., Mundt F., Denman S., McDonald J.E Integrated multiomic analysis of host-microbiota interactions in acute oak decline. BioMed Central 6:21:

48 4. Briones-Roblero C. I., Hernandez-Garcia J. A., Gonalez-Escobedo R., Soto-Robles L. V., Rivera Orduna F. N Structure and dynamics of the gut bactrial microbiota of the bark beetle, Dendroctonus rhizophagus (Curculionidae: Scolytinae) across their life stages. PLoS ONE 12(4): e Buczek A Atlas pasożytów człowieka. Fundacja na Rzecz Zwalczania Kleszczy, Lublin. 6. Buczek A., Bartosik K., Zając Z., Stanko M Host-feeding behavior of Dermacentor reticulatus and Dermacentor marginatus in mono-specific and inter-specific infestations. Parasite and Vectors. 8: Bulut C., Yetkin M.A., Koruk S.T., Erdinç F.S., Karakoç E.A A rare cause of nosocomial bacteremia: Sphingomonas paucimobilis. Mikrobiyoloji bülteni. 4 (42): Čapla J., Zajác P., Bajzík P., Zeleňáková L Sanitation process optimization in relation to the microbial biofilm of Pseudomonas fluorescens. Journal of Microbiology, Biotechnology and Food Sciences. Special issue: Chang C. L., Jeong J., Shin J. H., Lee E. Y., Son H. C Rahnella aquatilis sepsis in an immunocompetent adult. Journal of Clinical Microbiology. 37(12): Doughari H.J., Ndakidemi P.A., Human I.S., Benade S The ecology, biology and pathogenesis of Acinetobacter spp.:an overview. Microbes and Environments. 26 (2): doi: /jsme2.me PMID Dunaj J., Moniuszko-Malinowska A., Swiecicka I., ; Andersson M., Czupryna P., Rutkowski K., Zambrowski G., Zajkowska J., Grygorczuk S., Kondrusik M., Świerzbińska R., Pancewicz S Tick-borne infections and co-infections in patients with non-specific symptoms in Poland. Advances in Medical Science 63(1): Online 7 th November 2017; DOI: /j.advms Falagas M.E., Karveli E.A., Kelesidis I., Kelesidis T Community acquired Acinetobacter infections. European Journal Clinical Microbiology and Infectious Diseases. 26: doi: /s Földvári G., Rigó K., Lakos A Transmission of Rickettsia slovaca and Rickettsia raoultii by male Dermacentor marginatus and Dermacentor reticulatus ticks to humans. Diagnostic Microbiological Infecrtious Diseases. 76: Földvári G., Široký P., Szekeres S., Majoros G., Sprong H Dermacentor reticulatus: a vector on the rise. Parasite and Vectors. 9:314: DOI: /s x. 15. Gershman M.D., Kennedy D.J., Noble-Wang J Multistate outbreak of Pseudomonas fluorescens bloodstream infection after exposure to contaminated heparinized saline flush prepared by a compounding pharmacy. Clinical Infectious Diseases. 47 (11): Gonzales-Marin C., Spratt D.A., Millar M.R., Simmonds M., Kempley S.T., Allaker R.P Levels of periodontal pathogens in neonatal gastric aspirates and possible maternal sites of origin. Molecular Oral Microbiology. 26: Gundre P. Pascal W. Abrol S. Kupfer Y. Tessler S Prosthetic valve endocarditis caused by Gemella sanguinis: a consequence of persistent dental infection. The American Journal of the Medical Sciences. 341 (6): Harrison F., Browning L.E., Vos M., Buckling A Cooperation and virulence in acute Pseudomonas aeruginosa infections". BMC Biology. 4: Katargina O., Geller J., Vasilenko V., Kuznetsova T., Järvekülg, Vene S., Lundkvist A., Golovljova I Detection and characterization of Babesia species in Ixodes ticks in Estonia. Vector Borne Zoonotic Dis. 11(7):

49 20. Klein B. A., Lemon K. P., Gajare P., Jospin G., Eisen J. A., Coil D.A Draft Genome Sequences of Dermacoccus nishinomiyaensis Strains UCD-KPL2534 and UCD-KPL2528 Isolated from an Indoor Track Facility.Genome Announcement. 5(8): doi: /genomeA Kondrusik M Analiza ryzyka zachorowania na choroby przenoszone przez kleszcze na terenie Polski północno-wschodniej. Ocena wpływu czynników środowiskowych na sytuację epidemiologiczną w regionie w latach 2006, 2007, Rozprawa habilitacyjna. Uniwersytet Medyczny w Białymstoku, Białystok. 22. Liu P., Li B., Yin R Development and evaluation of ITS- and aflp-based LAMP assays for rapid detection of Aspegillus flavus in food samples. Canadian Journal of Microbiology. 60(9): Martins W., Carvalhaes C. G., Cayo R., Gales A. C., Pignatari A. C Cotransmission of Rahnella aquatilis between hospitalized patients. Brazilian Journal of infectious diseases. 19(6): Matsukara H., Katayama K., Kitano N., Kobayashi K., Kanegane C., HigudhiA., Kyotni S Infective endocrditis caused by an unusual gram-negative rod, Rahnella aquatilis. Pediatric Cardiology. 17: Menuet M., Bittar F., Stremler N First isolation of two colistin-resistant emerging pathogens, Brevundimonas diminuta and Ochrobactrum anthropi, in a woman with cystic fibrosis: a case report. Journal of Medical Case Rep. 2:373. doi: / Moniuszko-Malinowska A., Święcicka I, Dunaj J., Zajkowska J. M., Czupryna P., Zambrowski G., Chmielewska-Badora J., Żukiewicz-Sobczak W., Świerzbińska R., Rutkowski K., Garkowski A., Pancewicz S Infecion with Babesia microti in humans with non-specific symptoms in North-East Poland. Infectious Diseases (London). 48(7): ; DOI: / Moniuszko A., Dunaj J., Święcicka I., Zambrowski G., Chmielewska-Badora J., Żukiewicz-Sobczak W., Zajkowska J., Czupryna P., Kondrusik M., Grygorczuk S., Świerzbińska R., Pancewicz S Co-infections with Borrelia species, Anaplasma phagocytophilum, and Babesia spp. in patients with Tick-borne encephalitis. European Journal of Clinical Microbiology and Infectious Diseases. 33: Narasimhan S., Fikrig E Tick microbiome: the force within. Trends in Parasitology. 31(7): Obsomer V., Wirtgen M., Linden A., Claerebout E., Heyman P., Heylen D Spatial disaggregation of tick occurrence and ecology at local scale as a preliminary step for spatial surveillance of tick-borne diseases: general framework and health implications in Belgium. Parasite and Vectors. 6: Parvataneni, K. C., Iyer, S., Khatib, R., & Saravolatz, L. D Facklamia Species and Streptococcus pneumoniae Meningitis: A Case Report and Review of the Literature. Open Forum Infectious Diseases, 2(2), ofv Piccolin G., Benedetti G., Doglioni C., Lorenzato C., Mancuso S., Papa N., Pitton L., Ramon M. C., Zasio C., Bertiato G A study of the presence of Borrelia burgdorferi, Anaplasma (previously Ehrlichia) phagocytophilum, Rickettsia, and Babesia in Ixodes ricinus collected within the territory of Belluno, Italy. Vector Borne Zoonotic Dis. 6(1): Pichon B., Kahl O., Hammer B., Gray J. S Pathogens and host DNA in Ixodes ricinus nymphal ticks from a German forest. Vector Borne Zoonotic Dis. 6(4): Reith M., Singh R., Curtis B., Boyd J., Bouevitch A The genome of Aeromonas salmonicida subsp. salmonicida A449: insights into the evolution of a fish pathogen. BMC Genomics. 9 (427): Roggenkamp A., Abele-Horn M., Trebesius K.H., Tretter U., Autenrieth I.B., Heesemann J Abiotrophia elegans sp. nov., a possible pathogen in patients with culture-negative endocarditis. Journal of Clinical Microbiology. 36:

50 35. Rubel F., Brugger K., Pfeffer M., Chitimia-Dobler L., Didyk Y.M., Leverenz S Geographical distribution of Deracentor marginatus and Dermacentor reticulatus in Europe. Tick and Tick-Borne Diseases. 7: Rudolf I., Mendel J., Sikutová S., Svec P., Masaňiková J., Nováková D SrRNA gene-based identification of cultured bacterial flora from host-seeking Ixodes rcinus, Dermacentor reticulatus and Haemaphysalis concinn ticks, vectors of vertebrate pathogens. Folia Microbiologica (Praha). 54: Ryan M. P. Pembroke J.T. (2018). Brevundimonas spp: Emerging global opportunistic pathogens,.virulence. 9 (1): , DOI: / Šimo L., Kocáková P., Sláviková M Dermacentor reticulatus (Acari, Ixodidae) female feeding in laboratory. Biol. Bratislava. 59: Staley J. T., Garrity G. M. Boone D. R., Castenholz R. W., Don J. B. Krieg, Noel R Bergey's manual of systematic bacteriology. Berlin: Springer. 40. Svec P Reclassification of Staphylococcus pulvereri Zakrzewska-Czerwinska et al as a later synonym of Staphylococcus vitulinus Webster et al International Journal of Systematic and Evolutionary Microbiology. 54 (6): Tash K Rahnella aquatilis bacteremia from a suspected urinary source. Journal of Clinical Microbiology. 43(5): Webster, J. A., Bannerman T. L. Hubner R. J., Ballard D. N., Cole E. M., Bruce J. L., Fiedler F., Schubert K., Kloos W. E Identification of the Staphylococcus sciuri Species Group with Eco RI Fragments Containing rrna Sequences and Description of Staphylococcus vitulus sp. nov. International Journal of Systematic Bacteriology. 44 (3): Winstanley C., Fothergill J.L The role of quorum sensing in chronic cystic fibrosis Pseudomonas aeruginosa infections". FEMS Microbiology Letters. 290 (1): 1 9. d 44. Yamamoto T., Zhou X., Williams C.J., Hochwalt A., Forney L.J Bacterial populations in the vaginas of healthy adolescent women. Journal of Pediatric Adolescent Gynecology. 22: Yang C.H., Tsai K.T Gemella sanguinis endocarditis: first case report in Taiwan and review of the literature. Journal of the Formosan Medical Association. 113 (8): doi: /j.jfma PMID

51 Koinfekcje Babesia microti i Borrelia burgdorferi sensu lato w kleszczach z terenu województwa śląskiego w latach Marta Albertyńska 1,2, Beata Rozwadowska 1,2, Agnieszka Kubala 1, Krzysztof P. Jasik 2 1Wojewódzka Stacja Sanitarno-Epidemiologiczna w Katowicach, ul. Raciborska 39, Katowice, malbertynska@yahoo.pl 2Zakład Badań Strukturalnych Skóry, Katedra Kosmetologii, Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, Śląski Uniwersytet Medyczny w Katowicach, ul. Kasztanowa 3, Sosnowiec Co-infections with Babesia microti and Borrelia burgdorferi sensu lato in ticks from the Silesian Province in the years Abstract The aim of the study was to assess the occurrence of co-infection with microorganisms pathogenic to humans: Babesia microti and Borrelia burgdorferi sensu lato, in ticks from the Silesian Province acquired in Material and methods. The analysis was conducted on 170 ticks from patients from the Silesian Province. All ticks were tested to detect the presence of genetic material of B. microti and B. burgdorferi s.l. by real time PCR. Results. In 50 isolates, the genetic material of B. burgdorferi s.l. was found, which constituted 29.4% of all tested samples. B. microti was detected in 8 samples (4.7%): in 3 ticks from 2015, 4 ticks from 2016 and 1 tick from It was shown that the co-infection B. microti and B. burgdorferi s.l. was detected in 6 samples. Conclusions. The research confirmed the possibility of tick-borne infection of B. microti in the region of Silesia. Co-infection with B. microti and B. burgdorferi s.l. in ticks has been demonstrated which confirms the risk of transfer of both pathogens to humans. Key words: Babesia microti, Borrelia burgdorferi sensu lato, co-infection, real time PCR, The Silesian Province. Wstęp Kleszcze są pasożytami ssącymi krew, zaliczanymi do typu stawonogów. Ich znaczenie medyczne polega na przenoszeniu patogenów wielu chorób odzwierzęcych mogą być zarówno rezerwuarem jak i wektorem tych patogenów. W Polsce do najczęściej transmitowanych należą Borrelia burgdorferi sensu lato oraz wirus kleszczowego zapalenia opon mózgowych i mózgu, a także Babesia spp., Ehrlichia spp., Bartonella spp., Anaplasma phagocytophilum, Francisiella tularensis, Coxiella burnetii oraz Rickettsia spp. i Candidatus Neoehrlichia micurensis (Wójcik-Fatla i wsp. 2009, Chmielewski i wsp. 2011, Szlendak 2013). Pierwotniaki z rodzaju Babesia pasożytują w erytrocytach kręgowców i odpowiedzialne są za wywoływanie babeszjozy (piroplazmozy) - pasożytniczej choroby odkleszczowej (Berman 2012). Ze względu na znaczący wzrost zachorowań w ostatnich latach, babeszjoza zaliczana jest do grupy tzw. odkleszczowych chorób rozprzestrzeniających się, ang. emerging tick-borne diseases (Kjemtrup i Conrad 2000, Siński i Welc-Falęciak 2012, Rożej- Bielicka i wsp. 2015). Rodzaj Babesia to około 110 gatunków patogennych dla wielu 51

52 kręgowców, przy czym znaczenie chorobotwórcze dla człowieka wykazano dla czterech gatunków: B. divergens, B. microti, B. duncani oraz B. venatorum (Karbowiak 2004, Rożej-Bielicka i wsp. 2015). Zakażenie babeszjozą następuje w wyniku ukłucia przez zarażonego kleszcza, na drodze transfuzji poprzez zarażoną krew oraz preparaty krwiopochodne lub w wyniku przeszczepienia narządu, w którym obecny jest pierwotniak (Young i Krause 2009, Leiby 2011, Herwaldt i wsp. 2012). Możliwa jest również transmisja przezłożyskowa, związana z przeniesieniem patogenu z zarażonej matki na płód, u którego stwierdza się następnie wystąpienie babeszjozy wrodzonej (Fox i wsp. 2006). Choroba może przebiegać bezobjawowo, łagodnie (objawy grypopodobne przypominające malarię) lub ciężko, w zależności od stanu odporności gospodarza (Krause i wsp. 2007, Vannier i Krause 2009, Vannier i Krause 2012). Badania wykazały, że u około 25% zarażonych osób dorosłych i 50% dzieci, babeszjoza występuje w postaci bezobjawowej, może prowadzić do samowyleczenia, lub przechodzi w fazę utajoną. Dotyczy to osób z prawidłowo wykształconym układem odpornościowym (Krause 2003, Krause i wsp. 2007). Bezobjawowe nosicielstwo może być źródłem zarażenia w przypadku, gdy nosiciel zostaje dawcą krwi. Pierwsze objawy babeszjozy pojawiają się po okresie inkubacji, który może trwać od 1 do 4 tygodni od pokłucia przez kleszcza lub nawet do 9 tygodni w przypadku przekazania pierwotniaka na drodze transfuzji krwi (Young i Krause 2009, Herwaldt i wsp. 2011). U zarażonej osoby pojawiają się początkowo niespecyficzne objawy ogólne, takie jak złe samopoczucie i zmęczenie, wysoka gorączka, której często towarzyszą dreszcze i poty, bóle głowy, mięśni i stawów. Wśród rzadszych objawów wymienia się światłowstręt, nudności, wymioty, bóle brzucha i gardła, a także przeczulicę, niestabilność emocjonalną i depresję (Leiby 2011, Akel i Mobarakai 2017). W badaniu klinicznym stwierdza się powiększenie śledziony i wątroby, stan zapalny gardła, żółtaczkę (Skotarczak 2007). U chorych obserwuje się niedokrwistość hemolityczną. Możliwe są powikłania w postaci uszkodzenia nerek, wątroby oraz śledziony, a także koagulopatia wewnątrznaczyniowa, niewydolność serca, niewydolność oddechowa oraz zapalenie ośrodkowego układu nerwowego (Vannier i wsp. 2008). Krętki Borrelia burgdorferi sensu lato to mikroaerofilne bakterie gram-ujemne, będące czynnikiem etiologicznym boreliozy z Lyme. Bakterie zostały po raz pierwszy wyizolowane z jelita kleszczy w 1982 r. przez Willy ego Burgdorfera (Burgdorfer i wsp. 1982). W przebiegu boreliozy z Lyme wyróżnia się trzy stadia. W pierwszym etapie mamy do czynienia z boreliozą wczesną miejscową, charakteryzującą się wystąpieniem zakażenia miejscowego w postaci rumienia wędrującego, często z towarzyszącymi objawami grypopodobnymi. Kolejne stadium boreliozy wczesnej rozsianej - narządowej, dotyczy zakażenia występującego w różnych układach zapalenie układu nerwowego, zapalenie stawów, zapalenie mięśnia sercowego. Ostatnie stadium czyli borelioza późna rozsiana to szereg objawów ze strony zajętych układów, pojawiających się po około 6 miesiącach od zakażenia: późna postać stawowa, późna neuroborelioza, przewlekłe zanikowe zapalenie skóry kończyn (Chmielewski i wsp. 2014). Dotychczas opisano 19 genogatunków należących do kompleksu B. burgdorferi s.l., w tym 9 uważanych jest za patogenne dla człowieka: B. burgdorferi sensu stricto, B. afzelii, B. garinii, B. bavariensis, B. bissettii, B. lusitaniae, B. spielmanii, B. valaisiana, B. finlandensis (Michalik i Zajkowska 2013). W Europie najczęściej występują B. burgdorferi sensu stricto, B. afzelii i B. garinii. Współwystępowanie w kleszczach mikroorganizmów chorobotwórczych dla człowieka wiąże się z ryzykiem koinfekcji u pacjentów. Współzakażenia mogą zmieniać przebieg choroby poprzez nasilenie jej objawów oraz wydłużenie procesu leczenia. Celem projektu była ocena występowania koinfekcji patogennymi dla człowieka mikroorganizmami: B. microti oraz B. burgdorferi s.l. w kleszczach z terenu województwa śląskiego, pozyskanych w latach

53 Materiał i metody Materiał do badań stanowiły kleszcze pozyskane w latach od pacjentów z terenu województwa śląskiego. Były to osobniki dorosłe, larwy oraz nimfy. Wszystkie kleszcze wykorzystane w badaniach dostarczone zostały w całości. Ekstrakcję materiału genetycznego poszukiwanych patogenów przeprowadzono przy użyciu zestawów do izolacji AmpliSens RIBO prep (InterLabService, Moskwa, Rosja). Do izolacji materiału genetycznego zastosowano odpowiednią procedurę izolacji zgodnie z zaleceniami producenta zestawu. W celu wykrycia materiału genetycznego B. microti użyto specyficzne startery i sondy oraz enzym i bufory do reakcji amplifikacji w czasie rzeczywistym. Łańcuchową reakcję polimeryzacji w czasie rzeczywistym przeprowadzono w termocyklerze LightCycler 2.0 firmy Roche przy użyciu odpowiedniej pary starterów (5 - CAGGGAGGTAGTGACAAGAAATAACA-3 i 5 -GGTTTAGATTCCCATCATTCCAAT-3 ; Pracownia Sekwencjonowania DNA IBB PAN, Warszawa, Polska) oraz sondy (5-6FAM- TACAGGGCTTAAAGTCT-BBQ; TIB MOLBIOL, Berlin, Niemcy). Kontrolę dodatnią stanowiło DNA B. microti. Do reakcji real time PCR wykorzystano zestaw LightCycler TaqMan Master (Roche Diagnostics, Mannheim, Niemcy). Reakcję przeprowadzono przy następujących parametrach: 1 cykl pre-inkubacja 95 C przez 10 min.; 45 cykli amplifikacja denaturacja 95 C przez 10 sek., annealing 60 C przez 30 sek., elongacja 72 C przez 1 sek.; 1 cykl chłodzenie 40 C przez 30 sek. Reakcja odwrotnej transkrypcji wyizolowanego RNA B. burgdorferi s.l. została przeprowadzona w celu uzyskania cdna wykorzystanego w reakcji amplifikacji w czasie rzeczywistym. Proces odwrotnej transkrypcji przeprowadzono z wykorzystaniem zestawu AmpliSens REVERTA L (InterLabService, Moskwa, Rosja). Procedurę przeprowadzono zgodnie z zaleceniami producenta zestawu. Wykrywanie materiału genetycznego B. burgdorferi s.l. przeprowadzono przy użyciu termocyklera LightCycler 480 II firmy Roche z wykorzystaniem zestawu AmpliSens TBEV, B. burgdorferi s.l., A. phagocytophilum, E. chaffeensis / E. muris-frt PCR Kit (InterLabService, Moskwa, Rosja). Reakcję amplifikacji przeprowadzono zgodnie z zaleceniami producenta zestawu.. Wyniki W projekcie przeanalizowano 170 kleszczy pochodzących od pacjentów z województwa śląskiego, zebranych w latach Stwierdzono obecność materiału genetycznego B. burgdorferi s.l. oraz B. microti. W 50 przebadanych kleszczach potwierdzono obecność materiału genetycznego B. burgdorferi s.l., co stanowiło 29,4% wszystkich przebadanych osobników. W kolejnych latach procentowy udział kleszczy zakażonych B. burgdorferi s.l. wynosił: 28,2% w 2015 roku, 31,3% w 2016 roku i 29,5% w roku Materiał genetyczny pierwotniaka B. microti wykryto łącznie w 8 izolatach (4,7%), z czego 3 próbki pochodziły z 2015 roku, 4 z 2016 i 1 z roku Wystąpienie koinfekcji B. microti i B. burgdorferi s.l. stwierdzono w 6 z przebadanych kleszczy, co stanowiło 3,5% wszystkich próbek (tab. I.). Dyskusja Kleszcze są wektorem licznych mikroorganizmów patogennych dla człowieka. Do najczęściej przenoszonych należy B. burgdorferi s.l. Borelioza z Lyme jest na pierwszym miejscu wśród chorób odkleszczowych w Polsce, w tym również wśród chorób zawodowych (Szadkowska-Stańczyk i Kozajda 2014). Przedstawione wyniki badań kleszczy zebranych w latach wykazały częstość występowania B. burgdorferi s.l. na poziomie około 30%. 53

54 Badania prowadzone przez Stańczak i wsp. na terenie Katowic wykazały obecność krętków B. burgdorferi s.l. w 37,5% kleszczy (Stańczak i wsp. 2000). W badaniach przeprowadzonych przez Asmana i wsp. w rejonie Beskidu Żywieckiego stwierdzono aż 62% kleszczy z krętkami B. burgdorferi s.l. oraz 25-30% zakażonych kleszczy w Gminie Jeleśnia (Asman i wsp. 2012, Asman i wsp. 2013). W innych badaniach wykonanych przez Asmana i wsp. infekcję krętkami B. burgdorferi s.l. wykazano jedynie w 1,7% kleszczy zebranych na terenie Żywieckiego Parku Krajobrazowego (Asman i wsp. 2014). Badania prowadzone na kleszczach zebranych z różnych terenów Polski wykazały różną częstość zarażenia kleszczy. Wyniki badań prowadzonych przez Gałęziowską i wsp. w latach wykazały, że wśród wszystkich przebadanych kleszczy pochodzących z terenu Polski, 15,3% było zainfekowanych B. burgdorferi s.l. W analizach wykazano, że najwięcej zakażonych kleszczy pochodziło z południowo-zachodniej części Polski, natomiast najniższy procent dotyczył kleszczy z południowej i centralnej Polski (Gałęziowska i wsp. 2018). W naszych wcześniejszych badaniach wykazano, że B. burgdorferi s.l. jest najczęstszym patogenem występującym w kleszczach z terenu województwa śląskiego, spośród analizowanych (Rozwadowska i wsp. 2014, Albertyńska i wsp. 2016). Stwierdzono również występowanie w kleszczach koinfekcji różnymi genogatunkami B. burgdorferi s.l. (Rozwadowska i wsp. 2013). Patogenne piroplazmy przenoszone przez kleszcze to B. divergens, B. microti i B. venatorum (Gray i wsp. 2002). Najwięcej udokumentowanych przypadków ludzkiej babeszjozy związanych było z zarażeniem B. microti i B. divergens (Karbowiak 2004, Rożej- Bielicka i wsp. 2015). B. microti jest czynnikiem etiologicznym największej liczby przypadków ludzkiej babeszjozy na świecie (Sawczuk 2006, Teal i wsp. 2011). W Europie większość przypadków ludzkiej babeszjozy dotyczyło zarażenia B. divergens, jednakże literatura podaje również przypadki inwazji B. microti. Welc-Falęciak i wsp. opisali w swoich badaniach z 2011 roku dwa przypadki zarażenia B. microti w Polsce (Welc-Falęciak i wsp. 2015). Liczne badania wykazały obecność gatunku B. microti w kleszczach zebranych na terenie Polski (Skotarczak i Cichocka 2001, Siński i wsp. 2006, Wójcik-Fatla i wsp. 2006, Welc-Falęciak i wsp. 2012, Kiewra i wsp. 2014, Pawełczyk i wsp. 2014, Asman i wsp. 2015). Przeprowadzone badania molekularne kleszczy wykazały obecność koinfekcji B. microti i B. burgdorferi s.l. na poziomie 3,5% przebadanych osobników. Koinfekcję tymi patogenami wykazali również inni badacze (Wójcik-Fatla i wsp. 2009, Asman i wsp. 2014). Stwierdzono również występowanie podobnych koinfekcji u pacjentów (Moniuszko i wsp. 2014, Knapp i Rice 2015, Panczuk i wsp. 2016). Krause i wsp. wykazali występowanie współzakażeń u 39% przebadanych pacjentów. Najczęściej występowały koinfekcje Borrelia spp. i Babesia spp. oraz Borrelia spp. i A. phagocytophilum (Krause i wsp. 2002). U pacjentów z terenu Śląska również stwierdzono współzakażenie B. burgdorferi i A. phagocytophilum oraz B. burgdorferi i Babesia spp. (Welc-Falęciak i wsp. 2010). Koinfekcje stają się poważnym problemem epidemiologicznym i klinicznym, ponieważ metody leczenia chorób zakaźnych powodowanych przez różne patogeny kleszczowe różnią się od siebie. Ponadto współzakażenie gatunkami Babesia spp. i Borrelia spp. może wpływać na przebieg kliniczny choroby, szczególnie u pacjentów z obniżoną odpornością. Dodatkowo obie infekcje charakteryzują się występowaniem objawów niespecyficznych takich jak gorączka, objawy grypopodobne, zmęczenie, a co za tym idzie mogą być trudne do zdiagnozowania. W diagnostyce chorób odkleszczowych należy zawsze uwzględnić możliwość wystąpienia koinfekcji. Podziękowania Badania były finansowane przez Śląski Uniwersytet Medyczny w Katowicach z umowy numer KNW-2-I35/D/7/N. 54

55 Tab. I. Koinfekcje B. microti oraz B. burgdorferi s.l. potwierdzone metodą real time PCR, w kleszczach z terenu województwa śląskiego w latach (B.b.s.l. B. burgdorferi s.l., B.m. B. microti). Rok Liczba przebadanych kleszczy B.b.s.l. Liczba (%) kleszczy zakażonych B.m. Koinfekcje B.b. s.l. + B.m (28,2) 3 (3,8) 2 (2,6) (31,3) 4 (8,3) 3 (6,3) (29,5) 1 (2,3) 1 (2,3) Ogółem (29,4) 8 (4,7) 6 (3,5) Literatura 1. Akel T., Mobarakai N Hematologic manifestations of babesiosis. Ann Clin Microbiol Antimicrob. 16(6). 2. Albertyńska M., Rozwadowska B., Mendera-Bożek U., Jasik K.P., Okła H., Słodki A., Słodki J., Swinarew A.S., Cieślik-Tarkota R Obecność Borrelia burgdorferi sensu lato, Babesia microti, Anaplasma phagocytophilum, Ehrlichia chaffeensis/ehrlichia muris oraz wirusa kleszczowego zapalenia mózgu i opon mózgowych (TBEV) w kleszczach z terenu woj. śląskiego. W: Buczek A., Błaszak C. (red.), Stawonogi. Zależności w układzie żywiciel ektopasożyt - patogen. Koliber. Lublin: Asman M., Gąsior T., Pająk C., Cuber P., Szilman P, Szilman E., Solarz K Occupational risk of infections with Borrelia burgdorferi sensu lato, B. burgdorferi sensu stricto, B. garinii and B. afzelii in agricultural workers on territory of Beskid Żywiecki (South Poland). W: Buczek A., Błaszak C. (red.), Stawonogi. Znaczenie medyczne i ekonomiczne. Akapit. Lublin: Asman M., Pindel Ł., Solarz K Ryzyko narażenia na kleszcze (Acari: Ixodida) oraz Borrelia burgdorferi sensu lato i Anaplasma phagocytophilum na wybranych terenach Gminy Jeleśnia (Beskid Żywiecki). W: Buczek A., Błaszak C. (red.), Stawonogi. Aspekty medyczne i weterynaryjne. Akapit. Lublin: Asman M., Pindel Ł., Solarz K Ryzyko narażenia zawodowego na krętki Borrelia burgdorferi sensu lato, riketsje Anaplasma phagocytophilum i pierwotniaki Babesia microti na terenie Żywieckiego Parku Krajobrazowego. W: Buczek A., Błaszak C. (red.), Stawonogi. Zagrożenie zdrowia człowieka i zwierząt. Koliber. Lublin: Asman M., Solarz K., Cuber P., Gąsior T., Szilman P., Szilman E., Tondaś E., Matzullok A., Kusion N., Florek K Detection of protozoans Babesia microti and Toxoplasma gondii and their co-existence in ticks (Acari: Ixodida) collected in Tarnogórski district (Upper Silesia, Poland). Ann Agric Environ Med. 22(1): Berman J.J Apicomplexa. W: Berman J.J., Taxonomic Guide to Infectious Diseases. Elsevier: Burgdorfer G., Barbour A.G., Hayes S.F., Benach I.L., Grunwaldt E., Davies E.P Lyme disease: a tick born spirochetosis? Science. 216: Chmielewski T., Andrzejewski K., Mączka I., Fiecek B., Radlińska M., Tylewska- Wierzbanowska S Kleszcze zakażone bakteriami chorobotwórczymi dla człowieka na terenach parków miejskich Warszawy. Przegl Epidemiol. 65: Chmielewski T., Dunaj J., Gołąb E., Gut W., Horban A., Pancewicz S., Puacz E., Szelenbaum-Cielecka D., Tylewska-Wierzbanowska S Borelioza z Lyme. W: Diagnostyka laboratoryjna chorób odkleszczowych. KIDL. Warszawa:

56 11. Fox L.A., Wingerter S., Ahmed A., Arnold A., Chou J., Rhein J., Levy O Neonatal Babesiosis. Case Report and Review of the Literature. Pediatr Infect Dis J. 25: Gałęziowska E., Rzymowska J., Najda N., Kołodziej P., Domżał-Drzewicka R., Rząca M., Muraczyńska B., Charzyńska-Gula M., Szadowska-Szlachetka Z., Ślusarska B., Guty E Prevalence of Borrelia burgdorferi in ticks removed from skin of people and circumstances of being bitten research from the area of Poland, Ann Agric Environ Med. 25 (1): Gray J., von Stedingk L.V., Gürtelschmid M., Granström M Transmission studies of Babesia microti in Ixodes ricinus ticks and gerbils. J Clin Microbiol. 40(4): ). 14. Herwaldt B.L., Linden J.V., Bosserman E., Young C., Olkowska D., Wilson M Transfusion-Associated Babesiosis in the United States: a Description of Cases. Ann Intern Med. 155(8): Herwaldt B.L., Montgomery S., Woodhall D., Bosserman E.A Babesiosis Surveillance - 18 States, Morb Mortal Wkly Rep. 61(27): Karbowiak G Zoonotic reservoir of Babesia microti in Poland. Pol J Microbiol. 53: Kiewra D., Zaleśny G., Czułowska A The risk of infection with Anaplasma phagocytophilum and Babesia microti in Lower Silesia, SW Poland. W: Buczek A., Błaszak C. (red.), Stawonogi. Zagrożenie zdrowia człowieka i zwierząt. Koliber. Lublin: Kjemtrup A.M., Conrad P.A Human babesiosis: an emerging tick-borne disease. Int J Parasitol. 30: Knapp K.L., Rice N.A Human Coinfection with Borrelia burgdorferi and Babesia microti in the united States. J Parasitol Res. 2015: Krause P.J Babesiosis diagnosis and treatment. Vector Borne Zoonotic Dis. 3(1): Krause P.J., Daily J., Telford S.R., Vannier E., Lantos P., Spielman A Shared features in the pathobiology of babesiosis and malaria. Trends Parasitol. 23(12): Krause P.J., McKay K., Thompson C.A., Sikand V.K., Lentz R., Lepore T., Closter L., Christianson D., Telford S.R. Persing D., Radolf J.D., Spielman A Disease-Specific Diagnosis of Coinfecting Tickborne Zoonoses: Babesiosis, Human Granulocytic Ehrlichiosis and Lyme Disease. Clinical Infectious Diseases. 34: Leiby D.A Transfusion-Transmitted Babesia spp.: Bull s-eye on Babesia microti. Clin Microbiol Rev. 24(1): Michalik J., Zajkowska J Ekologiczne uwarunkowania najczęstszych postaci klinicznych boreliozy w Polsce i Europie. W: Buczek A., Błaszak C. (red.), Stawonogi. Aspekty medyczne i weterynaryjne. Koliber. Lublin: Moniuszko A., Dunaj J., Święcicka I., Zambrowski G., Chmielewska-Badora J., Żukiewicz-Sobczak W., Zajkowska J., Czupryna P., Kondrusik M., Grygorczuk S., Swierzbinska R., Pancewicz S Co-infections with Borrelia species, Anaplasma phagocytophilum and Babesia spp. in patients with tick-borne encephalitis. Eur J Clin Microbiol Infect Dis. 33: Panczuk A., Tokarska-Rodak M., Koziol-Montewka M., Plewik D The incidence of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti coinfections among foresters and farmers in eastern Poland. J Vector Borne Dis. 53: Pawełczyk O., Asman M., Solarz K., Jakubas-Zawalska J., Janikowski T., Mazurek U The PCR detection of Anaplasma phagocytophilum, Babesia microti and Borrelia burgdorferi sensu lato in ticks and fleas collected from pets in the Będzin district area (Upper Silesia, Poland) the preliminary studies. W: Buczek A., Błaszak C. (red.), Stawonogi. Zagrożenie zdrowia człowieka i zwierząt. Koliber. Lublin:

57 28. Rozėj-Bielicka W., Stypułkowska-Misiurewicz H., Goła b E Babeszjoza u ludzi. Przegl Epidemiol. 69: Rozwadowska B., Albertyńska M., Hudzik G Ryzyko wystąpienia koinfekcji genogatunkami Borrelia burgdorferi sensu lato na terenie województwa śląskiego. W: Działalność Państwowej Inspekcji Sanitarnej w zakresie zdrowia publicznego na rzecz mieszkańców województwa śląskiego. Katowice: Rozwadowska B., Albertyńska M., Hudzik G., Jasik K. P., Okła H., Słodki A., Słodki J Badania nad występowaniem Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Ehrlichia chaffeensis/e. muris oraz wirusa kleszczowego zapalenia mózgu i opon mózgowych (TBEV) u kleszczy z terenu województwa śląskiego. W: Buczek A., Błaszak C. (red.), Stawonogi. Zagrożenie zdrowia człowieka i zwierząt. Koliber. Lublin: Sawczuk M. Babesia W: Skotarczak B. (red.), Biologia molekularna patogenów przenoszonych przez kleszcze. Wydawnictwo Lekarskie PZWL. Warszawa: Siński E., Bajer A., Welc R., Pawełczyk A., Ogrzewalska M., Behnke J.M Babesia microti: prevalence in wild rodents and Ixodes ricinus ticks from the Mazury Lakes District of North-Eastern Poland. Int J Med Microbiol. 296 Suppl 40: Siński E., Welc-Falęciak R Ryzyko zakażeń przenoszonych przez kleszcze w ekosystemach leśnych Polski. Zarządzanie Ochroną Przyrody w Lasach. 6: Skotarczak B Babeszjoza człowieka i psa domowego; etiologia, chorobotwórczość, diagnostyka. Wiad Parazytol. 53(4): Skotarczak B., Cichocka A Isolation and amplification by polymerase chain reaction DNA of Babesia microti and Babesia divergens in ticks in Poland. Ann Agric Environ Med. 8(2): Stańczak J., Kubica-Biernat B., Racewicz M., Kruminis-Lozowska W., Kur J Detection of three genospecies of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in different regions of Poland. Int J Med Microbiol. 290(6): Szadkowska-Stańczyk I., Kozajda A Choroby zawodowe w Polsce wywoływane przez szkodliwe czynniki biologiczne. Bezpiecz Pr.4: Szlendak E Kleszcze (Acari: Ixodida) występujące w Polsce jako wektory chorób. W: Buczek A., Błaszak C. (red.), Stawonogi. Aspekty medyczne i weterynaryjne. Koliber. Lublin: Teal A.E., Habura A., Ennis J., Keithly J.S., Madison-Antenucci S A New realtime PCR assay for improved detection of the parasite Babesia microti. J Clin Microbiol. 50: Vannier E., Gewurz B.E., Krause P.J Human babesiosis. Infect Dis Clin North Am. 22: Vannier E., Krause P.J Update on Babesiosis. Interdiscip Perspect Infect Dis. 2009: Vannier E., Krause P.J Human Babesiosis. N Engl J Med. 366(25): Welc-Falęciak R., Bajer A., Paziewska-Harris A., Baumann-Popczyk A., Siński E Diversity of Babesia in Ixodes ricinus ticks in Poland. Adv Med Sci. 57(2): Welc-Falęciak R., Hildebrandt A., Siński E Co-infection with Borrelia species and other tick-borne pathogens in humans: two cases from Poland. Ann Agric Environ Med. 17: Welc-Falęciak R., Pawełczyk A., Radkowski M., Pancewicz S.A., Zajkowska J., Siński E First report of two asymptomatic cases of human infection with Babesia microti (Franca, 1910) in Poland. Ann Agric Environ Med. 22(1): Wójcik-Fatla A., Cisak E., Chmielewska-Badora J., Zwoliński J., Buczek A., Dutkiewicz J Prevalence of Babesia microti in Ixodes ricinus ticks from Lublin region (eastern Poland). Ann Agric Environ Med. 13(2):

58 47. Wójcik-Fatla A., Szymańska J., Buczek A Choroby przenoszone przez kleszcze. Część I. Ixodes ricinus jako rezerwuar i wektor patogenów. Zdr Publ. 119 (2): Wójcik-Fatla A., Szymańska J., Wdowiak L., Buczek A., Dutkiewicz J Coincidence of three pathogens (Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti) in Ixodes ricinus ticks in the Lublin macroregion. Ann Agric Environ Med. 16: Young C., Krause P.J The problem of transfusion-transmitted babesiosis. Transfusion. 49:

59 Molecular identification of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from dogs in Olsztyn-city agglomeration Magdalena Szczotko 1, Małgorzata Dmitryjuk 1, Mirosław M. Michalski 2 1Faculty of Biology and Biotechnology, Department of Biochemistry, 2 Faculty of Veterinary Medicine, Department of Parasitology and Invasive Diseases, University of Warmia and Mazury, Michała Oczapowskiego 2, Olsztyn, Poland Abstract Borrelia burgdorferi sensu lato, carried by Ixodida ticks (Acari), is an etiologic factor causing Lyme disease in humans and animals. Aim of this study was to compare the efficiency of three used PCR methods to examine the prevalence of B. burgdorferi s. l. in Ixodes ricinus ticks. For the analysis we used randomly selected, 50 blood-filled female ticks, which were collected from dogs visiting veterinary clinics in the Olsztyn agglomeration in years. The presence of spirochetes DNA was tested by PCR amplification of : ospa, 16S rrna, and fla genes. The prevalence of B. burgdorferi s.l. was different in presented three methods. Positive in each of them were 19 (38%) samples. In 7 cases positive PCR for two genes was obtained (4 fla + ospa; 4 16S + ospa). For 5 positive tests, expression of only the ospa gene has been demonstrated. BLASTn analysis of these sequences showed % identity to B. afzelii species. The highest prevalence of positive PCR for B. burgdorferi s. l. was obtained with the ospa gene, 33 ticks (66%) were PCR positive. For 16S and fla genes, 24 (48%), and 23 (46%) of individuals, were respectively positive. Chi-square ( 2 ) test demonstrated that there`s no significant difference in distribution of infected ticks between three used methods. Introduction Borrelia burgdorferi is a spirochete species that cause Lyme disease. The main vectors of this etiological agent are Ixodes ricinus, Ixodes scapularis and Ixodes persulcatus ticks. The most common species in Poland is I. ricinus (Czubasiewicz et al. 2013, Strzelczyk et al. 2015). Borrelia burgdorferi sensu lato is a complex of 23 genomospecies and genospecies. Nine genospecies have been detected in European I. ricinus ticks (Radzijevskaja et al. 2016, Scott et al. 2017). Only few of them are pathogenic to humans. Borreliosis is the most common tick-borne disease. It has been diagnosed in more than 80 countries (Strzelczyk et al. 2015, Scott et al. 2017). It is multisystem disorder. Bacteria spread nervous system, skin, heart and joints (Czubasiewicz et al. 2013). Every year, in Poland increasing number of disease cases are noticed and clinical relevance is emerging (Błaut- Jurkowska and Jurkowski 2015). The polymerase chain reaction (PCR) has been used in several studies to detect B. burgdorferi in infected animals, patients with borreliosis, I. ricinus ticks and cultured spirochetes. There are a few regions in bacteria`s genome that can be a target for PCR amplification, the most important are genes encoding 16S rrna, flagellin and outer surface protein (Osp) (Nocton et al. 1994, Radulowic et al. 2010, Czubasiewicz et al. 2013). Flagellin gene (fla) encodes the endoflagellar protein which is distinctive to spirochetes. Diversity of this protein is valuable in identifying borreliae (Fukunaga et al. 1996). 16S r RNA gene as a component of the small submit of ribosomes is highly conserved. Because of that, mentioned gene is used as a target sequence for PCR detection of B. burgdorferi (Rollum 2014). OspA gene is located on the linear plasmid. Corresponding protein (outer surface protein A - OspA) may play role in adherence the spirochetes to cells, and invasion and movement B. burgdorferi 59

60 through cells. There is a division of B. burgdorferi s.l. on genospecies due to differences in the structure of this protein (Czubasiewicz et al. 2013) The aim of this study was to compare the efficiency of three methods being used and to examine the prevalence of B. burgdorferi s.l in I. ricinus ticks collected from dogs in Olsztyncity agglomeration. Materials and methods Sample collection For the analysis we used randomly selected, blood-filled female Ixodes ricinus ticks, which were collected from dogs visiting veterinary clinics in the Olsztyn agglomeration in years. Collected ticks were placed in tubes with 70% ethanol until DNA extraction. DNA extraction Total DNA from collected ticks was extracted using the Micro AX TISSUE Gravity (A&A Biotechnology, Gdynia, Poland) according to the manufacturer's protocol. In the first step every tick was dried and crushed using sterile mortar and pestle. Shreded tissues were incubated for 2 hours in 50 o C with proteinase K and lisys buffer. After that DNA was eluted from the colums using elution buffer. PCR conditions The presence of B. burgdorferi s.l DNA was tested by PCR amplification of the three genes: ospa, fla, and 16S. The polymerase chain reaction was performed using three pairs of primers SL1/2, BFL1/2, and P1/2, respectively (Table 1). Positive tick samples were analysed twice. In addition, positive and negative controls were used to each performed PCR. Positive control for fla gene came from DNA Gdańsk (Poland). Positive control samples for ospa gene and 16S gene included puryfied and confirmed by sequencing genomic DNA obtained from previously positive ticks. The 25 l of PCR mixture contained: 12,5 DreamTaq Green PCR Master MIX (Thermo Scientific, Waltham, MA, USA), 9,4 l nuclease-free water, 0,05 l of each primer at concentration of 100 M and 5 of isolated DNA. All reactions were carried out in Mastercycler Nexus (Eppendorf, Hamburg, Germany). PCR conditions for ospa gene were following: 95 o C for 2min, followed by 40 cycles of 95 o C for 30 sec, 62 o C for 90sec, 72 o C for 1 min. The final extending was at 72 o C for 7 min. PCR conditions for 16S gene included: 95 o C for 2min, followed by 40 cycles of 95 o C for 30 sec, 64 o C for 90sec, 72 o C for 1 min. The final extending was at 72 o C for 7 min. PCR conditions for fla gene were following: initial denaturation at 94 o C for 2 min, followed by 40 cycles of 94 o C for 30 sec, 58 oc for 60 sec, 72 o C for 60 sec, the final extension was at 72 o C for 60 sec. 10 l of each amplicon were separated on 1,5% agarose gel stained with ethidium bromide, first at 60V for 10 minutes, then at 100V for 35 minutes using BIO-RAD device (Bio- Rad Laboratories, Inc. California, USA). PCR products were visualized under UV light using G-BOX Syngene (Syngene, Cambridge, Great Britain), equipped with Gene Snap Syngene (Syngene Cambridge, Great Britain). Sequencing Positive samples for only ospa gene were sequenced using Sanger technology at Genomed (Warszawa, Poland). The obtained bi-directional sequences were assembled and analyzed using BLASTn ( to confirm the attachment to the B. burgdorferi s. l. complex. Statistical analysis The analisys of ch-square test ( 2 ) was used to examine the distribution of infected ticks between three used methods. Probability of P < 0,05 was regarded as statistically significant. 60

61 Results During analysis, 50 ticks were tested using three different pairs of primers. The prevalence of B. burgdorferi s.l. was different in presented three methods however 19 (38%) samples were positive in each of them. In 7 cases positive PCR for two genes was obtained (4 fla + ospa; 4 16S + ospa). For 5 positive tests (samples: 6, 26, 28-29, 36, 42), expression of only the ospa gene has been demonstrated (FIG. 1-4). BLASTn analysis of these 5 sequences confirmed the membership of the B. burgdorferi s. l. complex. The obtained sequences were in % identical to the sequences of the Borrelia afzelii ospa gene deposited in the Gene Bank under the accession numbers X and DQ (Table 2). The highest prevalence of positive PCR for B. burgdorferi s. l. was obtained with the ospa gene, 33 ticks (66%) were PCR positive. Slightly less positive results were obtained with the 16S and fla genes, 24 (48%), and 23 (46%) of individuals, respectively (FIG. 1-4). Chi-square ( 2 ) test demonstrated that there`s no significant difference in distribution of infected ticks between 3 used methods ( 2 = 4,88; P = 0.087) Discussion Large number of studies from different parts of the world have shown high prevalence of B. burgdorferi s.l in I. ricinus ticks. In the urban area of Olsztyn-city agglomeration, the environmental potential of ticks increases from one year to another, which results in a high risk of tick-borne diseases for dogs and humans (Michalski 2017). Dogs and cats are considered to be indicators of the presence of ticks in a given area. Although infected dogs are not considered to be a natural reservoir for Borrelia species. But they may be responsible for feeding ticks on them. Dogs might increase human risk of exposure to B. burgdorferi-infected ticks. Therefore, they should be protected from exposure to infected ticks (Mather et al. 1994). Progressive development of molecular biology methods enables immediate detection of pathogens in humans, but also among domestic and farm animals. There are few methods that can be used to examine the prevalence of this spirochete. For the identification of Borrelia species, sequences in both bacterial chromosomes and in plasmids may be used. Many authors have most commonly applied the fragments of plasmid genes encoding surface proteins, mainly OspA and OspC. Another researchers were using more conservative genes in the bacterial chromosome, for example fla gene, encoding flagellin, and DNA encoding rrna in both ribosomal subunits. Selection of the DNA detection technique and appropriate molecular marker for B. burgdorferi s. l. significantly affects the sensitivity and specificity of the reaction, and therefore is crucial for obtaining the best possible results (Wodecka et al. 2010). In the presented studies, we tested three methods of B. burgdorferi s.l. DNA detection on a population of 50 adults filled canine blood female I. ricinus ticks. The prevalence of B. burgdorferi s.l. was different for the detection of the ospa, 16S rrna, and fla genes. Among obtained results there were no significant differences. In 19 tested ticks (38%), detection of all three analyzed spirochete genes was observed. In 7 cases positive PCR for two genes was obtained. For 5 positive tests expression of only the ospa gene has been demonstrated. Belonging to the B. burgdorferi s. l. complex of these amplicons was confirmed by sequencing. The obtained sequences showed % similarity to the sequences deposited in the Gene Bank, representing the B. afzelii species. PCR detection of ospa gene was the most efficient, 33 ticks out of 50 (66%) were PCR positive. Mentioned gene encodes lipoprotein, which mediates in the adherence of spirochete to the tick's gut. OspA lipoprotein appears during colonization of the intestinal tract. It is a ligand for intestinal cells, which allows colonization. Moreover it prevents internalization and digestion (Pal et al. 2004). Obtained results indicate that the infections were fresh and probably were purchased from dogs and not from earlier hosts. Our result is really high (66%) comparing to study from Norway where only 19,4% ticks collected from birds were infected by B. burgdorferii (Radzijevskaja et al. 2016). 61

62 The results for PCR detection of 16S rrna and fla gene were relatively similar. Surprisingly the lowest rate of infected ticks (46%) was demonstrated by the fla gene. The flagellin gene is the most sensitive molecular marker for the detection of Borrelia spirochetes in ticks using the nested PCR technique (Wodecka et al. 2010). Our research shows that for the rapid one-step diagnostics of ticks filled with blood, the ospa gene is best suited. The number of B. burgdorferii s.l positives were determined to be 15% examining flagellin gene in Southern Poland, when I. ricinus ticks were collected using flagging method. It was significantly lower than in our study (46%) (Strzelczyk et al. 2015). In the presented research, 48% of the infected ticks using the 16S gene were demonstrated. Studies that have been done with the same method, using the same pair of primers specific to 16S rrna gene were similar in Germany - 42% out of tested I. ricinus ticks attached to human skin have been infected. In contrary to our results and previous data, prevalence of B. burgdorferi in Sweden, Norway and Denmark was much lower (6 %, 16.5%, 24 % respectively), but in this study I. ricinus ticks were collected using flagging method (Liebisch et al. 1998, Rollum 2014). Summing up, prevalence of Borrelia spirochetes in ticks removed from dogs in Olsztyncity agglomeration is very high (from 46 to 66% depending on the primer pair used). According to our results and contemporary literature the best gene for detection of B. burgdorferi s.l. in the ticks collected from dogs seems to be the ospa gene. Additionally, if we use PCR with one pair of primers (one-stage), then the amplification products should be sequenced. If possible primers for at least two different genes should be used. Table 1. Oligonucleotide primers used in the study Primer/gen Primer sequences (5 3 ) e bp References SL1/2 ospa AATAGGTCTAATAATAGCCTTAATAGC CTAGTGTTTTGCCATCTTCTTTGAAAA 307 Demaerschalck et al BFL1/2 fla GCTCAATATAACCAAATGCACATG CAAGTCTATTTTGGAAAGCACCTAA 442 Stańczak et al P1/2 16S rrna ACGCTGGCAGTGCGTCTTAA CTGATATCAACAGATTCCACCC 669 Liebisch et al Table 2. Degree of identity [%] of sequenced amplicons of ospa gene with sequences deposited at Gen Bank using Blastn No of sample Borrelia afzelii ospa gene X Borrelia afzelii strain Bavaria CG725 Tr ospa gene DQ /226 (99%) 224/226 (99%) /246 (100%) 244/245 (99%) /238 (100%) 237/238 (99%) /238 (100%) 237/238 (99%) /238 (99%) 238/238 (100%) 62

63 FIG.1 Results of PCR of three genes: 16S, fla, ospa respectively, samples from 1 to 13. FIG. 2. Results of PCR of three genes: 16S, fla, ospa respectively, samples from 14 to 26. FIG. 3. Results of PCR of three genes: 16S, fla, ospa respectively, samples from 27 to 38. FIG. 4. Results of PCR of three genes: 16S, fla, ospa respectively, samples from 39 to

64 References 1. Bałut-Jurkowska J., Jurkowski M Borelioza - aktualny stan wiedzy. Przeg. Lek. 72/11: Czubasiewicz Z., Strzelczyk J. Krzakiewicz K Przegląd metod służących do wykrycia zakażenia Borrelia burgdorferi. Pediatr. Med. Rodz. 9 (2): Demaerschalck I., Messaoud A., Kesel M., Hoyois B., Lobet Y., Hoet P., Bigaignon G., Bollen A., Godfroid E Simultaneous presence of different Borrelia burgdorferi genospecies in biological fluids of lyme disease patients. J. Clin. Micobiol. Vol. 33, No. 3: Fukunaga M., Okada K., Nakao M., Konishi T., Sato Y Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of Lyme disease borreliae. Im. J. Syst. Bacteriol. Vol. 46, No. 4: Liebisch G., Sohns B., Bautsch W Detection and typing of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks attached to human skin by PCR. J. Clin. Micobiol. Vol. 36, No. 11: Mather T.N., Fish D, Coughlin R.T Competence of dogs as reservoirs for Lyme disease spirochetes (Borrelia burgdorferi). J. Am. Vet. Med. Assoc. Jul 15;205(2): Michalski M.M Composition of tick species (Acari: Ixodida) on dogs in the urban agglomeration a multi-year study. Med. Weter. 73(11): Nocton J., Dressler F., Rutlege B., Rys P., Persing D., Steere A Detection of Borrelia burgdorferi DNA by polymerase chain reaction in synovial fluid from patients with Lyme Arthritis. N. Engl. J. Med. 330: Pal U., Li X., Wang T, Mongomery R.R., Ramamoorthi N., Desilva A.M., Bao F., Yang X., Pypaert M., Pradhan D., Kantor F.S., Telford S., Anderson J.F., Fikrig E TROSPA, an Ixodes scapularis receptor for Borrelia burgdorferi. Cell 119: Radulović Ž., Milutinović M., Tomanović S., Mulenga A Detection of Borreliaspecific 16S rrna sequence in total RNA extracted from Ixodes ricinus ticks. Arq. Bras. Med. Vet. Zootec. Vol. 62. No Radzijevskaja J., Rosef O., Matulaityte V., Paulauskas A Borrelia burgdorferi sensu lato genospecies in Ixodes ricinus ticks feeding on passerine birds in southern Norway. Biologija Vol. 62. No. 2: Rollum R Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks in Scandinavia. Thesis for the Master s degree in Molecular Biosciences, Department of Molecular Biosciences Faculty of Mathematics and Natural Sciences. University of Oslo. 13. Scott J. Foley J., Anderson J., Clark K., Durden L Detection of Lyme Disease Bacterium, Borrelia burgdorferi sensu lato, in Blacklegged ticks collected in the Grand River Valley, Ontario. Int. J. Med. Vol. 14: Strzelczyk J., Gaździcka J., Cuber P., Asman M., Trapp G., Gołąbek K., Zalewska-Ziob M., Nowak-Chmura M., Siuda K., Wiczkowski A., Krzysztof S Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from southern Poland. Acta Parasit. 60(4): Wodecka B, Leońska A, Skotarczak B A comparative analysis of molecular markers for the detection and identification of Borrelia spirochaetes in Ixodes ricinus. J. Med. Microbiol. 59:

65 Diagnostyka boreliozy - dlaczego należy zbadać kleszcza Beata Wodecka Uniwersytet Szczeciński, Wydział Biologii, Katedra Genetyki, Szczecin, ul. Felczaka 3c, beata.wodecka@usz.edu.pl Streszczenie: Borelioza z Lyme jest najczęściej diagnozowaną chorobą odkleszczową na półkuli północnej. Wywoływana jest przez krętki z rodzaju Borreliella i ma przebieg trójetapowy, leczenie jednak jest najbardziej skuteczne na pierwszym etapie, gdy bakterie przebywają w skórze żywiciela. Rodzaj Borreliella zawiera obecnie 23 gatunki rozprzestrzeniane wyłącznie przez kleszcze właściwe (Ixodidae), z których co najmniej 10 daje objawy chorobowe. Zróżnicowanie objawów skorelowane jest z poszczególnymi gatunkami krętków, dlatego istotna jest prawidłowa ich identyfikacja. Metody serologiczne są w tych względzie nie tylko nieprecyzyjne, ale również opóźniają diagnostykę, a tym samym skuteczność leczenia. Najdokładniejsze w identyfikacji gatunkowej metody molekularne, oparte o analizy materiału genetycznego bakterii, są trudne do zastosowania w próbach pozyskiwanych od pacjentów, ale można je stosować do wykrywania DNA krętków w kleszczach usuwanych ze skóry. Takie badanie umożliwia szybsze uzyskanie wyniku, a tym samym wcześniejsze podjęcie leczenia, a więc w okresie, gdy jest ono w pełni skuteczne. 1. Borelioza z Lyme choroba odkleszczowa Borelioza z Lyme jest najczęściej diagnozowaną chorobą odkleszczową na półkuli północnej (Lindgren i Jaenson 2006). Jest to choroba atakująca zarówno ludzi jak i zwierzęta domowe oraz hodowlane, stanowi więc realny problem medyczny i weterynaryjny (Rudenko i wsp. 2011). Czynnikiem etologicznym boreliozy z Lyme są bakterie należące do krętków ściśle wyspecjalizowanych do naprzemiennego zasiedlania organizmów zmiennocieplnych wektorów, głównie kleszczy i ich stałocieplnych żywicieli kręgowców lądowych. Bakterie te, do niedawna określane jako kompleks Borrelia burgdorferi sensu lato (s.l.) zostały ostatnio wydzielone z rodzaju Borrelia jako osobny rodzaj Borreliella (Adeolu i Gupta 2014) i oba te rodzaje, ze względu na ścisłą specjalizację wobec kleszczy jako wektorów zostały wydzielone jako nowa rodzina Borreliaceae (Gupta i wsp. 2013). Wyspecjalizowanie bakterii Borreliella wobec kleszczy ogranicza się przede wszystkim do najliczniejszego w gatunki rodzaju Ixodes, a polega między innymi na umiejętności wykorzystania rozmaitych wytwarzanych przez kleszcza białek do swojego przetrwania, zarówno w organizmie kleszcza jak i jego żywiciela (Ramamoorthi i wsp. 2005). Tak ścisła zależność od wspomnianych białek stanowi jednak barierę dla innych sposobów rozprzestrzeniania się tych bakterii, dlatego boreliozę z Lyme określa się mianem choroby odkleszczowej (Steere i wsp. 2016). 2. Etapy choroby i skuteczność diagnostyczna Borelioza z Lyme ma przebieg trójetapowy, złożony z fazy wczesnej ograniczonej, wczesnej rozsianej i późnej, określanej też jako narządowa. Każdy z tych etapów jest związany z pokonywaniem przez bakterie kolejnych barier napotykanych przez bakterie i zdobywaniem nowych nisz chroniących je przed działaniem układu odpornościowego żywiciela (Steere i wsp. 2016). W fazie wczesnej ograniczonej bakterie przebywają w skórze żywiciela, intensywnie się namnażając. Najbardziej charakterystycznym objawem tego etapu jest tak zwany rumień wędrujący (erythema migrans), zaczerwienienie na skórze owalnego kształtu w miejscu wkłucia 65

66 się kleszcza, które powiększa się wraz z upływem czasu, a w centralnej jego części pojawia się przejaśnienie, co daje efekt pierścienia. Przyjmuje on średnicę co najmniej 5 centymetrów, a efekt rozchodzącego się promieniście zaczerwienienia skóry odpowiada przemieszczaniu się bakterii od miejsca wkłucia kleszcza w obrębie skóry. Obecność rumienia wędrującego jest najbardziej jednoznacznym wskaźnikiem diagnostycznym w boreliozie z Lyme, jednak występuje u niespełna połowy osób zakażonych bakteriami z rodzaju Borreliella. Faza wczesna ograniczona jest jedynym etapem choroby, w którym leczenie jest w pełni skuteczne, natomiast jedynym kryterium diagnostycznym wskazującym na konieczność podjęcia leczenia jest obecność rumienia wędrującego (Steere i Sikand 2003). Drugi etap choroby faza wczesna rozsiana związany jest z wędrówką bakterii za pośrednictwem naczyń krwionośnych w kierunku tkanek i narządów. Jest to etap krótkotrwały, gdyż bakterie we krwi narażone są szczególnie na działanie układu odpornościowego żywiciela i unikają go wykorzystując mechanizm adhezji do śródbłonka naczyń, dzięki któremu mogą następnie przenikać do przestrzeni międzykomórkowej wolnej od działania czynników układu dopełniacza. Od tego etapu diagnostyka boreliozy obejmuje wykrywanie przeciwciał w klasie IgM, które mogą pojawić się po 2 miesiącach od zakażenia, jednak ten typ przeciwciał jest trudny do wykrycia i wyniki często są fałszywie ujemne (Wormser i wsp. 2013). Od około 6 miesięcy po zakażeniu pojawiają się w organizmie osoby zakażonej przeciwciała z klasy IgG, które łatwiej się wykrywa, jednak samą chorobę znacznie trudniej już w tym momencie leczyć. Dzieje się tak dlatego, że trzeci etap choroby, w czasie którego pojawiają się przeciwciała IgG, czyli faza późna, związany jest z docelowym miejscem opanowywanym przez bakterie tkankami i narządami. Efektem przebywania krętków Borreliella w tej lokalizacji jest uszkadzanie narządów i upośledzanie ich funkcjonowania. Wyeliminowanie bakterii z organizmu w tym okresie pozostawia ślad u chorego w postaci niesprawnych narządów, przez co nie odczuwa on poprawy stanu zdrowia (Melia i Auwaerter 2016). 3. Rodzaj Borreliella czynnik etiologiczny boreliozy Rodzaj Borreliella składa się obecnie z 22 gatunków oraz 1 grupy genomowej o zróżnicowaniu genetycznym odpowiadającym randze gatunku. Gatunki te występują na 5 kontynentach, głównie w ich strefie umiarkowanej, nie stwierdzono ich obecności jedynie w Australii (Franke i wsp. 2012, Ivanova i wsp. 2014, Pritt i wsp. 2016, Margos i wsp. 2017). Ich cechą wspólną jest wektor są rozprzestrzeniane przez gatunki kleszczy z rodzaju Ixodes, zwłaszcza takie, które charakteryzują się brakiem specyficzności żywicielskiej, tj. I. ricinus w Europie, I. persulcatus w Azji oraz I. scapularis i I. pacificus w Ameryce Pn (Eisen i Lane 2002). Spośród tych gatunków 13 występuje jednocześnie na dwóch kontynentach, a tylko pozostałe 10 stwierdzono na pojedynczych kontynentach. Najwięcej gatunków Borreliella występuje w Europie, bo aż 15, z czego 7 jest wspólnych dla Ameryki Północnej (B. burgdorferi, B. bissettii, B. californiensis, B. carolinensis, B. kurtenbachii, B. lanei i Borreliella genomosp. 1), 5 dla Azji (B. garinii, B. afzelii, B. bavariensis, B. valaisiana i B. turdi) i 1 dla Afryki (B. lusitaniae), a 2 występują wyłącznie w Europie (B. spielmanii i B. finlandensis) (Franke i wsp. 2012, Wodecka i wsp. 2018). Z pozostałych 8 gatunków 4 występują wyłącznie w Azji (B. japonica, B. sinica, B. tanukii i B. yangsensis), 3 jedynie w Ameryce Pn. (B. americana, B. andersonii i B. mayonii) (Franke i wsp. 2012, Pritt i wsp. 2016), a B. chilensis jest jedynym przedstawicielem rodzaju Borreliella na kontynencie południowoamerykańskim (Ivanova i wsp. 2014). Spośród wymienionych 23 gatunków 10 uznanych zostało za chorobotwórcze, w tym 9 występujących w Europie, a mianowicie: B. burgdorferi, B. garinii, B. afzelii, B. bavariensis, B. spielmanii, B. bissettii, B. lusitaniae, B. valaisiana i B. kurtenbachii, a także północnoamerykański B. mayonii (Picken i wsp. 1996; Rijpkema i wsp. 1997; Strle i wsp. 1997; Wang i wsp. 1999; Ryffel i wsp. 1999; Collares-Pereira i wsp. 2004; Rudenko i wsp. 2008, 2009; Girard i wsp. 2011, Pritt 66

67 i wsp. 2016). Ten ostatni, odkryty stosunkowo niedawno gatunek, charakteryzuje się największą zjadliwością w obrębie rodzaju Borreliella objawiającą się w postaci niezwykle wysokiej w przypadku czynnika etiologicznego boreliozy z Lyme spirochetemii (Pritt i wsp. 2016). Trzy pierwsze z wymienionych gatunków są najbardziej rozpowszechnione na półkuli północnej i najczęściej przyczyniają się do zachorowania na boreliozę: B. garinii i B. afzelii w Europie i Azji, a B. burgdorferi w Ameryce Pn., rzadziej w Europie (Rudenko i wsp. 2011, Cerar i wsp. 2016). Dla wymienionych gatunków charakterystyczne jest również zróżnicowanie objawów boreliozy z Lyme (Qiu i wsp. 2008): B. burgdorferi najczęściej atakuje stawy i narządy ruchu wywołując postać stawową, B. afzelii daje objawy skórne, tzw. zanikowe zapalenie skóry (acrodermatica chronicum atroficans ACA), a B. garinii wykazuje powinowactwo do układu nerwowego, atakując zarówno ośrodkowy układ nerwowy jak i nerwy obwodowe i postać ta określana jest jako neuroborelioza. Opisane zróżnicowanie objawów nie jest jednak ścisłe i objawy przypominające neuroboreliozę mogą wystąpić np. przy zakażeniu gatunkiem B. burgdorferi. Ponadto, pozostałe gatunki chorobotwórcze również mogą dawać podobne objawy, np. B. spielmanii i B. lusitaniae wywołują zanikowe zapalenie skóry o lżejszym przebiegu (Ornstein i wsp. 2001, 2002; Ruzic-Sabljic i wsp. 2002). 4. Gatunki z rodzaju Borrelia przenoszone przez kleszcze własciwe (Ixodidae) Bakterie z rodzaju Borrelia, w przeciwieństwie do Borreliella przenoszonych wyłącznie przez kleszcze twarde (Ixodidae kleszcze właściwe), wykazują w przeważającej większości powinowactwo do tzw. kleszczy miękkich (Argasidae obrzeżkowate) i wywołują chorobę określaną jako dur powrotny (Cutler i wsp. 2016). Tylko 8 gatunków rozprzestrzenianych jest przez kleszcze twarde. Do tych ostatnich zaliczane są dwa gatunki rozprzestrzeniane w Europie przez kleszcza pospolitego (I. ricinus) podstawowy gatunek wektora krętków Borreliella na naszym kontynencie. Są to: B. miyamotoi i B. turcica (Fraenkel i wsp. 2002, Guner i wsp. 2004, Wodecka 2011, Wodecka i wsp. 2016, 2018). Oba te gatunki zasługują na szczególną uwagę. B. miyamotoi występuje na wszystkich trzech kontynentach półkuli północnej i wykorzystuje na nich te same gatunki kleszczy z rodzaju Ixodes, które stanowią podstawowe wektory dla Borreliella (Crowder i wsp. 2014, Cutler i wsp. 2016). Ponadto wykazano, że gatunek ten jest chorobotwórczy dla człowieka, ale zakażenie nim daje objawy odmienne od boreliozy z Lyme i duru powrotnego (Hovius i wsp. 2013, Krause i wsp. 2015). Z kolei B. turcica jest gatunkiem krętka wykazującym specyficzność żywicielską wobec gadów i do niedawna jedynym znanym jej wektorem był kleszcz Hyalomma aegyptium, a jedynym znanym terenem występowania pogranicze Europy i Azji na obszarze Turcji (Guner i wsp. 2004). Niedawno jednak wykryto jego obecność w kleszczach z rodzaju Ixodes zebranych z dzikich i udomowionych przedstawicieli psowatych w zachodniej Polsce (Wodecka i wsp. 2018). 5. Krętki Borreliella diagnostyka serologiczna i molekularna Zróżnicowanie genetyczne gatunków z rodzaju Borreliella nie pozostaje bez wpływu na diagnostykę serologiczną. Obecnie zwykle wykonuje się testy nakierowane na trzy najczęściej występujące gatunki, B. garinii, B. afzelii i B. burgdorferi (Steere i wsp. 2016). Badania dotyczące występowania gatunków z rodzaju Borreliella w Polsce w naturalnych populacjach kleszczy oraz w kleszczach zbieranych ze ssaków drapieżnych wykazały obecność 13 spośród 15 wykrywanych w Europie gatunków z rozmaitą częstotliwością zależną od stanowiska badań (Wodecka 2011, Wodecka i wsp. 2014, Skotarczak i wsp. 2016, Wodecka i wsp. 2016, 2018). Ponadto w Polsce występują oba przenoszone przez I. ricinus gatunki Borrelia: B. miyamotoi i B. turcica (Wodecka 2007, 2011, Wodecka i wsp. 2016, 2018). W związku z powyższym pozostałe chorobotwórcze gatunki są pomijane w standardowej diagnostyce boreliozy. Należy mieć również na uwadze fakt, że brak potwierdzenia chorobotwórczości 67

68 pozostałych gatunków może mieć liczne przyczyny, wśród których podstawowy jest brak standaryzacji metod różnicowania gatunków Borreliella wynikający z niedostatecznej charakterystyki genetycznej poszczególnych gatunków (Qiu i Martin 2014). Pełną charakterystykę genetyczną uzyskano zaledwie dla 12 spośród 23 gatunków Borreliella, opisując ich całe genomy, a wykrycie tych 23 gatunków zajęło 36 lat (Stanek i Reiter 2011, Franke i wsp. 2013, Fedorova i wsp. 2014, Kingry i wsp. 2016, Margos i wsp. 2017). Blisko połowę, tj. 11 z tych gatunków opisano zaledwie w ciągu ostatnich 10 lat, a przybywa również opisów odmiennych genetycznie szczepów z różnych kontynentów (Nava i wsp. 2014, Sebastian i wsp. 2016) i należy się spodziewać, że ich dokładniejsza charakterystyka skutkować będzie ustanowieniem nowych gatunków. Z tego względu problem braku standaryzacji metod różnicowania gatunków Borreliella jest znaczącą przeszkodą w poznaniu faktycznego ich rozprzestrzenienia na świecie i wymaga pilnego rozwiązania. Charakterystyka krętków Borreliella na podstawie materiału genetycznego jest o wiele bardziej precyzyjna niż wykonywana przy użyciu metod serologicznych. Jej podstawową zaletą jest ominięcie problemu reakcji krzyżowych, które pojawiają się w testach serologicznych (Branda i wsp. 2010). Badanie materiału genetycznego ma jednak również pewne ograniczenia. O ile w testach serologicznych można wykorzystać krew jako stosunkowo mało inwazyjny materiał badawczy, o tyle badania materiału genetycznego bakterii wymagają jego izolacji przede wszystkim z bezpośredniego miejsca bytowania patogenu, tj. bioptatów skórnych czy tkankowych, albo płynu stawowego lub rdzeniowego. Taki materiał jest niezwykle trudny do pozyskania, wiąże się z ryzykiem powikłań wynikających z nieprawidłowego lub niewprawnego pobierania. Badanie krwi na obecność DNA krętków Borreliella jest o tyle mało skuteczne, że bakterie te unikają długiego przebywania w świetle naczyń krwionośnych ze względu na narażenie na atak ze strony układu odpornościowego żywiciela (Marques i wsp. 2009). Alternatywą dla tego typu źródeł materiału do badań molekularnych jest badanie kleszcza żerującego na skórze. Jest to badanie całkowicie nieinwazyjne, a do tego łatwe źródło pozyskania materiału genetycznego bakterii. Podstawowym warunkiem skorzystania z takiego materiału jest jednak pozyskanie samego kleszcza w trakcie żerowania. 6. Żerowanie kleszcza i proces zakażania Kleszcze nabywają bakterie z rodzaju Borreliella w trakcie żerowania na zakażonym żywicielu. Bakterie te trafiają do jelita kleszcza i tam przebywają do momentu kolejnego żerowania. Ochronę przed strawieniem bakterii wraz z krwią stanowią uchyłki śródbłonka jelita kleszcza, w których część bakterii może przetrwać proces trawienia krwi. Krętki Borreliella wytwarzają w jelicie kleszcza białko powierzchniowe OspA, które przyłącza się do wytwarzanego przez śródbłonek jelita kleszcza białka TROSPA. Pozwala to dodatkowo ochronić bakterie przed strawieniem, umożliwiając im ścisłe przyleganie do błony epitelialnej, które trwa do momentu rozpoczęcia pobierania krwi w kolejnym stadium (Pal i wsp. 2014). Zakażenie żywiciela krętkami Borreliella nie odbywa się bezpośrednio po rozpoczęciu żerowania. Zanim do tego dochodzi, kleszcz musi przygotować się do pobrania krwi, wytwarzając otoczkę z proteoglikanów, która oddzieli krew od błony jelitowej. Dopiero po wytworzeniu tej otoczki, trwającym 9 do 12 godzin, kleszcz jest gotowy do przyjęcia posiłku (Kariu i wsp. 2013). Obecność pierwszej porcji krwi w jelicie jest sygnałem dla bakterii do podziałów i następnie wędrówki za pośrednictwem hemocelu do ślinianek (Caimano i wsp. 2007). Następuje zahamowanie wytwarzania białka OspA, co pozwala na uwolnienie bakterii i umożliwia ich intensywne podziały (Schwan i Piesman 2002). Zamiast białka OspA rozpoczyna się synteza OspC, które ułatwia przenikanie bakterii przez ścianę jelita do hemocelu (Radolf i wsp. 2012). Ten etap żerowania kleszcza trwa kolejne 12 godzin, więc w sumie od momentu wkłucia się kleszcza do zakażenia upływa około 24 godzin (Cook 2014). 68

69 W śliniankach bakterie wykorzystują inne białko wytwarzane przez kleszcza, tym razem do jego własnych potrzeb, tj. Salp15, które działa jako antykoagulant i modulator funkcji układu odpornościowego. Krętki Borreliella wykorzystują to białko do ochrony własnych komórek, przyłączając je za pośrednictwem białka OspC. Bakterie nie opłaszczone białkiem Salp15 są łatwo niszczone przez układ odpornościowy w reakcji odporności wrodzonej. Z tego względu zakażenie krętkami Borreliella skuteczne jest tylko przy udziale kleszcza (Ramamoorthi i wsp. 2005). Reasumując, zakażenie żywiciela rozpoczyna się w drugiej dobie żerowania kleszcza, natomiast wprowadzone do organizmu żywiciela krętki pozostają w jego skórze przez 30 dni od momentu zakażenia (Steere i wsp. 2016), co stwarza dogodne warunki do oceny ryzyka zakażenia poprzez badanie kleszcza usuniętego ze skóry żywiciela, np. człowieka lub domowego pupila (psa, kota). 7. Etapy badania kleszcza i interpretacja wyników Usunięcie kleszcza ze skóry żywiciela pozwala nie tylko na wykrycie w nim krętków Borreliella, ale również określenie etapu żerowania kleszcza i w efekcie powiązania obu czynników, co daje możliwość oceny stopnia ryzyka zakażenia krętkami wywołującymi boreliozę z Lyme. Badanie rozpoczyna się od wizualnej oceny stanu żerowania kleszcza dokonywanej pod binokularem, co pozwala na obliczenie tzw. indeksu opicia kleszcza (scutal index), który jest stosunkiem długości alloscutum (błoniastej części odwłoka, nie pokrytej tarczką grzbietową, obecnej u samic, nimf i larw) do szerokości scutum (Meiners i wsp. 2006). Indeks ten przyjmuje wartości od 1 w momencie rozpoczęcia pobierania krwi do 1,5 po upływie drugiej doby. Za stan wskazujący na możliwość zakażenia żywiciela przyjmuje się wartość indeksu opicia 1,1 oznaczającą moment, w którym krętki Borreliella mogą już dostać się do ślinianek (Meiners i wsp. 2006). Kolejnym etapem jest badanie kleszcza na obecność materiału genetycznego krętków Borreliella metodą nested PCR i w przypadku wyniku pozytywnego identyfikacja gatunku metodą PCR-RFLP, czyli ocena gatunkowo specyficznego polimorfizmu długości fragmentów restrykcyjnych produktu reakcji PCR (Wodecka 2011). W przypadku stwierdzenia opicia kleszcza, czyli wartości indeksu opicia równego lub większego od 1,1 oraz wykrycia DNA krętków Borreliella przyjmuje się, że dla wartości indeksu opicia 1,1 ryzyko zakażenia wynosi 25%, a przy wartości 1,5 i powyżej ma ono wartość 100% (Meiners i wsp. 2006). Dzięki takiej interpretacji możliwe jest całkowicie nieinwazyjne badanie, a do tego dokonywane na wczesnym etapie zakażenia, jedynym który pozwala na skuteczne leczenie boreliozy z Lyme. Wskazanie do wdrożenia leczenia istnieje tylko w przypadku stwierdzenia równocześnie wartości indeksu opicia równej co najmniej 1,1 i obecności DNA krętków w badanym kleszczu. 8. Wnioski 1. Badanie kleszcza wyjętego ze skory człowieka stanowi całkowicie nieinwazyjną i precyzyjną metodę oceny ryzyka zakażenia krętkami wywołującymi boreliozę z Lyme. 2. Zastosowanie metod molekularnych do wykrywania DNA krętków Borreliella w kleszczach pozwala na identyfikację gatunków Borreliella, wobec których nie opracowano testów serologicznych i których chorobotwórczość nie została potwierdzona ze względu na niedoskonałości identyfikacyjne testów serologicznych. 3. Badanie kleszczy jako narzędzie do oceny ryzyka zakażenia krętkami Borreliella pozwala o ponad miesiąc przyspieszyć wdrożenie leczenia boreliozy z Lyme niż obecnie stosowane metody serologiczne wykrywające przeciwciała wobec Borreliella, które pojawiają się co najmniej 2 miesiące po zakażeniu. 69

70 9. Podziękowania Manuskrypt powstał dzięki badaniom finansowanym przez Narodowe Centrum Nauki w Krakowie w ramach grantu nr N N Literatura 1. Adeolu, M., Gupta, R. S A phylogenomic and molecular marker based proposal for the division of the genus Borrelia into two genera: the emended genus Borrelia containing only the members of the relapsing fever Borrelia, and the genus Borreliella gen. nov. containing the members of the Lyme disease Borrelia (Borrelia burgdorferi sensu lato complex). Antonie van Leeuwenhoek 105: Branda J. A., Aguero-Rosenfeld M. E., Ferraro M. J., Johnson B. J., Wormser G.P., Steere A. C tiered antibody testing for early and late Lyme disease using only an immunoglobulin G blot with the addition of a VlsE band as the second-tier test. Clin. Infect. Dis. 50: Caimano M. J., Iyer R., Eggers C. H., Gonzalez C., Morton E. A., Gilbert M. A., Schwartz I., Radolf J. D Analysis of the RpoS regulon in Borrelia burgdorferi in response to mammalian host signals provides insight into RpoS function during the enzootic cycle. Mol. Microbiol. 65: Cerar T., Strle F., Stupica D., Ruzic-Sabljic E., McHugh G., Steere A. C., Strle K Differences in genotype, clinical features, and inflammatory potential of Borrelia burgdorferi sensu stricto strains from Europe and the United States. Emerg. Infect. Dis. 22: Collares-Pereira M., Couceiro S., Franca I., Kurtenbach K., Schäfer S. M., Vitorino L., Goncalves L., Baptista S., Vieira M. L., Cunha C First isolation of Borrelia lusitaniae from a human patient. J. Clin. Microbiol. 42: Cook M Lyme borreliosis: a review of data on transmission time after tick attachment. Int. J. Gen. Med. 8: Crowder C. D., Carolan H. E., Rounds M. A., Honig V., Mothes B., Haag H., Nolte O., Luft B. J., Grubhoffer L., Ecker D. J., Schutzer S. E., Eshoo M. W Prevalence of Borrelia miyamotoi in Ixodes ticks in Europe and the United States. Emerg. Infect. Dis. 20: Cutler S., Ruzic-Sabljic E., Potkonjak A Emerging borreliae - Expanding beyond Lyme borreliosis. Mol. Cell Probes. 31: Eisen L., Lane R. S., Vectors of Borrelia burgdorferi sensu lato. In: Gray, J., Kahl, O., Lane, R.S., Stanek, G. (Eds.), Lyme Borreliosis Biology, Epidemiology and Control. CABI Publishing, New York, pp Fedorova N., Kleinjan J. E., James D., Hui L. T., Peeters H., Lane R. S Remarkable diversity of tick or mammalian-associated Borreliae in the metropolitan San Francisco Bay Area, California. Ticks Tick-borne Dis. 5: Franke J., Hildebrandt A., Dorn W Exploring gaps in our knowledge on Lyme borreliosis spirochaetes Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick-borne Dis. 4: Girard Y. A., Fedorova N., Lane R. S., Genetic diversity of Borrelia burgdorferi and detection of B. bissettii-like DNA in serum of north-coastal California residents. J. Clin. Microbiol. 49: Guner E. S., Watanabe M., Hashimoto N., Kadosaka T., Kawamura Y., Ezaki T., Kawabata H., Imai Y., Kaneda K., Masuzawa T Borrelia turcica sp. nov., isolated from the hard tick Hyalomma aegyptium in Turkey. Int. J. Syst. Evol. Microbiol. 54:

71 14. Gupta R. S., Mahmood S., Adeolu M A phylogenomic and molecular signature based approach for characterization of the phylum Spirochaetes and its major clades: proposal for a taxonomic revision of the phylum. Front. Microbiol. 4: Hovius J. W., de Wever B., Sohne M., Brouwer M. C., Coumou J., Wagemakers A., Oei A., Knol H., Narasimhan S., Hodiamont C. J., Jahfari S., Pals S. T., Horlings H. M., Fikrig E., Sprong H., van Oers M. H A case of meningoencephalitis by the relapsing fever spirochaete Borrelia miyamotoi in Europe. Lancet. 382: Ivanova L. B., Tomova A., Gonzalez-Acuna D., Murua R., Moreno C. X., Hernandez C., Cabello J., Cabello C., Daniels T. J., Godfrey H. P., Cabello F. C Borrelia chilensis, a new member of the Borrelia burgdorferi sensu lato complex that extends the range of this genospecies in the Southern Hemisphere. Environ. Microbiol. 16: Kariu T., Smith A., Yang X., Pal U A chitin deacetylase-like protein is a predominant constituent of tick peritrophic membrane that influences the persistence of Lyme Disease pathogens within the vector. PLoS One. 8: e Kingry L. C., Batra D., Replogle A., Rowe L. A., Pritt B. S., Petersen J. M Whole genome sequence and comparative genomics of the novel Lyme Borreliosis causing pathogen, Borrelia mayonii. PLoS One. 11: e Krause P. J., Fish D., Narasimhan S., Barbour A. G Borrelia miyamotoi infection in nature and in humans. Clin. Microbiol. Infect. 21: Lindgren E., Jaenson. T.G Lyme borreliosis in Europe: influences of climate and climate change, epidemiology, ecology and adaptation measures. WHO Regional Office for Europe, Copenhagen. 21. Margos G., Fedorova N., Kleinjan J. E., Hartberger C., Schwan T. G., Sing A., Fingerle V Borrelia lanei sp. nov. extends the diversity of Borrelia species in California. Int. J. Syst. Evol. Microbiol. 67: Marques A., Brown M. R., Fleisher T. A Natural killer cell counts are not different between patients with post-lyme disease syndrome and controls. Clin. Vaccine Immunol. 16: Melia M. T., Auwaerter P. G Time for a different approach to Lyme disease and long-term symptoms. N. Engl. J. Med. 374: Meiners T., Hammer B., Gobel U. B., Kahl O Determining the tick scutal index allows assessment of tick feeding duration and estimation of infection risk with Borrelia burgdorferi sensu lato in a person bitten by an Ixodes ricinus nymph. Int. J. Med. Microbiol. 296: Nava S., Barbieri A. M., Maya L., Corina R., Mangold A. J., Labruna M. B., Venzal J. M Borrelia infection in Ixodes pararicinus ticks (Acari: Ixodidae) from northwestern Argentina. Acta Tropica. 139: Ornstein K., Berglund J., Nilsson I., Norrby R., Bergström S., Characterization of Lyme borreliosis isolates from patients with erythema migrans and neuroborreliosis in southern Sweden. J. Clin. Microbiol. 39: Ornstein K., Berglund J., Bergström S., Norrby R., Barbour A. G., Three major Lyme Borrelia genospecies (Borrelia burgdorferi sensu stricto, B. afzelii and B. garinii) identified by PCR in cerebrospinal fluid from patients with neuroborreliosis in Sweden. Scand. J. Infect. Dis. 34: Pal U., Li X., Wang T., Montgomery R. R., Ramamoorthi N., de Silva A. M., Bao F., Yang X., Pypaert M., Pradhan D., Kantor F. S., Telford S., Anderson J. F., Fikrig E TROSPA, an Ixodes scapularis receptor for Borrelia burgdorferi. Cell. 119: Picken R. N., Cheng Y., Strle F., Picken M. M Patient isolates of Borrelia burgdorferi sensu lato with genotypic and phenotypic similarities of strain J. Infect. Dis. 174:

72 30. Pritt B. S., Mead P. S., Hoang Johnson D.K., Neitzel D. F., Respicio-Kingry L. B., Davis J. P., Schiffman E., Sloan L. M., Schriefer M. E., Replogle A. B., Paskewitz S. M., Ray J. A., Bjork J., Steward C. R., Deedon A., Lee X., Kingry L. C., Miller T. K., Feist M. A., Theel E. S., Patel R., Irish C. L., Petersen J. M Identification of a novel pathogenic Borrelia species causing Lyme borreliosis with unusually high spirochaetaemia: a descrptbive study. Lancet Infect. Dis. 16: Qiu W. G., Bruno J. F., McCaig W. D., Xu Y., Livey I., Schriefer M. E., Luft B. J Wide distribution of a high-virulence Borrelia burgdorferi clone in Europe and North America. Emerg. Infect. Dis. 14: Qiu W. G., Martin C. L Evolutionary genomics of Borrelia burgdorferi sensu lato: Findings, hypotheses, and the rise of hybrids. Infect. Genet. Evol. 27: Radolf J. D., Caimano M. J., Stevenson B., Hu L. T Of ticks, mice and men: understanding the dual-host lifestyle of Lyme disease spirochaetes. Nat. Rev. Microbiol. 10: Ramamoorthi N., Narasimhan S., Pal U., Bao F., Yang X. F., Fish D., Anguita J., Norgard M. V., Kantor F. S., Anderson J. F., Koski R. A., Fikrig E The Lyme disease agent exploits a tick protein to infect the mammalian host. Nature. 436: Rijpkema S. G., Tazelaar D. J., Molkenboer M. J., Noordhoek G. T., Plantinga G., Schouls L. M., Schellekens J. F Detection of Borrelia afzelii, Borrelia burgdorferi sensu stricto, Borrelia garinii and group VS116 by PCR in skin biopsies of patients with erythema migrans and acrodermatitis chronica atrophicans. Clin. Microbiol. Infect. 3: Rudenko N., Golovchenko M., Mokrácek A., Piskunová N., Ruzek D., Mallatová N., Grubhoffer L Detection of Borrelia bissettii in cardiac valve tissue of a patient with endocarditis and aortic valve stenosis in the Czech Republic. J. Clin. Microbiol. 46: Rudenko N., Golovchenko M., Ruzek D., Piskunova N., Mallátová N., Grubhoffer L Molecular detection of Borrelia bissettii DNA in serum samples from patients in the Czech Republic with suspected borreliosis. FEMS Microbiol. Lett. 292: Rudenko N., Golovchenko M., Grubhoffer L., Oliver Jr. J. H Updates on Borrelia burgdorferi sensu lato complex with respect to public health. Ticks Tick-borne Dis. 2: Ruzic-Sabljic E., Maraspin V., Lotric-Furlan S., Jurca T., Logar M., Pikelj-Pecnik A., Strle F Characterization of Borrelia burgdorferi sensu lato strains isolated from human material in Slovenia. Wien. Klin. Wochenschr. 114: Ryffel K., Péter O., Rutti B., Suard A., Dayer E Scored antibody reactivity determined by immunoblotting shows an association between clinical manifestations and presence of Borrelia burgdorferi sensu stricto, B. garinii, B. afzelii, and B. valaisiana in humans. J. Clin. Microbiol. 37: Schwan T. G., Piesman J Vector interactions and molecular adaptations of Lyme Disease and Relapsing Fever spirochetes associated with transmission by ticks. Emerg. Infect. Dis. 8: Sebastian P. S., Saracho Bottero M. N., Carvalho L., Mackenstedt U., Lareschi M., Venzal J. M., Nava S Borrelia burgdorferi sensu lato in Ixodes cf. neuquenensis and Ixodes sigelos ticks from the Patagonian region of Argentina. Acta Tropica. 162: Skotarczak B., Wodecka B., Rymaszewska A., Adamska M Molecular evidence for bacterial pathogens in Ixodes ricinus ticks infesting Shetland ponies. Exp. Appl. Acarol. 69: Stanek G., Reiter M The expanding Lyme Borrelia complex clinical significance of genomic species? Clin. Microbiol. Infect. 17:

73 45. Steere A. C., Sikand V. K The presenting manifestations of Lyme disease and the outcomes of treatment. N. Engl. J. Med. 348: Steere A. C., Strle F., Wormser G. P., Hu L. T., Branda J. A., Hovius J. W. R., Li X., Mead P. S Lyme Borreliosis. Nat Rev Dis Primers. ; 2: Strle F., Picken R. N., Cheng Y., Cimperman J., Maraspin V., Lotric-Furlan S., Ruzic- Sabljic E., Picken M. M Clinical findings for patients with Lyme borreliosis caused by Borrelia burgdorferi sensu lato with genotypic and phenotypic similarities to strain Clin. Infect. Dis. 25: Wang G., van Dam A. P., Schwartz I., Dankert J Molecular typing of Borrelia burgdorferi sensu lato: taxonomic, epidemiological, and clinical implications. Clin. Microbiol. Rev. 2: Wodecka B Znaczenie jeleni (Cervus elaphus) w ekologii Borrelia burgdorferi sensu lato. Wiad. Parazytol. 53: Wodecka B FlaB gene as a molecular marker for distinct identification of Borrelia species in environmental samples by the PCR-restriction fragment length polymorphism method. Appl. Environ. Microbiol. 77: Wodecka B., Rymaszewska A., Skotarczak B Host and pathogen DNA identification in blood meals of nymphal Ixodes ricinus ticks from forest parks and rural forests of Poland. Exp. Appl. Acarol. 62: Wodecka B., Michalik J., Lane R. S., Nowak-Chmura M., Wierzbicka A Differential associations of Borrelia species with European badgers (Meles meles) and raccoon dogs (Nyctereutes procyonoides) in western Poland. Ticks Tick Borne Dis. 7: Wodecka B., Michalik J., Lane R.S Unexpected composition of Lyme disease and other Borreliaceae species in red foxes and their ixodid ticks. Ticks Tick-borne Dis. In press. 54. Wormser G. P., Levin A., Soman S., Adenikinju O., Longo M. V., Branda J. A Comparative cost-effectiveness of two-tiered testing strategies for serodiagnosis of Lyme disease with noncutaneous manifestations. J. Clin. Microbiol. 51:

74 74

75 Profil ekspresji genów kodujących białka opiekuńcze w komórkach fibroblastów zakażonych krętkami Borrelia burgdorferi Martyna Bednarczyk 1, Nikola Zmarzły 2, Agata Kaźmierczak 3, Beniamin Grabarek 2, Sławomir Dudek 4, Urszula Mazurek 2, Małgorzata Muc-Wierzgoń 1 1Katedra i Oddział Kliniczny Chorób Wewnętrznych. Wydział Zdrowia Publicznego w Bytomiu 2 Zakład Biologii Molekularnej Katedry Biologii Molekularnej, 3 Zakład Nutrigenomiki i Bromatologii Katedry Biologii Molekularnej. 4 Katedra i Zakład Farmakognozji i Fitochemii Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, Śląski Uniwersytet Medyczny w Katowicach, Autor korespondencyjny: martyna.bednarczyk@outlook.com Wstęp Borelioza (choroba z Lyme) jest jedną z najczęściej występujących chorób odzwierzęcych na świecie. Wywoływana jest przez krętki Borrelia Burgdorferi, które przenoszone są przez ślinę zakażonego kleszcza z rodzaju Ixodes. Wyróżniamy trzy najważniejsze ludzkie patogeny, Borrelia burgdorferi sensu stricto w Europie i USA oraz Borrelia afzelii i Borrelia garinii w Europie i Azji (Cook 2014, Hou i in. 2014). Poszczególne gatunki Borrelia różnią się tropizmem tkankowym, a tym samym wykazują odmienną patogeniczność oraz obraz kliniczny choroby. Niektóre genogatunki różnią się również wirulencją, wskazującą na zmienność genetyczną. Oznacza to, że w zależności od genogatunku krętka, boreliozę dzieli się na kilka typów, ponieważ poszczególne gatunki Borrelia mają zdolność do kolonizacji i rozmnażania się w różnych tkankach. B. burgdorferi jest zazwyczaj związana z zapaleniem stawów, B. garinii i B. bavariensis z neuroboreliozą, natomiast B. afzelii z przewlekłą chorobą skóry (Schuler i in. 2015, Bednarczyk i in. 2017). Borelioza jest chorobą wielonarządową, uzkadzającą różne narządy, w tym serce, stawy, ośrodkowy układ nerwowy i mózg. Początkowe objawy są niespecyficzne, np. wyjątkowe zmęczenie, objawy grypopodobne, zapalenie stawów, obwodowa neuropatia, czy zaburzenia poznawcze (Cook 2014). Po zakażeniu, stymulowany jest układ immunologiczny, w celu aktywacji miejscowej reakcji zapalnej. W konsekwencji, B. burgdorferi rozprzestrzenia się w organizmie i powoduje szereg reakcji immunologicznych i zapalnych (Peacock i Gherezghiher 2015). Unikalną cechą choroby jest rumień wędrujący (EM), który pojawia się zwykle 3 do 30 dni po ukąszeniu, może towarzyszyć mu gorączka, bóle głowy, mięśni i stawów. U prawie 1/3 pacjentów występuje zespół PTLDS, nawet po antybiotykoterapii, który charakteryzuje sie uporczywym lub nawracającym zmęczeniem oraz bólami stawów. Za zespół PTLDS uważa się utrzymujące się objawy dłużej niż 6 miesięcy pomimo odpowiedniego leczenia (Herrin i in. 2018, Pun i in. 2018). Białka szoku cieplnego (HSP), inaczej chaperony lub białka opiekuńcze, są grupą wysoce konserwatywnych białek, które uczestniczą przede wszystkim w przetrwaniu komórki w warunkach stresowych. Indukowane są w odpowiedzi na podwyższone temperatury (Gonzalez-Aravena i in. 2018, Sable i in. 2018). Białka HSP są jedynymi znanymi, niezależnymi od ATP chaperonami, które współdziałają podczas fałdowania substratów z chaperonami zależnymi od ATP. Pełnią w komórce funkcję kontroli jakości w odniesieniu do innych białek oraz odgrywają istotną rolę w procesie życia, starzenia się, choroby i 75

76 śmierci białek. Zapobiegają nieodwracalnej agregacji zdenaturowanych białek substratowych i pomagają w ich prawidłowym fałdowaniu. Uczestniczą również w utrzymaniu homeostazy (Ezemakuda i in. 2017). Podzielone zostały na pięć głównych grup HSP100, HSP90, HSP70, HSP60/40 i HSP20, w zależności od ich masy cząsteczkowej (Sable i in. 2018). HSP100 należy do nadrodziny ATPaz, heksamerycznych białek pierścieniowych zaangażowanych demontaż i translokację substratów. W celu dezagregcji białek, HSP70 rekrutuje zagregowane polipeptydy i dostarcza je do HSP100, jednocześnie aktywując ATPazę i umożliwiając HSP100 wychwytywanie polipeptydów za pomocą pętli tyrozynowych (Deville i in. 2017, Ezemakuda i in. 2017). HSP90, znany również jako HSC70 jest najbardziej złożonym kompleksem chaperonów w cytozolu komórek eukariotycznych. Uczestniczy w fałdowaniu i aktywacji setek tysięcy białek oraz bierze udział w ogólnej kontroli jakości białek, degradacji i remodelacji chromatyny (Rutz i in. 2018). Badania wykazały, że HSP90 odgrywa również rolę w replikacji wielu wirusów, poprzez interakcję i stabilizację specyficznych białek wirusowych (Srisutthisamphan i in. 2018). Ponadto bierze udział w autofagii zależnej od chaperonów, gdzie odpowiada za translokację substratów do lizosomy (Cuervo i in. 2014). Chaperony HSP70 obecne są we wszystkich głównych przedziałach komórkowych (cytozolu, jądrze komórkowym, ER i mitochondriach), funkcjonujących w różnych procesach komórkowych od zwijania kompleksów białkowych do translokacji białek przez błony komórkowe (Craig 2018). Cel pracy Celem przedstawionej pracy jest ocena zmian aktywności transkrypcyjnej genów kodujących białka opiekuńczy w komórkach fibroblastów zakażonych krętkami Borrelia Burgdorferi. Materiały i metody W niniejszym badaniu wykorzystano komórki fibroblastów skóry NHDF (CC-2511 line; Lonza, Basel, Switzerland) hodowane w układzie kokultury z krętkami Borrelia burgdorferi sensu stricto, B. garinii i B. afzelii. Do hodowli bakterii użyto medium BSK-H (Barbour-Stoenner-Kelly, Sigma-Aldrich, St. Louis, MO, USA) w temperaturze 37 o C w warunkach mikroaerofilnych. Po upływie 7 dni hodowli, obliczono średnią liczbę krętków w 1ml w medium z wykorzystaniem komory Bürker a, następnie przeprowadzono mikroskopową analizę hodowli. Referencyjne szczepy krętków Borrelia burgdorferi sensu stricto uzyskano z Narodowego Instytutu Zdrowia Publicznego w Warszawie. Hodowlę prowadzono w Zakładzie Mikrobiologii Wydziału Farmaceutycznego Śląskiego Uniwersytetu Medycznego w Polsce. Komórki NHDF z linii CC-2511 (firmy Lonza, Basel, Switzerland), zarówno badane jak i kontrolne, hodowano dokładnie w ten sam sposób z wykorzystaniem medium FGM (Lonza, Basel, Switzerland) na płytkach o powierzchni 25 cm 2 wyposażonych w filtry bakteriologiczne. Krętki Borrelia burgdorferi sensu stricto, B. garinii i B. afzelii dodano na 24 godziny do badanej hodowli komórek NHDF w stosunku 10:1, bakterie do fibroblastów (MOI = 10). Kolejnym etapem była izolacja całkowitego RNA z próbek za pomocą odczynnika TRIZOL (Invitrogen Life Technologies, California, USA), zgodnie z protokołem producenta. Całkowity ekstrakt RNA potraktowano DNazą I i oczyszczono za pomocą zestawu RNeasy Mini (Qiagen GmbH, Hilden, Germany), zgodnie z instrukcjami producenta. W celu jakościowej oceny RNA przeprowadzono elektroforezę w 1% żelu agarozowym wybarwionym bromkiem etydyny. Za pomocą spektrofotometru GeneQuant II wyznaczono stężenie RNA, na podstawie wartości absorbancji przy długości fali 260 nm. Profil ekspresji genów wyznaczano techniką mikromacierzy oligonukleotydowych z wykorzystaniem płytek HGU-133A (Affymetrix) zgodnie z protokołem producenta. Do zsyntetyzowania dwuniciowego cdna, wykorzystano jako matrycę 8 μg RNA (SuperScript 76

77 Choice system; Invitrogen Life Technologies, CA, USA). Syntezę biotynylowanego crna przeprowadzono z użyciem BioArray HighYield RNA Transcript Labeling Kit (Enzo Life Sciences, New York, USA). W celu przeprowadzenia fragmentacji crna zastosowano Sample Cleanup Module Kit (Qiagen GmbH, Germany). Płukanie, barwienie kompleksem streptawidyna-fikoerytryna i skanowanie mikromacierzy w skanerze GeneArray (Agilent) wykonywano zgodnie z zaleceniami Affymetrix Gene Expression Analysis Technical Manual. Wykorzystano dwanaście płytek mikromacierzy: trzy dla komórek kontrolnych oraz trzy dla każdego zestawu próbek zakażonych Borrelia. Transkrypty związane z białkami HSP odsączono spośród sond mrna obecnych w mikromacierzy HG-U133A. Baza danych Affymetrix NetAffxTM ( została wykorzystana w celu uzyskania nazw sond. Otrzymane wyniki poddano opracowaniu statystycznemu z wykorzystaniem Infrastruktury PL-Grid ( oraz programu Statistica W analizie statystycznej zastosowano poziom istotności statystycznej wynoszący p(α) < 0,05. Dla każdego analizowanego parametru wyznaczono najważniejsze elementy statystyki opisowej: średnią, medianę, wartość minimalną i maksymalną, odchylenie standardowe oraz kwartyl górny (75%) i dolny (25%). Statystycznie znamienne różnice profilu stężeń mrna różnicujących badane grupy komórek NHDF wyznaczono testem jednoczynnikowej ANOVA oraz testem post hoc TUKEYA. Specyficzność mrna w różnicowaniu poszczególnych grup pomiędzy sobą wyznaczono na podstawie diagramu VENNA. Wyniki Pierwszym etapem eksperymentu była analiza techniką mikromacierzy oligonukleotydowych (HGU-133A Affymetrix) transkryptomu (22283 mrna) hodowli ludzkich fibroblastów NHDF kontrolnych (K) oraz poddanych działaniu trzech genogatunków Borrelia: B. burgdorferi sensu stricto (S), B. garini (G) oraz B. afzelii (A). Wyniki następnie znormalizowano wykorzystując metodę RMA (log 2). Kolejnym krokiem był podział próbek na grupy w zależności od genogatunku krętka. Trzy grupy stanowiły hodowle komórek NHDF zainfekowane krętkami Borrelia. Pierwszą grupą była Borrelia afzelii, drugą - Borrelia garinii, a trzecią - Borrelia burgdorferii sensu stricte. Czwarta grupa była kontrolna komórki NHDF niezainfekowane. Na podstawie bazy danych Affymetrix oraz danych literaturowych, z mrna wyselekcjonowano 486 ID mrna genów kodujących białka szoku cieplnego (HSP). Wynik analizy porównawczej był podstawą do wytypowania ID mrna różnicujących porównywane grupy hodowli komórkowych pomiędzy sobą. Pierwszym etapem analizy statystycznej było przeprowadzenie testu jednoczynnikowej ANOVA z korekcją Benjamini-Hochberga, który umożliwił porównanie wszystkich analizowanych grup transkryptomów w odniesieniu do próby kontrolnej KH (Tab. 1). Ten test wykonuje się w celu oceny statystycznej znamienności obserwowanych zmian na poziomie profilu stężeń ID mrna HSP w zależności od genogatunku krętka, którym zainfekowano komórki NHDF. Na podstawie analizy statystycznej ANOVA stwierdzono, że spośród grupy 486 mrna genów kodujących białka HSP, w przypadku 162 ID mrna występują znaczne różnice w intensywności fluorescencji dla wartości p < 0,05. Wyniki wskazują, że 162 mrna różnicuje porównywane grupy hodowli NHDF od kontroli KH. W przypadku zwiększenia siły różnicowania, poprzez zmianę wartości p z 0,05 na 0,001, obserwowano stopniowe zmniejszanie liczby mrna różnicujących poszczególne grupy transkryptów. Kolejnym etapem analizy statystycznej było przeprowadzenie testu wielokrotnych porównań post-hoc (po fakcie) test Tukeya z poprawką Benjamini-Hochberga (Tab. 2). Wykonuje się go w celu określenia, jaka liczba ID mrna różnicuje analizowane grupy transkryptomów między sobą. 77

78 Analizując wyniki średnich sygnałów fluorescencji w odniesieniu do kontroli K, z grupy 162 ID mrna wytypowano przy wartości p < 0,05, dla B. burgdorferii vs K 75 ID mrna, dla B. garini vs K 81 ID mrna, natomiast dla B.afzelii vs K również 81. Kolejnym etapem było wygenerowanie diagramu VENNA, który przedstawia geny wytypowane z analizy statystycznej ANOVA wspólne dla infekcji krętkami Borrelia afzelii (kolor zielony), Borrelia garinii (kolor czerwony) i sensu stricto (niebieski) (ryc. 1). Pod uwagę brano tylko geny różnicujące. Na podstawie testu jednoczynnikowej ANOVA, stwierdzono, że ludzkie fibroblasty zakażone krętkami Borrelia sensu stricto różnicuje 75 genów w stosunku do kontroli, wytypowanych z 162 mrna. Spośród wytypowanych genów różnicujących, 22 są specyficzne tylko dla zakażenia Borrelia sensu stricto (tab. 3). Z kolei, komórki NHDF zainfekowane krętkami Borrelia garini w stosunku do kontroli charakteryzują się zróżnicowaniem 81 genów, z czego 24 są specyficzne dla tego genotypu krętka (tab. 4). Natomiast komórki fibroblastów zainfekowane genotypem krętka Borrelia afzelii w stosunku do kontroli różnicuje również 81 genów, z czego 28 jest charakterystycznych wyłącznie dla Borrelia afzelii (tab. 5). Dyskusja Motywem do podjęcia badań w kierunku zmian aktywności genów kodujących białka opiekuńcze w komórkach ludzkich fibroblastów NHDF zainfekowanych krętkami Borrelia burgdorferi jest problem zarówno z diagnostyką boreliozy, jak i terapią. Do tej pory najskuteczniejszą metodą leczenia jest terapia celowana anty-tnf. Jest niezwykle skuteczna, jednak wysokie koszty oraz pojawiająca się przy dłuższym stosowaniu lekooporność, skłaniają naukowców do ciągłego poszukiwania wciąż nowych sposobów leczenia (Pedretti i Tornero 2015, Bednarczyk i in. 2016). W niniejszej pracy skupiono się na genach kodujących chaperony, czyli białka szoku cieplnego, które biorą udział między innymi w utrzymaniu homeostazy komórkowej. Wytypowanie genów, które pod wpływem zakażenia Borrelia burgdorferi zmieniają swoją aktywność transkrypcyjną, może mieć zastosowanie w diagnostyce klinicznej oraz późniejszej terapii. W przypadku, gdy nie występują zmiany w ekspresji tych genów w stosunku do kontroli, można przypuszczać, że nie są one związane z rozwojem boreliozy. Porównując uzyskane wyniki stwierdzono, że badane fibroblasty różnią się poziomem mrna w zależności od genogatunku krętka, którym zostały zainfekowane. Analiza jednoczynnikowym testem ANOVA wykazała, że 162 ID mrna różnicuje komórki w zależności od szczepu Borrelia burgdorferi. Natomiast na podstawie testu post hoc Tukeya stwierdzono, że jest 29 genów, które różnicują komórki fibroblastów skóry zakażone krętkami Borrelia, niezależnie od genogatunku krętka. Co więcej, wszystkie geny spośród 29 wykazują inną aktywność transkrypcyjną w przypadku krętków Borrelia burgdorferi sensu stricto niż w przypadku zakażenia Borrelia afzelii i Borrelia garinii. Co oznacza, że geny które charakteryzują się niższą ekspresją w komórkach zakażonych B.b. sensu stricto, w komórkach zakażonych B.afzelii i B.garinii ulegają nadekspresji, i odwrotnie. Wśród genów różnicujących komórki NHDF zakażone Borrelia burgdorferi sensu stricto od kontroli, tylko 3 genu ulegają obniżonej ekspresji, a pozostałe nadekspresji. W przypadku Borrelia garini już 18 genów wykazuje obniżoną aktywność transkrypcyjną, natomiast jeśli chodzi o Borrelia afzelii to 11 genów ulega obniżonej ekspresji. Białka szoku cieplnego aktywowane są w odpowiedzi na niekorzystne warunki. Wzrost ich ekspresji może świadczyć o udziale tych białek w odpowiedzi immunologicznej na zakażenie krętkami. Wspólnymi genami różnicującymi dla wszystkich krętków są geny z rodziny DNAJ oraz HSP. Gen HSPD1 występuje wśród genów wspólnych dla wszystkich typów krętków. Koduje białko HSP60, które ma zdolność stymulacji komórek nabytego układu odpornościowego (limfocyty T i B) oraz wrodzonego układu odpornościowego (makrofagi i 78

79 komórki dendrytyczne) (Bajzert i in. 2018). W przypadku zakażenia krętkami B.afzeli i B.garinii ulega obniżonej ekspresji w stosunku do kontroli, natomiast przy zakażeniu B.b.sensu stricto, wykazuje nadekspresję. Może to oznaczać, ze infekcja prowadzi do wzrostu aktywności transkrypcyjnej genua w efekcie pobudzenia układu immunologicznego, w celu zwalczania zakażenia B. b. sensu stricto. Z kolei geny z rodziny DNAJ kodują białko HSP40, które jest co-chaperonem HSP70. Infekcje wirusowe lub bakteryjne mogą zmieniać profil ekspresji genów DNAJ (Braga i in. 2018). Zwiększona ekspresja HSP70 prowadzi do aktywacji limfocytów T, co ma miejsce w przypadku zakażenia B.b.sensu stricto. Na podstawie przeprowadzonych wstępnych badań zaobserwowano, że geny różnicujące wykazują podobną aktywność transkrypcyjną w przypadku zakażenia B. afzeli oraz B. garinii. Co za tym idzie, na podstawie profilu ekspresji genów nie można wnioskować o typie genogatunku krętka. Tabela 1. Test jednoczynnikowej ANOVA przedstawiający liczbę ID mrna genów kodujących białka szoku cieplnego różnicujących transkryptomy komórek NHDF zainfekowanych różnymi genogatunkami Borrelia Liczba mrna różnicujących KH vs Borrelia burgdorferii Wartość p p < 0,05 p < 0,02 p < 0,01 p < 0,005 p < 0,001 różnicujące Tabela 2. Test post-hoc Tukeya z poprawką Benjamini-Hochberga Grupa transkryptomów Kontrola B. burgdorferii B. garini B. afzelii kontrola B. burgdorferii B. garini B. afzelii Ryc. 1. Diagram Venna przedstawiający liczbę ID mrna różnicujących transkryptomy w zależności od typu infekcji 79

80 Tabela 3. Geny różnicujące dla Borrelia burgdorferi sensu stricto ID genu Symbol genu GeneSpring Zmiana p-value FC _s_at AP2B1 redukcja , _s_at DNAJB1 wzrost , _at OGDH wzrost , _s_at RPA1 wzrost , _s_at PPP4R1 wzrost , _at NUP93 wzrost , _s_at NOS3 wzrost , _s_at HSPB3 wzrost , _at DNAJC4 wzrost , _s_at AKT1 wzrost , _s_at DNAJB5 redukcja , _x_at TNPO1 wzrost , _at PSIP1 wzrost , _at BAG2 redukcja , _at ABAT wzrost , _s_at MAP2K7 wzrost , _s_at HSP90AA1 wzrost , _s_at HSPA4 wzrost , _s_at IPO5 wzrost , _at IL4I1 wzrost , _s_at TNPO1 wzrost , _x_at HSPA8 wzrost ,14 Tabela 4. Geny różnicujące dla Borrelia garini ID genu Symbol genu GeneSpring Zmiana p-value FC 65493_at HEATR6 wzrost , _at PTGES3 redukcja , _s_at FKBP4 Redukcja , _s_at HSBP1 Redukcja , _at KPNA1 Redukcja , _at DNAJB2 Wzrost , _s_at LYN redukcja , _s_at PPP2R1B redukcja E-4-1, _at IL1R1 wzrost , _at HMOX1 wzrost , _at POM121 wzrost , _s_at HSPH1 redukcja , _s_at FGF1 redukcja ,06 80

81 209459_s_at ABAT redukcja , _s_at GPR37 redukcja , _at IPO5 redukcja , _at NCAPD3 redukcja , _at CAMK2A redukcja E-4-1, _s_at EP300 wzrost , _x_at XYLT1 redukcja , _at POLR2D redukcja , _x_at DAXX redukcja , _at BAG4 redukcja , _at CASQ1 wzrost ,1 Tabela 5. Geny różnicujące dla Borrelia afzeli ID genu Symbol genu GeneSpring Zmiana p-value FC _s_at AP2B1 wzrost , _at SOD1 redukcja , _s_at HYOU1 wzrost , _at MAPKAPK2 wzrost , _at KPNA1 wzrost , _at BAG1 wzrost , _s_at HSPBP1 redukcja , _s_at NUP88 redukcja , _at BAK1 wzrost , _at FGF1 wzrost , _s_at DNAJA3 wzrost , _s_at ABCB8 redukcja , _s_at SERPINH1 wzrost , _s_at PKLR wzrost , _s_at NTRK1 redukcja E-4-1, _at TGFB1I1 wzrost , _s_at SPAG6 redukcja , _at PTGER3 wzrost , _s_at BAG1 redukcja , _s_at HSPA2 wzrost , _s_at DHX9 wzrost , _s_at POM121C wzrost , _at KPNA4 wzrost , _s_at CCL2 redukcja , _at DNAAF5 wzrost , _at DCPS redukcja , _s_at C11orf73 redukcja , _s_at ARPP21 redukcja ,11 81

82 Tab. 6. Geny wspólne dla wszystkich grup transkryptomów ID genu Symbol genu P-value GeneSpring A vs K G vs K SS vs K _s_at HSPD1 5.24E-4-1,12-1,23 1, _s_at THBS ,03 1,21-1, _at TRAP1 5.17E-4-1,16-1,08 1, _s_at TPR ,69-1,84 1, _s_at DAXX ,23 1,25-1, _at MTOR ,09-1,15 1, _at HSPA ,24-1,27 1, _at DNAJB ,21-1,38 1, _x_at PPID ,58 1,18-1, _x_at NF ,55 1,29-1, _s_at ATF ,27-1,34 1, _at STAC ,34 1,30-1, _x_at KPNB1 4.61E-4-1,07-1,12 1, _s_at KPNB ,13-1,27 1, _at DNAJA ,30 1,32-1, _at ST8SIA ,07-1,06 1, _s_at NF1 7.64E-4-1,28-1,34 1, _x_at APAF ,15 1,17-1, _s_at HSP90AA1 5.17E-4-1,18-1,16 1, _s_at MKI ,30-1,34 1, _at NUP ,18-1,29 1, _at MAPK ,22-1,31 1, _s_at DNAJC ,17-1,20 1, _at CAMK2G ,20 1,14-1, _at NUP E-4-1,43-1,31 1, _at CDC37L ,40 1,30-1, _at NUP ,21-1,13 1, _s_at KPNA ,33-1,38 1, _s_at SEH1L ,20-1,24 1,29 Literatura: 1. Bajzert J, Gorczykowski M, Galli J, Stefaniak T The evaluation of immunogenic impact of selected bacterial, recombinant Hsp60 antigens in DBA/2J mice.microbial Pathogenesis. 115: Bednarczyk M, Zmarzły N, Grabarek B, Wojdas E, Gola J, Asman M, Solarz K, Strzelczyk J, Zalewska-Ziob M, Wielkoszyński T, Kurek J, Koleżyńska B, Walkiewicz K, Mazurek U, Muc-Wierzgoń M Profil ekspresji genów związanych ze szlakiem degradacji białek zależnym od ubikwityny u pacjentów chorych na boreliozę. Stawonogi. W środowisku miejskim i podmiejskim. Lublin: Koliber Braga A, Carneiro B. M, Batista M. N, Akinaga M. M, Bittar C, Rahal P Heat shock proteins HSPB8 and DNAJC5B have HCV antiviral activity. PLS One. 12(11): Cook M. J Lyme borreliosis: a review of data on transmission time after tick attachment. In.t J. Gen. Med. 8: Craig E. A Hsp70 at the membrane: driving protein translocation. BMC Biology. 82

83 16: Curveo AM., Wong E Chaperone-mediated autophagy roles in disease and aging. Cell Research. 24: Deville C, Carroni M, Franke K. B, Topf M, Bakau B, Mogk A, Saibil H, R Structural pathway of regulated substrate transfer and threading through an Hsp100 disaggregase. Sci. Adv. 3: Ezemakuda A. N, Wang Y, Li X Expression of CeHSP17 Protein in Response to Heat Shock and Heavy Metal Ions. J. Neomatology. 49(3): Gonzalez-Aravena M, Calfio C, Mercado L, Morales-Lange B, Bethke J, Lorgeril J, Cardenas C HSP70 from the Antarctic sea urchin Sterechinus neumayeri: molecular characterization and expression in response to heat stress. Biol. Res. 51: Herrin B. H, Beal M. J, Feng X, Papes M, Little S. E Canine and human infection with Borrelia burgdorferi in the New York City metropolitan area. Parasites&Vectors. 11: Hou X, Xu J, Hao Q, Xu G, Geng Z, Zhang L Prevalence of Borrelia burgdorferi sensu lato in rodents from Jiangxi, southeastern China region. Int. J. Clin. Exp. Med. 7 (12): Muc-Wierzgoń M, Bednarczyk M, Nowakowska-Zajdel E, Kokot T, Wierzgoń A, Gola J, Dudek S, Rozwadowska B, Jasik K, Kozieł P, Walkiewicz K, Mazurek U mrna DUSP - the dual specifity phosphatases in fibroblast cells infected Borrelia burgdorferi. W: Stawonogi. Zależności w układzie żywiciel-ektopasożyt-patogen. Lublin: Koliber: Peacock B. N, Gherezghiher T. B, Hilario J. D, Kellermann G. H New insights into Lyme disease. Redox Biology. 5: Pedretti G, Tornero J, Fernandes-Nebro A, Blanco F, Gonzales-Alvaro I, Canete J. D, Maymo J, Alperiz M, Olive A Variation at FCGR2A and Functionally relates genes in assiociated with the response to anti TNF therapy in RA. PLOS ONE Pun S. B, Agrawal S, Jha S, Bhandari N, Chalise B. S, Mishra A, Shah R First report of Lyme disease in Nepal. JMM Case Report. 5: Rutz D. A, Luo Q, Freiburger L, Madl T, Kaila V. R, Sattlr M, Buchner J A switch point in the molecular chaperone Hsp90 responding to client interaction. Nature Communicate. 9: Sable A, Rai K. M, Choudhary M, Yadav V. K, Agarwal S. K, Sawant S. V Inhibition of Heat Shock proteins HSP90 and HSP70 induce oxidative stress, suppressing cotton fiber development. Sci. Rep. 8: Schüler W, Bunikis I, Weber-Lehman J, Comstedt P, Kutschan-Bunikis S, Stanek G, Huber J, Meinke A, Bergström S, Lundberg U Complete Genome Sequence of Borrelia afzelii K78 and Comparative Genome Analysis. PLOS ONE. 10 (3): Srisutthisamphan K, Jirakanwisal K, Ramphan S, Tongluan N, Kuadkitkan A, Smith D. R Hsp90 interacts with multiple dengue virus 2 proteins. Sci. Rep. 8:

84 84

85 Influence of Borrelia afzelii on hepatocytes in cell culture conditions Marta Łoboziak 1 *, Hubert Okła 2, Krzysztof P. Jasik 1 * 1Depatrment of Skin Structural Studies, Medical University of Silesia in Katowice, School of Pharmacy with the Division of Laboratory Medicine in Sosnowiec, Kasztanowa 3, Sosnowiec , martaloboziak@wp.pl *, kjasik@sum.edu.pl * 2Institute of Materials Science, Faculty of Computer Science and Materials Science, University of Silesia in Katowice, Chorzów, ul. 75 Pułku Piechoty 1A, , Poland ABSTRACT Borrelia burgdorferi s.l.. is responsible for symptoms of Lyme disease. Lyme disease is the most common tick-borne disease in Europe and North America, which presents numerous diagnostic and therapeutic problems. All mechanisms of the pathogenicity have not been identified jet. In addition, there is no vaccine against this patogen. The treatment process is long and complicated. Many patients suffer from the effects of the infection until the end of their lives. That is why it is so important to learn more about this patogen. The experiment was created to confirm the ability of Borrelia afzelii spirochetes to penetrate and survive inside hepatocytes in cell culture conditions. The phenomenon of colonization of connective tissue and cell penetration allows spirochetes to avoid host immune response and creates good conditions for prolonged stay in the body. During the study hepatocytes AML 12 (Alpha Mouse Liver 12 cell line) was cultured and subsequently infected with B. afzelii VS 461 (ATCC 51567). Co-culture was conducted for 24, 48 and 72 hours, control was 48 hours uninfected culture of hepatocytes AML 12 (Alpha Mouse Liver 12 cell line). Routine work material was prepared and observed using electron microscopy. Studies have confirmed the ability of Borrelia spirochetes to penetrate and survive inside cells. The ability of Borrelia spirochete to induce necrotic death has also been observed. Necrosis in vivo stimulates the inflammation of the organs, as observed in the Lyme disease. The high activity of host immune mechanisms promotes tissue damage through autoimmune reactions. Research on the physiology and pathogenic mechanisms of B. burgdorferi s.l. spirochetes offers the opportunity to discover effective and universal diagnostic tests and to hopefully develop new treatment regimens. Polish National Institute of Public Health observes, that the number of diagnosed cases of borreliosis are increasing rapidly. The most desirable result of the research is to discover a protective vaccine against Lyme disease. Introduction Bacteria of the genus Borrelia were discovered by Willy Burgdorfer et al. in 1982 from hard-bodied ticks of the genus Ixodes scapularis. The genus Borrelia are morphologically very similar and are difficult to distinguish biochemicaly. Borrelia burgdorferi s.l. is the causative agent of Lyme disease, recently the Lyme disease is the most common tick-borne disease described in Europe and the Northern America. These bacteria are transmitted by the infected ticks. Ticks play a major role in the spread of many pathogenic microorganisms. Lyme disease is a multisystem disease involving many organs, different manifestations depends on geographical distribution, pathogenic potential, and tissue tropism. Symptoms may affect a number of organs and systems, especially the skin, the nervous system (central and peripheral), the osteoarticular system and cardiovascular system (the myocardium). Lyme disease is distinguished by three stages of the disease: early localized, early disseminated and late. 85

86 B. burgdorferi bacteria show morphological variability depending on the environment. They can produce L forms and so-called blebs, also show the ability to change surface antigens. These features allow survival in adverse conditions, avoiding an immune response. In Lyme disease there are disorders of cellular immunity and reduced ability to phagocytosis observed, which may contribute to the chronicity of the disease process. In recent years, attention is drawn to the highly probable contribution of autoimmune reactions in the pathogenesis of Lyme disease, which may be responsible for the persistence of the disease process, even after eradication of infection Untreated bacteria could disseminates to distal areas, result in carditis, uveitis, arthritis and neuroborreliosis of the central or peripheral nervous systems (CNS and PNS). After treatment, symptoms like muscle and joints pain, cognitive difficulties, dysesthesia and fatigue can persist these manifestations are called post-treatment Lyme disease syndrome (PTLDS). The liver plays a fundamental role in maintaining homeostasis of the body and participates in most of the processes occurring in the human body. For these reasons, the characteristics of liver damage may occur in the course of most diseases, including diseases with bacterial etiology. Most often, this organ is affected by an increase in ALT and AST activity, less frequently by jaundice or hyperbilirubinemia. In the early stage of Lyme disease as a result of dissemination of spirochetes through the blood, the liver may also become involved. Damage to hepatocytes at this stage of the disease may be the result of direct liver invasion by B. burgdorferi spirochetes or due to systemic or local immune response initiated by spirochete infection. Pro-inflammatory cytokines are responsible for damage to hepatocytes, which will manifest with ALT and AST increase. Experimental studies confirmed the possibility of invading the B. burgdorferi spirochete to various organs of animals, including the heart and liver. Microscopic observation of histological changes in rat liver show changes in the perisinusoidal space. This damage could be responsible for liver disfunction included cirrhosis. The aim of this study was to demonstrated the impact of B.afzelii on hepatocytes in cell culture condition. Material and Methods Cell culture A hepatocytes AML 12 (Alpha Mouse Liver 12 cell line) was used in this study. Cells were cultured in Nunc cell culture dishes. The culture was carried out in the laminar box. In experiment was uded DMEM-F12 medium (Dulbecco's modified Eagle's medium and Ham's F12 medium) with insulin, transferrin, selenium, dexamethasone and fetal calf serum (10%). Cells were cultured in 37 C, in microaerophilic conditions (the carbon dioxide constituted % gaseous phase above medium). Cells during the culture were observed in microscope and passaged to keep proper physiological condition of hepatocytes. Bacterial culture In the experiment, a B. afzelii strain capable of infecting human cells was used - VS 461 (ATCC N o 51567). They were cultured in Department of Skin Structural Studies (School of Pharmacy with the Division of Laboratory Medicine in Sosnowiec, Medical University of Silesia in Katowice, Poland) in BSK-H culture medium (Barbour'a, Stoenner'a, Kelly'ego; Sigma-Aldrich, St. Louis, MO, USA) in 35 o C under microaerophilic conditions. After 10 days of bacterial growth a microscopic analysis of the culture was carried and average number of spirochetes in 1 ml of medium was calculated in the Bürker chamber. To ensure microaerophilic conditions, the bacterial suspension was placed in sterile GENbags. The culture was kept in the incubator for ten days. After this time, the suspension of B. afzelii spirochetes was used as an inoculum for fibroblast infection. B. afzelii was added to hepatocytes in 10:1 ratio, then culture was kept for 24,48 and 72 86

87 hours for hepatocytes. As control was used hepatocytes 48 hours culture without bacteria. At the end of the infection time, the fixation was performed. For this purpose, the culture fluid was poured and the monolayer of fibroblast was covered with solution of the 2,5% paraformaldehyde. The fixation was carried out for 3 hours. Cells after fixation were washed twice with PBS and re-fixed with 1% OsO4 in phosphate buffer for 30 min without the access of the light. After this stage material was washed with PBS twice. Fixed material before placement in the resin was dehydrated and gradually impregnated with epoxy resin. As a dehydraiting agent, several ethanol solutions with increasing concentration and acetone were used. At the end, the material was covered with a 1: 1 mixture of epoxide and acetone and stand for 2 hours. After this time, the bottles with cultures were opened to let acetone to evaporate. The next day the medium was replaced with an acetone-free epoxy mixture. After embedding the material, the epon mixture polymerized at 60 C for 3 days. The material thus prepared was cut using ultramicom to obtain ultra-thin sections. The material was collected on copper nets and contrasted with uranyl acetate and lead citrate. Then observed in a transmission electron microscope Hitachi H-500 at an accelerating voltage of 80 kv. Result Transmission electron microscopy (TEM) Hepatocytes from the control group showed high physiological activity and normal development. Plasmalemma of hepatocytes was unbroken. Normal intracellular structures was observed [Fig.1]. After 24 hours vacuolization of fibroblasts is observed. Vacuoles lokalized near nukleus [Fig.2]. After 48 hours rise in the amount of vacuoles is observed. Cytoplasm become thicker. Remaining structures such as mitochondria and RER seem to be correct [Fig.3]. Finaly after 72 hour coculture of hepatocytes and B. afzelii many signs of necrosis was visible. Characteristic was vacuoles and lipid drops accumulation that show the metabolism disfunction [Fig.4, 5, 6]. A change of the shape of hepatocytes and a structural disintegration of the cell are visible. The nucleus of hepatocytes show necrosis character. In the hepatocyte's cytoplasm dark stained dots are noticed, whose shape and size suggest that these are cross-sections of intracellular B. afzelii spirochetes [Fig.6]. Cell membrane seems to be discontinuous. Discussion Despite considerable progress in research methods and the application of many modern technologies various aspects of the pathogenicity of B. burgdorferi s.l spirochetes stay without the explanation. To avoid mechanisms of immune response B. burgdorferi s.l spirochetes use the change of surface antigens, inactivation of the complement cascade and colonize immune-privileged regions. One way to avoid a response from the immune system of mammalian host is persisting inside the cell, what protects the bacteria from the immune response and antibiotics. Conducted examinations showed, that B. afzelii spirochetes have an ability to initiate the necrosis in infected hepatocytes. The basic indicator of the necrosis was a large number of vacuoles and lipid drops present in hepatocytes. Necrosis starts a strong inflammatory response, which is describe as one of main injuring mechanisms of host tissues in Lyme disease. The main purpose of this research was to demonstrate the ability of B. afzelii spirochetes to survive inside hepatocytes that show their tissue tropism. Spirochetes colonize privileged places, where they have the best possible conditions for the development of infection. As a result of the collapse of local protective mechanisms and insufficiently production of antibodies spirochete can spread throughout the whole body. The infection most often affect intracellular spaces of the endothelium, fibroblasts, bone-joint system and central nervous system, where spirochetes are protected from the immune response and antibiotics. The study with electron microscopy allowed to prove the 87

88 ability of spirochetes to penetrate hepatocytes AML 12 lines. Apoptosis of hepatocytes is one of the causes of liver damage. Increased apoptosis of hepatocytes is closely related to the onset of inflammation and fibrosis of the liver. As a result of apoptosis, liver fibrosis occurs which leads to pathological reconstruction cirrhosis. Which can lead to portal hypertension and liver failure. Most acute and chronic liver diseases result from apoptosis of liver cells and fibrosis of liver tissue. During the acute phase of the infection, apoptotic processes are observed more severely than in the chronic phase. Hepatic dysfunction in Lyme disease was first described by Steere et al. in Three cases of early Lyme disease were described, where no liver fibrosis and liver cirrhosis were observed, but spirochetes were fund. Steere et al. observed the presence of symptoms of benign hepatitis in 10% of patients with present erythema migrans. In a physical examination, some of these patients had transient hepatomegaly. In laboratory tests ALT and AST activity increase was observed. Kazakoff et al. showed that about 27% of patients diagnosed with early disseminated Lyme disease had abnormal liver function tests. The few histopathological examinations of liver biopsies in patients with early disseminated Lyme disease also showed spirochetes in the hepatic sinuses and parenchyma. The study showed a negative effect of B. afzelii on hepatocytes. The necrotic and apoptotic deaths are activated. Thanks to the image, from the electron microscope, we see changes in the size of the cell and its organelles, primarily mitochondrion and the endoplasmic reticulum. The formation of vacuole and their enlargement, the shape of the nucleus and the condensation of the cytoplasm were also observed. Referring to mentioned studies, the ability of spirochetes to colonize hepatocytes has been demonstrated. There is no scientific evidence of chronic Lyme borreliosis be it due to either microbiological failure of appropriate antibiotic treatment, antibiotic resistance, or pathogen persistence after correct treatment. Furthermore, there are also no records of a reactivation of hypothetically latently persisting B. burgdorferi among immunocompromised hosts, as can be observed in latent infections due to intracellularly persisting pathogens. However, if unrecognised and untreated, Borrelia infection can cause persisting and increasing symptoms over months. To sum up, the study with using of electron microscopy showed, that spirochetes B. afzelii demonstrate a tropism towards hepatocytes. B.afzelii can adhere to the surface of human cells and penetrate them. B. afzelii infection may lead to liver dysfunction and liver damage. Conclusions Spirochetes B. afzelii can penetrate hepatocyte's cell membrane and survive inside them. Intracellular staying helps avoiding the immune response of the host and makes favourable environmental conditions for the infection. Spirochetes B. burgdorferi s.l. have impact on functioning of cells, especially intracellular signaling and metabolic pathway, which activation result in necrosis and apoptosis. 88

89 List of illustrations Fig. 1: Cross sections through the layer of the cell culture in vitro of hepatocytes TEM: Basement membrane (MB), Mitochondrion (Mt), Rough endoplasmic reticulum (RER), Nucleus (N), Microvilli (Mc) 89

90 Fig. 2: Cross sections through the layer of the coculture in vitro of hepatocytes and B. afzelli (24 h) TEM: Basement membrane (MB), Rough endoplasmic reticulum (RER), Nucleus (N), Vacuoles (V) Fig. 3: Cross sections through the layer of the coculture in vitro of hepatocytes and B. afzelli (48 h) TEM: Basement membrane (MB), Vacuoles (V), Mitochondrion (Mt) 90

91 Fig.4: Cross sections through the layer of the coculture in vitro of hepatocytes and B. afzelli (72 h): Basement membrane (MB), Mitochondrion (Mt), Rough endoplasmic reticulum (RER),Lipid drops (L) Fig. 5: Cross sections through the layer of the coculture in vitro of hepatocytes and B. afzelli (72 h): Basement membrane (MB), Mitochondrion (Mt), Lipid drops (L) 91

92 Fig. 6: Cross sections through the layer of the coculture in vitro of hepatocytes and B. afzelli (72 h): Basement membrane (MB), Nucleus (N), Lipid drops (L), Vacuole (V), B. afzelii strains (arrows) Literature 1. Bhate C, Schwarz RA Lyme disease: Part I. Advances and perspectives. JAAD. 64: Burgdorfer W, Barbour AG, Hayes SF, Péter O, Aeschlimann A Erythema chronicum migrans--a tickborne spirochetosis. Acta Trop : Chmielewski T, Dunaj J, Gołąb E, Gut W, Horban A, Pancewicz S, Puacz E, Szelenbaum-Cielecka D, Tylewska-Wierzbanowska S Diagnostyka Laboratoryjna chorób odkleszczowych. Gaudium Lublin. 1: Chmielewski T, Tylewska- Wierzbanowska S Inhibition of fibroblast apoptosis by B. afzelii, C. burnetti and B. hanselae. Polish Journal of Microbiology. 60(3): Chmielewski T, Tylewska- Wierzbanowska S Interactions between Borrelia burgdorferi and mouse fibroblasts. Polish Journal of Microbiology. 59(3): Cooper ML., Laxer JA, Hansbrough JF The cytotoxic effects of commonly used topical antimicrobial agents on human fibroblasts and keratinocytes. Journal of Trauma and Acute Care Surgery Donskow-Schmelter K. i Doligalska M Apopoza jako mechanizm ochronny dla patogenów i ich żywicieli. Wiadomości Parazytylogiczne. 51(4): Duray PH, Yin SR, Ito Y, Bezrukov L, Cox C, Cho MS, Fitzgerald W, Dorward D, Zimmerberg J, Margolis L Invasion of human tissue ex vivo by Borrelia burgdorferi. Journal of Investigative Dermatology. 191: Eitecka- Knysz E, Klimczak M, Lakwa K, Zajkowska J, Pancewicz S, Kondrusik M, Grzegorczuk S, Świerzbińska R, Harmanowska- Szpakowicz T Borelioza: dlaczego diagnostyka jest tak trudna? Diagnosta laboratoryjny: Gałęziowska E Borelioza- problem z diagnostyką laboratoryjną. AlmaMater. 4(77):

93 11. Guicciardi M. E. i wsp Apoptosis and Necrosis in the Liver. Comprehensive Physiology. 3: Kępa L., Stolarz W., Oczko-Grzesik B., Boroń-Kaczmarska A Odczyny wątrobowe w boreliozie z Lyme. Hepatologia 2016; 16: Kondrusik M, Grygorczuk S, Skotarczak B, Wodecka B, Rymaszewska A, Pancewicz S, Zajkowska J, Świerzbińska R, Hermanowska-Szpakowska T Molecular and serological diagnosis of Borrelia burgdorferi infection among patients with diagnosed Erythema Migrans. Annals of Agricultural and Environmental Medicine Journal. 14: Li C, Motaleb A, Sal M, Goldstein SF, Charon NW Spirochete Periplasmic Flagella and Motility J. Mol. Microbiol. Biotechnol. 2: Love AC, Schwartz I, Petzke MM Borrelia burgdorferi RNA induce type I and III interferons via Toll- like receptor 7 and contributes to production of NF-κB- dependent cytokines. Infection and Immunity Journal. 82(6): Maroszyńska-Dmoch E, Beata Wożakowska-Kapłon B Borelioza z Lymeniedoceniany problem w praktyce kardiologa. Folia Cardiologica Excerpta, tom 3, nr 8.9, Murray PR, Rosenthal KS, Pfaller MA Mikrobiologia. Wrocław: Elsevier Urban & Partner Norris SJ. How do Lyme Borrelia organisms cause disease? The quest for virulence determinants The Open Neurology Journal. 6: Panelius J, Meri S. Complement system in dermatological diseases- fire under the skin Frontiers in Medicine. 20. Rizzoli A, Hauffe HC, Carpi G, Vourc h GI, Neteler M, Rosá R Lyme borreliosis in Europe. Euro Surveill. 16 (27). 21. Rozwadowska B, Albertyńska M., Okła H, Jasik KP, Swinarew AS, Mazurek U, Dudek S, Urbańska-Jasik D, Izabela Poprawa I Induction of Apoptosis in Normal Human Dermal Fibroblasts Infected with Borrelia burgdorferi Sensu Lato. Vector-Borne and Zoonotic Diseases. 17: Rudnicka K.W., Szczesna E., Miszczyk E., Mikolajczyk-Chmiela M Apoptoza i Autofagia mechanizmy i metody detekcji. Postępy biologii komórki. 2: Schramm F, Kern A, Barthel C, Nadaud S, Meyer N, Jaulhac B, Boulanger N Microarray analyses of inflammation response of Human Dermal Fibroblasts to different strains of Borrelia burgdorferi sensu stricto. PLsS One. 7 (6): Stanek G, Wormser GP, Gray J, Strle F Lyme borreliosis. Lancet. Sep 6;6736(11): Steere AC, Coburn J, Glickstein L Lyme borreliosis. TickBorne Diseases of Humans. Goodman JL, Dennis DT, Sonenshine DE, ASM Press, Washington; Szymczak A Choroby wątroby o etiologii bakteryjnej. Zakaźne choroby wątroby i dróg żółciowych. Simon K (red.). Termedia, Poznań 2015; Tee SI, Martinez-Escanamé M, Zuriel D, Fried I, Wolf I, Massone C, Cerroni L Acrodermatitis Chronica Atrophicans with pseudolymphomatous infiltrates. The American Journal of Dermatopatology. 35 (3): Tilly K, Rosa PR, Stewart PE. Biology of Infection with Borrelia burgdorferi Infect Dis Clin North Am. 22: Zajkowska JM, Dunaj J. Borelioza z Lyme Diagnostyka laboratoryjna, trudności i wyzwania. Forum Zakażeń. 4 (4): Zhao X, Norris SJ, Liu J Molecular Architecture of the Bacterial Flagellar Motor in Cells. Biochemistry. 53:

94 94

95 Profil ekspresji genów kodujących czynniki restrykcyjne w komórkach zakażonych krętkami Borrelia. Expression profile of genes coding restriction factors in cells infected with Borrelia spirochete. Emilia Wojdas 1,2, Aleksandra Skubis 1, Bartosz Sikora 1, Sławomir Dudek 3, Urszula Mazurek 1 1Zakład Biologii Molekularnej Katedry Biologii Molekularnej, 2Zakład Analizy Instrumentalnej Katedry Analizy Instrumentalnej, 3Katedra i Zakład Farmakognozji i Fitochemii, Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, Śląski Uniwersytet Medyczny, Katowice. Autor korespondencyjny: emilia.wojdas@med.sum.edu.pl Wstęp Ryzyko ekspozycji na kleszcze, a tym samym możliwość transmisji na człowieka patogenów, których rezerwuarami są te stawonogi, nieustannie wzrasta. Sprzyjające warunki zapewnia promocja wypoczynku na świeżym powietrzu i łagodny klimat, zwłaszcza w porze zimowej. Odkleszczowa choroba z Lyme, wywoływana jest przez Gram ujemne krętki Borrelia burgdorferi (B.b.), dostające się do organizmu człowieka za pośrednictwem penetrującego ludzką skórę, zakażonego kleszcza (z jego śliną lub wymiocinami) (Wójcik- Fatla A. i wsp. 2009, Parada-Turska J. 2013). Zgodnie z danymi Państwowego Zakładu Higieny (Pracownia Monitorowania i Analizy Sytuacji Epidemiologicznej) w Polsce stale odnotowywany jest wzrost liczby zachorowań na boreliozę ( Szacuje się, że każdego roku zapada na tę chorobę, co najmniej 40 tys. osób, co obrazuje skalę problemu. Dodatkowych trudności diagnostycznych nastręcza brak jednoznacznego obrazu klinicznego i objawów (Godek A. 2014, Moniuszko A. i wsp. 2015, Stawicki T. 2017). Na potrzeby diagnostyki przebieg choroby został podzielony na 3 etapy: pierwszy, w którym z największym prawdopodobieństwem może wystąpić rumień wędrujący (EM, erytema migrant), manifestujący się jedynie w 30% przypadków zakażeń oraz towarzyszące ewentualnie niespecyficzne bóle głowy, mięśni, stawów i ogólne zmęczenie. W drugim etapie (około 3-6 miesięcy po kontakcie z zakażonym kleszczem) mogą ujawnić się stany zapalne stawów, wątroby, mięśnia sercowego lub mózgu. W trzecim etapie (około 1-3 lat po kontakcie z zakażonym kleszczem) obserwowane są przewlekłe dolegliwości, którym towarzyszą rozległe stany zapalne i objawy neurologiczne. W dalszych stadiach neuroboreliozy może wystąpić porażenie nerwów czaszkowych, obwodowych, zaburzenia czucia, niedowłady kończyn oraz problemy z koncentracją i pamięcią. Należy jednak pamiętać, że przebieg i charakter objawów jest indywidualny i uzależniony od kondycji i ogólnego stanu zdrowia pacjenta (Moniuszko A. i wsp. 2015, Cook M. J. 2015, Stawicki T. 2017). Spośród 15 dotychczas poznanych genogatunków krętków Borrelia, 7 jest chorobotwórczych dla człowieka (B. burgdorferi sensu strictro, B. afzelii, B. garinii, B. bissetti, B. spielmanii, B. lusitaniae, B. valaisiana). Badania molekularne pozwoliły na wyodrębnienie trzech szczególnie patogennych dla człowieka genogatunków: Borrelia garinii, Borrelia burgdorferi sensu stricto, Borrelia afzelii. (Mączka I., Tylewska-Wierzbanowska S. 2010). Należy nadmienić, że w obrębie jednego genogatunku może istnieć ponad 100 różnych szczepów. Zdiagnozowanej boreliozie towarzyszy często koinfekcja wspomnianymi genogatunkami, w wyniku której pojawić się może mozaika objawów klinicznych, maskujących się nawzajem (Ramesh G. et al. 2008). Infekcja Borrelia garinii wiąże się z nasileniem objawów 95

96 neurologicznych, Borrelia burgdorferi sensu stricto często związana jest z objawami stawowymi, natomiast infekcji Borrelia afzelii często towarzyszą zmiany skórne (Ramesh G. et al. 2008, Peacock B. N. et al. 2015). Patogeny wnikające do organizmu człowieka inicjują reakcję immunologiczną miejscową lub uogólnioną. Krętki Borrelia, poprzez złożoną strukturę genetyczną (1500 sekwencji genowych i co najmniej 132 geny), skutecznie adaptują się do warunków panujących w organizmie ludzkim i dzięki wielu strategiom równie skutecznie unikają odpowiedzi immunologicznej (Mączka I., Tylewska-Wierzbanowska S. 2010, Stawicki T. 2017). Omawiane bakterie, dzięki obecnej wewnętrznej witce, wykazują zdolność ruchu i są w stanie wnikać do wnętrza komórek ludzkich. Jako patogeny wewnątrzkomórkowe adaptują się do nowego środowiska, gdzie w formie cyst pozostają nierozpoznane przez układ odpornościowy przez długie okresy latencji, nie dając objawów chorobowych i nastręczając trudności diagnostycznych (Błaut-Jurkowska J., Jurkowski M. 2015). Zakażenie ludzkich komórek przez patogeny wewnątrzkomórkowe, w tym Borrelia, spowodowane jest przełamaniem barier ochronnych, z których pierwszą linię stanowią białka zaliczane do grupy czynników restrykcyjnych (Hatziioannou, T., & Bieniasz, P. D. 2011). Z uwagi na istotną rolę w mechanizmach naturalnej odpowiedzi komórkowej, typowane geny kodujące omawiane białka mogą stanowić kluczowy cel terapeutyczny lub stać się platformą diagnostyczną zakażeń Borrelia. Cel pracy Celem niniejszej pracy była ocena zmian aktywności transkrypcyjnej genów (na poziomie mrna) kodujących czynniki restrykcyjne zarówno w zainfekowanych boreliozą komórkach ludzkich jak i krwi pobranej od pacjentów z tym schorzeniem. Materiały i metody Hodowla komórkowa Komercyjną linię komórek fibroblastów skóry NHDF (ang. Normal Human Dermal Fibroblasts CC-2511 line; Lonza, Basel, Switzerland) hodowano w układzie kokultury z krętkami. Ludzkie komórki, zarówno badane jak i kontrolne, hodowano w medium FGM (Lonza, Basel, Switzerland) w butelkach o powierzchni 25 cm 2 wyposażonych w filtry bakteriologiczne. Hodowlę krętków Borrelia burgdorferi sensu stricto, B. garinii i B. afzelii prowadzono w medium BSK-H (Barbour-Stoenner-Kelly, Sigma-Aldrich, St. Louis, MO, USA), w warunkach mikroaerofilnych i stałej temperaturze 37 o C. Po 7 dniach prowadzonej hodowli zliczono w komorze Bürker a średnią liczbę krętków w 1ml medium. Krętki Borrelia burgdorferi sensu stricto, B. garinii i B. afzelii dodano na 24 godziny do badanej hodowli komórek NHDF w stosunku 10:1 (krętki do fibroblastów). Krew pełna Krew pełną pobrano zgodnie z protokołem producenta zestawem BD Vacutiner, od pacjentów ze zdiagnozowaną boreliozą (szacowanie na podstawie poziomu przeciwciał klasy IgG i IgM). W wyniku klasteryzacji hierarchicznej piętnastoosobowa grupa badana została podzielona na 3 podgrupy: B1 liczącą 11 osób, B2 liczącą 3 osoby i B3, do której włączona została jedna osoba. Ze względu na liczebność podgrupy B3 wykluczono ją z dalszej analizy, której poddano grupy B1 i B2 oraz trzynastoosobową grupę kontrolną. Ekstrakcja całkowitego RNA Ekstrakcja kwasu rybonukleinowego została przeprowadzona zgodnie z protokołem izolacji odczynnikiem TRIZOL (Invitrogen Life Technologies, California, USA). Otrzymane ekstrakty oczyszczono zgodnie z zaleceniami producenta zestawem RNeasy Mini (Qiagen GmbH, Hilden, Germany). W celu jakościowej i ilościowej oceny ekstraktów całkowitego RNA dokonano rozdziału elektroforetycznego w 1% żelu agarozowym, barwionym bromkiem 96

97 etydyny. Ocenę ilościową przeprowadzono w oparciu o pomiar spektrofotometryczny przy długości dali 260nm, przy użyciu aparatu GeneQuant II (Amersham BioSciences ). Analiza mikromacierzowa i statystyczna Analizę ekspresji genów przeprowadzono z wykorzystaniem macierzy oligonukleotydowych Human Genome Arrays U133A (Affymetrix ). Selekcję sond reprezentujących geny z grupy czynników restrykcyjnych przeprowadzono w oparciu o dane zaczerpnięte z bazy Affymetrix Net Affx TM Analysis Center ( W kolejnym etapie realizacji eksperymentu zsyntetyzowano dwuniciowe cdna (SuperScript Choice system; Invitrogen Life Technologies, CA, USA), a następnie biotynylowane crna korzystając z BioArrayHighYield RNA TranscriptLabeling Kit (Enzo Life Sciences, New York, USA). Do fragmentacji crna zastosowano SampleCleanup Module Kit (Qiagen GmbH, Germany). Następnie płytki mikromacierzowe poddano hybrydyzacji ze specyficznymi sondami i poddano znakowaniu produktów kompleksem streptawidyna- fikoerytryna. Chipy mikromacierzowe odpłukano i skanowano, odczytując sygnały fluorescencji w aparacie GeneArray (Agilent) zgodnie z zaleceniami producenta (Affymetrix Gene Expression Analysis Technical Manual). Do analizy otrzymanych danych wykorzystano infrastrukturę PL- Grid ( program GeneSpring 13.0 i podstawowe narzędzia statystyczne stosowane rutynowo w analizach biologicznych. Wyniki Eksperyment rozpoczęto od analizy techniką mikromacierzy oligonukleotydowych (HGU-133A Affymetrix) transkryptomu (22283 mrna) hodowli ludzkich fibroblastów NHDF kontrolnych (K, monokultura NHDF) oraz poddanych kokulturze jednym z trzech genogatunków Borrelia: B. burgdorferi sensu stricto (SS), B. garini (G) oraz B. afzelii (A). Wyniki następnie znormalizowano wykorzystując metodę RMA (log 2). Analizie poziomu ekspresji poddano 105 mrna genów kodujących czynniki restrykcyjne, spośród których wyznaczono geny różnicujące. W toku dalszych analiz wykonano test ANOVA z poprawką Benjamina- Hochberg (Tab.1.), który umożliwił porównanie wszystkich analizowanych grup transkryptomów (SS, G, A) w odniesieniu do próby kontrolnej (K). Wynik wskazuje, że spośród 105 transkryptów, 40 ulega statycznie istotnej zmianie profilu ekspresji w stosunku do grupy kontrolnej. W analizie przyjęto stosowany w badaniach medycznych poziom istotności statystycznej p<0,05. Kolejno realizowany etap analizy obejmował przeprowadzenie testu post-hoc Tukeya, dającego możliwość wskazania liczby mrna różnicujących między sobą badane grupy (Tab.2.). Analizując dane przygotowano diagram Venna (Ryc.1.), czyli graficzną prezentację zbioru mrna genów różnicujących i wspólnych dla przeprowadzonych w grupach badanych porównań. Z analizy wynika, że 3 mrna są wspólne dla wszystkich badanych grup. Należą do nich transkrypty kodujące TRIM25 (ang. tripartite motif containing 25) białko odpowiedzialne za regulację szlaku sygnałowego wrodzonej odpowiedni immunologicznej za pośrednictwem interferonu-gamma i cytokin, CH25H (ang. cholesterol 25-hydroxylase) biało z rodziny oksydoreduktaz, wiążące jony żelaza, SERINC3 (ang. serine incorporator 3) białko o aktywności transportera transbłonowego L-seryny, zaangażowane w obronę komórkową poprzez pozytywną regulację wewnętrznego szlaku sygnalizacji apoptozy. W badanych grupach odnotowano wzrost ekspresji genów kodujących TRIM 25 i CH25H oraz spadek ekspresji genu SERINC3. Analogiczne przeprowadzono analizę eksperymentu, w którym materiał badany stanowiła krew pacjentów ze zdiagnozowaną boreliozą (grupy B1, B2 oraz grupa kontrolna). Analizie poziomu ekspresji również poddano 105 mrna genów kodujących czynniki restrykcyjne, spośród których wytypowano geny różnicujące. Wykonanie testu ANOVA z 97

98 poprawką Benjamina- Hochberg (Tab.3.), pozwoliło na porównanie dwóch analizowanych grup transkryptomów (B1 i B2) w odniesieniu do próby kontrolnej (K). Wynik wskazuje, że spośród 105 transkryptów, 95 ulega statycznie istotnej zmianie profilu ekspresji. W analizie przyjęto stosowany w badaniach medycznych poziom istotności statystycznej p<0,05. W tabeli (Tab.5.) przedstawiono wykaz transkryptów różnicujących badane grupy (B1 i B2) względem kontroli (K), kierunek zmiany ekspresji w analizowanych grupach wyznaczony na podstawie parametru FC (ang. fold change), wskazującego wielokrotność różnicy pomiędzy znormalizowanymi wynikami (log2) oraz analizę poziomu obserwowanych różnic, wyznaczoną przy pomocy parametru p (ang. p-value). Podobnie jak w analizie prowadzonej wobec materiału uzyskanego z hodowli komórkowej również we krwi pacjentów 3 mrna są wspólne dla wszystkich badanych grup. Należą do nich transkrypty kodujące PML (ang. promyelocytic leukemia) białko odpowiedzialne za regulację transkrypcji, wiążące DNA i zaangażowane w prawidłowy przebieg procesu apoptozy oraz dwa warianty sond dla genu SERINC3 opisanego wcześniej w pracy. W badanych grupach odnotowano wzrost ekspresji genów kodujących warianty genu PML oraz spadek ekspresji genu SERINC3. Dyskusja Wrodzona odpowiedź immunologiczna odgrywa kluczowe znaczenie w patogenezie schorzeń o podłożu bakteryjnym, w tym zakażeń krętkami Borrelia. Udowodniono, że w przebiegu choroby z Lyme dochodzi do osłabienia mechanizmów odpornościowych gospodarza, związanych z odpowiedzią swoistą i nieswoistą (Ramesh G. et al , Grygorczuk S. i wsp. 2007). Kluczową rolę, polegającą na ochronie przed rozwojem zakażenia wewnątrzkomórkowymi patogenami stanowią białka kodujące czynniki restrykcyjne, które na dzień dzisiejszy są atrakcyjnym celem terapii antyretrowirusowej (Kirchhoff, F. 2010, Zheng, Y.-H. et al.2012). Białka te cechuje wszechstronność: pełnią one funkcje regulacyjne, transportowe, wpływają na prawidłowość przebiegu procesów zachodzących w komórce (transkrypcja, translacja) oraz napędzają szereg kaskad związanych z obroną komórek (w szczególności szlak interferono-zależny) (Bae E.H. Jung Y.T. 2014). W niniejszej pracy badano zmiany aktywności transkrypcyjnej genów kodujących czynniki restrykcyjne zarówno w zainfekowanych trzema genogatunkami krętków Borrelia burgdorferi komórkach ludzkich fibroblastów jak i krwi pobranej od pacjentów z tą jednostką chorobową. Przeprowadzone badania wykazały, że zakażenie krętkami Borrelia ma bezpośredni wpływ na zmianę poziomu ekspresji genów kodujących czynniki restrykcyjne. W przypadku badania monoinfekcji in vitro, prowadzonego na hodowlach komórkowych odnotowano istotnie statystycznie zwiększony poziom ekspresji genów kodujących czynniki restrykcyjne w stosunku do grupy kontrolnej. Dla każdej z badanych grup udało się zidentyfikować mrna, które potencjalnie mogłoby stanowić przesłankę do dalszych badań pozwalających wyznaczyć markery molekularne. W przypadku infekcji komórek B. garini typowanymi markerami mogłyby być geny PML, TRIM 15, TRIM 32, APOBEC3G i ZC3HAV1. Potencjalnymi markerami infekcji komórek przez B. afzelii geny TRIM 27, TRIM 31, TRIM 1, TRIM 3, a infekcji B. burgdorferi sensu stricto BST2 i TRIM 17. Co istotne, każdy z wytypowanych transkryptów jest charakterystyczny tylko w przypadku infekcji danym genogatunkiem. Nadekspresja czynników znajdujących się w omawianej grupie niesie za sobą szereg pozytywnych dla zainfekowanej komórki zdarzeń- za pośrednictwem czynników restrykcyjnych dochodzi do aktywacji produkcji interferonu typu I, czynnika transkrypcyjnego NF-kappa czy aktywacji szlaku sygnałowego za pośrednictwem cytokin (dane baza NetAffx Query ). Na tym etapie konieczna jest analiza na poziomie białka, potwierdzająca, że z wytypowanych transkryptów powstaje funkcjonalne białko docelowe. Kolejne badania w tym zakresie powinny obejmować analizy uwzględniające koinfekcję genogatunkami. 98

99 Klasteryzacja hierarchiczna wyników otrzymanych po przebadaniu próbek krwi pobranej od pacjentów ze zdiagnozowaną boreliozą, podzieliła chorych na dwie grupy badane: B1 i B2. W obrębie obu grup odnotowano szereg czynników restrykcyjnych, których ekspresja została istotnie statystycznie zmieniona pod wpływem infekcji krętkami w stosunku do kontroli. Interesujący jest fakt, że w obu grupach obserwowany jest spadek ekspresji genów kodujących czynniki: TRIM 23 i SERINC3. Białka kodowane przez te czynniki pełnią funkcje transportowe, uczestniczą w ubikwiynacji innych białek i wpływają pozytywnie na regulację szlaku sygnalizacji apoptozy (dane baza NetAffx Query ). Działanie antyapoptotyczne ułatwia krętkom adaptację do warunków panujących w komórce gospodarza. Zaburzenie prawidłowego przebiegu programowanej śmierci komórki ma istotne znaczenie w patogenezie chorób i umożliwia drobnoustrojom rozmnażanie się w zakażonych komórkach chroniąc się przed działaniem układu immunologicznego (Sokołowska J. Urbańska K , Rupniewska Z. i wsp. 2006). Tak w grupie B1 jak i B2 odnotowano istotny statystycznie wzrost ekspresji genów kodujących białka TRIM 15, TRIM 19 i TRIM 48. Rodzina białek TRIM liczy ponad 60 członków, zaangażowanych w różnorodne procesy biologiczne, w tym te, które wiążą się bezpośrednio z obroną komórkową i regulacją wrodzonej odporności (Mous K, et al. 2012). Nadekspresja genu TRIM 19, którego produkt pełni głównie funkcje białka sygnałowego, prowadzi do zatrzymania cyklu komórkowego lub inicjacji wejścia komórki w proces apoptozy, indukcji stanu zapalnego poprzez pozytywną regulację produkcji interleukin i aktywację odpowiedzi komórkowej (dane baza NetAffx Query ). Potwierdzenie potencjału markerowego typowanych mrna wymaga dalszych badań obejmujących analizy materiału pobranego od pacjentów z różnym zaawansowaniem boreliozy, w mono- i konfekcji. Poprawna diagnostyka i długofalowa terapią niosą za sobą niemałe koszty, a niedopełnienie procedur w tym zakresie może prowadzić do nieodwracalności procesu chorobowego. Błędne rozpoznanie pociąga za sobą koszty leczenia towarzyszącego oraz długotrwałą rehabilitację połączoną z niezdolnością chorych do pracy. Wygenerowane w ten sposób koszty mogą być redukowane odpowiednio prowadzoną profilaktyką i diagnostyką chorób odkleszczowych. Wyniki zaprezentowane w niniejszej pracy pokazują jak trudno wytypować jednoznaczne markery, mogące stanowić podstawę do usprawnienia detekcji infekcji krętkami Borrelia. Rozbieżności, obserwowane na poziomie wyników otrzymanych w eksperymencie w warunkach in vitro, w stosunku do wyników otrzymanych w toku analizy materiału klinicznego wskazują na trudność odtworzenia w warunkach laboratoryjnych skomplikowanej sieci zależności istniejącej w organizmie ludzkim. Należy mieć również na uwadze fakt, że w przypadku pacjentów najczęściej spotykane będą infekcje towarzyszące, tak innymi genogatunkami Borrelia, jak i innymi patogenami, które w istotny sposób mogą wpływać na sprawny przebieg procesów obronnych w organizmie. Nie można pominąć również kwestii dotyczącej zmienności osobniczej, jaką obserwuje się wśród pacjentów. Otrzymane wyniki nie pozwalają jednoznacznie ocenić, jaki obraz zmian profilu ekspresji genów kodujących czynniki restrykcyjne w odpowiedzi na zakażenie krętkami Borrelia można traktować, jako potencjalny wzór markerowy. Dalsze badania wymagają dopełniania, uwzględniając analizy na poziomie białka oraz typowanie markerów w układach mono- i koinfekcji. Wnioski Profil ekspresji genów kodujących białka z rodziny czynników restrykcyjnych jest zróżnicowany w badanych układach (w warunkach in vitro i krwi pełnej). Niezbędne są dalsze badania wykonane w materiale klinicznym, pozwalające ocenić, czy typowane geny TRIM 15, TRIM 19, TRIM 23, TRIM 48 oraz gen SERINC3 utrzymają swój potencjał markerowy. 99

100 Ostateczna ocena wartości markerowej typowanych genów wymaga analizy na poziomie białka oraz w różnych układach mono- i koinfekcji. Tabele i ryciny Tab.1. Wyniki jednoczynnikowej analizy wariancji ANOVA (z poprawką Benjamina- Hochberg), wskazujący liczbę mrna związanych z genami kodującymi czynniki restrykcyjne. Liczba mrna Wszystkie mrna P<0,05 P<0,02 P<0,01 P<0,005 P<0, Tab.2. Wynik testu post- hoc Tukeya (wielokrotnych porównań), wskazujący liczbę mrna różnicujących grupy poddane analizie (A, B, SS, K). Kolorem różowym zaznaczono liczę 40 mrna wyznaczonych testem analizy jednoczynnikowej ANOVA, jako różnicujące badane grupy transkryptów. Kolorem zielonym zaznaczono liczbę mrna reprezentatywnych dla różnicowania porównywanych grup transkryptomów przy założeniu, że wartość p< 0,05. Kolorem niebieskim- liczbę mrna, niereprezentatywnych w różnicowaniu porównywanych grup. Oznaczenie grupy G SS A K G SS A K Tab.3. Wyniki jednoczynnikowej analizy wariancji ANOVA (z poprawką Benjamina- Hochberg), wskazujący liczbę mrna związanych z genami kodującymi czynniki restrykcyjne. Liczba mrna Wszystkie mrna P<0,05 P<0,02 P<0,01 P<0,005 P<0, Przeprowadzono test post-hoc Tukeya, który pozwolił wyznaczyć liczbę mrna różnicujących między sobą badane grupy (Tab.4.). Tab.4. Wynik testu post- hoc Tukeya (wielokrotnych porównań), wskazujący liczbę mrna różnicujących grupy poddane analizie (B1, B2, K). Kolorem różowym zaznaczono liczę 95 mrna wyznaczonych testem analizy jednoczynnikowej ANOVA, jako różnicujące badane grupy transkryptów. Kolorem zielonym zaznaczono liczbę mrna reprezentatywnych dla różnicowania porównywanych grup transkryptomów przy założeniu, że wartość p< 0,05. Kolorem niebieskim- liczbę mrna, niereprezentatywnych w różnicowaniu porównywanych grup. Oznaczenie grupy B1 B2 K B B K

101 Tab.5.Wykaz transkryptów różnicujących badane grupy względem kontroli oraz kierunek zmiany ekspresji w analizowanych grupach. ID genu Symbol genu Zmiana p- vaule FC mrna różnicujące grupę B1 vs K 36742_at TRIM 15 I up 0, _s_at TRIM 38 down 0, _s_at TRIM 13 down 0, _s_at TRIM 23 down 0, _at TRIM 25 up 0, _at TRIM 15 II up 0, _at TRIM 29 up 0, _at TRIM 19 up 0, _x_at SERINC3 I down 0, _s_at TRIM 3 up 0, _x_at IFITM3 up 0, _at TRIM 45 up 0, _at TRIM 48 up 0, _at SERINC3 II down 0, _x_at SERINC3 III down 0, mrna różnicujące grupę B2 vs K 36742_at TRIM 15 up 0, _s_at TRIM 2 up 0, _s_at TRIM 23 I down 0, _s_at TRIM 31 up 0, _at TRIM 9 down 0, _at TRIM 10 I up 0, _s_at TRIM 5 down 0, _s_at TRIM 23 II down 0, _at TRIM 19 up 0, _x_at SERINC3 I down 0, _at TRIM 33 I up 0, _s_at TRIM 37 down 0, _at TRIM 33 II down 0, _at TRIM 44 down 0, _at TRIM 39 up 0, _at TRIM 68 down 0, _at TRIM 17 up 0, _at TRIM 48 up 0, _at SERINC3 II down 0, _x_at SERINC3 III down 0, _at TRIM 10 II up 0, *I, II, III- oznaczenia kolejnych wariantów sondy 101

102 Ryc.1. Diagram Venna przedstawiający liczbę mrna różnicujących transkryptomy w badanych grupach. Wytypowano 17 mrna wspólnych B. garini i kontroli (w tym 6 różnicujących), 14 mrna wspólnych dla B. burgdorferi sensu stricto i kontroli ( w tym 2 różnicujące) oraz 20 mrna wspólnych dla B. afzelii i kontroli (w tym 4 różnicujące). Spis literatury 1. Bae E.H. Jung Y.T Comparison of the Effects of Retroviral Restriction Factors Involved in Resistance to Porcine Endogenus Retrovirus. J. Microbiol. Biotechnol. 24 (4), Błaut- Jurkowska J., Jurkowski M Borelioza- aktualny stan wiedzy. Przegląd Lekarski 2015/ 72/ 11: Cook M. J Lyme borreliosis: a review of data on transmission time after tick attachment. In.t J. Gen. Med. 8: Godek A Nowoczesne metody leczenia boreliozy z konfekcją (antybiotyki, żywienie). Medycyna Rodzinna 3/ Grygorczuk S. i WSP Stężenie białka sfas i sfasl w hodowli komórek jednojądrzastych krwi obwodowej chorych z późną Boreliozą z Lyme. Przegl. Epidmiol Hatziioannou, T., & Bieniasz, P. D Antiretroviral Restriction Factors. Current opinion in virology, 1(6), Kirchhoff, F Immune Evasion and Counteraction of Restriction Factors by HIV- 1 and Other Primate Lentiviruses. Cell Host & Microbe, 8(1), Mączka I. Tylewska-Wierzbanowska S Cykl krążenia krętków Borrelia burgdorferi w środowisku. Post. Mikrobiol. 49: Moniuszko A. Dunaj J. Zajkowska J. Czupryna P. Świerzbińska R. Guziejko K. Aleksiejczuk P. Barry G. Kondrusik M. Pancewicz S Comparison of detection of Borreliaburgdorferi DNA and anti-borreliaburgdorferi antibodies in patients with erythema migrans in north-eastern Poland. Postep. Derm. Alergol. XXXII (1): Mous K, Jennes W, Camara M et al Expression analysis of LEDGF/p75, APOBEC3G, TRIM5alpha, and tetherin in a Senegalese cohort of HIV-1-exposed seronegative individuals. PLoS One; 7 (3): e

103 11. Parada-Turska J Stawowa postać boreliozy obraz kliniczny i leczenie. Reumatologia. 51(1): Peacock B. N. Gherezghiher T. B. Hilario J. D. Kellermann G. H New insights into Lyme disease. Redox Biology. 5: Ramesh G. Santana Gould L. Inglis F. England J. Phiipp T The Lyme disease spirochete Borrelia burgdorferi induces inflammation and apoptosis in cells from dorsal Root Anglia. 10: Rupniewska Z. Koczkodaj D. Wąsik- Szczepanek E BRUCE/ Apollon i jego rola w rodzinie białek hamujących apoptozy. Acta Hematologica Polonica. 37 nr3: s Stawicki T Analiza zapadalności na Boreliozę z Lyme w wybranych grupach pracowników leśnictwa w województwie zachodniopomorskim w latach Medycyna Pracy 2017; 68 (2): Sokołowska J. Urbańska K Biologiczna rola surwiwiny i jej kliniczne znaczenie.. Życie weterynaryjne. 86 (12). 17. Wójcik- Fatla A. Szymańska J. Buczek A Choroby przenoszone przez kleszcze. Część II. Patogeny Borrelia burgdorferi, Anaplasma phagocytophilum, Babesia microti. Zdr. Publ. 119 (2): Zheng, Y.-H., Jeang, K.-T., & Tokunaga, K Host restriction factors in retroviral infection: promises in virus-host interaction. Retrovirology, 9, Źródła internetowe: Baza NetAffx Query : ot 22. Strona Firmowa BioCare, Diagnostyka i terapia infekcji odkleszczowych 103

104 104

105 Zależność między profilem ekspresji IL12/23 a receptorami histaminowymi (HRH1-4) w przebiegu zakażenia Borrelia sp. Beniamin Grabarek 1, Nikola Zmarzły 1, Emilia Wojdas 1, Martyna Bednarczyk 2, Barbara Strzałka-Mrozik 1, Karol Juszczyk 1, Marek Asman 3, Urszula Mazurek 1 1Zakład Biologii Molekularnej Katedry Biologii Molekularnej, Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, 2 Katedra i Oddział Kliniczny Chorób Wewnętrznych, Wydział Zdrowia Publicznego w Bytomiu, 3 Zakład Parazytologii, Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, Śląski Uniwersytet Medyczny w Katowicach e mail: beniamin.grabarek@med.sum.edu.pl Wstęp Borelioza będąca przykładem zoonozy prozapalnej charakteryzuje się różnorodnością obrazu klinicznego, uzależnionego od genogatunku krętka, który przyczynił się do wywołania objawów. Najlepiej scharakteryzowanymi i poznanymi subtypami bakterii z rodzaju Borrelia są: B. burgdorferi, B. afzelii, B. garinii, B. burgdorferi i B. bavariensis. Podczas infekcji wywołanej przez wspomniane krętki można odnotować manifestację objawów dermatologicznych, reumatologicznych, neurologicznych oraz kardiologicznych. Z tego względu borelioza jest zarówno chorobą o złożonej etiologii i równocześnie, ze względu na szeroki przekrój objawów niezwykle uciążliwą dla chorego (Biesiada i wsp. 2010, Maroszyńska-Dmoch i wsp. 2013, Schüler and Bunikis 2015, Feng and Auwaerter 2015). Każdy z subtypu Borrelia sp. charakteryzuje się powinowactwem do określonego narządu. Infekcja wywołana przez B. burgdorferi skutkuje wystąpieniem zapaleniem stawów (ang. Lyme arthrisis), B. afzelii przyczynia się do rozwoju skórnej postaci choroby a z kolei B. garinii i B. bavariensis wykazują ukierunkowanie działania w stronę układu nerwowego (Schüler and Bunikis 2015). Skóra stanowi kluczowy element zakażenia przez Borrelia sp, gdyż w pierwszej kolejności manifestację zakażenia obserwuje poprzez wystąpienie rumienia wędrującego (50-80% przypadków) (Peacock and Gherezghiher 2015). Mimo, iż rumień nie występuje u wszystkich zakażonych oraz zanika w sposób samoistny w okresie do 4 tygodni od momentu kontaktu z krętkiem nie należy leczenia zaniechać lub przerwać przedwcześnie (Moniuszko and Dunaj 2015, Peacock and Gherezghiher 2015). Molekularnym przejawem zakażenia są zmiany profilu ekspresji genów kodujących cytokiny, czyli białka wydzielane przez szereg komórek naszego organizmu, biorących udział w procesach biologicznych. Do cytokin zaliczamy, m.in. czynnik martwicy nowotworu α (TNFα), transformujący czynnik wzrostu β (TGFβ), interleukiny (IL), interferon gamma (IFNγ). Implikacją zmian stężeń cytokin jest pobudzenie układu immunologicznego i indukowanie procesów zapalnych. W pierwszych etapach zoonozy objawy są mało charakterystyczne i z tego też względu borelioza stwarza problemy diagnostyczno-terapeutyczne. W przebiegu omawianego zakażenia obserwuje się: objawy grypopodobne, apatię, bóle stawów obwodowych, bóle o charakterze neuropatycznym (Cook 2014, Feng and Auwaerter 2015). Symptomami mogącymi sugerować ugryzienie przez kleszcza oprócz rumienia jest świąd i pieczenie skóry w miejscu kontaktu ze stawonogiem. 105

106 Ważną rolę w zapoczątkowaniu a następnie rozwoju procesu zapalnego odgrywają IL-12 oraz IL-23, których oddziaływanie z właściwymi receptorami powoduje aktywację kaskad sygnałowych i wzmożenie reakcji zapalnej. Interleukina 12 zbudowana jest z podjednostki p35 (IL12A) oraz p40 (IL12B) a interleukina 23 z podjednostki p19 (IL23A) oraz p40 (IL12B). Tym samym podjednostka p40 jest wspólna dla obu interleukin. Ponad to wydzielanie wspomnianych interleukin jest powiązane sekrecją i wzajemnymi oddziaływaniami innych cytokin (Teng et al 2015). Działanie IL-12 prowadzi do różnicowania populacji limfocytów Th 0 do Th 1 Intensyfikacja sekrecji IL-12 następuje pod wpływem: IL-18, TNF-α, IFNγ, natomiast obniżenie stężenia IL-12 jest powodowane przez interleukiny: IL-10, IL-11, IL-13. Z kolei IL-23 oddziałowują na subpopulację limfocytów T h17 oraz wspólnie z IL- 6, TGFβ uczestniczy w procesie różnicowania subpopulacji limfocytów T h0 do fenotypu T h17 (Teng et al. 2015, Duvalet et al. 2011). Natomiast występujące objawy świądu, zaczerwienienia, pieczenia i ocieplenia okolicy kontaktu z kleszczem przenoszącym krętki Borrelia sp. zdaje się sugerować zmiany w ekspresji histaminy i genów powiązanych z układem histaminergicznym (Derda i wsp. 2017). Histamina jest aminą biogenną powstającą w reakcji dekarboksylacji L-histydyny. Pełni rolę w procesie zapalnym, neurotransmisji, chemotaksji leukocytów, skurczu mięśni gładkich. Biologiczne efekty wywoływane przez histaminę odbywają się poprzez jej interakcję z receptorami histaminowymi HRH1-4 oraz receptor wewnątrzkomórkowy Hic (Panula et al. 2014).Uwolnienie histaminy w odpowiedzi na czynnik to wywołujący może nastąpić tylko z bazofili i komórek tucznych (Ciałkosiński i wsp. 2009). Cel badania Celem niniejszej pracy było zbadanie zmian profilu ekspresji mrna genów IL-12, IL- 23 oraz HRH1-4 u osób ze zdiagnozowaną boreliozą w porównaniu do kontroli, czyli osób zdrowych. Wyznaczenie profilu aktywności transkrypcyjnej analizowanych mrna pozwoli określić rolę białek kodowanych przez te geny w patogenezie zoonozy oraz zbadać czy i jakiego rodzaju występuje zależność pomiędzy analizowanymi transkryptami. Poprzez to możliwym stanie się określenie przydatności analizowania zmian ekspresji tych genów jako nowych, uzupełniających markerów molekularnych oraz wskazania ich jako nowych celi terapeutycznych leczenia boreliozy. Materiały i metody Krew pełna pobrana została od osób zdrowych (K) oraz chorych ze zdiagnozowaną i rozpoznaną boreliozą (B), którzy na podstawie klasteryzacji hierarchicznej z poprawką euklidesową, opierającą się występujących zmianach molekularnych zostali podzieleni na 4 podgrupy (B1, B2, B3, B4). Jednak do analiz uwzględniono podgrupę B1, B2, B4, gdyż podgrupa B3 było zbyt mało liczna. Ekstrakcja całkowitego RNA TRIZOL (Invitrogen Life Technologies, California, USA) to odczynnik wykorzystany do izolacji całkowitego RNA. Ekstrakcję kwasu rybonukleinowego wykonano zgodnie z rekomendacjami producenta. Następnie, uzyskane ekstrakty RNA zostały oczyszczone z wykorzystaniem zestawu RNeasy Mini (Qiagen GmbH, Hilden, Germany). Jakościowa i ilościowa ocena ekstraktów całkowitego RNA Jakościowa ocena uzyskanych izolatów RNA została przeprowadzona w oparciu o rozdział elektroforetyczny w 1% żelu agarozowym, który następnie w celu wizualizacji rozdziału całkowitego RNA został wybarwiony bromkiem etydyny. Drugi etap oceny dotyczył analizy ilościowej wyekstrahowanego RNA. W tym celu została przeprowadzona analiza spektrofotometryczna przy długości fali 260 nm, z wykorzystaniem aparatu GeneQuant II firmy Pharmacia Biotech (Uppsala, Szwecja) Analiza ekspresji genów z wykorzystaniem mikromacierzy oligonukleotydowych Pierwszy etap związany był z wykorzystaniem 8 μg RNA stanowiącego matrycę do syntezy 106

107 dwuniciowego cdna (SuperScript Choice system; Invitrogen Life Technologies, CA, USA). Drugi etap niniejszej analizy to synteza biotynylowanego crna ( BioArray HighYield RNA Transcript Labeling Kit; Enzo Life Sciences, New York, USA), który w następnej kolejności pofragmentowano (Sample Cleanup Module Kit (Qiagen GmbH, Germany) oraz poddano 16 godzinnej procedurze hybrydyzacji z sondami znajdującymi się na płytce mikromacierzowej HGU-133A. Następne etapy obejmowały: płukanie, barwienie kompleksem streptawidynafikoerytryna, zgodnie z protokołem dołączonym przez producenta. Ostatni etap wyznaczenia pozwalający określić profil mikromacierzowy to skanowanie mikromacierzy w skanerze GeneArray (Agilent). Do analizy otrzymanych wyników wykorzystano infrastrukturę PL- Grid ( wraz z programem GeneSpring Wyniki W pierwszym etapie analizy profilu mikromacierzowego mrna genów IL-12, IL-23 oraz HRH1-4 z ID mrna będących się na płytce mikromacierzowej HG-U133A wyselekcjonowano 211 ID mrna genów związanych z IL-12, IL-23 oraz HRH1-4. Drugi etap oparty był na jednoczynnikowej analizie wariancji ANOVA, co dało możliwość wyznaczenia genów różnicujących analizowane grupy (K, B1, B2, B4). Analizę przeprowadzano na poziomie istotności statystycznej p<0,05. Analiza wariancji ANOVA z poprawką Benjamini-Hochberg pokazuje, iż spośród 211 ID mrna, dla 176 obserwuje się istotną statystycznie zmianę wzoru ekspresji (Tab. 1.) Trzeci etap analizy statystycznej związany był z wykonaniem testu post-hoc Tukey`a (p<0,05), dzięki któremu możliwe było wskazanie liczby ID mrna różnicujących między sobą poddane analizie grupy (Tab. 2). Na podstawie testu post hoc Tukey`a obserwuje się, iż 45 ID mrna kodujących 36 mrna różnicuje podgrupę B1 od kontroli, 38 ID mrna kodujących 31 genów jest różnicującymi podgrupę B2 od kontroli. Z kolei 94 ID mrna odpowiadających 62 genom różnicuje podgrupę B4 od kontroli. Na diagramie Venn (ryc.1) przedstawiono liczbę ID mrna genów różnicujących dane grupy, specyficzne dla danej grupy, jak też wspólne dla przeprowadzonych porównań. Na jego podstawie można stwierdzić że 19 ID mrna jest specyficznie różnicujących grupę B1 od kontroli, 15 ID mrna jest charakterystycznych dla grupy B2 a 71 z 94 ID mrna różnicuje charakterystycznie podgrupę B4 od kontroli. IL23A i HRH3 są transkryptami charakterystycznymi dla podgrupy B1, HRH2 dla podgrupy B1 a HRH1 i HRH4 dla podgrupy B4. Zmiany aktywności transkrypcyjnej analizowanych genów zestawiono w tabeli 3, przedstawiając krotność i kierunek zmiany ekspresji. Dyskusja Zakażenia powodowane przez krętki Borrelia sp., dla których wektorem są kleszcze z rodzaju Ixodes (Newman and Eisen 2015) nastręczają problemów zarówno diagnostycznych, ale również terapeutycznych. Jest tak, gdyż pomimo ogromnego i ciągłego postępu medycyny i technik biologii molekularnej w niewystarczającym stopniu zostały poznane molekularne mechanizmy odpowiedzialne za rozwój tej zoonozy. Innym problemem, stanowiącym równocześnie wyzwanie jest złożoność struktury genomu krętków oraz ich strategia życiowa (Witecka-Knysz i wsp. 2007, Gąsiorowski i wsp. 2007). Zakażenie organizmu gospodarza doprowadza do indukcji a następnie rozwoju zakażenia a tym samym zmian w układzie immunologicznym. Zagadnieniem niezwykle intrygującym jest fakt, iż ten sam gatunek krętków w zależności od szerokości geograficznej powoduje uruchomienie odpowiedzi immunologicznej w której przeważa populacja limfocytów Th1 lub Th17 (Cerar et al. 2016). Analizując nasze wyniki eksperymentu mikromacierzowego dotyczącego IL12, IL23 oraz receptorów histaminowych HRH1-4 można zauważyć większe różnice wzoru ekspresji IL23, która w sposób specyficzny różnicuje podgrupę B1 od kontroli. Mając na uwadze molekularny mechanizm działania IL23 może sugerować to, iż w badanej przez nas populacji 107

108 chorych będzie dominować odpowiedź immunologiczna zależna od populacji Th17 limfocytów T (Teng 2015). Efekt wywierany przez omawianą gram ujemną bakterię jest najprawdopodobniej długotrwały za czym przemawiają obserwacje Diterich et al., którzy stwierdzają zdolność przeżycia krętka w organizmie, gdzie ma on możliwość modulowania układu odpornościowego (Diterich 2003). Ponad to, mając na względzie iż jednym z objawów infekcji wywołanej przez Borrelia sp. jest wystąpienie rumienia wędrującego (Schramm i wsp. 2012, Peacock and Gherezghiher 2015), któremu towarzyszy nasilony świąd (Derda i wsp. 2017) w miejscu kontaktu kleszcz organizm gospodarza, istotnym zagadnieniem jest dokładne poznanie roli histaminy w rozwoju boreliozy. W poprzednich badaniach wykazaliśmy udział IL12 i IL23 oraz aktywowanej przez nie ścieżki sygnałowej w boreliozie (Grabarek i wsp. 2017). Wykazaliśmy również na modelu in vitro fibroblastów skóry wpływ leku anty-tnf (adalimumab) na ekspresję genów związanych z układem histaminergicznym (Wcisło-Dziadecka et al. 2018). Niniejsze badania w powiązaniu z opisywanymi symptomami boreliozy stały się przesłanką do równoczesnego zestawienia ze sobą zmian aktywności transkrypcyjnej IL12/23 oraz receptorów histaminowych HRH1-4 w przebiegu boreliozy. Analiza zmian ekspresji genu kodującego podjednostkę p19 (IL23A) wskazuje na istotną rolę tej cytokiny. Obserwujemy 1,5-2 krotny wzrost aktywności transkrypcyjnej tego genu w grupie badanej w porównaniu z kontrolą. Również w odniesieniu do IL12B, kodującej wspólną dla IL12/23 podjednostkę p40 obserwujemy zmiany ekspresji wyrażone jej obniżeniem. Profil ekspresji IL12B i IL23A, jaki obserwujemy w naszych badaniach wskazuje na złożoność mechanizmów immunologicznych, które mają miejsce w przebiegu boreliozy. Receptory histaminowe są niezbędnym ogniwem wywierania efektów biologicznych przez histaminę. Są one receptorami błonowymi związanymi z białkiem G. W zależności od tego, który receptor zostanie pobudzony przez histaminę, obserwowane działanie biologiczne jest odmienne. Pobudzenie receptora HRH2 skutkuje wzrostem stężenia cyklicznego adenozynomonofosforanu (camp) i jest to efekt przeciwstawny do obserwowanego przy aktywacji receptora HRH3. Z kolei interakcja histamina-hrh4 skutkuje podwyższeniem stężenia jonów wapnia. W odniesieniu do HRH1 jego rola biologiczna wiązana jest z wystąpieniem reakcji immunologicznej typu natychmiastowego (Simons and Simons 2011, Jęda i wsp. 2014, Chojnacka i wsp. 2016). Podobne spostrzeżenia zostały poczynione w stosunku do HRH4, rozlokowanego w przeważającej mierze na powierzchni komórek układu immunologicznego, którego ekspresja zależna jest od IL-10 i IL-13 (Zawisza i Bardanin 2007). Potwierdza to współdziałanie cytokin z aminami biogennymi, tym samym wskazując na zasadność naszych badań. Analizując wzór ekspresji receptorów HRH1-4 można zaobserwować taki sam kierunek zmiany ekspresji we wszystkich podgrupach badanych tylko dla mrna HRH3, jednakże w podgrupie B4 krotność zmiany jest relatywnie niewielka, zbliżona do kontroli. Dla pozostałych transkryptów kodujących receptory histaminowe w zależności od podgrupy badanej wydzielonej na podstawie klasteryzacji hierarchicznej obserwuje się inny kierunek zmian aktywności transkrypcyjnej tych genów. Wykazanie nadekspresji HRH3 wskazuje na wpływ infekcji wywołanej przez Borrelia sp. na ośrodkowy układ nerwowy (OUN) i toczące się tam zmiany, gdyż ten rodzaj receptora histaminowego odpowiada za regulację syntezy i uwalniania histaminy z tkanki nerwowej (Zawisza i Bardanin 2007). Ponad to opisano rolę tego receptora jako regulatora syntezy i sekrecji innych neurotransmiterów a tym samym przyczynia się on do regulacji układu serotonicznego, cholinergicznego, dopaminergicznego, noradrenergicznego (Jęda i wsp. 2014). Wskazanie nadekspresji tego genu w porównaniu do grupy kontrolnej sugeruje, iż HRH3 mógłby być uzupełniającym markerem diagnostycznym boreliozy. 108

109 Zagadnieniem niezwykle ważnym w szczególności z punktu widzenia pacjenta jest mająca obecnie miejsce zmiana sposobu podejścia do leczenia. Aktualnie szeroko postulowanym zagadnieniem jest personalizacja medycyny, poszukiwanie strategii terapeutycznych ukierunkowanych na cele molekularne. Takie działania pozwalają na równoczesną intensyfikację korzyści farmakoterapii i minimalizację działań niepożądanych. Wynika to również z faktu wyprzedzania zmian molekularnych przez fenotypowe a tym samym możliwym jest wcześniejsze wykrycie utraty wrażliwości na lek i korekta terapii (Opławski et al. 2017). Wydaje się, że zagadnienie terapii szytej na miarę można również odnieść do opisywanej w niniejszej pracy zoonozy. Przemawia za tym fakt, iż grupa badana w wyniku klasteryzacji hierarchicznej w oparciu o kryteria molekularne, została podzielona na podgrupy B1-B4. W odniesieniu do przeprowadzonej analizy mikromacierzowej obserwuje się w poszczególnych podgrupach różny kierunek zmian ekspresji badanych genów. Tym samym rozszerzając panel analizowanych genów wydaje się że można byłoby dla każdej z podgrup wybrać najbardziej optymalny sposób leczenia warunkujący największą skuteczność farmaktoterapii. Odpowiedzią na rozwój biologii molekularnej i medycyny personalizowanej jest wprowadzenie do leczenia leków biologicznych (anty-cytokinowych), w tym monoklonalnych przeciwciał. Najbardziej rozpowszechnione tego typu leki to: leki anty-tnf (adalimumab, infliximab, etanercept), anty-il12/23 (ustekinumab), inhibitory kinaz JAK (Wcisło-Dziadecka et al. 2016, Wcisło-Dziadecka et al. 2017). Poprzednie nasze badania na modelu prawidłowych ludzkich fibroblastów skóry NHDF in vitro wykazały modulujący wpływ adalimumab na układ histaminergiczny w tym ekspresję receptora HRH1. Zmiany wywołane działaniem leku są obserwowalne już po 2 godzinnej ekspozycji komórek na lek i w tym czasie są one najbardziej nasilone (Wcisło-Dziadecka et al. 2018). Obserwacja zmian na fibroblastach, stanowiących główną pulę komórek skóry może wskazywać na użyteczność i zasadność rozważenia wprowadzenia adalimumab i/lub innych leków anty-cytokinowych do leczenia boreliozy. W naszych badaniach obserwujemy również zmiany profilu ekspresji IL12/23, tym samym wydaje się, że ustekinumab mógłby okazać się kolejną ciekawą do rozważenia strategią terapeutyczną. Wiążąc się z podjednostką p40 (IL12B) inhibowałby kaskadę sygnałową JAK-STAT, przyczyniając się do zmniejszenia nasilenia procesów zapalnych (Wcisło-Dziadecka et al. 2016, Grabarek i wsp. 2017). Niniejsza analiza profilu mikromacierzowego podkreśla w zakażeniu Borrelia sp rolę IL-12 i IL-23 oraz powiązanie z układem histaminergicznym między interleukinami a krętkiem. Wskazuje też na użyteczność analizowania zmian stężeń mrna tych genów i przeprowadzania analiz mikromacierzowych do poszukiwania nowych, uzupełniających markerów zakażenia wywoływanego przez Borrelia sp. oraz opracowywania nowych personalizowanych strategii terapeutycznych. Wnioski Gram ujemne bakterie Borrelia sp. indukując zakażenie, powodują zmiany w układzie immunologicznym, wyrażone molekularnie różnicami profilu ekspresji cytokin i czynników zapalnych. Wyniki przeprowadzonej analizy mikromacierzowej są potwierdzeniem udziału IL12, IL23, receptorów histaminowych HRH1-4 w analizowanej zoonozie. Wskazują na istotną rolę fenotypu Th17 limfocytów w przebiegu boreliozy oraz zdolność krętków do wywoływania zmian w OUN. Potwierdzono również zróżnicowanie obrazu molekularnego zoonozy mimo iż wywołujący ją czynnik jest ten sam. Stanowi to przesłankę do podjęcia prób opracowywania i wdrażania nowych strategii leczenia w tym zorientowanego na cele molekularne leczenia personalizowanego z wykorzystaniem leków anty-cytokinowych. 109

110 Tabela 1. Wynik jednoczynnikowej analizy wariancji ANOVA z poprawką Benjamini- Hochberg, przedstawiający liczbę ID mrna genów związanych IL12, IL23, HRH1-4. Wartość p Wszystkie ID mrna p<0,05 p<0,02 p<0,01 p<0,005 p<0,001 Liczba ID Mrna Tabela 2. Wynik testu post-hoc wielokrotnych porównań Tukey`a, pokazujący liczbę ID mrna różnicujących grupy poddane analizie. Nazwa grupy B1 B2 B4 K B B B K Ryc. 1. Diagram Venna na którym przedstawiono grupowanie mrna wytypowanych testem post-hoc Tukey`a po jednoczynnikowej analizie wariancji ANOVA (p<0,05). Tab 3. Profil ekspresji IL-12, IL23, HRH1, HRH2, HRH3, HRH4 między poszczególnymi podgrupami badanymi (B1, B2, B4) a kontrolą (K) ID B1 FC B2 B4 Symbol FC FC (wzrost/ (B2 vs (wzrost/ (wzrost/ genu (B1 vs K) (B4 vs K) spadek) K) spadek) spadek) _at IL12B spadek spadek spadek _x_at IL23A wzrost wzrost spadek _at IL23A wzrost spadek spadek _at HRH wzrost spadek wzrost _s_at HRH wzrost spadek wzrost _at HRH wzrost wzrost spadek _at HRH wzrost wzrost wzrost _x_at HRH wzrost wzrost wzrost _s_at HRH wzrost spadek spadek _at HRH spadek spadek spadek 110

111 Spis literatury 1. Biesiada G., Czepiel J., Lęsniak M., Garlicki A., Mach T Lyme disease: review. Arch Med Sci. 8(6): Całkosiński I., Dobrzyński M., Całkosińska M., Seweryn E., Bronowicka Szydełko A., Dzierzba K., Ceremuga I., Gamian A Charakterystyka procesu zapalnego. Postępy Hig Med Dosw., 63: Cerar T., Strle F., Stupica D., Ruzic-Sabljic E., McHugh G., Steere A.C., Strle K Differences in Genotype, Clinical Features, and Inflammatory Potential of Borrelia burgdorferi sensu stricto strains from Europe and the United States. Emerg Infect Dis. 22(5): Chojnacka K., Jasikowska K., Rybus-Kalinowska B., Jochem J., Grochowska- Niedworok E Histamina w serach potencjalne zagrożenie? Ann. Acad. Med. Siles. (online). 70: Cook M. J Lyme borreliosis: a review of data on transmission time after tick attachment. Int. J. Gen. Med. 8: Derda M., Cholewiński M., Klimberg A., Marcinkowski J., Hadas E Wektory przenoszące choroby pasożytnicze, bakteryjne i wirusowe człowieka. Pluskwiaki, karaluchy, pchły, mrówki i kleszcze. Hygeia Public Health. 52(3): Diterich I., Rauter C., Kirschning C.J., Hartung T Borrelia burgdorferi induced tolerance as a model of persistence via immunosuppression. Infect Immun. 71: Duvalet E., Semerano L., Assier E Interleukin-23: a key cytokine in inflammatory diseases. Ann. Med. 43: Feng J., Auwaerter P., Zhang Y Drug Combinations against Borrelia burgdorferi Persisters In Vitro: Eradication Achieved by Using Daptomycin, Cefoperazone and Doxycycline. PLOS ONE. 10 (3): Gąsiorowski J., Witecka-Knysz E., Knysz B., Gerber H., Gładysz A Diagnostyka boreliozy. Med Pr. 58(5): Grabarek B., Zmarzły N., Wojdas E., Bednarczyk M., Kaźmierczak A., Gola J., Asman M., Solarz K., Strzelczyk J.K., Zalewska-Ziob M., Wielkoszyński T., Kurek J., Koleżyńska B., Mazurek U Wpływ zakażenia krętkami borrelia sp. na aktywność transkrypcyjną genów związanych ze ścieżką sygnałową JAK/STAT aktywowaną przez interleukiny 12 i 23. W: Buczek A, Błaszak C. (red.) Stawonogi we współczesnym świecie Jęda A., Witek A, Janikowska G., Cwynar G., Janikowski T., Ciałoń.M, Orchel J., Mazurek U Profil ekspresji genów związanych z układem histaminergicznym wyznaczony techniką mikromacierzy oligonukleotydowych HG-U133A u kobiet z gruczolakorakiem endometrium. Ginekol Pol. 85: Maroszyńska-Dmoch E Kardiologiczne aspekty boreliozy z Lyme. Reumatologia 51(1): Moniuszko A., Dunaj J., Zajkowska J., Czupryna P., Świerzbińska R., Guziejko K., Aleksiejczuk P., Barry G., Kondrusik M., Pancewicz S Comparison of detection of Borrelia burgdorferi DNA and anti-borrelia burgdorferi antibodies in patients with erythema migrans in north-eastern Poland. Postep. Derm. Alergol. 32(1): Newman E.A, Eisen L., Eisen R. J., Fedorova N., Hasty J.M, Vaughn C., Lane R.S Borrelia burgdorferi sensu lato spirochetes in wild birds in northwestern california: associations with ecological factors, bird behavior and tick infestation. PLOS ONE. 10(2): Opławski M., Michalski M., Witek A., Michalski B., Zmarzły N., Jęda-Golonka A., Styblińska M., Gola J., Kasprzyk-Żyszczyńska M., Mazurek U., Plewka A

112 Identification of a gene expression profile associated with the regulation of angiogenesis in endometrial cancer. Mol Med Rep.; 16(3): Panula P., Sundvik M., Karlsted K Developmental roles of brain histamine. Trends Neurosci. 27: Peacock B.N, Gherezghiher T.B, Hilario J.D, Kellermann G.H New insights into Lyme disease. Redox Biology. 5: Schüler W., Bunikis I., Weber-Lehman J., Comstedt P., Kutschan-Bunikis S., Stanek G., Huber J., Meinke A., Bergström S., Lundberg U Complete Genome Sequence of Borrelia afzelii K78 and Comparative Genome Analysis. PLOS ONE. 10 (3): Simons F.E., Simons K.J Histamine and H1-antihistamines: celebrating a century of progress. J Allergy Clin Immunol. 128(6): Teng M. W., Bowman E. P., McElwee J. J., Smyth M. J., Casanova J. J., Cooper A., Cua D. J IL-12 and IL-23 cytokines: from discovery to targeted therapies for immunemediated inflammatory diseases. Nat med. 21(7): Wcisło-Dziadecka D., Grabarek B., Zmarzły N.., Skubis A., Sikora B., Kruszniewska Rajs C., Gola J., Mazurek U., Kucharz E Influence of adalimumab on the expression profile of genes associated with histaminergic system in the skin fibroblasts in vitro. BioMed Res Int. 2018: Wcisło-Dziadecka D., Zbiciak M., Wcisło Brzezińska L., Mazurek U Anticytokine therapy for psoriasis not only TNF blockers. Overview of reports on the effectiveness of therapy with IL12/IL23 and T and B lymphocyte inhibitors. Post Hig Med Dośw. 70: Wcisło Dziadecka D., Zbiciak Nylec M., Brzezińska Wcisło L., Bebenek K., Kaźmierczak A Newer treatments of psoriasis regarding IL-23 inhibitors, phosphodiesterase 4 inhibitors, and Janus kinase inhibitors. Dermatol Ther. 30(6). doi: /dth Witecka-Knysz E., Klimczak M., Lakwa K., Żajkowska J., Pancewicz S., Kondrusik M., Grzegorczuk S., Świerzbińska R., Hermanowska-Szpakowicz T Borelioza: dlaczego diagnostyka jest tak trudna? Diagnosta Lab.4: Zawisza E., Bardadin J Receptory H1, H2, H3, H4 i leki antyhistaminowe. Postępy Nauk Med

113 Ocena profilu metabolicznego krętków Borrelia afzelii, Borrelia garinii i Borrelia burgdorferi sensu stricto Sławomir Dudek 1, Izabela Biedroń 2, Beata Rozwadowska 3, Ilona Kaczmarczyk-Sedlak 1 1 Katedra i Zakład Farmakognozji i Fitochemii, Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, Śląski Uniwersytet Medyczny w Katowicach, Polska; ul, Jagiellońska 4, Sosnowiec, sdudek@sum.edu.pl 2 Instytut Ekologii Terenów Uprzemysłowionych, ul. Kossutha 6, Katowice, Polska 3Zakład Badań Strukturalnych Skóry, Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, Śląski Uniwersytet Medyczny w Katowicach, Polska, ul. Kasztanowa 3, Sosnowiec Objective Borrelia burgdorferi is a Gram-negative bacterium that is the causative agent of Lyme disease. This pathogen is transmitted by Ixodes ticks. The genetic material of spirochetes is one of the smaller genome among prokaryotes. The bacteria lost a large number of genes as they adapted to their hosts. This cause that Borrelia burgdorferi need a specific culture conditions in vitro. The aim of this study was the evaluation of metabolic profile of three genospecies of Borrelia burgdorferi sensu lato. Materials and methods Three genospecies of Borrelia: Borrelia afzelii, Borrelia garinii and Borrelia burgdorferi sensu stricto were grown on EcoPlates and next on Phenotype MicroArray plates to measure the carbon substrate utilisation patterns of spirochetes. The experiment was carried out for 4 and 7 days, respectively. Results EcoPlate results indicated that three genospiecies of Borrelia utilize only D-xylose. In turn, Phenotype MicroArray analysis allowed to determine that Borrelia used of the following compounds: D-xylose, L-arabinose, D-galactose, D-rhamnose, acetic acid, D-α-glucose, D- ribose, D-fructose-6-phosphate, acetoacetic acid, L -lyxose and glucuronamide. Conclusions Obtained data indicated that in in vitro cultures Borrelia burgdorferi sensu lato spirochetes are able to utilize from the environment many different substrates, but their later metabolism is not completely known. Therefore, further research is necessary to explain this. Wstęp Borrelia burgdorferi jest gram-ujemną bakterią wywołującą boreliozę, znaną również jako choroba z Lyme od miasta w Stanach Zjednoczonych, gdzie w 1975 roku zostało w tym samym czasie zdiagnozowane młodzieńcze idiopatyczne zapalenie stawów u kilkunastu dzieci. Stwierdzono, iż czynnikiem wywołującym te objawy był krętek Borrelia należący do rodziny Spirochaetaceae (Nordberg i wsp. 2012). Od tego momentu bakteria ta była badana w wielu jednostkach naukowych na świecie i dobrze poznano jej morfologię, anatomię, fizjologię, a także całkowicie zsekwencjonowano materiał genetyczny (Fraser i wsp. 1997, Sharma i wsp. 2015, Dudek i wsp. 2017). Do tej pory udało się zidentyfikować ponad 20 gatunków z czego głównymi patogenami wywołującymi boreliozę są trzy genogatunki określane razem jako Borrelia burgdorferi sensu lato: Borrelia afzelii, Borrelia garinii oraz Borrelia 113

114 burgdorferi sensu stricto (Rauter i wsp. 2005). Wielkość komórki krętka to ok. 0,2 1 μm na 5 25 μm. Bakteria ta posiada peryplazmatyczne wici, które łączą oba jej końce umożliwiając wykonywanie obrotowych ruchów w ciele gospodarza (Motaleb i wsp. 2000). Dzięki zmienności morfologicznej mogą przekształcać się w formy przetrwalnikowe np. cysty, w wyniku czego są w stanie przetrwać niekorzystne okresy m.in. antybiotykoterapii (Meriläinen i wsp. 2016). Głównymi powierzchniowymi antygenami krętków są lipoproteiny OspA-OspG, które pełnią zróżnicowane funkcje w ich procesach życiowych, m.in. współuczestniczą w procesie przemieszczania się bakterii z układu pokarmowego kleszczy do krwi ssaków (Schwan i wsp. 2002). Rezerwuarem krętków są głównie kleszcze rodzaju Ixodes, które infekują ssaki tymi patogenami w trakcie żerowania. Ilość zainfekowanych kleszczy jest różna w zależności od rejonu, z którego pochodzą, jednak na terenie całej Polski jest ono dosyć wysokie (Komoń i wsp. 2007, Mucha i wsp. 2012, Rozwadowska i wsp. 2012, Kasprzak i wsp. 2016). Sezonowa aktywność kleszczy trwa od kwietnia do początku listopada ze szczytem w maju i drugim we wrześniu (Wójcik-Fatla i wsp. 2009). Materiał genetyczny krętków to składający się z podwójnej, liniowej nici chromosom o zamkniętych końcach typu szpilki do włosów (910 kbz) oraz około 20 linowych i kolistych plazmidów (5-56 kbz) co czyni go jednym z mniejszych genomów w świecie bakterii. Niektóre plazmidy mogą zostać utracone w trakcie hodowli in vitro, lecz nie wpływa to na żywotność krętków (Grimm i wsp. 2003, Corona A, 2015). Z uwagi na wielkość genomu bakterie te są uzależnione od swoich żywicieli, ponieważ część genów w toku ewolucji zostało utraconych. Zamiast enzymów, obecnych w wielu innych komórkach bakteryjnych, które syntetyzują niektóre związki krętki Borrelia pobierają je ze środowiska (Furmańczyk 2011). Brak jest m.in. genów kodujących enzymy odpowiedzialne za biosyntezę kwasów tłuszczowych, nukleotydów czy aminokwasów, a nawet stwierdzono nieobecność genów odpowiedzialnych za cykl Krebsa (Fraser i wsp. 1997). Za to zidentyfikowano ponad 50 genów kodujących białka transportujące np. węglowodany, oligopeptydy, aminokwasy do wnętrza jej komórki (Gherardini i wsp. 2010, Corona i wsp. 2015). Wymusza to również specyficzne wymagania w jakich może rozwijać się ten patogen w hodowlach in vitro co bierze się z bardzo ograniczonej zdolności metabolicznej krętka. Borrelia rośnie na pożywce BSK-H, która zawiera 65 składników w tym witaminy, aminokwasy czy też surowicę króliczą (Pollack i wsp. 1993). Głównym źródłem węgla pozyskiwanym z podłoża przez krętki obok glukozy są m.in. mannoza, glicerol, chitobioza (Lackum i wsp. 2005). Za proces pobierania substratów odpowiada głównie system fosfotransferazy zależny od fosfoenolopirogronianu (PTS, ang. phosphoenolpyruvate phosphotransferase system), którego zadaniem jest transport cukrów i ich pochodnych do wnętrza komórki. Transport ten jest powiązany z fosforylacją substratu z udziałem fosfoenolopirogronianu (Marczak i wsp. 2003). PTS monitoruje dostępność nadających się do użycia węglowodanów ukierunkowując procesy metaboliczne krętka pod konkretny substrat, który jest aktualnie dostępny w środowisku (Bijay i wsp. 2016). Celem pracy była ocena profilu metabolicznego trzech genogatunków Borrelia burgdorferi sensu lato. Materiał i metody Wszystkie trzy szczepy (Borrelia burgdorferi sensu stricto B31, Borrelia garinii 20047, Borrelia afzelli VS 461) krętków boreliozy zdolne infekować komórki ludzkie hodowano w Wojewódzkiej Stacji Sanitarno-Epidemiologicznej w Katowicach, w medium hodowlanym BSK-H (Barbour'a, Stoenner'a, Kelly'ego; Sigma-Aldrich, St. Louis, MO, USA) w temperaturze 35 o C w warunkach mikroaerofilnych. Po 7 dniach wzrostu przeprowadzono analizę mikroskopową hodowli oraz obliczono średnią liczbę krętków w 1 ml pożywki. Komórki bakterii policzono w komorze Bürkera. Szczepy wzorcowe krętków pochodziły z Narodowego Instytutu Zdrowia Publicznego Państwowego Zakładu Higieny w Warszawie. 114

115 Analiza została przeprowadzona przy użyciu 96-dołkowych mikropłytkek EcoPlate, które zawierają 31 źródeł węgla (każde w trzech powtórzeniach), mogące być wykorzystane przez mikroogranizmy: woda (kontrola), β-metylo-d-glukozyd, A-D-laktoza, L-arginina, pirogronian metylu, D-ksyloza, kwas D-galakturonowy, L-asparagina, Tween40, eritritol, kwas 2-hydroksybenzoesowy, L-fenyloalanina, Tween 80, D-mannitol, kwas 4- hydroksybenzoesowy, L-seryna, α-cyklodekstryna, kwas γ-hydroksy-masłowy, L-treonina, glikogen, kwas D-glukozaminowy, fosforan 1-glukozy, kwas α-oksomasłowy, fenyloetyloamina, D-celobioza, fosforan D,L-α-glicerolu, γ-lakton kwasu D-galaktonowego, kwas itakonowy, kwas D-jabłkowy, kwas glicyno-l-glutaminowy, putrescyna. Substraty te są umieszczone w dołkach w formie zliofilizowanej razem z dodatkiem barwnika wskaźnikowego soli tetrazolowej. Badanie przeprowadzono w trzech powtórzeniach dla 3 szczepów krętków: Borrelia afzelii, Borrelia garinii oraz Borrelia burgdorferi sensu stricto, które w postaci zawiesiny umieszczono w dołkach z substratami na 96 godzin. Odczytu dokonywano co 15 minut w aparacie Biolog OmniLog Identification System (Biolog, Hayward, CA, USA) przy długości fali 560 i 590 nm. Kolejna analiza obejmowała ocenę profilu metabolicznego na mikromacierzach fenotypowych PM1 przeprowadzonych w trzech powtórzeniach. Mikromacierze fenotypowe są bardziej zaawansowaną metodą analizy od EcoPlate, gdyż każdorazowo na jednej płytce można analizować do 95 substratów (plus kontrola negatywna woda). Oznaczenia wykonano zgodnie z protokołem producenta dla mikroorganizmów mikroaerofilnych. Odczytu dokonywano co 15 minut w aparacie Biolog OmniLog Identification System (Biolog, Hayward, CA, USA). Wyniki Analiza na mikropłytkach EcoPlate wykazała, że wszystkie trzy genogatunki krętków Borrelia wykorzystywały tylko jeden substrat: D-ksylozę (Ryc. 1-3). Nie stwierdzono zużycia przez bakterie pozostałych substratów. Analiza za pomocą mikromacierzy fenotypowych profilu metabolicznego krętków Borrelia burgdorferi sensu lato pozwoliła na otrzymanie wzoru zużycia substratów zawartych w podłożu przez te bakterie. W przypadku D-ksylozy, nastąpiło potwierdzenie wyników, uzyskanych z płytek EcoPlate, gdyż od pierwszych godzin eksperymentu widać szybkie zużywanie tego cukru (Ryc. 4F). Ponadto w porównaniu do kontroli stwierdzono również aktywność metaboliczną krętków w przypadku następujących substratów: L-arabinozy, D- galaktozy, D-ramnozy, kwasu octowego, D-α-glukozy, D-rybozy, fruktozo-6-fosforanu, kwasu acetylooctowego, L-liksozy oraz glukuronamidu (Ryc. 4). Dyskusja Podobnie jak u wielu bakterii również u krętków Borrelia burgdorferi głównym źródłem węgla jest glukoza (Fraser i wsp. 1997). W przypadku tego monocukru zaobserwowano niewielkie, ale równomierne jego zużycie (Ryc. 4D). Z dostępnych do tej pory informacji wiadomo, że krętek aby mógł się rozwijać, oprócz wspomnianego monosacharydu, musi mieć dostarczone ze środowiska następujące źródła węgla: glicerol, maltozę, mannozę, N- acetyloglukozaminę i chitobiozę (Barbour i wsp. 1986, Lackum i wsp. 2005). Dane literaturowe wskazują, że N-acetyloglukozamina niezbędna do produkcji ściany komórkowej bakterii musi być dostarczana ze środowiska (Barbour i wsp. 1986). Brak jest natomiast śladu jego metabolizmu w przeprowadzonych analizach, podobnie jak w przypadku mannozy, maltozy oraz glicerolu. W przypadku jej dimeru: chitobiozy brak jest danych, gdyż ten substrat nie był obecny w mikromacierzach fenotypowych ani płytkach EcoPlate. Natomiast ten dwucukier jest częścią składową chityny, której rozkład może być ważnym źródłem węgla dla krętków w czasie bytowania w ciele kleszcza (Tilly i wsp. 2001). Inne doniesienie wspomina o trehalozie, która również może przyczyniać się do wzrostu krętków Borrelia burgdorferi w 115

116 hodowlach in vitro (Hoon-Hanks i wsp. 2012), lecz w tym przypadku również metabolizm tego cukru nie był zaobserwowany. Ksyloza została określona jako cukier, który nie jest metabolizowany przez krętki Borrelia burgdorferi (Lackum i wsp. 2005). Jednakże w dwóch różnych analizach z wykorzystaniem trzech genogatunków krętków boreliozy wykazano jej zużycie, które następowało już w pierwszych godzinach od dodania inokulum na płytki (Ryc. 1-3 i 4F). W ciągu prac nad opisaniem genomu Borrelia Fraser i wsp. zidentyfikowali geny: BB693 - xylose operon regulatory prt (XylR-1) oraz BB831 - xylose operon regulatory prt (XylR-2) czyli białka operonu regulującego proces metabolizmu ksylozy (Fraser i wsp. 1997). Wiadomym jest, że w przypadku innych drobnoustrojów proces blokowania transkrypcji białek operonu ksylozy polega na łączeniu się represora z sekwencją operatora zapobiegając w ten sposób transkrypcji operonu xyl. Dopiero obecność ksylozy w pożywce warunkuje allosteryczną zmianę konformacji białka represorowego, co w efekcie prowadzi do transkrypcji genów strukturalnych operonu i umożliwia metabolizm tego cukru (Zheng i wsp. 2016). Tłumaczyłoby to zużycie ksylozy na takim poziomie jak w doświadczeniu. Według Millera i wsp. geny XylR1 i XylR2 mają alternatywne funkcje i pełnią odpowiednio rolę regulatora transkrypcji oraz kinazy cukrowej. Wykazali oni, że krętki Borrelia w swoim genomie posiadają gen BB0545 kodujący ksylulokinazę, która odpowiedzialna jest za przekształcanie D-ksylozy do D-ksylulozo-5-fosforanu (Miller i wsp. 2013). W efekcie aktywność tego enzymu mogła spowodować pozorne zużycie na płytce tego cukru przez krętki Borrelia burgdorferi senu lato. Brak jest natomiast informacji w literaturze co dalej dzieje się z ksylulozo-5-fosforanem, gdyż Borrelia burgdorferi nie posiada m.in. enzymu transketolazy odpowiedzialnego za jego przekształcenie w szlaku pentozofosforanowym (Zhang i wsp. 2016). Podobną aktywnością metaboliczną jak ksyloza charakteryzowała się także L-arabinoza (Ryc. 4A), która również według Lackum i wsp. nie jest wykorzystywana przez krętki jako źródło energii (Lackumi i wsp. 2005). W przypadku liksozy (Ryc. 4I), której utylizacja została odnotowana na najwyższym poziomie spośród badanych substratów, możliwe, że system PTS potraktował ją jako ksylozę, gdyż liksoza jest jej epimerem (Langan i wsp. 2014). W przypadku rybozy (Ryc. 4K) Lackum i wsp. również podają, że ten cukier nie może stanowić głównego źródła węgla, a tym samym wspierać wzrost krętków w hodowlach in vitro. Możliwe natomiast jest, że bakterie mogą wykorzystywać tą pentozę do innych zastosowań. Z uwagi na to, że metabolizm krętków umożliwia przekształcenie glukozy w rybozę za to już glukoza nie może być otrzymywana z rybozy. Zatem ryboza transportowana do komórki bakteryjnej może mieć zastosowanie np. przy syntezie kwasu nukleinowego, nie zaś jako źródło energii jak np. glukoza (Lackumi i wsp. 2005). Ramnoza (Ryc. 4J) natomiast według Yanagihara i wsp. jest jednym ze składowych związków m.in. krętków Borrelia, stąd jej absorpcja może być tłumaczona pozyskiwaniem składników budulcowych ze środowiska przez krętki (Yanagihara i wsp. 1984). Podobnie galaktoza (Ryc. 4C) stanowi jedną z głównych części składowych tych bakterii, więc możliwe jest, że krętki pobierając ją z podłoża w dalszych etapach wbudowują ją w swoje komórki (Hossain i wsp. 2001). Istnieją doniesienia o roli fruktozo-6-fosforanu (Ryc. 4B) w ATP-zależnym metabolizmie bakterii Borrelia, co może tłumaczyć jego zużycie w eksperymencie (Moore i wsp. 2002). Natomiast w przypadku metabolizmu glukuronamidu (Ryc. 4E), kwasu octowego (Ryc. 4H) lub acetylooctowego (Ryc. 4G) brak jest jednoznacznych danych literaturowych informujących w jakim celu mogły być pozyskiwane przez krętki Borrelia burgdorferi w hodowli in vitro. 116

117 Wnioski Zapobieganie oraz zwalczanie chorób bakteryjnych zaczyna się od poznania drobnoustrojów poprzez ich dogłębne badania. Krętki Borrelia burgdorferi sensu lato jako czynnik etiologiczny wywołujący boreliozę znane są od kilkudziesięciu lat, a mimo to nie można powiedzieć, że poznano je dokładnie. Pomimo niezwykle małego genomu jak na przedstawicieli królestwa bakterii nie są poznane dokładne procesy metaboliczne, które zachodzą w ich komórkach. Wyniki uzyskane w trakcie opisanego badania stawiają więcej pytań niż odpowiedzi. Uzyskane dane wskazują, że krętki Borrelia burgdorferi sensu lato w hodowlach in vitro są w stanie pozyskiwać ze środowiska wiele różnych związków, których późniejszych losów nie jesteśmy w stanie prześledzić. Stąd wniosek, że aby poznać rolę tych związków w metabolizmie krętów niezbędne są dalsze badania. Z uwagi na ciągłe trudności napotykane zarówno w leczeniu boreliozy, a przede wszystkim z jej prewencją szczepionki oparte na antygenach krętkowych nie spełniły powierzanej w nich roli, być może między innymi dokładniejsze poznanie metabolizmu krętków stanie się kluczem do obrony przed nimi. Praca wykonana w ramach umowy dla młodych naukowców Śląskiego Uniwersytetu Medycznego w Katowicach Nr KNW-2-I10/N/7/N. Ryc. 1. Wykres przedstawiający zużycie substratu ksylozy w porównaniu do kontroli na płytkach EcoPlate przez bakterie Borrelia afzelii. 117

118 . A B Ryc. 2. Wykres przedstawiający zużycie substratu ksylozy w porównaniu do kontroli na płytkach EcoPlate przez bakterie Borrelia garinii. Ryc. 3. Wykres przedstawiający zużycie substratu ksylozy w porównaniu do kontroli na płytkach EcoPlate przez bakterie Borrelia burgdorferi sensu stricto 118

119 C E G I D H J F Ryc. 4. Wykresy przedstawiające zużycie substratów w porównaniu do kontroli na mikromacierzach fenotypowych przez bakterie Borrelia burgdorferi sensu lato: A arabinoza, B fruktozo-6-fosforan, C galaktoza, D glukoza, E glukuronamid, F ksyloza. 119

120 K Ryc. 4 c.d. Wykresy przedstawiające zużycie substratów w porównaniu do kontroli na mikromacierzach fenotypowych przez bakterie Borrelia burgdorferi sensu lato: G kwas acetooctowy, H kwas octowy, I liksoza, J ramnoza, K ryboza. Literatura 1. Barbour A.G Biology of Borrelia species. Microbiol. Rev. 50: Bijay K Phosphoenolpyruvate Phosphotransferase System Components Modulate Gene Transcription and Virulence of Borrelia burgdorferi. Infect Immun. 84: Corona A Borrelia burgdorferi: Carbon Metabolism and the Tick-Mammal Enzootic Cycle. Microbiol Spectr. 3: Fraser CM Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature. 390: Furmańczyk E Struktura genomu Borrelia burgdorferi; informacja genetyczna zawarta w poszczególnych replikonach składowych. Post. Mikrobiol. 50: Gherardini F Metabolism and Physiology of Borrelia. In Samuels DS, Radolf JD (ed.), Borrelia: Molecular biology, host interaction and pathogenesis. Caister Academic Press, Norfolk, UK Grimm D Plasmid stability during in vitro propagation of Borrelia burgdorferi assessed at a clonal level. Infect Immun. 71: Hoon-Hanks LL Borrelia burgdorferi malq mutants utilize disaccharides and traverse the enzootic cycle. FEMS ImmunolMed Microbiol. 66: Hossain H Structural analysis of glycolipids from Borrelia burgdorferi. Biochimie. 83: Kasprzak J Występowanie krętków Borrelia spp. w kleszczach Ixodes ricinus z terenów endemicznych województwa kujawskopomorskiego. Probl Hig Epidemiol. 97: Meriläinen L Pleomorphic forms of Borrelia burgdorferi induce distinct immune responses. Microbes Infect. 18: Motaleb MA Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc Natl Acad Sci USA. 97: Moore SA The structure of a pyrophosphate-dependent phosphofructokinase from the Lyme disease spirochete Borrelia burgdorferi. Structure. 10: Mucha D Choroby przenoszone przez kleszcze sytuacja epidemiologiczna w województwie pomorskim. Medycyna Ogólna i Nauki o Zdrowiu Nordberg M Tick-Borne Infections in Humans. Aspects immunopathogenesis, diagnosis and coinfections with Borrelia burgdorferi and Anaplasma phagocytophilum. Linköping University, Sweden. 120

121 16. Komoń T Występowanie Borrelia burgdorferi s.l. w wybranych populacjach kleszczy Ixodes ricinus na terenie Nadbużańskiego Parku Krajobrazowego Wiadomoœci Parazytologiczne. 53: Lackum K Carbohydrate utilization by the Lyme borreliosis spirochete, Borrelia burgdorferi. FEMS Microbiol Lett. 243: Langan P L-Arabinose Binding, Isomerization, and Epimerization by D-Xylose Isomerase: X-Ray/Neutron Crystallographic and Molecular Simulation Study. Structure. 22: Marczak M Bakteryjne systemy transportu cukrów. Postępy Biochemii, 49: Miller CL Borrelia host adaptation Regulator (BadR) regulates rpos to modulate host adaptation and virulence factors in Borrelia burgdorferi. Mol Microbiol. 88: Pollack RJ Standardization of medium for culturing Lyme disease spirochetes. J Clin Microbiol. 31: Rauter C Prevalence of Borrelia burgdorferi Sensu Lato Genospecies in Ixodes ricinus Ticks in Europe: a Metaanalysis. Appl Environ Microbiol. 71: Rozwadowska B Genogatunki krętków Borrelia burgdorferi wykryte na terenie województwa śląskiego w latach PRZEGL EPIDEMIOL. 66: Schwan TG Vector interactions and molecular adaptations of lyme disease and relapsing fever spirochetes associated with transmission by ticks. Emerg Infect Dis. 8: Sharma B Borrelia burgdorferi, the Causative Agent of Lyme Disease, Forms Drug-Tolerant Persister Cells. Antimicrob Agents Chemother. 59: Tilly K Genetics and Regulation of Chitobiose Utilization in Borrelia burgdorferi. J Bacteriol. 183: Wójcik-Fatla A Choroby przenoszone przez kleszcze. Część I. Ixodes ricinus jako rezerwuar i wektor patogenów. Zdr Publ. 119: Yanagihara Y Chemical compositions of cell walls and polysaccharide fractions of spirochetes. Microbiol Immunol. 28: Zhang K Lyme disease spirochaete Borrelia burgdorferi does not require thiamin. Nat Microbiol. 2: Zheng Z Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01. Biotechnol Lett. 38:

122 122

123 Expression profile of genes associated with epithelial-mesenchymal transition in patients with Lyme disease Nikola Zmarzły 1, Beniamin Grabarek 1, Emilia Wojdas 1, Martyna Bednarczyk 2, Ewelina Hermyt 3, Joanna Gola 1, Jolanta Adamska 1, Marek Asman 4, Urszula Mazurek 1 1Department of Molecular Biology, School of Pharmacy with the Division of Laboratory Medicine in Sosnowiec, 2 Department of Internal Diseases, School of Public Health in Bytom, 3Department of Gynecology and Obstetrics, School of Medicine in Katowice, 4 Department of Parasitology, School of Pharmacy with the Division of Laboratory Medicine in Sosnowiec, Medical University of Silesia in Katowice Corresponding author: nikola.zmarzly@med.sum.edu.pl Introduction In Europe, spirochetes of the Borrelia burgdorferi sensu lato complex are transmitted by Ixodes ricinus ticks, causing borreliosis, also known as Lyme disease or Lyme borreliosis (LB). It is an inflammatory bacterial disease that affects various human organs and tissues, e.g. skin, joints, nervous system (Stanek et al. 2011). One of the most common symptoms of borreliosis is the occurrence of erythema migrans, which is a round, red skin lesion that appears several days or weeks after the tick bite. It is most often caused by B. afzelii infection, less by B. garinii (Stanek et al. 1996, Stanek and Strle 2003). Borrelial lymphocytoma (BL) is a bluish-red nodule typically located on the earlobe, nipple or scrotum (Busch et al. 1996), while acrodermatitis chronica atrophicans (ACA) is a bluish-red discoloration of the skin, usually on hands and feet, that can occur months to years after the primary infection. (Stanek and Strle 2003). B. afzelii is the main causative agent of BL and ACA (Busch et al. 1996). In turn, B. garinii is associated with the dysfunction of the nervous system called neuroborreliosis (NB), which involves the presence of unspecific symptoms, e.g. concentration difficulties, vertigo, neck pain, meningitis, cranial neuritis, facial palsy (Henningsson et al. 2010, Mygland et al. 2010). Lyme arthritis (LA) and Lyme carditis (LC) belong to the late LB manifestations and are relatively rare in Europe (Berglund et al. 1995, Strle and Stanek 2009). Their main cause in Europe and the North America is B. burgdorferi s. s infection (Stanek et al. 1990, Tijsse-Klasen et al. 2013). LA involves large joints inflammation, while LC can manifest as shortness of breath, fainting, chest pain (Steere et al. 1980, Szer et al. 1991). The presence of epithelial and mesenchymal cells is essential for proper embryonic development and organogenesis. It has been observed that the epithelial cell may be converted into a mesenchymal cell, acquiring its structural and functional characteristics. This process is defined as epithelial-mesenchymal transition (EMT) and describes the change from the polarized and immobile cells to cells with increased mobility (Pieniążek et al. 2012). EMT is characterized by a decrease in the expression of proteins that enhance the adherence of cells (e.g. E-cadherin, γ-catenin) and increased transcriptional activity of the mesenchymal markers such as-cadherin and fibronectin (Kalluri and Weinberg 2009). Taking into account the consequences and biological context of this process, three types of EMT can be distinguished (Kalluri and Weinberg 2009). Type 1 EMT (developmental) plays an important role in the embryogenesis, organogenesis and tissue morphogenesis of 123

124 multicellular organisms (Pieniążek et al. 2012). Type 2 is associated with wound healing, tissue regeneration and organ fibrosis. This process begins as part of a repair event that normally generates fibroblasts and other cells to reconstruct tissue after injury and inflammation-related damage. It takes place in an inflammatory environment, where it is regulated by numerous proinflammatory cytokines (Kalluri and Weinberg 2009). Type 3 EMT is associated with cancer cells that have undergone genetic and epigenetic changes, especially in genes associated with progression and distant metastasis (Taylor et al. 2010). The epithelial-mesenchymal transition can be induced by various signaling pathways that contain important molecules such as transforming growth factor beta (TGF-β), growth factors acting via receptor tyrosine kinases (RTK), fibroblast growth factor receptors (FGFRs), NF-κB, Wnt, Notch and Hedgehog proteins (Zaravinos 2015). The EMT induction can be mediated through interactions of bacterial pathogens with epithelial cells. Some of the bacteria possess the ability to trigger and maintain a chronic inflammatory environment, in which cells are continuously exposed to stress. Alterations in signaling pathways caused by the pathogen can lead to intracellular stress with tissue damage and promote the acquisition of malignant phenotype. EMT can be also induced by hypoxia, which often accompanies the infection (Chandrakesan et al. 2014, Leone et al. 2016). The aim of the study The aim of the study was to assess the expression profile of genes associated with epithelial-mesenchymal transition in the blood of patients with Lyme disease. Materials and methods The study group included whole blood collected from 15 patients with Lyme disease, which was confirmed by assessment of IgG and IgM levels. As a result of hierarchical clustering, it was divided into 4 subgroups: B1, B2, B3 and B4. Subgroup B3 was excluded from further analysis due to its size. The control group consisted of whole blood collected from 13 healthy volunteers. Total RNA extraction Total RNA was extracted with the use of TRIzol reagent (Invitrogen Life Technologies, CA, USA) according to the instructions provided by the manufacturer. RNA extracts were then purified with RNeasy Mini kit and RNase-Free DNase Set (Qiagen GmbH, Hilden, Germany). Concentration and purity of obtained RNA extracts were assessed using a Gene Quant II spectrophotometer (Pharmacia LKB Biochrom Ltd, Cambridge, UK). Qualitative evaluation was performed with agarose gel electrophoresis with ethidium bromide staining. Microarray analysis Expression profile of genes associated with epithelial-mesenchymal transition in the blood of patients with Lyme disease compared to control was assessed with the use of microarray technique (HG-U133A; Affymetrix, Inc., Santa Clara, CA, USA). Synthesis of double stranded cdna from RNA was performed with SuperScript Choice System (Invitrogen Life Technologies, CA, USA). Then BioArray HighYield RNA Transcript Labeling Kit (Enzo Life Sciences, NY, USA) was used in order to obtain biotinylated crna. It was purified with RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany) and fragmented using the Sample Cleanup Module Kit (Qiagen GmbH, Germany). After hybridization to the HG-U133A microarray crna was stained with streptavidin phycoerythrin. Gene Array Scanner G2500A (Agilent Technologies, CA, USA) was used to read the fluorescence signals. All procedures were performed as recommended by Affymetrix Gene Expression Analysis Technical Manual. Comparative analysis of the transcriptome was performed for 478 mrnas representing genes 124

125 associated with epithelial-mesenchymal transition selected based on the literature data and Affymetrix NetAffx Analysis Center database ( Statistical analysis The results analysis was performed with the use of the PL-Grid Infrastructure ( and GeneSpring GX software (Agilent Technologies, Inc., Santa Clara, CA, USA) The one-way analysis of variance (ANOVA) with the Benjamini- Hochberg correction Tukey s post hoc test were performed to select differentially expressed genes in patients with Lyme disease compared to control. P<0.05 was considered to indicate a statistically significant difference. Results The results analysis was based on a comparison of the expression level of selected mrnas between the study and control groups. Hierarchical clustering divided the study group into four subgroups (B1-B4), however subgroup B3 was excluded from further analysis. The results of one-way ANOVA test with Benjamini Hochberg correction showed that among 478 mrnas representing genes associated with epithelial-mesenchymal transition, 396 mrnas were significantly differentially expressed in study groups compared to control (p < 0.05; Table I). The Tukey's post hoc test allowed to obtain information regarding the differences between level of mrna among patients with Lyme disease and healthy volunteers (Table II). The results indicated that the number of mrnas differentiating each study group from the control was as follows: B1 vs. C, 91; B2 vs. C, 105; B4 vs. C, 198 (p<0.05; Table II). Venn diagram was then constructed based on the results obtained after performing the one-way ANOVA and Tukey's post hoc tests (Figure 1). The number of differentially expressed mrnas characteristic for each study group when compared to control was as follows: B1 vs. C, 39; B2 vs. C, 52; and B4 vs. C, 147. The results indicate that 12 mrnas differentiated all study groups from the control (Figure 1). Table III shows the list of transcripts that differentiate all study groups from the control, taking into account the direction of expression change in the analyzed groups (p<0.05 and FC>1.8 or FC<-1.8). Discussion Lyme disease is a multisystem, inflammatory bacterial disease that affects various human organs and tissues. In Europe, it is mainly caused by Borrelia garinii and Borrelia afzelii spirochetes, less frequently by Borrelia burgdorferi sensu stricto spirochetes (Stanek et al. 2011). Some of the bacteria can trigger and sustain inflammatory reactions, to which host responds by generating fibroblasts and other cells to repair the damage. Alterations in signaling pathways and genes associated with epithelial-mesenchymal transition can lead to chronic inflammation and fibrosis (Kalluri and Weinberg 2009, Stone et al. 2016). The microarray analysis allowed to assess changes in the expression of genes associated with epithelial-mesenchymal transition, which participates in both physiologic and pathologic healing. In our study, we observed that 12 mrnas differentiate all study groups from the control, however a fold change greater than 1.8 (at least in one group) was noted only for 5 mrnas corresponding to the following genes: MAP3K8, PCM1, PIK3CA, LIMS1, TCF7L2. Mitogen-activated protein kinases (MAPKs) are a family of serine-threonine kinases that mediate intracellular signaling associated with key cellular processes including cell proliferation, differentiation, survival, apoptosis, gene induction, cellular stress and inflammatory responses (Thalhamer et al. 2008, Kim and Choi 2010). Map3k8 (mitogenactivated protein kinase kinase kinase 8) plays an essential role in cytokine and chemokine 125

126 production during inflammatory processes. It is crucial for both innate and adaptive immune responses as it participates in modulating signal transduction pathways associated with MAPKs, TNF-α, IL-1, IL-17, adiponectin and G protein-coupled receptors. It was observed that Map3k8 / mice are more susceptible to influenza virus, Group B Streptococcus, Mycobacterium tuberculosis, Toxoplasma gondii, Listeria monocytogenes and Schistosoma mansoni infections than wild-type mice (Watford et al. 2008, Sánchez et al. 2017). Our study demonstrated statistically significant decrease in expression of MAP3K8 in study groups in comparison to control [FC = ; FC = ; FC = ]. Cytokine production by innate immune cells is necessary for the immune response during inflammation. It was proposed that proinflammatory stimuli lead to recruitment of pericentriolar material to the centrosome. Its disruption attenuates the secretion of interleukin- 6 and interleukin-10, suggesting the importance of centrosome in cytokine production (Dammermann and Merdes 2002, Vertii et al. 2016). Pericentriolar material 1 (PCM1), required for centrosome assembly and function, was downregulated in our study [FC = ; FC = ; FC = ]. Phosphoinositide-3-kinase catalytic alpha (PIK3CA) is an integral part of the PI3K pathway, responsible for regulation of numerous cellular processes such as cell survival, proliferation, differentiation, autophagy and inflammatory cytokine production (Cremer et al. 2011, Nakayama et al. 2015). It has been shown that Francisella tularensis, a facultative Gramnegative intracellular pathogen, dampens autophagy, PI3K/Akt, MAPK, TLR, interferon signaling pathways, which results in inhibition of the production of various proinflammatory cytokines (Cremer et al. 2011). Our study demonstrated significant decrease in expression of PIK3CA in patients with Lyme disease compared to control [FC = ; FC = ; FC = ]. LIM zinc finger domain containing 1 (LIMS1 also known as PINCH-1) is an adapter protein that forms a complex with integrin-linked kinase (ILK) and parvin. It is believed that PINCH-1 regulates cell adhesion stability and promotes cell survival. It can also bind Ras suppressor protein and the protein phosphatase 1α, which are responsible for the modulation of MAPK and PI3K/AKT signaling (Montanez et al. 2012). In our study, LIMS1 was significantly downregulated in study groups when compared to control [FC = ; FC = ; FC = ]. Transcription factor 7-like 2 also known as TCF7L2 or TCF4 is involved in Wnt/βcatenin signaling, which plays a critical role in cell proliferation, differentiation, survival and immune cell function (Angus-Hill et al. 2011, Suryawanshi et al. 2016). This pathway participates in achieving the balance between effective immune responses against infectious agents and tolerance toward commensal microbiota and self-antigens. Its disorders may cause uncontrolled activation of the immune system and excessive immune tolerance, which leads to autoimmune diseases and cancer, respectively (Suryawanshi et al. 2016). Our study demonstrated significant decrease in expression of TCF7L2 in B1 group [FC = ], while in B2 and B4 groups it was upregulated when compared to control [FC = ; FC = ]. In summary, it is important to achieve the balance between effective immune response against infectious agents and tolerance toward commensal microbiota and self-antigens. Obtained results indicate that disruptions in PI3K/Akt, MAPK, Wnt/β-catenin signaling pathways, essential for mounting an effective immune response during infection, lead to inhibition of proinflammatory cytokine production. Conclusions The changes in the expression profile of genes associated with epithelial-mesenchymal transition encoding proteins of PI3K/Akt, MAPK, Wnt/β-catenin signaling pathways indicate alterations in cytokine and chemokine production in patients with Lyme disease. 126

127 Table I. The results of one-way ANOVA test with Benjamini Hochberg multiple testing correction. P-value P all P < 0.05 P < 0.02 P < 0.01 P < P < Table II. Number of differentially expressed mrnas among the transcriptome groups. C, control; B1-B4, study groups. Group name B1 B2 B4 C B B B C p<0.05 vs. B1 group 2 p<0.05 vs. B2 group 3 p<0.05 vs. B4 group Table III. Transcripts differentiating study groups from control group at p<0.05 and FC 1.8 or ID Gene symbol P-value FC B1 vs. C B2 vs. C B4 vs. C _s_at MAP3K _s_at PCM _at PIK3CA _s_at LIMS _s_at TCF7L indicates increase in mrna level, while - indicates decrease in mrna level. ID, identification number of the probe; FC, fold-change; C, control; B1-B4, study groups. Figure 1. Venn diagram demonstrating differentially expressed mrnas among B1, B2 and B4 groups compared with the control. C, control; B1-B4, study groups. 127

128 References 1. Angus-Hill M.L, Elbert K.M, Hidalgo J, Capecchi M.R T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108: Berglund J, Eitrem R, Ornstein K, Lindberg A, Ringér A, Elmrud H, Carlsson M, Runehagen A, Svanborg C, Norrby R An epidemiologic study of Lyme disease in southern Sweden. N Engl J Med. 333: Busch U, Hizo-Teufel C, Böhmer R, Fingerle V, Rössler D, Wilske B, Preac-Mursic V Borrelia burgdorferi sensu lato strains isolated from cutaneous Lyme borreliosis biopsies differentiated by pulsed-field gel electrophoresis. Scand J Infect Dis. 28: Chandrakesan P, Roy B, Jakkula L.U, Ahmed I, Ramamoorthy P, Tawfik O, Papineni R, Houchen C, Anant S, Umar S Utility of a bacterial infection model to study epithelial-mesenchymal transition, mesenchymal-epithelial transition or tumorigenesis. Oncogene. 33: Cremer T.J, Butchar J.P, Tridandapani S Francisella Subverts Innate Immune Signaling: Focus On PI3K/Akt. Front Microbiol. 2: Dammermann A, Merdes A Assembly of centrosomal proteins and microtubule organization depends on PCM-1. J Cell Biol. 159: Henningsson A.J, Malmvall BE, Ernerudh J, Matussek A, Forsberg P Neuroborreliosis--an epidemiological, clinical and healthcare cost study from an endemic area in the south-east of Sweden. Clin Microbiol Infect. 16: Kalluri R, Weinberg R.A The basics of epithelial-mesenchymal transition. J Clin Invest. 119: Kim E.K, Choi E.J Pathological roles of MAPK signaling pathways in human diseases. Biochim Biophys Acta. 1802: Leone L, Mazzetta F, Martinelli D, Valente S, Alimandi M, Raffa S, Santino I Klebsiella pneumoniae Is Able to Trigger Epithelial-Mesenchymal Transition Process in Cultured Airway Epithelial Cells. PLoS One. 11: e Montanez E, Karaköse E, Tischner D, Villunger A, Fässler R PINCH-1 promotes Bcl-2-dependent survival signalling and inhibits JNK-mediated apoptosis in the primitive endoderm. J Cell Sci. 125: Mygland A, Ljøstad U, Fingerle V, Rupprecht T, Schmutzhard E, Steiner I, European Federation of Neurological Societies EFNS guidelines on the diagnosis and management of European Lyme neuroborreliosis. Eur J Neurol. 17: Nakayama M, Inoue T, Naito M, Nakayama K, Ohara N. Attenuation of the Phosphatidylinositol 3-Kinase/Akt Signaling Pathway by Porphyromonas gingivalis Gingipains RgpA, RgpB, and Kgp. The Journal of Biological Chemistry. 2015;290(8): doi: /jbc.m Pieniążek M, Donizy P, Ziętek M, Szynglarewicz B, Matkowski R Rola szlaków sygnalizacyjnych związanych z TGF-b w patogenezie przejścia nabłonkowomezenchymalnego (EMT) jako głównego elementu warunkującego progresję choroby nowotworowej. Postepy Hig Med Dosw (Online). 66: Sánchez Á, Relaño C, Carrasco A, Contreras-Jurado C2, Martín-Duce A, Aranda A, Alemany S Map3k8 controls granulocyte colony-stimulating factor production and neutrophil precursor proliferation in lipopolysaccharide-induced emergency granulopoiesis. Sci Rep. 7: Stanek G, Fingerle V, Hunfeld KP, Jaulhac B, Kaiser R, Krause A, Kristoferitsch W, O'Connell S, Ornstein K, Strle F, Gray J Lyme borreliosis: clinical case definitions for diagnosis and management in Europe. Clin Microbiol Infect. 17:

129 17. Stanek G, Klein J, Bittner R, Glogar D Isolation of Borrelia burgdorferi from the myocardium of a patient with longstanding cardiomyopathy. N Engl J Med. 322: Stanek G, O'Connell S, Cimmino M, Aberer E, Kristoferitsch W, Granström M, Guy E, Gray J European Union Concerted Action on Risk Assessment in Lyme Borreliosis: clinical case definitions for Lyme borreliosis. Wien Klin Wochenschr. 108: Stanek G, Strle F Lyme borreliosis. Lancet. 362: Steere A.C, Batsford W.P, Weinberg M, Alexander J, Berger H.J, Wolfson S, Malawista S.E Lyme carditis: cardiac abnormalities of Lyme disease. Ann Intern Med. 93: Stone R.C, Pastar I, Ojeh N, Chen V, Liu S, Garzon K.I, Tomic-Canic M Epithelialmesenchymal transition in tissue repair and fibrosis. Cell Tissue Res. 365: Strle F, Stanek G Clinical manifestations and diagnosis of lyme borreliosis. Curr Probl Dermatol. 37: Suryawanshi A, Tadagavadi R.K, Swafford D, Manicassamy S Modulation of Inflammatory Responses by Wnt/β-Catenin Signaling in Dendritic Cells: A Novel Immunotherapy Target for Autoimmunity and Cancer. Front Immunol. 7: Szer I.S, Taylor E, Steere A.C The long-term course of Lyme arthritis in children. N Engl J Med. 325: Taylor M.A, Parvani J.G, Schiemann W.P The pathophysiology of epithelialmesenchymal transition induced by transforming growth factor-beta in normal and malignant mammary epithelial cells. J Mammary Gland Biol Neoplasia. 15: Thalhamer T, McGrath M.A, Harnett M.M MAPKs and their relevance to arthritis and inflammation. Rheumatology (Oxford). 47: Tijsse-Klasen E, Pandak N, Hengeveld P, Takumi K, Koopmans M.P, Sprong H Ability to cause erythema migrans differs between Borrelia burgdorferi sensu lato isolates. Parasit Vectors. 6: Vertii A, Ivshina M, Zimmerman W, Hehnly H, Kant S, Doxsey S. The Centrosome Undergoes Plk1-Independent Interphase Maturation during Inflammation and Mediates Cytokine Release. Dev Cell May 23;37(4): doi: /j.devcel Watford W.T, Hissong B.D, Durant L.R, Yamane H, Muul L.M, Kanno Y, Tato C.M, Ramos H.L, Berger A.E, Mielke L, Pesu M, Solomon B, Frucht D.M, Paul W.E, Sher A, Jankovic D, Tsichlis P.N, O'Shea J.J Tpl2 kinase regulates T cell interferon-gamma production and host resistance to Toxoplasma gondii. J Exp Med. 205: Zaravinos A The Regulatory Role of MicroRNAs in EMT and Cancer. J Oncol. 2015:

130 130

131 Obecność Anaplasma phagocytophilum u kleszczy z terenu województwa śląskiego Beata Rozwadowska 1, 2, Marta Albertyńska 1, 2, Sławomir Dudek 3, Krzysztof P. Jasik 2, Urszula Mendera-Bożek 1 1 Wojewódzka Stacja Sanitarno-Epidemiologiczna w Katowicach, Katowice, ul. Raciborska 39, , b.rozwadowska@wsse.katowice.pl 2 Zakład Badań Strukturalnych Skóry, Katedra Kosmetologii, Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, Śląski Uniwersytet Medyczny w Katowicach, Sosnowiec, ul. Kasztanowa 3, Katedra i Zakład Farmakognozji i Fitochemii, Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, Śląski Uniwersytet Medyczny w Katowicach, Sosnowiec, ul. Jagiellońska 4, Prevalence of Anaplasma phagocytophilum in ticks from the Silesian voivodeship Abstract Anaplasma phagocytophilum is a Gram-negative bacteria transmitted by ticks. These pathogens cause human granulocytic anaplasmosis (HGA). The aim of this study was to confirm the prevalence of A. phagocytophilum in ticks from the Silesian voivodeship in years Material and methods. The analysis was conducted on ticks provided to the Provincial Sanitary and Epidemiological Station in Katowice from patients. The material was examined for the detection of A. phagocytophilum and B. burgdorferi sensu lato with using real time PCR method. Results. It was shown that A. phagocytophilum was detected in the nucleic acid extracts from 5,8% of ticks. Also B. burgdorferi sensu lato was detected in 33,7% samples. B. burgdorferi sensu lato was the dominant pathogen. Co-infections of A. phagocytophilum and B. burgdorferi sensu lato were observed in 5 ticks (4,8%). Moreover, 88,3% of A. phagocytophilum positive samples were also infected with B. burgdorferi sensu lato. Conclusions. The infections caused by A. phagocytophilum and B. burgdorferi sensu lato pose serious threats to inhabitants of the Silesian voivodeship. Key words: A. phagocytophilum, HGA, real time PCR, co-infection, the Silesian voivodeship. Wstęp Kleszcze są głównymi wektorami patogenów wywołujących choroby transmisyjne w Polsce. Najczęstszymi patogenami przenoszonymi przez kleszcze są krętki należące do kompleksu Borrelia burgdorferi sensu lato wywołujące boreliozę z Lyme. Ponadto, mogą one być wektorami wirusa kleszczowego zapalenia opon mózgowych (ang. Tick-borne encephalitis virus, TBEV), Anaplasma phagocytophilum, Ehrlichia spp., Bartonella spp., Babesia spp., pałeczek tularemii oraz riketsji wywołujących gorączki plamiste (Parola i Raoult 2001, Wójcik-Fatla i wsp. 2009a,b, Chmielewski i wsp. 2011, Pancewicz i wsp. 2011, Szlendak 2013, Rozwadowska i wsp. 2014, Czupryna i wsp. 2015, Albertyńska i wsp. 2016). Kleszcze mogą być równocześnie wektorem kilku patogenów (Hildebrandt i wsp. 2003, Skotarczak i wsp. 2003). A. phagocytophilum zaliczana jest obecnie do rzędu Ricketssiales, rodziny Anaplasmataceae i rodzaju Anaplasma. Do roku 2001 były to trzy odrębne gatunki tj. Ehrlichia phagocytophila, Ehrlichia equi oraz czynnik ludzkiej erlichiozy granulocytarnej (HGE). 131

132 Głównym wektorem A. phagocytophilum w Europie jest kleszcz z gatunku Ixodes ricinus. Natomiast rezerwuarem są dziko żyjące zwierzęta kopytne tj. jelenie, sarny oraz liczne gryzonie. Człowiek i zwierzęta domowe mogą być zakażone A. phagocytophilum będąc tylko żywicielem przypadkowym (Grygorczuk i wsp. 2004, Chmielewski i wsp. 2014). A. phagocytophilum to niewielka bakteria Gram-ujemna (0,2-2µm) o kształcie owalnych bądź kulistych ziarniaków. Jest to organizm wewnątrzkomórkowy, cechujący się tropizmem do granulocytów obojętnochłonnych. Charakteryzuje się zdolnością do tworzenia w wakuolach śródplazmatycznych struktur o nazwie morula. Są to mikrokolonie wielkości 2-4µm składające się nawet z około 50 komórek bakteryjnych. Genom A. phagocytophilum jest 4- krotnie mniejszy od genomu E. coli. Składa się z par zasad. Ponad połowę genomu stanowią geny metabolizmu podstawowego bakterii. Unikatowe struktury białkowe kodowane są przez ponad 1/3 otwartych ramek odczytu (ORFs). A. phagocytophilum nie jest zdolna do wykorzystania glukozy jako źródła energii, ale za to posiada geny umożliwiające syntezę nukleotydów, witamin, biotyny czy też koenzymu A (Grygorczuk i wsp. 2004, Rikihisa 2011, Chmielewski i wsp. 2014, Dzięgiel i wsp. 2016). A. phagocytophilum jest czynnikiem etiologicznym ludzkiej anaplazmozy granulocytarnej (HGA). Jest to choroba odzwierzęca. Występuje w strefie klimatu umiarkowanego tj. w Europie, Ameryce Północnej oraz Azji. Do zakażenia dochodzi głównie przez kleszcze. Niemniej jednak może do niego dojść również drogą transfuzji oraz w drodze zakażeń perinatalnych (Dhand i wsp. 2007, Dumler i wsp. 2007). Zakażenie A. phagocytophilum u człowieka ma zazwyczaj przebieg bezobjawowy. Można je wtedy potwierdzić jedynie wykrywając specyficzne przeciwciała we krwi. Niestety zakażenie może mieć również charakter zróżnicowany i niecharakterystyczny. Może czasem przybrać postać ostrą i doprowadzić do śmierci pacjenta. Objawy zakażenia mogą przypominać grypę. Pojawia się gorączka, bóle głowy, stawów i mięśni, złe samopoczucie. Okres wylęgania choroby trwa od 5 do 21 dni. Dodatkowo w czasie zakażenia może występować biegunka, wymioty, kaszel, zmiany skórne. Przy ciężkich zakażeniach u chorych może wystąpić zespół wewnątrznaczyniowego wykrzepiania (DIC), niewydolność nerek, niewydolność oddechowa oraz objawy ze strony układu neurologicznego (Dhand i wsp. 2007). Śmiertelność w przypadku HGA jest bardzo niska i wynosi poniżej 1%. Niestety wśród dzieci, starszych oraz osób z obniżoną odpornością może dochodzić nawet do 10% (Chmielewski i wsp. 2014). Zakażenia A. phagocytophilum sprzyjają innym zakażeniom wywoływanym przez patogeny przenoszone przez kleszcze (Grygorczuk i wsp. 2004). Według rekomendacji złotym standardem w diagnostyce HGA jest odczyn immunofluorescencji pośredniej IFA. Metoda pozwala wykryć przeciwciała w klasie IgM i IgG w fazie ostrego zakażenia oraz w okresie zdrowienia. Przeciwciała w klasie IgM wykrywane są po 3-5 dniach od zakażenia lub po 1 dobie od wystąpienia gorączki. Przeciwciała w klasie IgG wykrywane są po 7-10 dniach od zakażenia. Przeciwciała w klasie IgG mogą utrzymywać się rok lub jeszcze dłużej, najwyższe miano osiągają między dniem od zakażenia. Czułość diagnostyczna metody IFA dla przeciwciał w klasie IgM wynosi zaledwie 27-37%, a dla klasy IgG %. Interpretacja wyniku powinna być skorelowana z objawami klinicznymi pacjenta. We wczesnym etapie zakażenia (poniżej 7 dnia) można w diagnostyce zastosować metodę PCR oraz rozmaz krwi. Do metod molekularnych materiał stanowi krew obwodowa pobrana na EDTA natomiast do metod serologicznych surowica krwi. Niestety odchylenia wyników laboratoryjnych w przypadku ostrej anaplazmozy są mało specyficzne i zbliżone do odchyleń podczas kleszczowego zapalenia opon mózgowych i mózgu. W pierwszym etapie HGA obserwuje się m.in. leukopenię, trombocytopenię, wzrost aktywności aminotransferazy aparaginianowej (AspAT) oraz alaninowej (ALAT) oraz dehydrogenazy kwasu mlekowego LDH. Natomiast w ostrym okresie choroby następuje 132

133 wzrost CRP i kreatyniny. Z reguły odchylenia wyników badań laboratoryjnych cofają się po około 2 tygodniach. Rzadko kiedy pojawiają się powikłania oraz zgony. Nie opisano w Europie anaplazmozy o przebiegu przewlekłym (Chmielewski i wsp. 2014). Celem niniejszej pracy była ocena występowania A. phagocytophilum u kleszczy zebranych na terenie województwa śląskiego w latach Materiał i metody Materiał do badań stanowiły kleszcze pochodzące z terenu województwa śląskiego. Były one dostarczone do Interdyscyplinarnej Pracowni Diagnostyki Molekularnej Wojewódzkiej Stacji Sanitarno-Epidemiologicznej w Katowicach. Przebadano 104 kleszcze w kierunku wykrycia materiału genetycznego A. phagocytophilum i B. burgdorferi sensu lato. Kleszcze były dostarczane do laboratorium żywe w odpowiednich pojemnikach i probówkach lub w roztworze 70% etanolu. Badaniu poddano tylko kleszcze, które miały zachowany cały, nieuszkodzony aparat gębowy. Izolacja materiału genetycznego. Materiał genetyczny został wyekstrahowany z kleszczy z wykorzystaniem zestawów do izolacji RIBO prep. Nucleic acid extraction kit (Federal Budget Institution of Science Central Research Institute for Epidemiology, Moscow, Russia). Do izolacji materiału genetycznego zastosowano odpowiednią procedurę izolacji zgodnie z zaleceniami producenta zestawu. Kleszcze przed izolacją były zalane w probówce 500 µl etanolu 96% i wirowane w x g. Następnie procedurę powtórzono dodając 500 µl PBS. Po odpipetowaniu supernatantu dodano do probówki 300 µl PBS i zmacerowano w nim kleszcza. Po tym etapie materiał odwirowano, a do analizy wykorzystano supernatant. Zestaw zastosowany do izolacji posiada certyfikat do diagnostyki in vitro (CE-IVD). Odwrotna transkrypcja. Reakcja odwrotnej transkrypcji wyizolowanego RNA B. burgdorferi sensu lato została przeprowadzona w celu uzyskania cdna do reakcji amplifikacji w czasie rzeczywistym. Proces odwrotnej transkrypcji przeprowadzono z wykorzystaniem zestawu REVERTA L. RT reagents kit (Federal Budget Institution of Science Central Research Institute for Epidemiology, Moscow, Russia). Procedurę transkrypcji przeprowadzono zgodnie z zaleceniami producenta zestawu. Zestaw zastosowany do reakcji transkrypcji posiada certyfikat do diagnostyki in vitro (CE-IVD). Detekcja A. phagocytophilum i B. burgdorferi sensu lato. Wykrywanie materiału genetycznego A. phagocytophilum i B. burgdorferi sensu lato przeprowadzono z wykorzystaniem termocyklera LightCycler 480 II firmy Roche. Reakcję amplifikacji w czasie rzeczywistym przeprowadzono przy użyciu zestawu AmpliSens TBEV, B.burgdorferi sl, A.phagocytophilum, E.chaffeensis/E.muris-FRT (Federal Budget Institution of Science Central Research Institute for Epidemiology, Moscow, Russia). Reakcja amplifikacji była oparta na przyłączeniu komplementarnych starterów do specyficznego fragmentów genomów patogenów zastosowanych w zestawie. Reakcję detekcji przeprowadzono zgodnie z zaleceniami producenta zestawu. Zestaw zastosowany do reakcji detekcji posiada certyfikat do diagnostyki in vitro (CE-IVD). Wyniki Przebadano 104 kleszcze w kierunku wykrycia obecności materiału genetycznego A. phagocytophilum i B. burgdorferi sensu lato metodą real-time PCR. W badanym materiale potwierdzono obecność materiału genetycznego A. phagocytophilum oraz B. burgdorferi sensu lato. A. phagocytophilum wykryto w 6 izolatach, co stanowiło 5,8% wszystkich przebadanych próbek. Natomiast materiał genetyczny B. burgdorferi sensu lato wyizolowano w 35 kleszczach co stanowiło 33,7% wszystkich badanych próbek (tab. I). Następnie spośród próbek, które cechowały się logarytmicznym przyrostem fluorescencji w kierunku wykrycia A. phagocytophilum oraz B. burgdorferi sensu lato potwierdzono współwystępowanie tych patogenów. Występowanie koinfekcji wykazano w 5 133

134 badanych izolatach, co stanowiło 4,8% wszystkich przebadanych izolatów. Jednakże - analizując tylko wyniki pozytywne dla A. phagocytophilum - koinfekcje z B. burgdorferi sensu lato były obecne aż w 5 z 6 próbek, w których wykryto A. phagocytophilum. Stanowiło to 83,3% wszystkich wyników dodatnich w kierunku A. phagocytophilum. Natomiast wśród wszystkich próbek dodatnich w kierunku B. burgdorferi sensu lato koinfekcje z A. phagocytophilum były obecne tylko w 14,3% wszystkich próbek w których potwierdzono obecność materiału genetycznego B. burgdorferi sensu lato. Dyskusja W ostatnich latach zakażenia patogenami przenoszonymi przez kleszcze stwarzają coraz większe trudności diagnostyczne. Kleszcze mogą być wektorem i rezerwuarem nie tylko krętków B. burfdorferi sensu lato, ale i innych patogenów, które mogą stanowić zagrożenia dla życia i zdrowia ludzi. Coraz częściej pojawia się problem infekcji wywołanych równocześnie kilkoma patogenami. Na podstawie wyników uzyskanych przez WSSE w Katowicach potwierdzono występowanie A. phagocytophilum u kleszczy z terenu województwa śląskiego na poziomie 5,8%. Niesie to za sobą ryzyko zakażenia tym patogenem wśród mieszkańców województwa śląskiego. W badanym materiale potwierdzono również występowanie krętków B. burgdorferi sensu lato oraz wykazano występowanie koinfekcji A. phagocytophilum z B. burgdorferi sensu lato na poziomie 4,8%. Podobne badania były przeprowadzone w północnej części Polski przez Stańczak i wsp. (2004). Wykazały one również współwystępowanie u kleszczy B. burgdorferi sensu lato i A. phagocytophilum, ale na wyższym poziomie 8,3%. Patogenem dominującym była A. phagocytophilum, natomiast w badaniach przeprowadzonych przez WSSE w Katowicach B. burgdorferi sensu lato wyizolowano dla 33,7% próbek. Występowanie infekcji mieszanych przenoszonych przez kleszcze ma duże znaczenie epidemiologiczne. Coraz częściej odnotowywane są przypadki współzakażeń u ludzi, co w znaczny sposób powoduje zaostrzenie objawów chorób odkleszczowych. Przebieg i manifestacja tych chorób jest odmienna od typowego schematu. W przypadku równoczesnego zakażenia A. phagocytophilum i B. burgdorferi sensu lato wykazano, że zakażenie jednym patogenem stymuluje nabywanie i transmisję drugiego (Wójcik-Fatla 2010). Potwierdziły ten fakt wyniki uzyskane przez WSSE w Katowicach. Wśród kleszczy u których potwierdzono obecność A. phagocytopjhilum, aż 83,3% było również zakażonych B. burgdorferi sensu lato. Współzakażenia A. phagocytophilum i B. burgdorferi mogą zmieniać naturalny przebieg choroby, potęgować objawy i prowadzić do zwiększenia bakteriemii. Potwierdził to w swoich badaniach Grab i wsp. w 2007 roku. Obecność wielokrotnych zakażeń patogenami odkleszczowymi wykazano u chorych ze zdiagnozowaną boreliozą. Przypadki zakażeń mieszanych B. burgdorferi i A. phagocytophilum oraz B. burgdorferi sensu lato i Babesia spp. u pacjentów z terenu Śląska potwierdziły badania prowadzone przez Welc-Falęciak i wsp. (2010). Podobne wyniki uzyskano dla osób z okolic Lublina. Dominowały tam współzakażenia dwoma patogenami B. burgdorferi i A. phagocytophilum, B. burgdorferi i Bartonella spp. oraz trzema B. burgdorferi, A. phagocytophilum i Bartonella spp. (Chmielewska-Badora i wsp. 2012). Przeprowadzone badania potwierdzają występowanie A. phagocytophilum u kleszczy z terenu województwa śląskiego oraz współwystępowanie z B. burgdorferi sensu lato. Może to stanowić ryzyko zakażenia dla mieszkańców województwa śląskiego. Występowanie koinfekcji wśród kleszczy niesie za sobą duże ryzyko zakażenia ludzi kilkoma patogenami równocześnie. Najczęściej występującą chorobą transmisyjna przenoszoną przez kleszcze nadal jest borelioza z Lyme. Zapadalność na tę chorobę wg danych NIZP-PZH w Warszawie w roku 2017 wynosiła 56 przypadków na 100 tys. W województwie śląskim w roku 2017 odnotowano 2779 zachorowań na boreliozę z Lyme. Niestety liczba zachorowań z każdym rokiem ma tendencję wzrostową. Jeśli chodzi o zachorowania na gorączkę plamistą i inne riketsjozy to wg danych NIZP-PZH w Warszawie w roku 2017 były zgłoszone 4 zachorowania 134

135 na terenie województwa dolnośląskiego. Na terenie śląska nie zgłoszono żadnego zachorowania. W 2015 roku Welc-Falęciak i wsp. opisali przypadek wystąpienia ludzkiej granulocytarnej anaplazmozy u 42 letniego pacjenta z terenu województwa podlaskiego. Zarówno objawy kliniczne jak i badania laboratoryjne potwierdziły ostrą fazę choroby. Czynnik etiologiczny wykryto przy użyciu technik molekularnych. Ponadto u pacjenta zdiagnozowano również wczesną boreliozę. W Polsce pierwsze trzy przypadki HGA zostały opisane i zdiagnozowane w 2001 roku na terenie endemicznym (północno-wschodnia część Polski) (Tylewska-Wierzbanowska i wsp. 2001). HGA zostało potwierdzone przy użyciu immunofluorescencji pośredniej oraz techniki PCR. Na terenach endemicznych u pacjentów pokłutych przez kleszcze z wczesną boreliozą powinno uwzględniać się zawsze ryzyko zakażenia wywołanego przez A. phagocytophilum lub inny patogen odkleszczowy. Zakażenia wywoływane przez patogeny odkleszczowe stanowią coraz poważniejsze zagrożenie dla ludzi. Społeczeństwo coraz bardziej aktywnie spędza wolny czas i korzysta z różnych form aktywności na świeżym powietrzu. Najskuteczniejszą ochronną przeciwko patogenom są szczepienia ochronne, jednakże w tym przypadku dostępne są tylko szczepionki przeciwko kleszczowemu zapaleniu mózgu i opon mózgowo-rdzeniowych. W celu uniknięcia zakażenia nadal najważniejszą rolę odgrywa profilaktyka i edukacja społeczeństwa. Należy unikać ekspozycji na kleszcze w czasie przebywania w lesie, należy usuwać liście i wysokie trawy w miejscu zamieszkania i pracy, nosić odpowiednie ubranie osłaniające cale ciało czy też stosować właściwe repelenty (Wójcik-Fatla 2010). Wnioski Potwierdzono obecność A. phagocytophilum oraz B. burgdorferi sensu lato u kleszczy z terenu województwa śląskiego oraz wykazano ich współwystępowanie. B. burgdorferi sensu lato stanowiła patogen dominujący w badanych kleszczach. Znaczna większość kleszczy (83,3%) zakażonych A. phagocytophilum była zakażona również B. burgdorferi sensu lato. Na terenie województwa śląskiego istnieje ryzyko wystąpienia infekcji mieszanych u mieszkańców pokłutych przez kleszcze zakażone A. phagocyophilum i B. burgdorferi sensu lato. Podziękowania Badania były finansowane przez Śląski Uniwersytet Medyczny w Katowicach z umowy numer KNW-1-104/N/7/B. Tab. I. Obecność materiału genetycznego A. phagocytophilum oraz B. burgdorferi sensu lato, potwierdzona metodą real-time PCR u kleszczy z terenu województwa śląskiego (A.p. Anaplasma phagocytopilum, B.b.s.l. Borrelia burgdorferi sensu lato,). Liczba przebadanych kleszczy Liczba zakażonych kleszczy (%) Liczba (%) A.p. B.b.s.l. B.b.s.l. + A.p. kleszczy nie zakażonych (5,8) 35 (33,7) 5 (4,8) 67 (64,4) Spis literatury 1. Albertyńska M., Rozwadowska B., Mendera-Bożek U., Jasik K.P., Okła H., Słodki A., Słodki J., Swinarew A.S., Cieślik-Tarkota R Obecność Borrelia burgdorferi sensu lato, Babesia microti, Anaplasma phagocytophilum, Ehrlichia chaffeensis/ehrlichia muris oraz wirusa kleszczowego zapalenia mózgu i opon mózgowych (TBEV) w kleszczach z 135

136 terenu woj. śląskiego. W: Buczek A., Błaszak C., (red.), Stawonogi. Zależności w układzie żywiciel-ektopasożyt-patogen. Lublin: Koliber: Chmielewska-Badora J., Moniuszko A., Żukiewicz-Sobczak W., Zwoliński J., Piątek J., Pancewicz S Serological survey in persons occupationally exposed to tick-borne pathogens in cases of co-infections with Borrelia burgdorferi, Anaplasma phagocytophilum, Bartonella spp. and Babesia microti. Ann Agric Environ Med. 19(2): Chmielewski T., Andrzejewski K., Mączka I., Fiecek B., Radlińska M., Tylewska- Wierzbanowska S Kleszcze zakażone bakteriami chorobotwórczymi dla człowieka na terenach parków miejskich Warszawy. Przegl Epidemiol. 65: Chmielewski T., Dunaj J., Gołąb E., Gut W., Horban A., Pancewicz S., Puacz E., Szelenbaum-Cielecka D., Tylewska-Wierzbanowska S Ludzka anaplazmoza granulocytarna (HGA). W: Diagnostyka laboratoryjna chorób odkleszczowych. Warszawa: KIDL: Czupryna P., Moniuszko-Malinowska A., Pancewicz S., Garkowski A., Gościk J., Siemieniako A., Zajkowska J Lyme disease in Poland a serious problem? ADVMS. 133: Dhand A., Nadelman R.B., Aquero-Rosenfeld M., Haddad F.A., Stokes P., Horowitz H.W Human granulocytic anaplasmosis during pregnancy: case series and literature review. CID. 45: Dumler J.S., Madigan J.E., Pusterla N., Bakken J.S Ehrlichioses in humans: epidemiology, clinical presentation, diagnosis, and treatment. CID. 45: S Dziegiel B., Adaszek Ł., Winiarczyk S Wild animals as reservoirs of Anaplasma phagocytophilum for humans. Przegl Epidemiol. 70(3): Grab D.J., Nyarko E., Barat N.C., Nikolskaia O.V., Dumler J.S Anaplasma phagocytophilum-borrelia burgdorferi coinfection enhances chemokine, cytokine, and matrix matalloprotease expression by human brain microvascular endothelial cells. Clin Vaccne Immunol. 14 (11): Grygorczuk S., Hermanowska-Szpakowicz T., Kondrusik M., Pancewicz S., Zajkowska J Ehrlichioza choroba mało znana i rzadko rozpoznawana w Polsce. Wiadomości lekarskie. 57(7-8): Hildebrandt A., Schmidt K.H., Wilske B., Dorn W., Straube E., Fingerle V Prevalence of four species of Borrelia burgdorferi sensu lato and coinfection with Anaplasma phagocytophila in Ixodes ricinus ticks in central Germany. Eur J Clin Microbiol Infect Dis. 22(6): Pancewicz S., Moniuszko A., Dunaj J., Zajkowska J., Kondrusik M., Grygorczuk S Koinfekcje w materiale Kliniki Chorób Zakaźnych i Neuroinfekcji. W: Neuroinfekcje, streszczenia. VII Ogólnopolska Konferencja Naukowa, października 2011 r. Białystok. Klinika Chorób Zakaźnych i Neuroinfekcji Uniwersytetu Medycznego w Białymstoku. Polska: Parola P., Raoult D Ticks and Tickborne Bacterial Diseases in Humans: An Emerging Infectious Threat. Clin. Inf. Dis. 32: Rikihisa Y Mechanizm of obligatory intracellular infection with Anaplasma phagocytophilum. Clinical Microbiology Reviews. 24(3): Rozwadowska B., Albertyńska M., Hudzik G., Jasik K.P., Okła H., Słodki A., Słodki J Badania nad występowaniem Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Ehrlichia chaffeensis/e. muris oraz wirusa kleszczowego zapalenia mózgu i opon mózgowych (TBEV) u kleszczy z terenu województwa śląskiego. W: Buczek A., Błaszak C. (red.), Stawonogi. Zagrożenie zdrowia człowieka i zwierząt. Koliber: Lublin; 2014: Stańczak J., Gabre R. M., Racewicz M., Kruminis-Łozowska W., Kubica-Biernat B Ixodes ricinus as a vector of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum 136

137 and Babesia microti in urban and suburban forests. Ann Agric Environ Med. 11: Skotarczak B., Rymaszewska A., Wodecka B., Sawczuk M Molecular evidence of coinfection of Borrelia burgdorferi sensu lato, human granulocytic ehrlichiosis agent, and Babesia microti in ticks from northwestern Poland. J Parasitol. 89(1): Szlendak E Kleszcze (Acari: Ixodida) występujące w Polsce jako wektory chorób. W: Buczek A., Błaszak C. (red.), Stawonogi. Aspekty medyczne i weterynaryjne. Lublin: Koliber: Tylewska-Wierzbanowska S., Chmielewski T., Kondrusik M., Hermanowska- Szpakowicz T., Sawicki W., Sułek K First cases of acute human granulocytic ehrlichiosis in Poland. Eur J Clin Microbiol Infect Dis. 20: Welc-Falęciak R., Hildebrandt A., Siński E Co-infection with Borrelia species and other tick-borne pathogens in humans: two cases from Poland. Ann Agric Environ Med. 17: Welc-Falęciak R., Kowalec M., Zajkowska J., Pancewicz S.A., Siński E Clinical and molecular features of one case of human infection with Anaplasma phagocytophilum from Podlaskie Province in eastern Poland. Ann Agric Environ Med. 22(3): Wójcik-Fatla A Współzakażenia Borrelia burgdorferi i innymi patogenami odkleszczowymi. W: Cisak E., Zwoliński J. (red.), Borelioza i inne choroby przenoszone przez kleszcze w aspekcie narażenia zawodowego. Instytut Medycyny pracy im. Prof. J. Nofera w Łodzi Wójcik-Fatla A., Szymańska J., Buczek A. 2009a. Choroby przenoszone przez kleszcze. Część I. Ixodes ricinus jako rezerwuar i wektor patogenów. Zdr. Publ. 119 (2): Wójcik-Fatla A., Szymańska J., Buczek A. 2009b. Choroby przenoszone przez kleszcze. Część II. Patogeny Borrelia burgdorferi, Anaplasma phagocytophilum, Babesia microti. Zdr. Publ. 19 (2): Biuletyn NIZP-PZH w Warszawie Gorączka plamista i inne riketsjozy (A77;A79). W: Choroby zakaźne i zatrucia w Polsce Biuletyn NIZP-PZH w Warszawie Borelioza z Lyme (A69.2). W: Choroby zakaźne i zatrucia w Polsce

138 138

139 Ornithophilic ticks (Ixodida: Argasidae, Ixodidae) occurring in the south-eastern Poland and their role in pathogens circulation in environment Alicja Buczek 1, Katarzyna Bartosik 1, Alicja M. Buczek 1, Weronika Buczek 1, Joanna Kulisz 1, Aneta Woźniak 1, Dorota Kulina 2, Dariusz Ciura 3, Halina Cios 4, Zbigniew Zając 1 1Chair and Department of Biology I Partasitology, Medical Univeristy of Lublin, Radziwiłłowska 11 str, Lublin 2 Department of Basic Nursing and Medical Teaching 3Department of Health Promotion and Obesity Management, Department of Pathophysiology, Medical University of Silesia, Medyków Str.18, Katowice, Poland 4State School of Higher Education in Chełm, Pocztowa Str. 54, Chełm, Poland Abstract Ticks are characterized by diverse host specificity. Globally, three-host ticks with wide host range and ticks parasitizing on mammals and birds which are moving not only within their habitats, but take over a distances during seasonal migrations have uttermost significance in pathogen transmission and maintenance in environment. Introcuction Ticks have been categorized into 5 classes by Hoogstraal and Aeschlimann (1982) because of their trophic relationship with birds. According to that feature, among 19 species of Polish fauna of ticks, there are 4 exclusively ornithophilic species, 2 generally ornithophilic species, 4 partly ornithophilic species, 5 accidentally ornithophilic ticks and 4 non ornithophilic ticks (Siuda et al. 2006). Among them, occurrence of two ornithophilic ticks has been confirmed in Lublin voivodship. Generally ornithophilic tick Agras reflexus (Argasidae) parasitizes on pigeons and according to Filippova (1966) other few birds species. It can also attack humans accidentally. Partly ornithophilic tick Ixodes ricinus belongs to Ixodidae family. Five another representatives of this family I. trianguliceps, I. hexagonus, I. crenulatus, I. apronophorus and Dermacentor reticulatus that have been collected in this area on other hosts or vegetation (sources of data are given in paper of Buczek and Bartosik 2011) were occasionally found on birds and only abroad. Sources of data on those ticks infesting birds are given in papers from 60 90s. of XX century cited by Siuda et al. (2006). I. trianguliceps, I. hexagonus, I. crenulatus, I. apronohorus and D. reticulatus have been included into group of occasionally ornithophilic ticks by Siuda et al. (2006) and Nowak-Chmura and Siuda (2012). During our 20 years lasting field studies on distribution and ecology of the D. reticulatus, which is common tick in eastern part of Lublin province, we do not found immature forms of that tick parasitizing on birds. Diverse habitat preferences of particular birds species and their behavioral differences cause birds are found in heterogeneous ticks habitats where they are exposed to attacks of these ectoparasites. Local wandering and long distance migrations of birds into far away habitats contributes to tick and tick-borne pathogens dissemination. Birds role in tick and pathogens transmission into new habitats has been noticed in the past (Hoodstraal et al. 1961, Babos 1964, Kahl 1971, Hoogstraal 1972, Nosek and Sixl 1972, Hoogstral and Aeschlimann 1982, Siuda 1993, Humair et al. 1998). However, because of significant increase of number of 139

140 cases of tick borne diseases in humans and animals and occurrence in new areas pathogens that were not previously identified there, studies on diverse ways of pathogens circulation in environment and their zoonotic reservoirs became intensified. Numerous researches conducted worldwide, including Europe, document birds significance in transmission of ticks infected with pathogens of huge importance for public health, eg. diverse Borrelia spirochetes (Humair et al. 1993, Humair 2002, Kipp et al. 2006, Labuda 2008, Hasle et al. 2011, Spitalská et al. 2011, Marsot et al. 2012, Socolovschi et al. 2012, Geller et al. 2013, Hubálek et al. 2014, Klaus et al and others), rickettssiae counted into genera Rickettsia, Coxiella, Anaplasma (Ioannou et al. 2009, Hildebrandt et al. 2010, Spitalská et al. 2011, Socolovschi et al. 2012, Hornok et al. 2013, 2014, Wallménius et al. 2014, Novakova et al. 2015, Mărcuţan et al. 2016), Bartonella (Molin et al. 2011) tick-borne encephalitis virus (Hubálek and Halouzka 1996, Waldenstro m et al. 2007, Geller et al. 2013) and Babesia protozoans (Hildebrandt et al. 2010, Movila et al. 2011). There are few data on ticks fauna parasitizing on native birds species in Poland (Siuda 1986a, b, Złotorzycka 1990, Siuda 1993, Siuda et al. 2006). Studies on ticks occurring on birds and pathogen prevalence in those hosts and arthropods are also rare. Although, the area of Poland seems to be attractive - because of its geographic location - for researchers, as zoologists and epidemiologists working on ticks and transmission diseases of humans and animals, attempts on determining ticks fauna of birds and/or transmitted pathogens were made just in few regions, ie. in the Mazurian Lake region (north-eastern Poland)(Gryczyńska et al. 2002, 2004, Gryczyńska and Welc-Falęciak 2016), Pojezierze Wielkopolskie (in west-central Poland)(Michalik et al. 2008, Skotarczak et al. 2006), Landscape Park Zielonka Forest near Poznań city (in west-central Poland)(Biernat et al. 2016), Pojezierze Pomorskie (Zielonczyn, Pobierowo, north-western Poland)(Wodecka and Skotarczak 2016), and along the Baltic Sea coast (Nowak-Chmura et al. 2012). Attractiveness of Poland is caused by location on migratory ways of birds from other regions of the World, i.e. from Africa, Near East and areas located at the Mediterranean Sea into Western and Northern Europe. Together with migrating birds, ticks potentially infected with pathogens - foreign for native fauna can be accidentally transferred. Furthermore, area of Poland undergoes an impact of different air masses, what along with more often weather variations, or even maybe because climate change (what can be determined only in long-term observation) can be favorable for ticks transferred from warmer climatic zones. Few cases of tick transmission by migratory birds into Poland have been described so far. Following species were confirmed: Ixodes eldaricus (Nowak-Chmura 2012), I. festai (Siuda and Szymański 1991), Haemaphysalis punctata (Lachmajer et al. 1956) and Hyalomma marginatum (Siuda and Dutkiewicz 1979, Nowak and Solarz 2010). One of them H. marginatum - belongs to the most important vectors of transmission diseases of humans and animals in its endemic areas. Among others it transmits Crimean-Congo Hemorrhagic Fever, with increasing number of cases in Palearctic (Ergönül 2006, Al-Abria et al. 2017). In some areas of Europe, e.g. in parts of southern continental France, introduction of that tick species, likely by migratory birds, is observed (Vial et al. 2016). Migration of birds infected with pathogens or birds infested with infected ticks into Poland can enlarge range of pathogens transmitted by native tick species. Pigeon tick Argas reflexus (Fabricius, 1794) A. reflexus is widely distributed species, occurring in cities of West, South and Middle Europe (Dusbábek and Rosický 1976), also in Poland (Rafalski 1954, Siuda 1984, 1993). Current list of documented locations of A. reflexus in our country was given in earlier paper (Buczek et al. 2017). In eastern and south-eastern Poland two locations of this tick have been confirmed in Rzeszów ( N, E) (Buczek and Magdoń 2000) and Lublin (51 15 N, ) (Buczek and Bartosik 2011). Pigeon ticks usually are found in attics and church towers were pigeons, their specific hosts, use to occur. Humans are attack by A. reflexus accidentally, during night, if there are no pigeons in their surrounding or if ticks have 140

141 problems with bird access (e.g. during building renovation, after chasing pigeons from attics, during disinfestation process). Specific biological characteristics of pigeon tick determine its ability of long survival in different environmental conditions - even in case of lack of the host, its possibility of development in high values of humidity and temperature and its huge adaptive ability to new habitats. Biological features of A. reflexus are described in papers of Dusbábek and Rosický (1976), Buczek (1988, 1991a, b, 1992, 1992/1993, 1995, 1996, 1998). According to current knowledge A. reflexus has no huge importance in epidemiology of tick-borne human diseases. However, there are known cases (i.e. Stanek and Simeeoni 1989) suggesting possibility of transmission of Borrelia burdorferi spirochetes by A. reflexus to human. Studies conducted by Siński et al. (1994), although involving few individuals, did not reveal presence of Borrelia spirochates in pigeon ticks collected in attics in Upper Silesia. Wegner (1976) has demonstrated ability of A. reflexus to maintenance of tick-borne encephalitis virus for some time. Castor bean tick Ixodes ricinus (Linnaeus, 1758) Range of distribution of I. ricinus covers almost the whole Europe. This is the most common tick in Poland, occurs in diverse types of natural habitats and in urban and suburban areas, as parks, gardens and recreational areas. For last 20 years, many locations of this species have been documented by scientists from Polish research centers. In area of south-eastern Poland, that has been monitored by us for many years, I. ricinus is very common tick with changing distribution. We can clearly observe trend of shift of its occurrence toward cities, what increases its range on urban and suburban areas (Bartosik et al. 2011, unpublished data). Abundance of population of I. ricinus and its dynamics of activity are constantly changing. Numerous numbers of that species have been found near to Lublin, Lubartów, Puławy, in Polesie National Park and Roztocze National Park during field researches and collection of specimens for laboratory studies on their biology and prevalence of tick-borne pathogens. We observe increase of abundance of I. ricinus in various parts of Lublin voivodship. For example, in location often visited by inhabitants of the region, placed in Dąbrowa (near Lublin city) during short, two year period number of tick has been increased twice. Ixodes ricinus is non nidicolous tick with three-host life cycle and wide range of potential hosts. On birds parasitizes mostly juvenile forms larvae and nymphs. They are significantly linked in circulation tick-borne pathogens in environment. According to studies conducted within Operation Baltic in 1981 by Nowak-Chmura et al. (2012), I. ricinus was dominant species on birds migrating during spring and the only one on birds migrating during autumn. In light of research of Biernat et al. (2016) prevalence of spotted fever group rickettsiae in immature I. ricinus ticks collected from sylvatic passerine birds in west-central Poland is high and varies in the range of 10.5% to 26.9%. Probably, birds play an important role in circulation of these pathogens in environment in eastern and mid-eastern Poland, where prevalence of spotted fever group of rickettsiae in I. ricinus ticks varying from 4.4% (Białowieża National Park) (Welc-Falęciak et al. 2014) to 7.9% (Starachowice)(Stańczak et al 2008), while in D. reticulatus is 43.8% (Zając et al. 2017). It should be checked if birds take part in maintenance of other pathogens that have been identified in Lublin province in I. ricinus ticks collected on vegetation. Group of these pathogens includes: tick-borne encephalitis virus, Borrelia burgdorferi, Anaplasma phagocytophilum, Babesia microti and Toxoplasma gondii (i.e. Stańczak et al. 1999, Cisak et al. 2002, 2006, Sroka et al. 2003, 2009, Stojek and Dutkiewicz 2004, Chmielewska-Badora et al. 2007, Wójcik-Fatla et al. 2009, 2011). It is estimated that, in Lublin voivodship B. burgdorferi spirochetes occur in % of ticks (Siński et al. 1994, Wójcik-Fatla et al. 2009), but in some localities prevalence of spirochetes can reach even 22.25% (Siński et al. 1994). A. phagocytophilum has been confirmed in 0.7 to 10.2% of I. ricinus ticks (Chmielewska- Badora et al. 2007, Wójcik-Fatla et al. 2009), and the protozoan B. microti in % of ticks (Wójcik-Fatla et al. 2009). Prevalence of the TBE virus in I. ricinus in Lublin province is 141

142 estimated to % of ticks (Cisak et al. 2002, Wójcik-Fatla et al. 2011), while T. gondii is estimated to occur in % of I. ricinus ticks (Sroka et al. 2003, 2009). Cyclic studies that have been conducted within 20 years in the Mazurian Lake region (north-eastern Poland) among 623 engorging larvae and nymphs of I. ricinus collected on blackbirds (Turdus merula) in 61 specimens (9.8%) Borrelia burgdorferi s.l. spirochetes were detected (Gryczyńska and Welc-Falęciak 2016). In turn, in nymphs of I. ricinus parasitizing on birds in other European regions much more higher prevalence of B. burgdorferi s.l. spirochetes was confirmed. It is varied from 12% to 22% (Humair et al. 1993, Hasle et al. 2011, Capligina 2014, Hubálek et al. 2014,). In Switzerland, among bird-feeding ticks Borrelia spp. (19.5%) and Rickettsia helvetica (10.5%) predominated but other pathogens were identified as well, i.e. A. phagocytophilum(2%), R. monacensis (0.4%) and TBEV (0.2%) (Lommano et al. 2014). Investigation of birds role in maintenance and transmission of tick-borne disease in east and south-eastern Poland is especially interesting because there are 455 species of birds in the Lublin province, according to the list given by Ornithological Association ( So far, there were no ornithological studies on birdfeeding ticks and tick-borne pathogens in birds in this area of Poland. Hence, it is not known whether native, ornithophilic tick species of Poland, i.e. Ixodes arboricola, I. lividus, I. caledonicus, I. frontalis, are parasitizing those hosts in eastern Poland, and if yes, what is the level of ticks infestation in birds. Because of maintenance of foci of tick-borne diseases in east and south-eastern Poland and high prevalence of pathogens in inhabitants, it is important, from epidemiological perspective, to take interdisciplinary investigations on diverse routes of tick-borne pathogens transmission in nature. References: 1. Al-Abria S.S., Al Abaidanib I., Fazlalipourc M., Mostafavid E., Leblebicioglue H., Pshenichnayaf N., Memishg Z.A., Hewsonh R., Peterseni E., Malaj P., Nhu Nguyenj T.M., Malikj M.R., Formentyk P., Jeffriesk R Current status of Crimean-Congo haemorrhagic fever in the World Health Organization Eastern Mediterranean Region: issues, challenges, and future directions. Int. Jour. Infect. Dis. 58: Babos S Die Zeckenfauna Mitteleuropas. Akadémiai Kiadó, Budapest. 3. Bartosik K., Szymańska J., Buczek A Risk to human posed by Ixodes ricinus ticks in relation to diagnostic and therapeutic possibilities in south-eastern Poland. Zdr. Publ. 121(4): Biernat B., Stańczak J., Michalik J., Sikora B., Cieniuch S Rickettsia helvetica and R. monacensis infections in immature Ixodes ricinus ticks derived from sylvatic passerine birds in west-central Poland. Parasitol. Res. 115(9): Buczek A., Bartosik K Occurrence of Argas reflexus (Fabricius, 1794) (Ixodida, Argasidae) in urban habitat of south-eastern Poland. Wiad. Parazytol. 57(4): Buczek A Studies on the biology of Argas (A.) reflexus (Fabricius, 1794)(Acari: Ixodida: Argasidae). 1. Effect of temperature and relative humidity on embryonic development and egg hatch. Folia Biol. 36: Buczek A. 1991a. Disturbances of the larvae hatch process of Argas (A.) reflexus (Fabr.)(Acari: Ixodida: Argasidae) caused by different temperatures and relative humidity levels. Wiad. Parazytol. 37: Buczek A. 1991b. Influence of high relative humidity on course of embryonic development and egg hatch of Argas (A.) reflexus (Fabricius, 1794)(Acari: Ixodida: Argasidae). Z. Angew. Zool. 4: Buczek A Studies on the biology of Argas (A.) reflexus (Fabricius, 1794)(Acari: Ixodida: Argasidae). 2. Effect of alternating temperatures on embryonic development and egg hatch. Folia Biol. 40:

143 10. Buczek A. 1992/1993. Effect of low temperature on the embryonic development and egg hatch of Argas (A.) reflexus (Fabricius, 1794)(Acari: Ixodida: Argasidae). Z. Angew. Zool. 2: Buczek A Disturbances of embryonic development and egg hatch of Argas (A.) reflexus (Fabricius, 1794) caused by altering temperatures. In: D. Kropczyńska, J. Boczek and A. Tomczyk (eds.), The Acari. Physiological aspects of Acari-host relationships. Oficyna Dabor, Warszawa: Buczek A Inhibitory factors of Argas (Argas) reflexus (Fab.)(Acari, Argasidae) larvae development. Anz. Schadlingskd. Pflanzenschutz Umweltschutz 69: Buczek A Factors disturbing the development of ticks (Acari, Ixodida). Zeszyty Naukowe Nr 214. Ochrona Środowiska 2: Buczek A., Bartosik K Ticks (Ixodida: Ixodidae, Amblyommidae) in southeastern Poland and their medical and epidemiological importance. Zdrowie Publiczne 121(4): Buczek A., Bartosik K., Kulina D., Raszewska-Famielec M., Borzęcki A Skin lesions in humans bitten by European pigeon tick Argas reflexus (Fab.)(Ixodida: Argasidae) massively occurring in the Upper Silesian conurbation of south-west Poland. Ann. Agr. Environ. Med. 16. Buczek A., Magdoń T The pigeon tick Argas reflexus (Fabr.) in urban environments of Poland. Acta Parasitologica 45: Capligina V., Salmane I., Keišs O., Vilks K., Japina K., Baumanis V., Ranka R Prevalence of tick-borne pathogens in ticks collected from migratory birds in Latvia. Tick. tick-borne dis. 5(1), Chmielewska-Badora J., Zwolinski J., Cisak E., Wojcik-Fatla A., Buczek A., Dutkiewicz J Prevalence of Anaplasma phagocytophilum in Ixodes ricinus ticks determined by polymerase chain reaction with two pairs of primers detecting 16S rrna and anka genes. Annals of Agricultural and Environmental Medicine, 14(2) Cisak E., Chmielewska-Badora J., Zwolinski J Dynamika zmian poziomu swoistych przeciwcial w przebiegu boreliozy z Lyme u pracownika leśnictwa. Przeglad epidemiologiczny, 56(SUPP/1), Cisak E., Wójcik-Fatla A., Stojek N. M., Chmielewska-Badora J., Zwolinski J., Buczek A., Dutkiewicz J Prevalence of Borrelia burgdorferi genospecies in Ixodes ricinus ticks from Lublin region (eastern Poland). Ann. Agr. Env. Med. 13(2), Dusbábek F., Rosický B Argasid ticks (Argasidae, Ixodoidea) of Czechoslovakia. Acta Sci. Nat. Brno 10: Ergönül O Crimean-Congo haemorrhagic fever. Lancet. Infect. Dis. 6: Filippova N.A Argasovye kleshchi (Argasidae). Fauna SSSR, Paukoobraznye. 4(3). Nauka Moskva, Leningrad (in Russian). 24. Geller J., Nazarova L., Katargina O., Leivits A., Ja rveku lg L., Golovljova I Tickborne pathogens in ticks feeding on migratory passerines in western part of Estonia. Vector-Borne Zoonotic Dis. 13: doi: /vbz Gryczynśka A., Barkowska M., Siemia tkowski M Analysis of Ixodes ricinus (L.) tick burdens in a resident passerine bird community in the Mazurian Lake region (Northeastern Poland). Acta Parasitol. 47: Gryczyńska A., Welc-Falęciak R Long-term study of the prevalence of Borrelia burgdorferi s.l. infection in ticks (Ixodes ricinus) feeding on blackbirds (Turdus merula) in NE Poland Exp. Appl. Acarol. 70: Gryczynśka A., Zgo dka A., Płoski R., Siemia tkowski M Borrelia burgdorferi sensu lato infection in passerine birds from the Mazurian Lake region (Northeastern Poland). Avian Pathol. 33:

144 28. Hasle G., Bjune G.A., Midthjell L., Røed K.H., Leinaas H.P Transport of Ixodes ricinus infected with Borrelia species to Norway by northward-migrating passerine birds. Ticks Tick Borne Dis. 2(1), Hildebrandt A., Franke J., Meier F., Sachse S., Dorn W., Straube E The potential role of migratory birds in transmission cycles of Babesia spp., Anaplasma phagocytophilum, and Rickettsia spp. Ticks Tick Borne Dis. 1(2): Hoogstraal H., Kaiser M.N., Traylor M.A., Gaber S., Guindy E Ticks (Ixodoidea) on birds migrating from Africa to Europe and Asia. Bull World Health Organ. 24: Hoogstraal H Birds as tick hosts and as reservoirs and disseminators of tickborne agents. Wiad. Parazytol. 18: Hoogstraal H., Aeschlimann A Tick-host specificity. Bulletin de la société entomologique Suisse. 55, Hornok S., Csörgő T., de la Fuente J., Gyuranecz M., Privigyei C., Meli M.L., Kreizinger Z., Gönczi E., de Mera F., Hofmann-Lehmann R Synanthropic birds associated with high prevalence of tick-borne rickettsiae and with the first detection of Rickettsia aeschlimannii in Hungary. Vector-Borne Zoonotic Dis. 13: Hornok S., Kováts D., Csörgő T., Meli M.L., Gönczi E., Hadnagy Z., Takács N., Farkas R., Hofmann-Lehmann R Birds as potential reservoirs of tick-borne pathogens: first evidence of bacteremia with Rickettsia helvetica. Parasit Vectors. 7: Hubálek Z., Halouzka J Arthropod-borne viruses of vertebrates in Europe. Arthropod-borne viruses of vertebrates in Europe. 37. Hubálek Z., Anderson J.F., Halouzka J., Hajek V Borreliae in immature Ixodes ricinus (Acari: Ixodidae) ticks parasitizing birds in the Czech Republic. Journal of Med. Entomol. 33(5), Humair P.F Birds and Borrelia. Int. J. Med. Microbiol. 291: Humair P.F., Postic D., Wallich R., Gern L An avian reservoir (Turdus merula) of the Lyme borreliosis spirochetes. Zentralbl. Bakteriol. 287: Humair P.F., Turrian N., Aeschlimann A., Gern L Ixodes ricinus immatures on birds in a focus of Lyme borreliosis. Folia Parasitologica. 40, Ioannou I., Chochlakis D., Kasinis N., Anayiotos P., Lyssandrou A., Papadopoulus B., Tselentis Y., Psaroulaki A Carriage of Rickettsia spp., Coxiella burnetii and Anaplasma spp. by endemic and migratory wild birds and their ectoparasites in Cyprus. Clin Microbiol Infect. 15(Suppl. 2): Kahl K Some observations on the occurrence of Ixodes ricinus (L.) living on migratory birds. Wiad. Parazytol. 17: Kipp S., Goedecke A., Dorn W., Wilske B., Fingerle V Role of birds in Thuringia, Germany, in the natural cycle of Borrelia burgdorferi sensu lato, the Lyme disease spirochaete. Int. J. Med. Microbiol. 296: Klaus C., Gethmann J., Hoffmann B., Ziegler U., Heller M., Beer M Tick infestation in birds and prevalence of pathogens in ticks collected from different places in German. Parasitol Res. 115: Labuda M Blackbirds and song thrushes constitute a key reservoir of Borrelia garinii, the causative agent of borreliosis in Central Europe. App Environ Microbiol. 74: Lachmajer J., Skierska B., Wegner Z Tick of the genus Haemaphysalis Koch (Ixodidae) found on the territories of Poland. Biul. Inst. Med. Morsk. Gdańsk.7:

145 47. Lommano E., Dvorák C., Valotton L., Jenni L., Gern L Tick-borne pathogens in ticks collected from breeding and migratory birds in Switzerland. Ticks Tick Borne Dis 5(6): Mărcuţan I.D., Kalmár Z., Ionică A.M., D Amico G., Mihalca A.D., Vasile C., Sándor A.D Spotted fever group rickettsiae in ticks of migratory birds in Romania. Parasit Vectors. 9: Marsot M., Henry P.Y., Vourc h G., Gasqui P., Ferquel E., Laignel J., Grysan M., Chapuis J.L Which forest bird species are the main hosts of the tick, Ixodes ricinus, the vector of Borrelia burgdorferi sensu lato, during the breeding season? Int J Parasitol. 42: Michalik J., Wodecka B., Skoracki M., Sikora B., Stanczak J Prevalence of avianassociated Borrelia burgdorferi s.l. genospecies in Ixodes ricinus ticks collected from blackbirds (Turdus merula) and song thrushes (T. philomelos). Int J Med Microbiol. 298: Molin Y., Lindeborg M., Nystro m F., Madder M., Hjelm E., Olsen B., Jaenson T.G.T., Ehrenborg Ch Migratory birds, ticks, and Bartonella Infect Ecol Epidemiol. 1: Movila A., Reye A.L., Dubinina H.V., Tolstenkov O.O., Toderas I., Hübschen J.M., Müller P.C., Alekseev A.N Detection of Babesia sp. EU1 and members of spotted fever group rickettsiae in ticks collected from migratory birds at Curonian Spit, NorthWestern Russia. Vector Borne Zoonotic Dis. 11: Nosek J., Sixl W Central-European ticks (Ixodoidea). Mitt Abteil Zool Botanik Landesmus Joanneum. 1: Novakova M., Bulkova A., Costa F.B., Kristin A., Krist M., Krause F., Liznarova E., Labruna M.B., Literak I Molecular characterization of Candidatus Rickettsia vini in Ixodes arboricola from the Czech Republic and Slovakia. Ticks Tick Borne Dis. 6: Nowak M., Solarz K A new case of transfer to Poland of the tick Hyalomma (Euhyalomma) marginatum Koch, 1844 (Acari: Amblyommidae) on migratory birds. 22nd Congress of Polish Parasitological Society, Puławy, Poland. p Nowak-Chmura M Ixodes eldaricus Djaparidze, 1950 (Ixodidae) on migrating birds reported first time in Poland. Veterinary Parasitology. 186: Nowak-Chmura, M., Siuda, K Ticks of Poland. Review of contemporary issues and latest research. Ann Parasitol. 58, Nowak-Chmura, M., Siuda, K., Wegner, Z., Piksa, K Species diversity of ticks (Acari: Ixodida) on migrating birds on the Baltic Sea coast of Poland. Zool Stud. 51(1411), Rafalski J Występowanie w Polsce kleszczy Argas vespertilionis Latr. i Argas reflexus Fabr. (Arachnida, Ixodoidea). Pol. Pismo Entomol. 24: Siński E., Karbowiak G., Siuda K., Buczek A., Jongejan F Zakażenie kleszczy Borrelia burgdorferi w wybranych rejonach Polski. Przegl. Epidemiol. 48: Siuda K., Dutkiewicz J Hyalomma marginatum Koch, 1844 (Acarina: Ixodidae) in Poland - an example for transport of exogenous tick by migratory birds. Wiad. Parazytol. 25: (in Polish with English summary) 62. Siuda K., Majszak A., Nowak M Ticks (Acari: Ixodida) parasitizing birds (Aves) in Poland. Biol. Lett. 43: Siuda K., Szymański S A case of transfer to Poland a Mediterranean tick Ixodes (Ixodes) festai Rondelli, 1926 (Acari: Ixodida: Ixodidae). Wiad. Parazytol. 37: (in Polish with English summary) 64. Siuda K Stan wiadomości nad rozmieszczeniem w Polsce obrzeżków z rodzaju Argas (Acarina: Ixodides: Argasidae). Wiad. Parazytol. 30:

146 65. Siuda K. 1986a. Ixodidae ticks (Ixodida, Acari) parasitizing birds in Poland. Part I. Obligatory ornithophilous ticks. Wiad. Parazytol. 32: (in Polish with English summary) 66. Siuda K. 1986b. Ixodidae ticks (Ixodida, Acari) parasitizing birds in Poland. Part II. Not obligatory and accidentally ornithophilous ticks. Wiad. Parazytol. 32: (in Polish with English summary) 67. Siuda K Ticks (Acari: Ixodida) of Poland. Part II. Taxonomy and distribution. Warszawa, Poland: PTP, 380 pp. (in Polish) 68. Skotarczak B., Rymaszewska A., Wodecka B., Sawczuk M., Adamska M., Maciejewska A PCR detection of granulocytic Anaplasma and Babesia in Ixodes ricinus ticks and birds in west-central Poland. Ann Agric Environ Med. 13: Socolovschi C., Reynaud P., Kernif T., Raoult D., Parola P Rickettsiae of spotted fever group, Borrelia valaisiana, and Coxiella burnetii in ticks on passerine birds and mammals from the Camargue in the south of France. Ticks Tick Borne Dis. 3: Socolovschi C., Kernif T., Raoult D., Parola P Borrelia, Rickettsia, and Ehrlichia species in bat ticks, France, Emerging infectious diseases. 18(12), Spitalská E., Literák I., Kocianová E., Taragel ová V The importance of Ixodes arboricola in transmission of Rickettsia spp., Anaplasma phagocytophilum, and Borrelia burgdorferi sensu lato in the Czech Republic, Central Europe. Vector Borne Zoonotic Dis. 11: Spitalská E., Literák I., Kocianová E., Taragel ová V The importance of Ixodes arboricola Sroka J., Chmielewska-Badora J., Dutkiewicz J Ixodes ricinus as a potential vector of Toxoplasma gondii. Ann Agric Environ Med.10: Sroka J., Szymanska J., Wojcik-Fatla A The occurrence of Toxoplasma gondii and Borrelia burgdorferi sensu lato in Ixodes ricinus ticks from east Poland with the use of PCR. Ann Agric Environ Med.. 16: Stańczak J., Racewicz M., Kubica-Biernat B., Kruminis-Lozowska W., Dabrowski J., Adamczyk A., Markowska M Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks (Acari, Ixodidae) in different Polish woodlands. Ann Agric Environ Med.. 6(2), Stanek G., Simeoni J Are pigeon ticks transmitters of Borrelia burgdorferi to humans? A preliminary report. W: Stanek G. (ed), Lyme boreliosis II. Zbl. Bakt. Suppl. 18: Stojek N.M., Dutkiewicz J Studies on the occurrence of Gram-negative bacteria in ticks: Ixodes ricinus as a potential vector of Pasteurella. Ann Agric Environ Med. 11(2), Vial L., Stachurski F., Leblond A., Huber K., Vourc'h G., René-Martellet M., Desjardins I., Balança G., Grosbois V., Pradier S., Gély M., Appelgren A., Estrada-Peña A Strong evidence for the presence of the tick Hyalomma marginatum Koch, 1844 in southern continental France. Ticks Tick Borne Dis. 7(6): Waldenstro m J., Lundkvist A., Falk K.I., Garpmo U., Bergström S., Lindegren G., Sjöstedt A., Mejlon H., Fransson T., Haemig P.D., Olsen B Migrating birds and tick borne encephalitis virus. Emerg Infect Dis. 13: Wallménius K., Barboutis C., Fransson T., Jaenson G.T.E., Lindgren P.E., Nyström F., Björn O., Salaneck E., Nilsson K Spotted fever Rickettsia species in Hyalomma and Ixodes ticks infesting migratory birds in the European Mediterranean area. Parasit Vectors. 7: Wegner Z Laboratory study on some parasitic hematophagous arthropods as possible subsidiary links of the biocenosis of tick-born encephalitis. Bull. Inst. Mar. Trop. Med. Gdynia 27:

147 82. Welc-Falęciak R., Kowalec M., Karbowiak G., Bajer A., Behnke J. M., Siński E Rickettsiaceae and Anaplasmataceae infections in Ixodes ricinus ticks from urban and natural forested areas of Poland. Parasit Vectors. 7(1), Wodecka B., Skotarczak B Identification of host blood-meal sources and Borrelia in field-collected Ixodes ricinus ticks in north-western Poland. Ann Agric Environ Med. 23(1): Wójcik-Fatla A., Cisak E., Zając V., Zwoliński J., Dutkiewicz J Prevalence of tickborne encephalitis virus in Ixodes ricinus and Dermacentor reticulatus ticks collected from the Lublin region (eastern Poland). Tick Tick Borne Dis. 2(1), Wójcik-Fatla A., Szymanska J., Wdowiak L., Buczek A., Dutkiewicz J Coincidence of three pathogens [Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti] in Ixodes ricinus ticks in the Lublin macroregion. Ann Agric Environ Med. 16(1), Zając V., Wójcik-Fatla A., Sawczyn A., Cisak E., Sroka J., Kloc A. Zając Z., Buczek A., Dutkiewicz J., Bartosik,K Prevalence of infections and co-infections with 6 pathogens in Dermacentor reticulatus ticks collected in eastern Poland. Ann Agric Environ Med. 24(1), Złotorzycka J Catalogue of the Polish parasitic fauna. Part IV. Bird parasites. Fascicle 3. Parasitic arthropods. Warszawa, Wrocław, Poland: PWN, Polish Scientific Publisher, 366 pp. 147

148 148

149 Pediculosis and demodecosis Wszawica i demodekoza 149

150 150

151 Human lice Pediculus humanus and pediculosis in the past and present - occurrence, diagnostics and controlling Joanna N. Izdebska, Paulina Kozina, Karolina Cierocka, Łukasz Mierzyński Department of Invertebrate Zoology and Parasitology, Faculty of Biology, University of Gdańsk, Wita Stwosza 59, Gdańsk, Poland Pediculosis is a common and currently harmless parasitosis, yet it constitutes a problem with social dimension. Human lice Pediculus humanus have well-grounded reputation of Rickettsia prowazeki vectors, which causes typhus (typhoid fever). However, the problem was solved when antibiotic treatment was discovered, as well as through the development of anti-typhoid vaccine by Polish biologist, Rudolf Wiegl (Kryński 1967, Kadulski et al. 2003, Kadulski and Izdebska 2012). Despite the fact that pediculosis no longer poses a significant health issue, its incidence often raises social unrest, evokes the sense of shame, and in practical aspect - absence in school, at work, treatment expenditures (Izdebska 2014). For instance, statistics conducted in the UNSA indicate that human pediculosis yearly concerns from 6 to 12 million Americans, which in the case of children results in school absenteeism of million school days; the annual sales of anti-lice shampoos exceeds there 160 million USD (Mumcuoglu et al. 2006, Schiffman 2006). Human lice are common parasites, which spread easily within the host population, where they often remain unnoticed, not causing disease symptoms. The development of parasitosis is associated with parasite proliferation. The disease (pediculosis) has a worldwide distribution, appearing in various human populations and in different environments (e.g. Izdebska and Fryderyk 2008, Izdebska 2014). The development of prophylactic and containment methods requires good knowledge of the biology and physiology of lice, including mechanisms enabling their adaptation to parasitism and changing life conditions, resulting e.g. from evolution of the host and the progress in the development of containment methods and agents. The systematic position and the origin of human-associated lice The sucking lice Anoplura are parasitic insects, which, along with chewing lice are included in the order Phthiraptera, covering specialized parasites of mammals and birds. They appear to be most highly specialized parasites among insects, as their all developmental stages are associated with the host and exhibit a range of complex, advanced adaptations to survival in its hair or feathers. Ancestors of Phthiraptera shall be looked for in free roaming insects, and they probably have a common ancestor with booklice Psocoptera (Piotrowski 1992, Kadulski and Izdebska 2012). The speciation processes within Anoplura were directly linked to the evolution of hosts (cospeciation), and it is estimated that the process was coincided in time with the appearance of placental mammals and has been going on for the last approx. 77 million years (Light et al. 2010, Boutellis et al. 2014). Considering lice are typically highly specific parasites towards their hosts, in humans two specific species are found - the human louse Pediculus humanus Linnaeus, 1758 and crab louse Pthirus pubis (Linnaeus, 1758), differing in topographic and topical preferences and the parasitic mechanism (Izdebska 2014). The origins of lice undoubtedly reach pre-hominides, although various evolutionary scenarios and varying periods of their separation have been indicated and analyzed (Kittler et al. 2003, Mumcuoglu 2008, Light and Reed 2009, Weiss 2009, Veracx and Raoult 2012, Ashfaq et al. 2015, 151

152 Drali et al. 2016). The genetic origin of P. humanus points out to its expansion from Africa approx. 100,000 years ago and dispersal to four continents in the last 80 thousand years (Reed et al. 2004, Reed et al. 2007, Light et al. 2008, Boutellis et al. 2014). Lice are among the oldest parasites of humans. Information on human lice and methods of their containment were found in Egyptian papyruses, Sumer and Akkadian sources and even works of the Aristotle. Human lice and their eggs were found on the hair of Egyptian mummies, and combs for lice removal and recipes for their containment were known in the ancient Egypt. The archaeological records confirm the presence of lice on various continents, in varying ethnic and cultural groups. They have been found on archaeological localities in Peru, Brazil, Mexico, as well as remains of Viking settlements on Greenland and in prehistoric textiles from Austria, providing data not only on the range of invasion, but also on the lifestyle of ancient populations. The age of lice eggs found on a human hair in Brazil has been estimated at up to 10,000 years, while eggs found in Judea (Israel) are dated at B.C.; eggs from a mummy in the Asian Loulan are 3.8 thousand years old (Mumcuoglu and Zias 1989, Araújo et al. 2000, Reinhard and Buikstra 2003, Orion et al. 2004, Mumcuoglu 2008, Anderson and Chaney 2009, Mumcuoglu and Hadas 2011, Mumcuoglu and Gunnewag 2012). On the other hand, the good condition of eggs in various archaeological samples from Chile, dated between 2000 B.C. to 500 A.D. allowed for analysis of their morphology using scanning microscopy (Arriaza et. al. 2013). Geographic distribution and prevalence of human lice The geographic distribution of lice, due to their specificity towards hosts overlaps the distribution of the hosts (Yong et al. 2003, Kadulski and Izdebska 2012). On the other hand, the lice transmission typically occurs during direct contacts between host individuals, thus the prevalence depends on their density or life history but also individual properties. The intensity of infestation depends on both environmental conditions as well as individual characters of the host. In the case of human lice, the level of personal hygiene, high population density and poor diet may constitute significant factors (Piotrowski 1963, Piotrowski 1990, Burgess 2004, Izdebska 2014, Moosazadeh et al. 2015, Galassi et al. 2018). However, data indicating the actual prevalence of lice in various human populations is scarce - the information is scattered and typically is based on singular studies (Kadulski et al. 2003) (Table 1). In the USA, where regular examinations are carried out, every year head pediculosis concerns about 12 million people, and the total annual expenditures for lice containment are estimated at several hundred million USD (Mumcuoglu et al. 2008). Since in Poland there is no obligation to register pediculosis cases, it is difficult to provide reliable information on its prevalence. The published data varies, yet the period of examinations, site and selection of the experimental group are highly important. Typically, pediculosis concerns less than 1% of the population, yet the percentage is higher in children (Izdebska 2014) (Table 2). Lice parasitism and pathogenicity Low lice infestation level is not associated with disease symptoms. However, mass infestations have traits of parasitosis (pediculosis). There are known cases when the counts of these parasites reached several thousand, while it appears that the number of approx. 20,000 lice constitutes the upper level of infestation in human. Such count exceeds the biological volume of the environment, and lice are no longer capable of finding a favorable site on the hist and fall off spontaneously (Piotrowski 1963). Although lice parasitism may have a wider and more variable significance, as it may result not only in skin lesions, but also allergic reactions; by damaging skin lice open the gates for various secondary infections, and furthermore they can be vectors for pathogenic microorganisms (Robinson et al. 2003, Speare et al. 2005, Boutellis et al. 2014). 152

153 A typical transmission mechanism consists in a direct transfer from individual to individual, thus it frequently occurs between relatives, but it is facilitated by any higher population density (crowded bus, tram, mass events, schools, kindergartens, camps). Moreover, lice can be transferred indirectly by infected clothes, hear brushes, towels, bedclothes and upholstery. A possible mechanism of transfer is the so called phoresis (transport through other organisms) e.g. via certain flies (Izdebska 2014). Interestingly, lice typically enter new hosts when people touch with their heads, which is a common human behavior from various parts of the world, exhibiting affection and positive emotions. And the majority of infections concerns lice transfer between family members or close friends. Perhaps such behavior has been developed through evolution as adaptation, as the quickest possible obtaining of lice provoked rapid obtaining of efficient immunity during attacks at later life stages. Previously this immunity could have ensured protection against diseases transferred via lice, e.g. typhoid. Human behavior consisting in touching with heads probably acted as a natural and unconscious anti-lice vaccination to reduce the exposure to pathogens that can be transferred by these insects (Canyon et al. 2002, Rózsa and Apari 2012). The consequence of lice presence may be caused by their direct parasitism, although penetration of the skin by parasites may be the cause for secondary infections. Inflammation is formed as a result of sting, which is caused by the effect of the saliva, and after over 10 hours - clots with erythema. Stings can be painful, and they are followed by slight sensation of itchiness. However, reactions to sting can be more variable, e.g. erythema, peeling and burns of the skin, secondary infections (bacterial, fungal), purulent dermatitis, lymphadenopathy, conjunctivitis, and even fever and malaise; purulent dermatitis can be associated with alopecia. In some cases a measles-like rash occurs, imitating viral efflorescence. The infected are found to be scraping and shaking head, and sometimes exhibiting apathy (Piotrowski 1963, Ko and Elston 2004, Madke and Khopkar 2012). Pediculosis diagnostics - detection and containment of human lice Pediculosis diagnosis is based on the determination of active stages of lice and/or live eggs (nits), as well as occurrence of infection symptoms in the form of pruritis, presence of sting marks, scabs, skin reddenings etc. Naturally, the sole presence of scarce, asymptomatic lice is only an infestation ant it is not equivalent to pediculosis diagnosis. However, allowing these parasites to remain on the host may lead to the development of parasitosis and cause discomfort and stress. Thus, in this case it is necessary to apply containment. Indication for the examination is determination of pediculosis in persons with whom the patient has had close contact or persistent itching of the head. However, diagnostics shall also include other possible causes for pruritis, including dermatological ailments or presence of other parasites (Izdebska 2014). Detection of lice and pediculosis is typically of indirect character - the basis is determination of the presence of live parasites (imagines and/or developmental stages) at the correct location. Moreover, it is necessary to perform species identification and determine marks of feeding, which constitutes connection of the presence of lice with the symptoms of pediculosis (mass infestation, intensified symptoms, feeding). During detection, especially in collective research, where a larger group of persons is to be examined, magnifying optical devices are useful, such as loupes, eyepiece loupes as well as dermatoscopy (e.g. analyses for marks of lice feeding). The use of Wood s lamp appears to be particularly favorable for the detection of local pediculosis foci, as it is used in dermatological diagnostics, e.g. in mycosis examinations. Lice exhibit yellow-green fluorescence in the study utilizing Wood s lamp (Burgess 2004, Mumcuoglu et al. 2006, Badri et al. 2010, Izdebska 2014, Sayyadi et al. 2014). Typically, lice eggs are looked for, which are typically located in the occiput area and behind the ears. However, the presence of eggs may result in false positive diagnosis, as dead eggs may remain attached to hair for up to six months. Human hair grows at a rate of approx. 153

154 1 cm per month, thus hollow egg shells gradually become separated from the head skin and are easier to discern, especially on dark hair (Izdebska 2014). However, it is also here where the use of Wood s lamp becomes useful, enabling distinction of live eggs from dead ones - live eggs exhibit bright (white), intense fluorescence, while dead have gray color (Rasmussen 1984). Detection of live nymphae or adulti is useful for the confirmation of diagnosis, for which purpose, apart from magnifying devices, special combs are used. Combs made of different materials have been used in detection and removal of lice since the antiquity, and the oldest devices of this type documented in archaeological sources were known as early as in 1500 B.C. (Palma 1991, Mumcuoglu 1996, Mumcuoglu 2008). Earlier, wooden or bone combs were used, which were later replaced with metal and then plastic combs. However, currently it is possible to use more advanced technologies. Thus, certain combs possess metallic teeth, precisely engraved into fine grooves, increasing adhesion. Moreover, there are electric combs (e.g. Licetec V-Comb), small devices with two functions: of a comb and a vacuum cleaner. The device catches lice and their eggs into the filter, which can be disposed of and replaced. The apparatus can be used repeatedly, e.g. by an entire family, yet it must be thoroughly cleaned between uses. The basis for pediculosis treatment is lice removal or killing lice on the host. Repellents can be used by means of prophylaxis, which, by deterring lice, reduce the possibility of dispersal between hosts. Substances of plant origin are frequently used for this purpose, e.g. lavender, geranium or anise. Therapy should be carried out only after live lice have been determined. When containing lice, it is highly important to interrupt their life cycle (eliminate the eggs), disabling reproduction and prevents recrudescence of pediculosis. And the basic and most simple method of prevention containment is removal of lice, e.g. via combing. It is a rather efficient method (depending on the tools used, procedure precision, frequency of application) and the least invasive. The procedure consists in combing wet hair with addition of a lubricant (olive oil or hair conditioner), for minutes on average, depending on the length and density of hair. In general, combing should last for as long as lice are being found. The combing should be repeated every 2-3 days for 2 weeks after each examination in which live lice have been found ( Madke and Khopkar 2012, Izdebska 2014, Rukke et al. 2014). A device known as the Louse Buster is highly efficient in mechanical containment of lice, which is used to kill lice and their eggs without the use of chemical substances. It utilizes heated air with parameters adjusted so as to be deadly for lice. Moreover, it is equipped with an applicator with single-use nozzle, designed so as to penetrate to the hair base. Warm and dry air results in dehydration and drying of all life stages of lice; it produces particularly good effects when eliminating eggs, which is not always sufficiently effective in other methods. The scientifically confirmed efficacy is approx. 95% (Bush et al. 2011). A common method of treating pediculosis is the use of agents containing them in hair and on the skin (e.g. in the form of a shampoo) and in extreme cases - oral treatment. In the case of chemical containment of lice, the age of the infected and his/her health state must be taken into account - not all agents can be used in children, particularly under 2 years of age, or in pregnant or breast-feeding women. These formulations often contain strong substances with biocidal effect. A convenient form of their dosage are shampoos, yet there are lice containment agents in the form of a liquid, foam, gel or spray. When selecting the lice containment agent not only the type and concentration of the active substance is important, but also the presence of additional substances, which may alleviate the impact on the skin or facilitate application. Efficient compounds for lice containment include pyrethrin, permethrin, ivermectin. On the other hand, rather efficient, yet non-toxic are agents containing silicones (cyclomethicone and dimethicone), which can be used in small children, pregnant and breastfeeding women. Agents containing plant extracts, e.g. from larkspur (Consolida regalis, 154

155 Delphinium consolida), are also commonly used (Mumcuoglu 1996, Burgess 2004, Mumcuoglu et al Izdebska 2014, Madke and Khopkar 2017, Candy et al. 2018). Chemical containment, independently of higher or lower harmfulness of the substances used, is not always efficient with relation to lice developing immunity to subsequent substances. Tables Tab. 1. Occurrence of Pediculus humanus in the world based on selected literature data Country Years Prevalence of infestation [%] Data source Brazil Linardi et al Korea (children) Huh et al East Africa (Tanzania) Henderson 1996 South Africa (Mpumalanga) (children) Govere et al Australia (Victoria) (children) Counahan et al Thailand (children) Fan et al.2004 Argentina (La Rioja) (children) Catalá et al Nepal Poudel and Barker 2004 Greece (Athens) (children) Tagka et al Argentina (Buenos Aires) (children) Toloza et al Pakistan (children) Saddozai and Kakarsulemankhel 2008 Mexico (children) Manrique-Saide et al Bangladesh (Mymensingh) Akhter et al Turkey (Sivas) (children) Degerli et al Nigeria (children) Etim et al Bangladesh (Dhaka) (children) Karim et al Argentina (Bahía Blanca) (children) Gutiérrez et al Egypt (children) Raheem et al Turkey (Gaziantep) (children) Eroglu et al Iran (children) Nazari et al Iran (children) Moosazadeh et al Cambodia (children) Liao et al Tab. 2. Occurrence of Pediculus humanus in Poland based on selected literature data Area Years Prevalence of Data source infestation [%] Pomerania (Gdańsk) (children) Piotrowski 1982 Pomerania (Tricity) (children) Wegner et al Lower Silesia 0.62 (children, Lonc and Okulewicz (Wałbrzych) teenagers) 2000 Eastern Poland (children) Buczek et al Mazowieckie Province (children) Gliniewicz et al Eastern Poland (children) Bartosik et al References 1. Akhter S., Mondal M.M.H., Alim M.A., Moinuddin M.A Prevalence of lice infestation in humans in different socio-economic status at Mymensingh in Bangladesh. Int. J. Bio. Res. 1:

156 2. Anderson A.L., Chaney E Pubic lice (Pthirus pubis): history, biology and treatment vs. knowledge and beliefs of US college students. Int. J. Environ. Res. Public Health. 6: Araújo A., Ferreira L.F., Guidon N. Maues da Serra Freire N., Reinhard K.J., Dittmar K Ten thousand years of head lice infection. Parasitol. Today 16: Arriaza B., Standen V., Núnez H., Reinhard K Study of archaeological nits/eggs of Pediculus humanus capitis by scanning electron microscopy. Micron 45: Ashfaq M., Prosser S., Nasir S., Masood M., Ratnasingham S., Hebert P.D High diversity and rapid diversification in the head louse, Pediculus humanus (Pediculidae: Phthiraptera). Sci Rep. 5: Badri T., Hammami H., Benmously R., Mokhtar I., Fenniche S Dermoscopic diagnosis of pediculosis capitis. Acta Dermatovenerol. Alp. Pannonica Adriat. 19: Bartosik K., Buczek A., Zajac Z., Kulisz J Head pediculosis in schoolchildren in the eastern region of the European Union. Ann. Agric. Environ. Med. 22: Boutellis A., Abi-Rached, L., Raoult, D The origin and distribution of human lice in the world. Infection. Genet. Evol. 23: Buczek A., Markowska-Gosik D., Widomska D., Kawa I.M Pediculosis capitis among schoolchildren in urban and rural areas of eastern Poland. Eur. J. Epidemiol. 19: Burgess I. F Human lice and their control. Annu. Rev. Entomol. 49: Burkhart C.N., Burkhart C.G Head lice: Scientific assessment of the nit sheath with clinical ramifications and therapeutic options. JAAD 53: Bush S.E., Rock A.N., Jones S.L., Malenke J.R., Clayton D.H Efficacy of the Louse Buster, a new medical device for treating head lice (Anoplura: Pediculidae). J. Med. Entomol. 48: Candy K., Brun S., Nicolas P., Durand R., Charrel R.N., Izri, A Do drowning and anoxia kill head lice? Parasite 25: Canyon D.V., Speare R., Muller R Spatial and kinetic factors for the transfer of head lice (Pediculus capitis) between hairs. J. Invest. Dermatol. 119: Catalá S., Junco L., Vaporaky R Pediculus capitis infestation according to sex and social factors in Argentina. Rev. Saúde Pública 39: Counahan M., Andrews R., Büttner P., Byrnes G., Speare R Head lice prevalence in primary schools in Victoria, Australia. J. Paediatr. Child. Health. 40: Değerli S., Malatyali E., Çeliksöz A., Özçelik S., Mumcuoğlu K.Y The prevalence of Pediculus humanus capitis and the coexistence of intestinal parasites in young children in boarding schools in Sivas, Turkey. Pediatr. Dermatol. 29: Drali R., Abi-Rached L., Boutellis A., Djossou F., Barker S.C., Raoult D Host switching of human lice to new world monkeys in South America. Infection. Genet. Evol. 39: El Raheem T.A.A., El Sherbiny N.A., Elgameel A., El-Sayed G.A., Moustafa N., Shahen S Epidemiological comparative study of pediculosis capitis among primary school children in Fayoum and Minofiya governorates, Egypt. J. Community Health 40: Eroglu F., Basaran Ü., Kürklü C.G., Yüceer M., Yalcıntürk R.G., Tanrıverdi M., Daglı E.I., Koltas I.S Pediculosis capitis is a growing neglected infestation due to migration in southeast Turkey. Parasitol. Res. 115: Etim S.E., Ohioma M.E., Okon O.E., Akpan P.A Pediculosis among primary school children in Calabar, Nigeria and implications for control. Sci. Res. Essays 7:

157 22. Fan C.K., Liao C.W., Wu M.S., Hu N.Y., Su K.E Prevalence of Pediculus capitis infestation among school children of Chinese refugees residing in mountainous areas of northern Thailand. Kaohsiung. J. Med. Sci. 20: Galassi F.G., Fronza G., Toloza A.C., Picollo M.I., González-Audino P Response of Pediculus humanus capitis (Phthiraptera: Pediculidae) to Volatiles of Whole and Individual Components of the Human Scalp. J. Med. Entomol. [in press] 24. Gliniewicz A, Sawicka B, Kędra E, Wieloch W Head pediculosis in children s homes in Warsaw and Mazowieckie Province in the years : its occurrence and control. In: Arthropods. Invasions and their control. Buczek A., Błaszak C. (eds.)., Lublin: Govere J.M., Speare R., Durrheim D.N The prevalence of pediculosis in rural South African schoolchildren. S. Afr. J. Sci. 99: Gutiérrez M.M., González J.W., Stefanazzi N., Serralunga G., Yañez L., Ferrero A.A Prevalence of Pediculus humanus capitis infestation among kindergarten children in Bahía Blanca city, Argentina. Parasitol. Res. 111: Henderson C.A Skin disease in rural Tanzania. Int. J. Dermatol. 35: Huh S., Pai K.S., Lee S.J., Kim K.J., Kim N.H Prevalence of head louse infestation in primary school children in Kangwon-do, Korea. Korean J. Parasitol. 31: Izdebska J.N Wszy. Poznaj i pokonaj problem. Wydawnictwo Naukowe PWN, Warszawa: Izdebska J.N., Fryderyk S Morphological differentiation and interesting adaptations to parasitism in sucking lice and biting lice (Insecta, Phthiraptera). In: Arthropods. Influence on host. A. Buczek, C. Błaszak (eds.). Akapit, Lublin: Kadulski S Wszy i wszoły (Phthiraptera). In: Fauna Polski. Charakterystyka i wykaz gatunków. Tom III. W. Bogdanowicz, E. Chudzicka, I. Pilipiuk, E. Skibińska (eds.), Muzeum i Instytut Zoologii PAN, Warszawa: Kadulski S., Izdebska J.N Rząd: wszy i wszoły Phthiraptera. In: Zoologia. Volume 2, part 2. Stawonogi. Tchawkodyszne. C. Błaszak (ed.). PWN, Warszawa: Kadulski S., Izdebska J.N., Fryderyk S Wstępne obserwacje nad zróżnicowaniem populacji Pediculus humanus L. (Pediculidae, Anoplura) w Polsce. In: Stawonogi i żywiciele. A. Buczek, C. Błaszak (eds.). Liber, Lublin: Karim M.T., Musa S., Mondal D., Khanum H Relationship between head lice (Pediculus humanus capitis) infestation and nutritional status of children. Dhaka Univ. J. Biol. Sci. 23: Kawa I.M., Jedliński M., Borys M., Andrzejak A Występowanie wszawicy głowowej i świerzbu u dzieci w domach dziecka na terenie województwa lubelskiego. In: Stawonogi i żywiciele. A. Buczek, C. Błaszak (eds.). Liber, Lublin: Kittler R., Kayser M., Stoneking M Molecular Evolution of Pediculus humanus and the Origin of Clothing. Curr Biol. 13: Ko C.J., Elston D.M Pediculosis. JAAD 50(1): Kryński, S Rudolf Weigl ( ) Med. Dośw. Mikrobiol. 19: Liao C.W., Cheng P.C., Chuang T.W., Chiu K.C., Chiang I.C., Kuo J.H., Tu Y.H., Fan Y.M., Jiang H.T., Fan C.K Prevalence of Pediculus capitis in schoolchildren in Battambang, Cambodia. J. Microbiol. Immunol. Infect. [in press] 40. Light J.E., Allen J.M., Long L.M., Carter T.E., Barrow L., Suren G., Raoult D., Reed D.L Geographic distributions and origins of human head lice (Pediculus humanus capitis) based on mitochondrial data. J. Parasitol. 94: Light J.E., Reed D.L Multigene analysis of phylogenetic relationships and divergence times of primate sucking lice (Phthiraptera: Anoplura). Mol. Phylogenet. Evol. 50:

158 42. Light J.E., Smith V.S., Allen J.M., Durden L.A., Reed D.L Evolutionary history of mammalian sucking lice (Phthiraptera: Anoplura). BMC Evol. Biol. 10: Linardi P.M., Maria M.D., Botelho J.R., Cunha H.C., Ferreira J.B Prevalence of nits and lice in sampls of cut hair from floors of barbershop and beauty parlors in Belo Horizonte, Minas Gerais state, Brazil. Mem. I. Oswaldo Cruz 83: Lonc E., Okulewicz A Scabies and head-lice infestations in different environmental conditions of Lower Silesia, Poland. J. Parasitol. 86: Madke B., Khopkar U Pediculosis capitis: An update. Indian J. Dermatol. Venereol. Leprol. 78: Manrique-Saide P., Pavía-Ruz N., Rodríguez-Buenfil J.C., Herrera Herrera R., Gómez- Ruiz P., Pilger, D Prevalence of pediculosis capitis in children from a rural school in Yucatan, Mexico. Rev. Inst. Med. Trop. Sao Paulo 53: Moosazadeh M., Afshari M., Keianian H., Nezammahalleh A., Enayati A.A Prevalence of head lice infestation and its associated factors among primary school students in Iran: a systematic review and meta-analysis. Osong Public Health Res. Perspect. 6: Mumcuoglu K.Y., Zias J How the ancients de-loused themselves. Biblical Archaeology Society: Mumcuoglu K.Y Control of human lice (Anoplura: Pediculidae) infestations: past and present. Am. Entomologist 42: Mumcuoglu K.Y Human lice: Pediculus and Pthirus. In: Paleomicrobiology. Raoult D., Drancourt M. (eds.) Springer, Berlin, Heidelberg: Mumcuoglu K.Y The louse comb: past and present. Am. Entomologist 54: Mumcuoglu K.Y., Gilead L., Ingber A New insights in pediculosis and scabies. Expert Rev. Dermatol. 4: Mumcuoglu K.Y., Gunneweg J A head louse egg, Pediculus humanus capitis found in a louse comb excavated in The Christmas Cave, which dates to the 1 st c. BC and AD. In Outdoor Qumran and the Dead Sea. Its impact on the indoor bio-and material cultures at Qumran and the Judean Desert manuscript. Proceedings of the joint Hebrew University and COST Action D-42 Cultural Heritage Workshop held at the Hebrew University of Jerusalem in May: Mumcuoglu K.Y., Hadas G Head Louse (Pediculus humanus capitis) Remains in a Louse Comb from the Roman Period Excavated in the Dead Sea Region. IEJ 61: Mumcuoglu K.Y., Meinking T.A., Burkhart C.N., Burkhart C.G Head louse infestations: the no nit policy and its consequences. Int. J. Dermatol. 45: Nazari M., Goudarztalejerdi R., Payman M.A Pediculosis capitis among primary and middle school children in Asadabad, Iran: An epidemiological study. Asian Pac. J. Trop. Biomed. 6: Nutanson I., Steen C.J., Schwartz R.A., Janniger C.K Pediculus humanus capitis: an update. Acta Dermatoven. APA 17: Orion E., Matz H., Wolf R Ectoparasitic sexually transmitted diseases: scabies and pediculosis. Clin. Dermatol. 22: Palma R.L Ancient head lice on a wooden comb from Antinoe, Egypt. JEA 77: Piotrowski F Wszy (Anoplura) i ich rola epidemiologiczna. PWN, Wrocław: Piotrowski F [Head pediculosis among children and youth in Gdańskie Province in 1979]. Wiad. Parazytol : Piotrowski F Zarys entomologii parazytologicznej. PWN, Warszawa:

159 63. Piotrowski F Anoplura (echte Läuse). In: Handbuch der Zoologie. Arthropoda: Insecta. Fischer M., Kristensen N. (eds), Walter de Gruyter, Berlin New York: 4, 32: Poudel S.K.S., Barker S.C Infestation of people with lice in Kathmandu and Pokhara, Nepal. Med. Vet. Entomol. 18: Rasmussen J. E Pediculosis and the pediatrician. Pediatr. Dermatol. 2: Reed D.L., Light J.E., Allen J.M., Kirchman J.J Pair of lice lost or parasites regained: the evolutionary history of anthropoid primate lice. BMC Biol. 5: Reed D.L., Smith V.S., Hammond S.L., Rogers A.R., Clayton D.H Genetic analysis of lice supports direct contact between modern and archaic humans. PLoS Biol. 2(11): e Reinhard K.J., Buikstra J Louse infestation of the Chiribaya culture, southern Peru: variation in prevalence by age and sex. Mem. I. Oswaldo Cruz 98: Robinson D., Leo N., Prociv P., Barker S.C Potential role of head lice, Pediculus humanus capitis, as vectors of Rickettsia prowazekii. Parasitol. Res. 90: Rózsa L., Apari P Why infest the loved ones-inherent human behaviour indicates former mutualism with head lice. Parasitology 139: Rukke B.A., Soleng A., Lindstedt H.H., Ottesen P., Birkemoe T Socioeconomic status, family background and other key factors influence the management of head lice in Norway. Parasitol. Res. 113: Saddozai S.H.A., Kakarsulemankhel J.K Infestation of head lice, Pediculus humanus capitis, in school children at Quetta city and its suburban areas, Pakistan. Pak. J. Zool. 40: Sayyadi M., Sayyad S., Vahabi A Pediculosis capiti: A reviw article. Life Sci. J. 11(SPEC.): Schiffman P The LouseBuster. ELE 382 Biomedical Seminar II. 75. Speare R., Canyon D.V., Melrose W Quantification of blood intake of the head louse: Pediculus humanus capitis. Int. J. Dermatol. 45: Tagka A., Lambrou G.I., Braoudaki M., Panagiotopoulos T., Papanikolaou E., Laggas D Socioeconomical Factors Associated With Pediculosis (Phthiraptera: Pediculidae) in Athens, Greece. J. Med. Entomol. 53: Toloza A., Vassena C., Gallardo A., González-Audino P., Picollo M.I Epidemiology of Pediculosis capitis in elementary schools of Buenos Aires, Argentina. Parasitol. Res. 104: Veracx A., Raoult D Biology and genetics of human head and body lice. Trends Parasitol. 28: Wegner Z, Racewicz M, Stańczak J Occurrence of pediculosis capitis in a population of children from Gdańsk, Sopot, Gdynia and the vicinities. Appl. Parasitol. 35: Weiss R.A Apes, lice and prehistory. J. Biol. 8(2): Yong Z., Fournier P.É., Rydkina E., Raoult, D The geographical segregation of human lice preceded that of Pediculus humanus capitis and Pediculus humanus humanus. CR Biol. 326:

160 160

161 Obligation to report pediculosis and scabies in Poland - own observations Andrzej Tytuła 1,2, Katarzyna Bartosik 1, Alicja M. Buczek 1, Zbigniew Zając 1, Ewa Kulbaka 2, Dariusz Ciura 3, Adam Borzęcki 4 1Chair and Department of Biology and Parasitology, Medical University, Radziwiłłowska 11 St., Lublin 2District Chamber of Nurses and Midwives in Lublin, Czechowska 3a Str., Lublin, Poland 3Department of Health Promotion and Obesity Management, Department of Pathophysiology, Medical University of Silesia, Medyków 18 Str, Katowice, Poland 4Med-Laser Non-Public Health Care Centre, Młyńska 14A Str, Lublin, Poland Introduction Pediculosis and scabies are currently a major social problem, as they are common in care and educational institutions as well as school and educational institutions (Buczek et al. 2001, 2004, 2006), thus pertaining to the same professional practice of nurses working in schools and educational institutions. The risk of social stigmatisation of children and entire families related to the occurrence of these embarrassing and therefore concealed diseases impedes initiation of effective treatment and implementation of measures targeted at elimination or at least limitation of this problem. Although pediculosis is an important hygienic and social problem (Izdebska 2014), it has not been included in the list of infectious diseases specified in the Appendix to the binding Act of December 5, 2008 on prevention and control of infections and infectious diseases in humans. However, this problem is so widespread that it pertains to the scope of not only representatives of professional corporations, i.e. members of the Supreme Council of Nurses and Midwives, but also patient organisations or associations, which participate in the lawmaking process together with experts. During the work on the amendment of the Act in question in 2017, these organisations with the Supreme Council of Nurses and Midwives proposed extension of the list of infectious diseases and the obligation to report these diseases as well as granting educational nurses the right to take action targeted at detection, prevention, and treatment of the diseases. The proposed changes would offer a possibility of effective control of the social threat posed by pediculosis and scabies (commonly but wrongly associated with dysfunctional milieus and social margin) (Frolova 1997). They would also correspond directly to the provisions of the Act of 7 September 1991 on the system of education (Journal of Laws 2017 items 2198, 2203, and 2361), which imposes the obligation to provide children in educational and care institutions with organisational facilities for safe and hygienic conditions. Pediculosis symptoms, diagnosis, and prophylaxis Pediculosis is one of the oldest and most common human parasitic diseases in the world (Meinking 1999). Depending on the environment, its prevalence varies in a wide range from 0% to 61.4% (Falagas et al. 2008). There are three forms of the disease: head lice (pediculosis capitis), body lice (pediculosis vestimenti) also referred to as vagabond s disease (morbus vagabundorum), and pubic lice (pthiriasis). 161

162 The first two forms are caused by human lice (Pediculus humanus) (Fig. 1a). Traditionally, there are two subspecies of human lice, i.e. Pediculus humanus capitis and Pediculus humanus corporis, which rarely appear in the pure form, as suggested by contemporary researchers. Kadulski and co-authors (2003) demonstrated many transitional forms, which supports the use of the common name Pediculus humanus for the aetiological agent of head and body lice. In turn, the pubic lice Pthirus pubis (Fig. 1b) is the cause of pthiriasis. Figure 1. Lice: a Pediculus humanus, b Pthirus pubis. Pediculosis capitis is a disease of the scalp skin. The primary symptom of this disease is itchiness of the scalp, which provokes scratching. This in turn can lead to mechanical damage to the skin facilitating penetration by pathogenic bacteria (Malcolm and Bergman 2007). Serous-purulent discharge forming scabs and gluing hair is secreted from skin injuries. This leads to plica formation. Invasions of human lice can be accompanied by enlargement of lymphatic nodes located near the infestation site and conjunctivitis (Ko and Elston 2004, Heukelbach et al. 2005, Scott et al. 2005) as well as allergic reactions in the nasal cavity (Fernandez et al. 2006). Additionally, particles of lice faeces spread via air and dust can enter the human respiratory tract and trigger asthma attacks (Buczek 2010). Body lice (pediculosis vestimenti), similar to head lice, is characterised by pruritus, which mainly affects body regions covered by clothes and colonised by these parasites. Scratching the sites of lice infestation can cause linear skin abrasions. Frequently, secondary bacterial inflammations develop with signs of impetiginisation, impetigo, and sometimes pustules. Small scars formed near the lesions are surrounded by discoloured or hyper-pigmented skin. Brown hyper-pigmentation of the skin most often appears in persistent pediculosis. Additionally, local lymphadenopathy may occur in the areas of lice infestation (Urban et al. 2005). Pubic pediculosis (pthiriasis) manifests itself by itching of the area infested by pubic lice, i.e. the mons pubis. The lice can also infest human eyelashes (pthiriasis palpebrarum), which causes conjunctivitis or purulent conjunctivitis as a result of bacterial superinfection (Asharf et al. 2014, Baskan et al. 2014). Blue-grey discolorations (melanoderma) appear in infested areas. They are caused by components of lice saliva, which stimulate conversion of blood haemoglobin into melanin (Buczek 2010). The human louse is a vector of pathogenic organisms, e.g. Rickettsia prowazekii (etiological factor of epidemic typhus, typhus epidemicus), Rickettsia quintana (etiological factor of trench fever, five-day fever), and Borrelia recurrentis (etiological factor of the recurrent epidemic typhus). Among these pathogens, Rickettsia prowazekii have been assigned the most 162

163 important role in history, as these rickettsiae were a cause of massive outbreaks in Poland and worldwide (Lachowska-Kotowska et al. 2012, Bartosik et al. 2014). Lice are most often transmitted via direct physical contact between healthy and infected subjects. This parasite can also be transmitted via an indirect route by sharing combs, brushes, headwear, or clothes with a Pediculus humanus infected subject. Fast spread of lice and long persistence of the disease in a given area is facilitated in dense concentrations of people, e.g. in kindergartens, schools, shelters, or means of public transport. Pediculosis is usually diagnosed in the sites of presence of large groups of people. Cases of persistent body pediculosis have been reported in hygienically self-neglected and malnourished individuals. Such cases have been reported in the Lublin province as well (Urban et al. 2005). Pediculosis is mostly spread among children (Feldmeier 2017) Diagnosis is based on the clinical picture and the presence of eggs (nits), juvenile stages (nymphs), or adults in the hair and head region in the case of head pediculosis or on the body in the case of body lice. In the latter case, lice and nits can be found on patient s clothes, as eggs are usually laid along the seams. The duration of the disease can be determined based on the location of nits on the hair, as female lice fix the nits at the hair root in the case of head pediculosis. The spread of pediculosis can be prevented by following hygiene rules. A parasitized patient should be treated immediately, and prophylaxis of pediculosis in children primarily consists in regular checks of the hair and scalp (Cummings et al. 2018). This allows selection of infested children that are a source of infection. The diagnosis of head lice is usually not difficult. In some cases, however, the disease must be distinguished from head seborrheic eczema and dandruff. Body pediculosis often requires exclusion of skin reactions to other parasitic arthropods (itch mites, fleas, bedbugs, harvest mites). Scabies - symptoms, diagnostics, and prophylaxis Scabies is currently a major epidemiological threat in all climatic zones due to its high infectivity and ease of spread through contact with an infected person. It is estimated that approximately 1-10% of humans worldwide suffer from scabies, but this percentage in some regions can be higher and reach even 50-80% (Andrews et al. 2009). The etiological factor is a microscopic itch mite (Sarcoptes scabiei var. hominis) (Fig. 2.), which makes burrows in the skin triggering inflammatory reactions. Figure 2. Sarcoptes scabiei var. hominis. Humans can also be infested by animal itch mites, e.g. Sarcoptes scabiei var. canis, which causes sarcoptic mange in dogs, Sarcoptes scabiei var. equi (agent of sarcoptic mange in horses), or Sarcoptes scabiei var. caprae (agent of sarcoptic mange in goats). However, itch mites that are 163

164 typical of various species of animals do not find favourable conditions in human skin; hence, the infestation of human skin is temporary. In the case of human scabies infection from animals, there are no burrows typical of Sarcoptes scabiei var. hominis invasion. Urticarial papules and tiny blisters can be observed on exposed skin areas, i.e. extremities and trunk in contact with infected animals. The infection spontaneously disappears after a short period (Angel et al. 2000). Complications can only occur in the presence of secondary bacterial infections or can be caused by scratching. The length of the scabies incubation period depends on the intensity of infection with itch mites and the immune status of the patient. It can range from 3 days to 3 weeks. The full picture of the disease develops within 3 to 6 weeks after the infestation. Clinical symptoms of primary infection appear after 2-4 weeks, as there is no hypersensitivity to these mites. However, in the case of re-invasions in sensitised humans, the symptoms may occur immediately after infection. The characteristic symptoms of scabies include night pruritus, mite burrows (visible as several-millimetre filiform-arcuate epidermis lesions), inflammatory pustular and vesicular reactions, secondary lesions - excoriations (excoriatio) and eczema (eczematisatio), as well as secondary bacterial infections (e.g. by Streptococcus pyogenes and Staphylococcus aureus) with impetiginisation symptoms (Fischer et al. 2012, Hay et al. 2012). The typical form of scabies is characterised by the presence different-shaped burrowed tracks with a female staying at their end. Sometimes bacteria can be detected in the tracks (Fimiani et al. 1997). Inflammatory pustular-vesicular reactions are the most common lesions in scabies. Erythematous lesions (papules) are caused by both larvae and nymphs of these mites. Chronic red-brown nodules are present on covered parts of the body, primarily male genitals, inguinal region, and axillary folds. They can persist for some time even after effective therapy. In infants and young children, these follicular lesions can appear on the entire the body but especially on hands and soles (Urban et al. 2004, Kacprzak-Bergman and Szenborn 2006). The first skin lesions caused by scabies develop on hands, i.e. along the lateral edges of fingers and in interdigital spaces. In typical cases, skin lesions appear on the flexion wrist surface, anterior axillary folds, elbow flexion region, umbilical region, and gluteal region. Lesions can also be observed in the mammillary region in females and on external genitalia in males. In the classic form of scabies in adults, there are no signs of the disease on the back and face. Norwegian scabies (scabies norvegica), also referred to as crusted scabies, is the most contagious and severe form of the disease. Numerous mites are present in layered scabs. Skin lesions occur on all body parts, even those untypical for this disease, e.g. the face, scalp, and interscapular region as well as nails. Norwegian scabies is highly contagious and spreads quickly in groups of humans sharing rooms and among medical staff taking care of infected patients (Corbett et al. 1996, Vorou et al. 2007). Norwegian scabies affects immunocompromised subjects, e.g. AIDS patients, subjects undergoing immunosuppressive treatment, disease-emaciated patients, those suffering from mental diseases, and malnourished or vitamin A-deficient patients (Kolar and Rapini 1991, Corbett et al. 1996, Sampathkumar et al. 2010, Subramaniam et al. 2010). Diagnosis of scabies is based on clinical symptoms (pruritus intensified at night, pustular-vesicular eruption in typical regions), epidemiological history (itchy rash in one of the household members or others present in the vicinity), and laboratory tests. Itch mites are detected in the skin using a dermatoscope (Walter et al. 2011), which shows the mites, tracks made by these parasites in the skin, and their excrements. They can also be detected on plasters stuck on affected skin and in skin scrapings. Various stages of development of these mites can be found in such material. The prophylaxis of scabies is based primarily on compliance with personal hygiene principles and avoidance of contact with Sarcoptes scabiei-infected patients. 164

165 After diagnosis of the infestation by this parasite, the patient should be isolated immediately. Treatment should be administered instantaneously as well. Patients bedding sets and clothes should be washed in hot water. When Norwegian scabies is detected, clothes, bedding, and all items used by the patient must be disinfected and disinfested. Problem of the prevalence of pediculosis and scabies The common belief that pediculosis and scabies are the diseases of social margin and a consequence of poverty and grubbiness makes the presence of these diseases not only an embarrassing but also marginalised problem. However, it affects institutions gathering large groups of people, e.g. schools, kindergartens, boarding schools, and closed establishments such as penal institutions, orphanages, and refugee centres. Since humans live increasingly close to each other and adopt certain patterns of social behaviour (McLaury 1983), even short direct or indirect contact with an affected patient or his/her clothing or everyday accessories is sufficient to be infected with pediculosis or scabies. These diseases also occur in families with high social status and in those that very strictly comply with the principles of personal and environmental hygiene. Interviews with parents of schoolchildren or pre-school children, social network sites, and actions taken by managements of educational institutions imply that pediculosis can be referred to as a re-emerging disease. It should be emphasised that both pediculosis and scabies are parasitic diseases bearing the risk of development of certain complications, and they should be treated with specific formulations (often with insecticides) under medical supervision although these medicines can be bought without prescription in every pharmacy (Zieliński and Czarkowski 2006). Importantly, the occurrence of pediculosis or scabies is associated with the need for treatment of all household members and large-scale disinfection. Therefore, the rule that prevention is better than cure should be followed. Obligation to report vs. actual status Pediculosis and scabies represent a group of infestations by external parasites; therefore, they are not included in the list of infectious diseases in the appendix to the Act of December 5, 2008 on prevention and control of infections and infectious diseases in humans (Journal of Laws 2008 no 234 item 1570 as amended). It should be mentioned here that the Act of December 5, 2008 fundamentally changed the obligation to report these diseases, which used to be one of the provisions in the Act of September 6, 2001 on prevention and control of infectious diseases in humans. The latter Act imposed an obligation on doctors and medical entities as well as prison services and educational institutions to report cases of pediculosis and scabies to sanitary inspection units (Act on communicable diseases and infections, , Journal of Laws No. 126 item 1384, as amended; Regulation of the Minister of Health of 10 July 2013 on the obligation to report a suspicion or diagnosis of infection, communicable diseases, or death due to an infection or contagious disease, Journal of Laws 2013 item 848). Nevertheless, despite the clear obligation, over the past 10 years between 1998 and 2008, only several or several tens of pediculosis and scabies cases were reported, as demonstrated by available statistical data stored at the District Sanitary and Epidemiological Station in Lublin. These data covered the area of the city of Lublin and Lublin County and were included in the annual reports of the National Institute of Hygiene. The cases were referred to as single or incidental. It is evident that, despite the obligation imposed on specified entities by the Act of 6 September 2001 on prevention and control of infectious diseases in humans, reporting these diseases posed some difficulties. This problem was addressed in the investigations conducted by Małgorzata Godala and Franciszek Szatko from the Department of Hygiene and Epidemiology, Medical University of Łódź, who observed certain reluctance of general practitioners to comply with the obligation to report infectious diseases, which may 165

166 have been related to mental, social, economic, organisational, and cultural barriers (Godala and Szatko 2010a, 2010b). The Act of 5 December 2008 changing the list of infectious diseases subjected to mandatory reporting, e.g. by exclusion of pediculosis and scabies, solved the problem of reporting these diseases but did not eliminate the problem itself. The actual prevalence of such parasitic infectious diseases as pediculosis and scabies significantly differs from common suppositions of their incidence, while they constitute a serious problem, as evidenced by our surveys of parents of schoolchildren, pre-school children, and teenagers (unpublished data). The situation may be caused by the mental barrier and shame resulting from lack of basic knowledge of the epidemiology of these infectious diseases in society. We therefore experience a somewhat curious situation: aware of such a scale of the phenomenon, one can only try to combat the disease individually in the home environment. In the light of the applicable regulations, nurses working in the educational milieu are not obliged to control the cleanness of pupils heads; this issue is regulated by the Catalogue of duties of nurses working in the educational milieu presented in Appendix 4 to the Regulation of the Minister of Health on guaranteed services in basic care health (Wojciechowska et al. 2016). Therefore, also in this area, parents take care of their children, as they are obliged by the provisions of the Family and Care Code to care for the health and physical development of their children. Hence, parents and legal guardians should systematically check the heads of their children. A nurse working in the educational milieu, who serves a function of an educator and adviser, can instruct parents and pupils or intervene at an explicit request from parents having difficulty in assessment of the problem (Wojciechowska et al. 2016). Conclusions 1. The law on reporting contagious diseases provides the basis for taking specific actions to assess the epidemiological situation of a population in a given area. 2. Reports on the prevalence of specific infectious diseases provide the basis for actions taken by Sanitary and Epidemiological Services to reduce or eliminate the specific problem. 3. The knowledge of the epidemiological status in a given population depends on the attitude of the entities liable to report cases of infectious diseases. Given the opinion of experts in the field of epidemiology, it should be clearly stated that no legal provision will improve the epidemiological situation in the country unless there is a system motivating institutions and medical personnel to implement the law properly 4. We are all responsible for the epidemiological situation of populations, especially in terms of the occurrence of infectious diseases such as pediculosis and scabies. The absence of legal grounds to report their occurrence to relevant authorities does not abolish the obligation to fight the problem, especially when it is highly prevalent. 5. In the light of the current legislation on infectious diseases, there is a need for an extensive educational campaign to explore the problem of pediculosis and scabies, in particular their occurrence factor, symptoms, and complications in order to raise public awareness of the scale of the phenomenon and to combat the deep stereotypes of pediculosis and scabies as embarrassing diseases. 6. Activities directed on control and elimination of pediculosis and scabies should be merged with existing clinical and public health programmes and systems. 7. Implementation of pro-health behaviours including procedures for prevention of pediculosis and scabies, i.e. regular hygienic checks, could largely contribute to reduction of the scale of this still quite urgent problem. At present, these activities should be independent of the legal provisions regulating the obligation to report infectious diseases. 8. Control of pediculosis and scabies in population should be treated as public health priority. 166

167 References 1. Andrews R.M., McCarthy J., Carapetis J.R., Currie B.J Skin disorders, including pyoderma, scabies, and tinea infections. Pediatr Clin North Am. 56: Angel T.A., Nigro J., Levy M.L Infestations in the pediatric patient. Pediatr. Clin. North. Am. 47: Ashraf M., Waris A., Kumar A, Akhtar N A case of unilateral phthiriasis palpebrarum infestation involving the left eye. BMJ Case Rep. pii: bcr Bartosik K., Lachowska-Kotowska P., Buczek A Pediculosis and great epidemics of typhus in the history of Poland. In: Buczek A, Błaszak C. (eds.) Arthropods- the medical and economic importance. Akapit, Lublin, Baskan C., Duman R., Balci M., Ozdogan S A rare cause of blepharoconjunctivitis: Phthiriasis palpebrarum. Niger J. Clin. Pract. 17: Buczek A Parasitic diseases. Epidemiology, Diagnostics and Symptoms. Koliber, Lublin (in Polish). 7. Buczek A., Kawa I.M., Markowska-Gosik D., Widomska D Pediculosis capitis in rural schools of Lubelskie voivodschip. Wiad. Parazytol. 47: (in Polish). 8. Buczek A., Markowska-Gosik D., Widomska D., Kawa I.M Pediculosis capitis among schoolchildren in urban and rural areas of eastern Poland. Eur. J. Epidemiol. 19: Buczek A., Pabis B., Bartosik K., Stanislawek I.M., Salata M., Pabis A Epidemiological study of scabies in different environmental conditions in central Poland. Ann Epidemiol. 16: Corbett E.L., Crossley I., Holton J., Levell N., Miller R., De Cock K.M Crusted ("Norwegian") scabies in a specialist HIV unit: successful use of ivermectin and failure to prevent nosocomial transmission. Genitourin. Med. 72: Cummings C., Finlay J.C., MacDonald N.E Head lice infestations: A clinical update. Paediatr. Child Health. 23: e18-e Falagas ME, Matthaiou DK, Rafailidis PI, Panos G, Pappas G Worldwide Prevalence of Head Lice. Emerg Infect Dis. 14: Feldmeier H Pediculosis capitis - an update. MMW Fortschr. 159: (in German). 14. Fernandez S., Fernandez A., Armentia A., Pineda F Allergy due to head lice (Pediculus humanus capitis). Allergy 61: Fimiani M., Mazzatenta C., Alessandrini C., Paccagnini E., Andreassi L The behaviour of Sarcoptes scabiei var. hominis in human skin: an ultrastructural study. J. Submicroscop Cytol. Pathol. 29: Fischer K., Holt D., Currie B., Kemp D Scabies: important clinical consequences explained by new molecular studies. Adv. Parasitol. 79: Frolova A.I An assessment of the state of pediculosis morbidity in Russia and the modern means for its control. Med. Parazitol. (Mosk). 3: (in Russian). 18. Godala M, Szatko F. 2010a. Zgłaszalność chorób zakaźnych. Cz. I. Ocena świadomości lekarzy dotycząca zgłaszania chorób zakaźnych do inspekcji sanitarnej. Probl. Hig. Epidemiol. 91: Godala M, Szatko F. 2010b. Zgłaszalność chorób zakaźnych. Cz. II. Bariery ograniczające pełną zgłaszalność chorób zakaźnych do inspekcji sanitarnej w ocenie lekarzy podstawowej opieki zdrowotnej w Łodzi. Probl. Hig. Epidemiol. 91: Hay R.J., Steer A.C., Engelman D., Walton S Scabies in the developing world--its prevalence, complications, and management. Clin Microbiol Infect. 18: Heukelbach J., Wilcke T., Winter B., Feldmeier H Epidemiology and morbidity of scabies and pediculosis capitis in resource-poor communities in Brazil. Br. J. Dermatol. 153:

168 22. Izdebska J.N Lice? To get to know and overcome the problem. The guide-book. PWN, Warszawa (in Polish). 23. Kacprzak-Bergman I., Szenborn L Atlas chorób zakaźnych dzieci. Elsevier Urban & Partners, Wrocław. 24. Kadulski S., Izdebska J.N., Fryderyk S Preliminary observations about diversity of the Pediculus humanus L. population (Pediculidae, Anoplura) in Poland. In: Buczek A., Błaszak C. (eds), Arthropods and hosts. Liber, Lublin: Ko C.J., Elston D.M Pediculosis. J. Am. Acad. Dermatol. 50: Kolar KA, Rapini RP Crusted (Norwegian) scabies. Am. Fam. Physician. 44: Lachowska-Kotowska P., Bartosik K., Kulina D., Kulbaka E., Buczek A The role of arthropods in transmission of rickettsial diseases. Rickettsial diseases transmitted by insect. In: Buczek A, Błaszak C. (eds.) Arthropods- the medical and economic importance. Akapit, Lublin, Malcolm C.E., Bergman J.N Trying to keep a head of lice: a therapeutic challenge. Skin Ther. Letter 11: McLaury P Head lice. Pediatric social disease. Am. J. Nurs. 83: Meinking TL Infestations. Curr Probl Dermatol. 11: Sampathkumar K., Mahaldar A.R., Ramakrishnan M., Prabahar S Norwegian scabies in a renal transplant patient. Indian J. Nephrol. 20: Scott P., Middlefell L.S., Fabbroni G., Mitchell D.A Interesting case: cervical lymphadenopathy induced by head lice. Br. J. Oral Maxillofac. Surg. 43: Subramaniam G, Kaliaperumal K, Duraipandian J, Rengasamy G Norwegian scabies in a malnourished young adult: a case report. J. Infect. Dev. Ctries. 4: Urban.J, Wawrzycki B., Wojnowska D., Kądziela-Wypyska G., Juszkiewicz-Borowiec M., Miturska R., Billewicz-Kraczkowska A Świerzb u noworodków, niemowląt i dzieci szkolnych: przyczyny błędów diagnostycznych. W: Stawonogi. Interakcje pasożyt-żywiciel. Buczek A, Błaszak C. (red.) Liber, Lublin, Urban J., Wawrzycki B., Barud W., Chodorowska G., Urbańska A., Juszkiewicz- Borowiec M., Wojnowska D Clothing lice (pediculosis vestimenti): case presentation and literaturę review. In: Buczek A, Błaszak C. (eds.), Arthropods. A variety of forms and interactions. Koliber, Lublin, Vorou R., Remoudaki H.D., Maltezou H.C Nosocomial scabies. J. Hosp. Infect. 65: Walter B., Heukelbach J., Fengler G., Worth C., Hengge U., Feldmeier H Comparison of dermoscopy, skin scraping, and the adhesive tape test for the diagnosis of scabies in a resource-poor setting. Arch. Dermatol. 147: Wojciechowska M., Piejak M., Staszewska D., Michalska E., Herbuś J., Gośćiewska B., Zając J., Wojciechowska M Strategia opieki nad uczniem w wieku szkolnym w środowisku nauczania i wychowania. Krajowe Stowarzyszenie Pielęgniarek Medycyny Szkolnej, Naczelna Izba Pielęgniarek i Położnych: Szczecin, Zieliński A., Czarkowski M.P Choroby zakaźne w Polsce w 2004 roku. Przgl. Epidemiol. 60:

169 Demodex infestation in aesthetic medicine patients preliminary study Renata Przydatek-Tyrajska 1,2, Katarzyna Bartosik 2, Aleksandra Sędzikowska 3, Monika Dybicz 3, Weronika Buczek 2, Alicja Buczek 2 1Reno-Med, Non-Public Health Care Centre, Podkowy 87, Warsaw 2Chair and Department of Biology and Parasitology, Medical University of Lublin, Radziwiłłowska 11, Lublin 3Department of General Biology and Parasitology, Warsaw Medical University, Chałubińskiego 5, Warsaw, Poland Abstract The objective of our survey was to collect data on the prevalence of infestations with Demodex mites among subjects under the care and consultation of aesthetic medicine doctors. The study material consisted of eyelashes and skin scrapings collected from patients faces and eyebrows. The material was sampled from 51 patients (38 females and 13 males). Finding at least one Demodex mite in one specimen, i.e. scrapings from the face, eyebrows, or eyelashes, was regarded a positive result. Demodex mites were identified in 24 patients (47.5% of examined subjects). In comparison with the control group, patients infested by the mite reported a higher incidence of chronic diseases, e.g. IgA deficiency, alcoholism, mammary cancer, polycystic ovary syndrome, seronegative arthritis, depression, and cholesteatoma % of patients from the group diagnosed with Demodex invasion received periodic local or systemic immunosuppressive therapy. Keywords: Demodex mites, aesthetic medicine, rosacea, acne vulgaris, chronic diseases, immunosuppression Introduction Demodex spp. are mites colonising human skin and leading to development of demodecosis, i.e. a disease caused in humans by two species: Demodex folliculorum (Simon 1843) and Demodex brevis (Akbulatowa 1963). D. folliculorum can mainly be found in hair follicles, whereas D. brevis usually colonises sebaceous glands as well as the lobules of tarsal glands called Meibomian glands (English and Nutting 1981). Demodex mites are usually localised around the nose and eyes or on the forehead and chin. The infection is spread via a direct route due to the limited ability of the parasite to survive outside the host organism (Liu et al. 2010). Another source of infection may be mite eggs spread with dust (Czepita et al. 2007). The disease caused by the presence of Demodex mites is called demodecosis. Frequently, the infestation by these mites is asymptomatic, in particular at a low intensity of invasion. The symptoms include eyelid pruritus and redness (Sędzikowska et al. 2016). Demodex mites colonising eyelash hair follicles cause persistent chronic blepharitis (Czepita et al. 2007). Demodecosis can be divided into primary and secondary forms, in which D. folliculorum is the etiological factor of the primary form and D. brevis causes secondary demodecosis (Akilov et al. 2005). The presence of Demodex mites on facial skin is often associated with lesions, e.g. rosacea, erythemato-papulous and pustulous (rosacea-like) skin lesions, and erythematodesquamative lesions (Raszeja-Kotelba et al. 2004). As reported by Forton and Seys (1993), 169

170 Demodex mites exert a pathogenic effect at a density higher than 5 individuals per cm 2 on the skin of patients with rosacea. Material and methods The examinations aimed at diagnosis of Demodex infection were carried out in patients consulting a certified specialist in aesthetic medicine. Each subject received a Written Informed Consent Form before participating in the study. Upon their consent, the patients answered survey questions about previous illnesses, medications taken currently, or previous aesthetic medicine treatments (Appendix 1). The patients skin condition was evaluated before the examination. To diagnose the Demodex spp. infection, scrapings were collected from patients faces with the use of disposable, sterile scalpel blades (type 10, from B. Braun Aesculap). In some patients, the collection of scrapings was preceded by squeezing small comedones from the region of nasal wings. The study material also included eyelashes taken from all patients participating in the study. Minimum two eyelashes from each eye were collected from each subject. Scrapings from the eyebrow area were collected from patients who reported pruritus in this region. The scrapings from faces and eyebrows as well as eyelashes were placed on microscopic slides. Hoyer s solution was applied onto the material (Cielecka et al. 2009) and covered with a coverslip. The slides were viewed under a light microscope to detect various forms of the Demodex mite and determine the intensity of the invasion. A positive result was reported for slides that contained adults, larvae, or eggs of Demodex sp. The presence of Demodex mites in at least one of the slides (face and eyebrow scrapings or eyelashes) was regarded as a positive result. The study involved 51 subjects (36 women and 15 men) aged from 12 to 69. Results In the group of 51 subjects, a positive result was noted in 24 patients (47.5%), including 15 women (62.5%) and 9 men (37.5%). The average age of infected patients was 46 years and the highest prevalence was reported among patients between 41 and 60 years of age (Fig. 1). Figure 1. Patients infested with Demodex sp. in different age groups (N=24). 170

171 Twenty patients (83.3%) diagnosed with demodecosis presented with various types of skin lesions on the face, e.g. desquamation and dryness of the skin, redness of the skin, pruritus, skin eruptions, pustules, and papules. The analysis of the scrapings revealed the following positive results: - Demodex mites in the scrapings from the eyebrow area and an eyebrow hair % (Fig. 2A) - Demodex mites from the eyelashes - 50% (Fig. 2B) - Demodex mites from the skin scrapings (nose, chin, cheeks) % (Fig. 2C). A B C Figure 2. Adults, juveniles, and egg of Demodex folliculorum from patient s eyebrows (A); adults, larva, nymph, and egg of D. folliculorum from patient s eyelashes (B); D. folliculorum adult removed from facial skin with the content of sebaceous glands (C). 171

172 Among 54.17% of patients (13 subjects) diagnosed with infestation by Demodex mites, the intensity of the invasion ranged from 3 to 5 mites per 1 cm 2 scrapings from eyelashes and/or eyebrows (an egg was found in 40% of patients in skin scrapings, 30% on eyelashes, and 30% on eyebrow hair). The group of patients exhibited intensified skin symptoms. In 11 patients, the invasion intensity ranged from 1 to 2 Demodex mites in the above-mentioned slides, which accounts for 45.83% of patients diagnosed with demodecosis. The skin lesions in this group of patients were milder or absent. Based on the data provided in the questionnaires and the analysis results, we compiled the information about patients ailments and the presence of Demodex mites (Table 1). The ophthalmologic symptoms most frequently affecting the examined patients included eyelid itching (45.1% of the subjects) and the eye dryness sensation (35.29% of the patients). Both these symptoms were more frequent in patients diagnosed with the presence of Demodex sp. This correlation was statistically significant (Table 1). The questionnaire contained a question of the occurrence of styes and tarsal cysts on the eyelid. Patients reporting this problem accounted for merely 16.66% of all subjects. The presence of Demodex mites was diagnosed in all 7 patients who were periodically immunosuppressed (29.16% of patients with the diagnosed invasion of Demodex sp.). The highest invasion intensity was recorded in these patients. This group included patients receiving topical external treatment with a steroid-containing formulation (57.14%). The same number of female and male patients had this treatment. Pimafucort ointment (10 mg Hydrocortisonum, 10 mg Natamycinum, 3500 IU/g Neomycinum) and Hydrocortisonum cream (0.5%) were applied most frequently. Inhaled steroids were used by 42.86% of the subjects. The most commonly applied medicines included Flixotide aerosol (Fluticasoni propionas, micrograms per dose), Seretide (Fluticasoni propionas 125 or 250 micrograms per dose plus salmeterol 25 micrograms per dose), and Avamys (27.5 micrograms of Fluticason furoate per dose). There were 33.33% of females and 66.66% of males in this group of patients. Oral immunosuppressive drugs (cytostatics, steroids) were taken by one female patient. Discussion Demodex mites infesting humans arouse growing doctors and scientists interest and are increasingly being investigated. A patient infected by the mite can report to various specialist doctors, ranging from general practitioners, internists, and dermatologists to ophthalmologist. Given the wide range of symptoms common to other disease conditions, the patient can seek help from allergists, rheumatologists, or aesthetic medicine doctors as well as psychiatrists. The present study focused on patients of aesthetic medicine clinics. This medicine field has been developing rapidly in recent years and is promoted by media or colour magazines. A certified aesthetic medicine doctor can help the patient with this problem, simultaneously improving his appearance, which improves patient s well-being and selfconfidence. As shown by literature data, age is one of the most important factors increasing the likelihood of infection by Demodex mites. In this study group, the average age of patients affected by demodecosis was 46 years. The age is positively correlated with the probability of infection although not in annual but several-year intervals, i.e. the older the patient is, the greater the likelihood of infection, which can be related to the age-dependent decrease in the immunity of the organism (Sędzikowska 2018). The incidence of the disease in younger people is lower (Aycan et al. 2007, Zhao et al. 2011). While the influence of age on the development of demodecosis seems to be indisputable, the effect of the sex on the invasion by Demodex mites has not been clearly elucidated. In the present studies, both females and males were infected. As shown by literature data and our observations of Demodex infestation in females and males, it seems that 172

173 patient s sex does not exert an impact on the probability of Demodex infection (Aycan et al. 2007, Wesołowska et al. 2014, Sędzikowska 2018). Demodex mites are often detected in patients with rosacea and acne vulgaris. Both diseases can be a big problem for the patient. These chronic diseases aggravate the appearance of the skin to such a large extent that it is difficult for the patient to function in everyday life and can strongly influence his psychosocial sphere. In this study, 37.5% of patients with rosacea were diagnosed with the presence of Demodex folliculorum, which is in agreement with results reported by Casas et al. (2012), who observed increased abundance of these mites in the case of rosacea. The presence of Demodex mites on the facial skin can cause noticeable changes in the composition of the skin flora, i.e. bacteria that are atypical for the face may be present (Ahn and Huang 2018). Szkaradkiewicz et al. (2012) have described Bacillus oleronius bacteria living in the intestinal tract of Demodex mites and excreted onto human skin. The presence of the mites in combination with these bacteria may exacerbate the symptoms, e.g. in inflammation of the eyelid margins (Jarmuda et al. 2012). The bacterial group associated with Demodex mites is probably larger, as indicated by Tatu et al. (2016), who isolated Bacillus cereus bacteria from Demodex mites. Factors that can promote the presence of Demodex mites in patients with acne vulgaris and rosacea include oily, acidic, and very dry skin (Turan et al. 2017). This is associated with the content of cholesterol esters in sebum, which may be food for the mites (Demirdağ et al. 2016). As demonstrated by Lacey et al. (2018), the presence of great numbers of Demodex mites can induce the release of pro-inflammatory mediators by sebocytes. These researchers have shown that a small number of Demodex mites contribute to inhibition of cytokine production. In the examined group, patients with acne vulgaris accounted for a lower percentage than those with rosacea (25% vs. 37.5%). However, there are reports of the possible involvement of Demodex mites in the course of acne vulgaris as well. As described by Zhao et al. (2012), diagnosis of demodecosis should be considered in the case of ineffective acne treatment and adequate therapy against these mites should be administered. However, not all reports indicate such a connection. As suggested by Okyay et al. (2006), there is no correlation between the presence of Demodex mites and acne vulgaris. Eyelid pruritus is reported by patients as the most frequent symptom (66.66% of the subjects). Similar results can be found in literature data, where pruritus is the most common ophthalmologic symptom in patients with demodecosis (Sędzikowska et al. 2016). Similar results were reported by other research teams, which described itching as one of the main symptoms of demodecosis (Inceboz et al. 2009, Liu et al. 2010, Vargas-Arzola et al. 2012). Intensive invasion of Demodex brevis can destroy glandular cells, cause granuloma in the eyelid, and obstruct the ducts of the Meibomian or sebaceous glands (English and Nutting 1981). Lesions in the eyelids, e.g. stye or tarsal cyst, were noted in a small percentage of the patients (16.66%). As reported by Tarkowski et al. (2015), studies carried out on the Polish population demonstrated a correlation between tarsal cysts and prevalence of Demodex mites. Similar results were obtained by other authors (Schear et al. 2016), who did not indicate a causeand-effect relationship but an indisputable correlation between this mite and the tarsal cyst. The authors suggest that Demodex mites colonising eyelashes have an indirect effect on the front margin of the eyelid. The still insufficient literature data on the consequences of the infestation of human skin by Demodex mites justify the need for further research. More detailed and thorough analyses in this field will elucidate the role of Demodex mites in human skin. In the future, this will facilitate providing more adequate help to patients with lesions caused by the presence of these mites. The symptoms appearing on facial skin can be clearly visible and thus produce the feeling of discomfort in the patients. Therefore, we plan to continue and expand the scope of our research. Acknowledgements We are grateful to Anna Wesołowska-Zoń for the language editing of the manuscript. 173

174 Table 1. Correlations between ailments reported by patients and the presence of Demodex sp. in patients of aesthetic medicine doctors. Chronic diseases Group of 24 subjects with Group of 27 subjects without All subjects - 51 patients Demodex sp. (47.5%) Demodex sp. (52.5%) (100%) Statistical analysis (chi 2 test) number of number of number of percent % percent % subjects subjects subjects percent % respiratory diseases chi-square=0.042; df=1; p=0.838 cardiovascular diseases chi-square =0.699; df=1; p=0.403 neurological diseases chi-square =0.652; df=1; p=0.419 gastrointestinal diseases chi-square =1.444; df=1; p=0.229 allergies chi-square =0.066; df=1; p=0.797 (including atopic chi-square =0.415; df=1; dermatitis*) p=0.519 thyroid diseases chi-square =0.049; df=1; p=0.825 acne vulgaris chi-square =0.003; df=1; p=0.956 rosacea chi-square =0.787; df=1; p=0.375 seborrhoeic dermatitis chi-square =0.042; df=1; p=0.838 other chronic diseases ** chi-square =6.928; df=1; p=0.008 Ophthalmological symptoms eyelid pruritus chi-square =6.952; df=1; p=0.008 eye dryness sensation chi-square =8.717; df=1; p=

175 Appendix 1. History of Patient s health status. age:. sex:. chronic conditions : respiratory diseases, cardiovascular diseases, neurological diseases, gastrointestinal diseases with emphasis of the presence of Helicobacter pylori bacteria, inhalation, cutaneous, and food allergies, drug allergies, thyroid diseases, autoimmune diseases: thyroiditis, Hashimoto s disease, RA-Rheumatoid arthritis, systemic lupus erythematosus, scleroderma, other skin diseases : - acne vulgaris - rosacea - seborrhoeic dermatitis- vitiligo - kelomas - other skin diseases..., eye diseases, previous ophthalmological treatment..... cancer diseases... do you take any medications? * at present...* permanently... * eye drops, ointments...* healing skin creams/ointments how and with what do you wash your face every day?... do you sometimes have inflammation of eyelid margins, eyelid pruritus at the base of eyelashes, recurrent conjunctivitis, styes, tarsal cysts, eye dryness or other eyelid/eye conditions?... Have you noticed when the skin appearance improves? Have you noticed when the skin appearance worsens? (appearance of one or more of the following lesions - erythema, pruritus, skin burning, presence of papules, pustules, spots and other skin imperfections? - which?. Do you go to the solarium or sauna? (If so, how does it affect the condition of your skin? 175

176 Are you on any special diet? Is there any family history of current or previous skin diseases? Have you had any aesthetic medicine treatments? * peeling * laser-assisted vessel closing * laser-assisted erythema reduction * fractional laser * microdermabrasion * mesotherapy * skin fillers * platelet-rich plasma * other treatments..... If you have had any of these treatments how do you rate them? Do you have any pets at home? Have you heard of the Demodex mite? (If so, in what circumstances?) Is your job associated with direct contact with another person, e.g. masseur, doctor, beautician, etc.? Thank you for participation in the survey! References 1. Ahn C.S., Huang W.W Rosacea Pathogenesis. Dermatol. Clin. 36: Akilov O.E., Butov Y.S., Mumcuoglu K.Y A clinico-pathological approach to the classification of human demodicosis. J. Dtsch. Dermatol. Ges. 3: Aycan O.M., Otlu G.H., Karaman U., Daldal N., Atambay M Frequency of the appearance of Demodex sp. in various patient and age groups. Turkiye Parazitol. Derg. 31: Casas C., Paul C., Lahfa M., et al: Quantification of Demodex folliculorum by PCR in rosacea and its relationship to skin innate immune activation. Exp. Dermatol. 21: Cielecka D., Salamatin R., Garbacewicz A Applications of Hoyer s fluid in diagnostics and morphological studies of some parasites. Wiad. Parazytol. 55: (in Polish). 6. Czepita D., Kuźna-Grygiel W., Czepita M., Grobelny A Demodex folliculorum and Demodex brevis as a cause of chronic blepharitis. Ann. Acad. Med. Stetin. 53: (in Polish). 176

177 7. Demirdağ H.G., Özcan H., Gürsoy S., Beker Akbulut G The effects of sebum configuration on Demodex spp. density. Turk. J. Med. Sci. 46: English F.P., Nutting W.B Feeding characteristics in demodectic mites of the eyelid. Aust. J. Ophthalmol. 9: Forton F., Seys B Density of Demodex folliculorum in rosacea: a case-control study using standardized skin-surface biopsy. Brit. J. Dermatol. 128: Inceboz T., Yaman A., Over L., Ozturk A.T., Akisu C Diagnosis and treatment of demodectic blepharitis. Turkiye Parazitol. Derg. 33: Jarmuda S., O'Reilly N., Zaba R., Jakubowicz O., Szkaradkiewicz A., Kavanagh K Potential role of Demodex mites and bacteria in the induction of rosacea. J. Med. Microbiol. 61: Lacey N., Russell-Hallinan A., Zouboulis C.C., Powell F.C Demodex mites modulate sebocyte immune reaction: Possible role in the pathogenesis of rosacea. Br. J. Dermatol. doi: /bjd Liu J., Sheha H., Tseng S.C Pathogenic role of Demodex mites in blepharitis. Curr. Opin. Allergy Clin. Immunol. 10: Okyay P., Ertabaklar H., Savk E., Erfug S Prevalence of Demodex folliculorum in young adults: relation with sociodemographic/hygienic factors and acne vulgaris. Eur. Acad. Dermatol. Venereol. 20: Raszeja-Kotelba B., Jenerowicz D., Izdebska J.N., Bowszyc-Dmochowska M., Tomczak M., Dembińska M Some aspects of the skin infestation by Demodex folliculorum. Wiad. Parazytol. 50: (in Polish). 16. Schear M.J., Milman T., Steiner T., Shih C., Udell I.J., Steiner A The Association of Demodex with Chalazia: A Histopathologic Study of the Eyelid. Ophthal. Plast. Reconstr. Surg. 32: Sędzikowska A., Osęka M., Grytner-Zięcina B Ocular symptoms reported by patients infested with Demodex mites. Acta Parasitol. 61: Sędzikowska A., Osęka M., Skopiński P The impact of age, sex, blepharitis, rosacea and rheumatoid arthritis on Demodex mite infection. Arch. Med. Sci. 14: Szkaradkiewicz A., Chudzicka-Strugała I., Karpiński T.M., Goślińska - Pawłowska O., Tułecka T., Chudzicki W., Szkaradkiewicz A.K., Zaba R Bacillus oleronius and Demodex mite infestation in patients with chronic blepharitis. Clin. Microbiol. Infect. 18: Tarkowski W., Owczyńska M., Błaszczyk-Tyszka A., Młocicki D Demodex mites as potential etiological factor in chalazion- a study in Poland. Acta Parasitol. 60: Tatu A.L., Ionescu M.A., Clatici V.G., Cristea V.C Bacillus cereus strain isolated from Demodex folliculorum in patients with topical steroid-induced rosacea form facial dermatitis. An. Bras. Dermatol. 91: Turan N., Kapıcıoğlu Y., Saraç G The Effect of Skin Sebum, ph, and Moisture on Demodex Infestation in Acne Vulgaris and Rosacea Patients. Turkiye Parazitol. Derg. 41: Vargas-Arzola J., Reyes-Velasco L., Segura-Salvador A., Márquez-Navarro A., Díaz- Chiguer D.L., Nogueda-Torres B Prevalence of Demodex mites in eyelashes among people of Oaxaca, Mexico. Acta Microbiol. Immunol. Hung. 59: Vollmer R.T Demodex-associated folliculitis. Am. J. Dermatopathol. 18: Wesołowska M., Knysz B., Reich A., Blazejewska D., Czarnecki M., Gladysz A., Pozowski A., Misiuk-Hojlo M Prevalence of Demodex spp. in eyelash follicles in different populations. Arch. Med. Sci. 10:

178 26. Zhao Y.E., Guo N., Xun M., Xu J.R., Wang M., Wang D.L Sociodemographic characteristics and risk factor analysis of Demodex infestation (Acari: Demodicidae). J. Zhejiang Univ. Sci. B. 12: Zhao Y.E., Hu L., Wu L.P., Ma J.X A meta-analysis of association between acne vulgaris and Demodex infestation. J. Zhejiang Univ. Sci. B. 13:

179 Threats for human and animal health posed by arthropods Zagrożenia zdrowia człowieka i zwierząt stawonogami 179

180 180

181 The influence of various repellents on the migration activity of storage pests and human harmful beetles Aleksandra Izdebska 1, Natalia Malejky 1, Małgorzata Kłyś 1 1 Department of Ecology and Environmental Protection, Institute of Biology, Pedagogical University of Cracow, Podbrzezie 3, Kraków, Poland, malgorzata.klys@up.krakow.pl natalia.malejky@tlen.pl olaleksandra7@gmail.com Abstract Migration is the movement of organisms from a given area to another. There are also recognized one-way and two-way migrations. Among the beetles of storage pests from the Bostrichidae and Curculionidae families in laboratory conditions, we observe one-way migrations (emigration), two-way migrations. It was found that the growth of migration activity of storage pests is affected by various repellents. These substances are intended to deter organisms where their occurrence is undesirable. The migration activities of Sitophilus oryzae (L.) from the Curculionidae family and Rhyzopertha dominica (F.) from the Bostrichidae family are affected by various types of plants and substances extracted from them. On R. dominica, the most repellent effect has: Lavandula officinalis (L.), Eucalyptus kruseana (F. Muell), Momordica charantia (L.) and Salvia officinalis (L.), causing an increase in migration activity. However on S. oryzae: Ocimum canum (L.), Hyptis spiciger (Lam.), Mentha arvensis (L.) and Eucalyptus tereticornis (Sm.). Key words: migration, repellents, Rhyzopertha dominica (F.), Sitophilus oryzae (L.), storage pests. Introduction According to the definition migration is the movement of individuals or diasporas from one area to another. This term may refer single individuals or whole populations. We can differentiate emigration and immigration. Emigration takes place when organisms are leaving the living area. We define immigration as the arrival of individuals in a given area which settle down there. We can talk about migration also in a narrower scope. It concerns individuals who periodically move between two areas of existence. An example is the seasonal migration of some species of animals which migrate to properly avail the changing environmental conditions. In addition to mortality and reproduction, immigration and emigration determine the size of a given population. Migration of organisms between populations is also the cause of gene flow, and thus changes in their frequency. In the animal world, we can extract oneway and two-way (return) migration. The first type includes mass migrations of animals to new areas, whose main cause is searching for food. Bi-directional migration occur when migratory organisms are leaving the area in which they came to the world, arrival to another region and stay there for some time, and then return to the previously occupied environment (Jura and Krzanowska 1998). Storage pests Migration is common among insect pests of stored cereals and food products. It is a specialized group of insects adapted to living in closed rooms. Originally these organisms 181

182 were found in the nests of rodents, insects and birds feeding on dead animal or plant material. However, when a human abandoned an itinerant way of life, settled down and began to accumulate crops, pests found good conditions for their expansion. As the places used to store the crops were improved, the insects were getting better and better conditions for growth (Nawrot 2001). Family: Bostrichidae This family includes small beetles, usually dark colored, with a cylindrical body. They have 9-11 membered tentacles, which are completed with a three-point mace. The beetle's head is hidden under a hooded, convex pronotum. The larvae are bent arcuately. They have three pairs of legs and a head pulled into the prothorax. Most species which belong to this family feed in wood. However, we also meet those that prefer cereal grains and their products, such as R. dominica (Nawrot 2001). Rhyzopertha dominica It is one of the most dangerous pests of stored cereal grains. R. dominica is a brown-red beetle with a body length of mm. It has a round head hidden under the pronotum. His tentacles are 10-membered. The last three members form a bunting and have the shape of a triangle. The pronotum at the front is rounded, covered with visible mounds, at the base is slightly spotted. This insects lay of white, dull eggs not longer than 0.6 mm. The shape resembles a pear. The larva is white and hairy. It has a brown head and a hook at the end of the abdomen. It developing by the time obtains a characteristic shape. Has an extended torso and hidden head in the pronotum. The pupa looks like an adult insect. The minimum temperature for the growth of this insect is 17 0 C. R. dominica was dragged to Poland and other countries from India. It feeds on products such as grains of all kinds of cereals, beans, pasta, cereal products, dried vegetables and fruits, pumpkin seeds and even wood. This pest shows natural migration activity (Nawrot 2001). Repellents and their influence on the migration activity of Rhyzopertha dominica Repellents cause an increase in migration activity of animals. They are repellent organisms that occur in a particular place is undesirable. The name derives from Latin and comes from the word repellêre - to deter, reject (Kociołek - Balawejder and Złocińska 2009). Repellents are plant products and extracts, eg: oils, ethyl acetate extract, ethanol extract, powdered plants, essential oils, eugenol and many more (Kłyś et al. 2017). Kłyś (2007) in her research proved that Salvia officinalis (L.) has a deterrent effect on R. dominica. Sage increased the migration activity of beetles beyond the baseline population. In the food with the addition of sage after 40 days of research, the emigration rate was 90%. Kłyś (2011b) also investigated the influence of powdered plants - Lavandula officinalis (L.) and Carum carvi (L.) on the migration activity of R. dominica. Under the conditions that enabled the migration of adults beetles, the addition of lavender and caraway seeds to the wheat grain resulted in high insect emigration. In a population in which lavender was added to wheat at a concentration of 1.2% during the 100 days of the experiment, % emigration was observed. Cumin in the same concentration caused, for the first 70 days of the experiment, 95-80% emigration of this beetle. Kłyś (2007) also conducted research on the influence of powdered sage Salvia officinalis (L.) and wormwood Artemisia absinthium (L.) for the migration of R. dominica. The experiment was divided into two variants. In the first one called "a" one-way emigration was studied. On the other hand in the second variant "b", bidirectional migration occurred. In favorable migratory conditions, the addition of powdered sage caused less colonization of the substrate. It was proved that the emigration from food containing sage was high, especially at the beginning of the experiment. This allows to conclude that sage is a strong repellent. In turn, the addition of wormwood did not cause an increase in migration activity. 182

183 Kłyś (2006) managed work to verify the hypothesis that migration is determined by food and habitat selectivity. In studies were used: oat flakes, wheat, semolina and barley groats. She stated, that the migration activity is related to the food preferences of R. dominica, which are determined by granulation and the type of nutrient. In the initial phase of the study, the highest emigration was observed in oat flakes. Over time, the migration was highest respectively in: wheat, oat flakes, barley groats and semolina. The female beetles showed the highest migration activity. In addition, the ability of beetles to select the preferred type of food was assessed. The individuals could move freely between different kind of grains. Migration rate was analyzed. After 40 days of research, the highest migration rate (over 50%) was observed in oat flakes. From the 70th day of the breeding, it dropped to 34%. In wheat migration rate amounted to 49% and in barley ratio did not exceed 20%. The smallest migration rate was recorded in semolina. Thus, the food that beetles favor has the impact on the growth of their migration (Kłyś 2006). It was also investigated how the temperature decrease affects migration activity of R. dominica. At the beginning the populations were placed at 31 0 C, which is optimal for this insect. In the next stage of research temperature was reduced to 22 0 C. It was observed that the lowering of the temperature causes an increase in migratory activity of the beetles. There was also a higher activity among females (Kłyś 2009). Aref and Valizadegan (2015) in laboratory tests proved that essential oils from Eucalyptus floribunda, Eucalyptus dundasii and Eucalyptus kruseana deter the R. dominica after 24 hours at each of the tested concentrations of 70, 140 and 280 μl/l. However, the highest repellency was obtained using E. kruseana. At a concentration of 140 and 280 μl/l, it was respectively 82.75% and 92.91%. The influence of the extract from: Mentha longifolia (L.), Momordica charantia (L.), Luffa aegyptiaca (Mill.), Luffa carum copticum (L.) and Curcuma longa (L.) was also examined to prevent R. dominica. The tests were carried out for 10 days. Concentrations of 25, 50 and 75% were used. It turned out M. charantia showed repellency of 90%, L. aegyptiaca 80%, Luffa carum copticum 66.67% in a concentration of 75%. Therefore, among the listed plant extracts, the highest migration activity causes M. charantia (Shahet al. 2015). An analysis of the chemical composition, repellency and toxicity of essential oils from Laurus nobilis (L.) from Tunisia, Morocco and Algeria was performed. The results showed that the essential oils from L. nobilis deter R. dominica. The deterrent effects depend on the origin of the oil. In tests, the oil from Morocco was more effective than Tunisian and Algerian oils. Among the tested plant species, the strongest repellent effect on R. dominica has the L. nobilis essential oil from Tunisia. The best results were observed in the highest concentration (0.12 μl/cm2) after 3 and 5 hours of exposure. Using oil from Morocco noticed the same effect after 1 hour. Laurel oil from Algeria (0.12 μl/cm2) after 24, 5, 3 and 1 hour showed repellent effects respectively of 85%, 90%, 90% and 97.5%. The experiment proved that essential oils extracted from Mediterranean plants are effective as repellents and cause an increase in beetle activity (Jemaa et al. 2012). Family: Curculionidae This family includes insects of various sizes. We meet individuals with only a few mm and species reaching up to 2 cm length. The characteristic feature of these beetles is the elongation in the snout front part of the head. At the end of the snout there are biting gnawing organs. The larvae are thick, short and legless. Adult beetles and larvae of all species are herbivorous. A lot of individuals which belong to this family causes damages in forestry and agriculture (Nawrot 2001). Representatives of this family belonging to storage pests are weevils: rice (Sitophilus oryzae L.), grain (Sitophilus granarius L.) and maize (Sitophilus zeamais Motsch.). Sitophilus oryzae 183

184 S. oryzae is mm long. Its head is elongated into a characteristic snout. The weevil has knee-bent, ball-shaped tentacles. On the pronotum S. oryzae has got oval punctures. Cover wings are brown and black, with rows of dots. On each of them are visible two orange spots. It has well-developed membranous wings of the second pair. The female lays white, oval, shiny eggs, mm in size. The larva of S. oryzae is curved and legless. Its body is white with a darker head. The larva is divided into three additional lobes, the first three abdominal segments. The pupa is white, has visible buds of the wings of the second pair. S. oryzae usually spread passively with infected grain. The beetle probably comes from India. It is drag into the country together with grains of rice and corn (Nawrot 2001). The influence of repellents on migration activity of Sitophilus oryzae The influence of ethanolic extracts from plants: Psidium guajava (L.), Citrus reticulata (Blanco), Citrus limon (L.), Citrus sinensus (L.) and Azadirachta indica (L.) on S. oryzae were examined. In the experiment were used five concentrations of 5%, 10%, 15% and 20%. After obtaining the results, it was found that P. guajava was the most effective, while the A. indica was the least. It was shown that C. reticulata, C. limon and C. sinensus cause a moderate increase in beetles migration, and the results do not differ significantly (Akhtar et al. 2013). The effects of dried plant and powder from Eucalyptus tereticornis (Sm.) on the S. oryzae were also evaluated. The solvents used were: n-hexane, acetone, ethanol and methanol. S. oryzae was deterred by all the extracts. It is concluded, that E. tereticornis affects the growth of migration activity of beetles (Khan and Shahjahan 1998). Nootkatone is a natural sesquiterpene ketone. It exhibits insecticidal activity. Its toxicity and repellency were checked for storage pests, including S. oryzae. The wheat was treated with a 0.5% nootkatone solution or higher. The repellency was % (Mao and Henderson 2010). Essential oils obtained from aromatic plants have insecticidal properties. Nowadays, they are used as an alternative insecticide for protection against stored pests. The effect of the combination of essential oils with Vepris heterophylla (Engl. Letouzey), Ocimum canum (L.), and Hyptis spicigera (Lam) on the S. oryzae was investigated. The presence of monoterpenoid in these plants has been demonstrated. The biggest beetle repelling effect was achieved thanks to the combination of oils from H. spiciger and O. canum. The repellency was 77.5% (Ngassoum et al. 2007). The essential oil from Mentha arvensis (L.) has repellent effects and toxic to the S. oryzae. The result of the experiment showed that this oil strongly affects the growth of beetle migrations even at low concentrations (Mishra et al. 2012b). Also, the repellency of ten plant extracts to three types of pests of stored products was assessed. One of them was S. oryzae. All tested plants influenced the growth of migratory activity of this insect. Anagillis arvensis (L.) and Hibiscus rosa sinensis (L.) caused repellency of 60% after 24 hours. The worst repellency has Chenopodium album (L.). about 17.5% after 24 hours (Singh et al. 2013) Ethanol, chloroform and hexane extracts were made from plants: Aloysia polystachia (Griseb), Moldenke (Verbenaceae), Solanum argentinum Bitter et Lillo (Solanaceae) and Tillandsia recurvata (L.) (Bromeliaceae). Their impact was examinedon S. oryzae. The moderate deterrent effect was caused by S. argentinum and A. polystachia. The hexane extract from S. argentinum was characterized by the strongest repellency (Viglianco et al. 2008). In another experiment, the effectiveness of six essential oils obtained from cumin, sage, grapefruit, strawberry, thyme, ylangylang on the S. oryzae migration activity was examined. Cumin and grapefruit oil showed the highest repellency at a dose of 10 μl. Caraway oil has been shown to be rich in carvone and limonene while the grapefruit oil has high concentration of limonene, β-myrce and α-pinene. After mixing the same amount of monoterpenes with essential oils of cumin and grapefruit, carvone with limonene in cumin oil the highest 184

185 repellency was obtained (96.7%). Limonen with α-pinene and β-myrcene in grapefruit showed a strong repellency (86.4%) with a synergistic effect on S. oryzae. A mixture of cumin and grapefruit oils, as well as carvings and limonene may affect the migration of S. oryzae (Yoon et al. 2007). Conclusion Many plants and compounds extracted from them affect the growth of insects emigration. Beetles from the Bostrichidae and Curculionidae families are dangerous pests of stored products. The above study shows that a lot of research is being done to assess the repellency of individual substances, mainly plant substances. The main purpose of these researches were to find effective ways to fight with presented pests. It is important that these measures do not harm human and the environment. Fot. 1. Rhyzopertha dominica F. Wikipedia Fot. 2. Sitophilus oryzae L. References: 1. Akhtar, M., Arshad, M., Raza, A.B.M., Chaudhary, M.I., Iram, N., Akhtar, N., Mahmood, T., Repellent effects of certain plant extracts against rice weevil, Sitophilus oryzae L. (Coleoptera: Curculionidae). Int. J. Agric. Appl. Sci. 5:

186 2. Aref S. P., Valizadegan O., Farashiani M. E Eucalyptus dundasii Maiden essential oil, chemical composition and insecticidal values against Rhyzopertha dominica (F.) and Oryzaephilus surinamensis (L.). Journal of Plant Protection Research. 55: Auamcharoen, W., Chandrapatya, A., Kijjoa, A., Kainoh, Y., Toxicity and repellency activities of the crude methanol extract of Duabanga grandiflora (Lythraceae) against Sitophilus oryzae (Coleoptera: Curculionidae). Pak. J. Zool. 44: Jemaa B.J.M., Tersim N., Toudert K.T., Khouja M.L Insecticidal activities of essential oils from leaves of Laurus nobilis L. from Tunisia, Algeria and Morocco, and comparative chemical composition. Journal of Stored Products Research. 48: Jura Cz., Krzanowska H Encyklopedia biologiczna: wszystkie dziedziny nauk przyrodniczych. T. VI. Wydawnictwo OPRES. Kraków. 6. Khan, M., Shahjahan, R.M., Evaluation of eucalyptus leaf extracts as repellent for adult Sitophilus oryzae (L.) (Col.: Curculionidae) and attractant for Callosobruchu schinensis (L.) (Col.: Bruchidae). Bangladesh J. Entomol. 8: Kłyś M Nutritional preferences of the lesser grain borer Rhyzopertha dominica F. (Coleoptera: Bostrichidae) under conditions of free choice of food. Journal of Plant Protection Research. 4: Kłyś M Correlation between nutritional selectivity and migratory activity of Rhizopertha dominica F. (Coleoptera, Bostrichidae). Journal of Plant Protection Research. 4: Kłyś M The influence of the herbs sage and wormwood on the migration of Rhyzopertha dominica (F.) (Coleoptera: Bostrichidae) populations. Journal of Stored Products Research 43: Kłyś M An Influence of Lowered Temperature on the Migration Activity of the Population of Rhizopertha dominica F. (Coleoptera, Bostrichidae). Journal of Plant Protection Research. 3: Kłyś M Repellent effect of the plants lavender and caraway on the migration of Rhyzopertha dominica F. populations (Coleoptera: Bostrichidae). Entomol. Gener. 33: Kłyś M., Malejky N., Nowak-Chmura M The repellent effect of plants and their active substances against the beetle storage pests. Journal of Stored Products Research. 74: Kociołek Balawejder E., Złocińska A Środki odstraszające owady (insect repellents) w ochronie ludzi. Nauki Inżynierskie i Technologie 1. Prace Naukowe Uniwersytetu Ekonomicznego we Wrocławiu nr Mao, L., Henderson, G Evaluation of potential use of nootkatone against maize weevil Sitophilus zeamais Motschulsky and rice weevil S. oryzae L. (Coleoptera: Curculionidae). J. Stored Prod. Res. 46: Mishra, B.B., Tripathi, S.P., Tripathi, C.P.M., Response of Tribolium castaneum (Coleoptera: Tenebrionidae) and Sitophilus oryzae (Coleoptera: Curculionidae) to potential insecticide derived from essential oil of Mentha arvensis leaves. Biol. Agric. Hortic. 28: Mumtaz A., Arshad M, Raza A.B.M., Iqbal Ch., Iram N., Akhtar N., Mahmood T Repellent effects of certain plant extracts against rice weevil, Sitophilus oryzae L. (Coleoptera: Curculionidae). Int. J. Agric. Appl. Sci. 1: Nawrot J Owady szkodniki magazynowe. Wydawnictwo THEMAR. Warszawa. 18. Ngassoum, M.B., Tinkeu, L.S.N., Ngatanko, I., Tapondjou, L.A., Logna, G., Malaisse, F., Hance, T., Chemical composition, insecticidal effect and repellent activity of essential oils of three aromatic plants, alone and in combination, towards Sitophilus oryzae L. (Coleoptera: Curculionidae). Nat. Prod. Commun. 2:

187 19. Shah T.B., Khan I., Saeed M., Khan A., Khan G.Z., Farid A., Khan S.M Repellency evaluation of selected indigenous medicinal plant materials against Rhyzopertha dominica (Herbst) (Coleoptera: Tenebrionidae). Journal of Entomology and Zoology Studies. 3: Singh, A.N., Rajan, S., Raghavendra, D., Prasad, S.R., Plant extracts as repellents against adults of Tribolium castaneum, Rhyzopertha dominica and Sitophilus oryzae. Indian J. Plant Prot. 41: Viglianco, A.I., Novo, R.J., Cragnolini, C.I., Nassett, M., Cavallo, A Antifeedant and repellent effects of extracts of three plants from Cordoba (Argentina) against Sitophilus oryzae (L.) (Coleoptera: Curculionidae). BioAssay 3: Yoon, C., Kang, S.-H., Jang, S.-A., Kim, Y.-J., Kim, G.-H Repellent efficacy of caraway and grapefruit oils for Sitophilus oryzae (Coleoptera: Curculionidae). J. Asia Pac. Entomol. 10:

188 188

189 What bites a dog and a cat? a review of selected ectoparasites atacking dogs and domestic cats Anna Kocoń 1, Magdalena Nowak-Chmura 1, Małgorzata Kłyś 2, Natalia Malejky 2 1Institute of Biology, Department of Invertebrate Zoology and Parasitology, Pedagogical University of Cracow, Podchorążych 2, Cracow, a_kocon@wp.pl 2Institute of Biology, Department of Ecology and Environmental Protection, Pedagogical University of Cracow, Podchorążych 2, Cracow Abstract Arthropods (Arthropoda) are mainly the skin ectoparasites. They live on the surface of their host s skin, feed on his body fluids or body shells and its products. They cause not only discomfort, strong pruritus of animals, but are also responsible for mechanical damage to the skin leading to dermatitis. The presence of blood-sucking arthropods in older, weakened animals can lead to anaemia. In addition, many arthropods are carriers of serious diseases, including infectious ones. It is connected with their large epidemiological role in the transmission of pathogenic microorganisms. External parasites can also cause invasion of internal parasites in animals. We should care about the health of our pets not only due to their well-being, but also because of our safety, and above all, the safety of children. External parasites most frequently found in domestic dogs and cats are: ticks, demodex, itch mites, Cheyletiella mites, lice, sucking lice, chewing lice, mosquitoes, moss, flies. Introduction Having animals at home has many advantages, among them, one can mention: reduction of stress, sense of security, medicine for loneliness, learning responsibility, empathy and it is very often said that a dog is the man s best friend. At the beginning of April 2017, Kantar Public conducted a study on the possession of animals in households. Research has shown that over half of the Poles (52%) have any pet in their household. More often, the owners of pets are residents of villages and small towns, and these are mainly middle-aged (40-49 years old) people. In addition to the age and size of the place of residence, having children was another factor conducive to having a pet at home. The most common animal in Polish homes is the domestic dog (Canis familiaris) (42%), the second place goes to the domestic cat (Felis catus) (26%), while 18% of the respondents have a dog and a cat at the same time (Kantar Public 2017). All cats and dogs, both young and old, staying permanently in a residential home with people, as well as those living outside in a kennel, or farm buildings, may undergo parasitic invasions. The degree of exposure to the meeting with ectoparasites depends on: the animal s health, age, living conditions and diet. Ectoparasites can live on the body of the host permanently, periodically, or be accidental parasites. They live on the surface of the skin of their host, feed on its body fluids or body shells and its products. The most common, as well as annoying for dogs are cats are: ticks, demodex, itch mites, Cheyletiella mites, lice, sucking lice, chewing lice, mosquitoes, moss, flies. Many external parasites are not specific in terms of feeding, and thus may threaten the health of people, roommates in one residential house. 189

190 Due to the rapid spread of ectoparasites on the host s body, it is necessary to quickly help animals attacked by parasitic arthropods. First of all, the animals should be protected against excessive infestation of parasites and against the destruction of the animal body, but also the pathogenic microbes transmitted by ectoparasites should be prevented. A review of the selected ectoparasites attacking domestic dogs and cats Domestic dog (Canis familiaris) The domestic dog is the most common house animal in Polish homes (Kantar Public 2017). The dog has always been an important human companion and helper, mainly used among hunter-gatherers. Most of the breeds has been artificially selected by humans based on their appearance and behaviour. The beginnings of dog domestication are estimated at thousand years ago (Verginelli et al. 2005). Domestic dogs in Poland are attacked by four species of ticks from the Ixodidae family: Ixodes ricinus, Ixodes crenulatus, Ixodes hexagonus, Ixodes rugicollis and one species from the Amblyommidae family: Dermacentor reticulatus. There have also been reported cases of the introduction of the Rhipicephalus sanguineus species to Warsaw, a typical tick species feeding on dogs, which does not occur in the Polish fauna (Szymański 1979). Moreover, other tick species may also attack dogs and cats in Poland: Ixodes persulcatus, Haemaphysalis punctata and Haemaphysalis concinna) (Siuda et al. 2007). Ticks most often choose a place well-supplied with blood for feeding, on the delicate skin, difficult to access for the animal s own hygiene, these are: the area of the snout, behind the ears, on the neckline, neck, on the back and groins, at the base of the tail and around the anus (Siuda 1993). Ixodes ricinus a common tick is the most common and the most encountered tick species in Poland (Fig. 1). This parasite is a vector and carrier of many pathogenic pathogens, including, among others: Borrelia burgdorferi, Borellia garinii, Borrelia afzelli, virus from the Flaviviridae family, Rickettsia slovaca, Rickettsia conorii, Anaplasma phagocytophilum, Babesia spp., Coxiella burnetti, Toxoplasma gondii, Theileria mutans and others (Nowak-Chmura and Siuda 2012, Nowak-Chmura 2013). Ixodes ricinus occurs mainly in moist, shady habitats, along narrow roads, forest paths, tall grass, bushes, even in home gardens, in places where we often go with a dog for a walk, which may result in a tick attack on a host (Siuda 1993). Most often, the tick attacks its hosts in the spring-summer and autumn period. Ixodes hexagonus this tick (Fig. 2) can be found in the close vicinity of the household, in canine kennels (Hillyard 1996, Siuda and Nowak 2011). Its range probably covers all of Poland (Michalik et al. 2010, Kilar 2011, Nowak-Chmura 2013). The main pathogens transmitted by the Ixodes are, among others: tick-borne encephalitis virus, Borrelia burgdorferi, Borrelia garinii, Borrelia afzelii, Rickettsia helvetica, Anaplasma phagocytophilum (Nowak-Chmura 2013). Ixodes rugicollis - another tick species observed on domestic dogs in Poland (Siuda et al. 2010). The natural habitat of I. rugicollis is usually burrows, hideouts of mammals, low humidity habitats (Nowak-Chmura 2013). The medical and veterinary significance of I. rugicollis is not fully studied. Ixodes crenulatus a tick which habitat includes mainly burrows of predatory mammals and rodents. The occurrence of this tick was found at various places in Poland (Siuda 1993, Kadulski 2007, Siuda et al. 2010). The role of this species in the spread of transmission diseases is little known, it is known that it is the carrier of Coxiella burnetii and an important vector of Borrelia burgdorferi s. In habitats where I. ricinus is not found (Estrada-Peña et al. 1995). Dermacentor reticulatus a meadow tick, this species feeds mainly in places of wooded, bushy valleys of rivers, streams, marshy mixed forests (Szymański 1986). This parasite is now expanding its range of occurrence in Central Europe and neighbouring 190

191 countries (Dautel et al. 2006; Nowak 2011; Petney et al. 2012). In Poland, most of the positions of this tick occur in the north, in the north-eastern and eastern areas of the country (Siuda 1993, Bogdaszewska 2004, Kadulski and Izdebska 2009, Nowak-Chmura 2013). This parasite is also of great importance in the transmission of pathogenic pathogens throughout Europe, mainly in the case of Babesia canis protozoan, which is an important etiologic factor of the dog babesiosis disease. This disease can lead to the dysfunction of many organs of the host. In Poland, cases of this disease have also been described (Zygner et al. 2007, 2008, Welc-Falęciak et al. 2009, Mierzejewska et al. 2015). The most common symptoms of tick-borne diseases in domestic dogs are: high fever, drowsiness, lack of appetite, vomiting, apathy, depression, lack of appetite, dyspnoea, enlargement of lymph nodes, spleen, paleness of mucous membranes, diarrhoea (Zygner and Wiśniewski 2006). Demodex canis (Fig. 3). Demodex canis is found in the hair follicles and sebaceous glands, sometimes it can also be observed in the lymph nodes, internal organs and blood. It naturally occurs in small amounts in most dogs (80%) and usually does not cause clinical symptoms. Mites can cause a disease called demodicosis and lead to one of the most troublesome skin problems in pets (Gauguere 1994). The mite infection in domestic dogs can occur through indirect and direct contact with an infected dog. The man is infected very rarely. The most common symptoms of the attack of D. canis is, among others, skin flaking, appearance of purulent pustules coming from hair follicles, increased pigmentation, thinning of the hair, red erythematous spots. Skin lesions appear mainly in the areas of the head, spout, lips, ears, torso, less often in the vicinity of the paws (more often these are front paws); that is, in places where there is a large concentration of hair follicles and sebaceous glands. Severe, generalized demodicosis can lead to the death of an animal (Gauguere 1994). Sarcoptes scabiei var. canis mite psoriasis (Fig. 4) can cause a disease called sarcoptosis (scabies). Scabies mite attacks mammals, including humans, farm animals and domestic dogs, cats. Dogs living in larger clusters, such as shelters, huts, refugees, are often exposed to attacks by S. scabiei, due to the fact that there is a good chance of getting infected with close contact an infected dog. Dogs may collect mites from the immediate environment. Scabies dig tunnels under the skin, their saliva has strong digestive enzymes that dissolve skin tissue. The skin becomes irritated, pimples develop on it, lumps, it thins, the fur becomes brittle. Adult females lay their eggs in subcutaneous tunnels that hatch in a few days. Without access to the host, the scabies mites can survive only for a few days. The main characteristic symptoms of the appearance of S. scabiei on the skin are redness and small baldness in places where the skin is thin, among others, the area of the lips, eyes, ankles and elbows, and on the edge of the earlobes, spreading over the rest of the body to the: elbows, armpits, chest and abdomen of the animal (Klockiewicz 2003). Dogs infected with mites are restless, because of strong itching, they shake their heads, lick the infected parts of the body, scratch their heads, ears, rub against objects (trees, furniture, etc.). The untreated disease causes the damage of the organism and may lead to the death of the animal (Klockiewicz 2003). Cheyletiella yasguri mites (Fig. 5) causing a skin disease called cheyletiellosis, often also referred to as walking dandruff. This name comes from fast-moving mites in search of food in flaky epidermis, which they move, thereby setting it in motion. C. yasguri lives on the surface of the skin and nourishes with keratin, peeled epidermis, hair, skin secretions. Periodically, they can attach to the skin of the host, piercing it with the mandibles and sucking out exudates coming out of the micro-damage to the skin (Bronswijk and Kreek 1976). Mites are closely related to their host and they often die in a free environment outside of his body. They can also move between different species of animals (mainly rabbits, cats), including humans. The infection is usually direct when in contact with another infected 191

192 animal, mainly through: rubbing, licking fur, sleeping together, playing. C. yasguri can be found on fleas, lice, flies, which allows these mites to spread to potential hosts. The risk of infection with these mites is greater in large dog clusters, among young, sick, weakened, undernourished animals. Pruritus and dandruff are the most common symptom of invasion. Sick animals are restless, scratching, licking, rubbing against various objects which leads to skin eruptions, skin damage, numerous wounds, thinning of hair, and a strong seborrhoea. The constantly exfoliating epidermis makes the animals look like they have been sprinkled with flour. Dandruff is located along the entire body of the animal. In the advanced stage of infestation with these mites, there is a decrease in body weight, apathy, fever and systemic complications (Saevik et al. 2004). Linognathus setosus dog lice (Fig. 7) is the cause of the disease called lice. The area of lice existence is the scalp, ears, back and the areas of the tail base, in the case of strong infestation it spreads to the entire body. Lice eggs, called nits, are fixed by a female with the so-called cement, at the base of the hair, which with a larger number of effs is noticeable. L. setosus is a parasite that isn t too mobile, is practically immobile (Sadzikowski and Gundłach 2004). The dog lice often attack weakened, old, exhausted and undernourished animals. The attacked animals feel anxious, have pruritus, scratch too often, which leads to intensive licking, rubbing, biting in the affected areas. The coat becomes rough, the skin is usually red, which can lead to dermatitis. Excess lice infestation can lead to anaemia (Blagburn et al. 1981). Lice are transferred from one host to another through direct contact with an infected dog, e.g. in animal shelters, in parks, i.e. places where there are a lot of dogs. It is impossible to meet them living freely in the environment, because they are not adapted to a life without a host, which distinguishes them, for example, from fleas and ticks. Trichodectes canis dog lice (Fig. 8) occurs throughout the host s body, in hairy areas, mainly on the neck and head (Stefański 1968). It causes a disease called lice. T. canis is a vector for Dipylidium caninum. It is not a serious problem for the host, but in severe infections it can be very irritating. It attacks sick, neglected dogs by direct contact. It feeds mainly on the liquids produced by the irritated skin. It causes stress in the host, which creates wounds on the surface of the skin, which leads to bacterial infections and as a result of excessive scratching, biting the fur, hair loss also occurs (Sadzikowski and Gundłach 2004). Ctenocephalides canis dog flea (Fig. 6), its main hosts are usually animals from the Canidae family, such as, e.g. domestic dog, fox (Vulpes vulpes), grey wolf (Canis lupus). It can also parasite on men, cats and other mammals (Sandner 1976). This cosmopolitan insect is present in a variety of environmental conditions, thanks to the ability of jumping, it spreads quickly to other hosts. Female dog fleas usually lay eggs in close proximity to the host, e.g. in the animal s den, and in the neglected, sick dogs, the eggs can be laid directly on the skin. This insect can carry germs of plague, endemic dura, and is an intermediate host of tapeworm (Dipylidium caninum) and a vector of nematode larvae of Dirofilaria immitis (Stefański 1968). The flea infestation, otherwise known as dog Ctencocephalides, causes anxiety in dogs, itching, which causes frequent scratching and rubbing of dogs on various objects, which in turn leads to the formation of secondary skin changes around the head, neck and around the tail (Stefański 1968). The dog s skin becomes red, skin inflammation often occurs, the dog may also lose hair. C. canis can cause allergic dermatitis in dogs that are allergic to the saliva of these insects. This ectoparasite, sucking out large amounts of blood in young, older, sick individuals can lead the animal to anaemia (Patyk 1978). Domestic at (Felis catus) The domestic cat was second in Poland s most-owned domestic animals (Kantar Public 2017). A mammal species from the Felidae family domesticated about 9,5 thousand years ago. Over the past several thousand years, many domestic cat breeds have been bred, with many 192

193 different features. Cats used to help and still help people to exterminate mice and rats, and additionally, they were also taken on hunts to scare off the game (Lasota-Moskalewska 2005). Domestic cats, like domestic dogs, are attacked mainly by four species of ticks: Ixodes ricinus, Ixodes crenulatus, Ixodes hexagonus and Ixodes rugicollis (Siuda et al. 2007, Kocoń et al. 2017), which have been described above in domestic dogs. Demodex cati cat demodex (Fir. 9), as in the case of Demodex canis, it can occur in most healthy cats as a natural flora. Invasion of the cat demodex causes changes that are mainly located on: the head, neck, eyelids, causing thinning of hair and baldness, seborrhoea, formation of papules, epidermal pustules, which in turn leads to dermatitis (Dembele 2000). Otodectes cynotis ear mite (Fig. 10) is mainly found in the external auditory canal of domestic cats, less often in dogs. In strong infestation, other areas of the body may be attacked: the neck, back, loins, tail. Young kittens get sick more often and the infection takes place through direct contact. The first symptom of O. cynotis feeding is a significant amount of dark brown, waxy, dry secretion in the cat s earlobe. In the advanced stage of the disease, the accumulated mucus clogs the ear canal, which leads to the fact that the cat stops hearing. Other characteristic symptoms of scabies are strong pruritus, during which the cat whisks its head, scratches its ears an tilts its head. There may also be local allergic reactions, local inflammation. Constant itching forces the animal to constantly scratch and additional irritation of the infected areas, which leads to spreading of parasites to other areas of the body. Skin lesions resulting from pruritus may take the form of local baldness and strongly itching popular efflorescence (Bowman 2012). Notoedres cati cat scabies (Fig. 11), an infection may take place by direct or indirect contact with an infected animal. The structure and behaviour resemble the Sarcoptes scabiei mites. It usually parasites on the head, ears, over time spreading to the neck, back and other parts of the body. The wrinkled skin, skin with scabs, loss of hair are the effect of mites feeding. The symptoms of the invasion, as in the case of other mites, include intensive pruritus, continuous scratching and licking of the infected parts of the body (Kotomski 2000). Cheyletiella blakei domestic cat mites (Fig. 12) is a parasite similar to C. yasguri, attacking domestic dogs, it has the same skin symptoms. Both mite species are not strictly specific to typical hosts. Excessive flaking of the skin is the only clinical symptom of infestation, which may disturb the owners. Some animals may develop pruritus with varying degrees of severity (Fagasiński 2000). Felicola subrostratus a chewing lice, found all over the body, in the hair (Fig. 14). It parasites on older or sick cats, it especially prefers long-haired breeds. In the case of an invasion, the cat is restless, scratches and bites the place where it feels itching on the skin, it rubs itself. A longer invasion time and an increased number of chewing lice cause redness of the skin, scratches on the skin, loss of animal fur (Kotomski 2000). Ctenocephalides felis a cat flea (Fig. 13), the symptoms of flea infestation among cats are the same as for C. canis dog lice in domestic dogs, i.e., it is: strong pruritus causing frequent scratching, rubbing against various objects, which leads to the occurrence of skin lesions. The following body areas are attacked most often: the head, neck and tail area. The animal s skin gets bald and becomes red (Furmaga 1985). Summary External parasites attacking domestic dogs and cats are of great veterinary and medical importance (Tab. 1). They are the vectors of causal pathogens, but most of all they cause a lot of negative interactions that occur during infestation of the hosts: severe pruritus, baldness, skin lesions, secondary bacterial infections, fungal infections, dermatitis and others. Caring for the health of our animals, we also take care of our health because animals infected with ectoparasites may be a source of invasion for their owners or other animals living in the same or neighbouring area, which can be a huge problem. Recreation areas for children 193

194 that require special care are also at risk. People may be infected with animal parasites regardless of their age, however, children are the most vulnerable to contact with them due to the lack of proper hygiene habits and immature defence system. In children, there may be more frequent cases of parasites and a more severe course of animal diseases than in the case of adults. Frequent travels of people with their pets probably have a large impact on the existing epizootic situation of many external parasites and causative pathogens transmitted by them. The spread of ectoparasites to new areas may be of great veterinary importance. This situation may lead to a higher frequency of rare or new parasitic diseases. The struggle with external parasites may be difficult and long-lasting, therefore, prevention against the attacks of skin ectoparasites should be applied. There are a lot of preparations available on the veterinary and zoological market for the prevention of ectoparasite attacks, they are various types of preparations in the form of drops, collars, sprays, pills for dogs and cats. Dosage is determined with a veterinarian. Parasites should also be removed from places where animals are staying, sleeping, playing, for example, in kennels, dens, cots, blankets and residential houses. Table 1. Ectoparasits of pet animals Species of the parasite Host Parasitic disease / carrier (vector) of diseases Ixodes ricinus Canis familiaris, Felis catus wektor Ixodes hexagonus Canis familiaris, Felis catus wektor Ixodes rugicollis Canis familiaris, Felis catus wektor Ixodes crenulatus Canis familiaris, Felis catus wektor Dermacentor reticulatus Canis familiaris, Felis catus wektor Demodex canis Canis familiaris demodekoza Sarcoptes scabiei var. canis Canis familiaris sarkoptoza Cheyletiella yasguri Canis familiaris chejletielloza Ctenocephalides canis Canis familiaris ktenocefalidoza/wektor Linognathus setosus Canis familiaris wszawica Trichodectes canis Canis familiaris, Felis catus wszołowica Demodex cati Felis catus demodekoza Otodectes cynotis Felis catus, Canis familiaris otodektoza Notoedres cati Felis catus sarkoptoza Cheyletiella blakei Felis catus chejletielloza Ctenocephalides felis Felis catus ktenocefalidoza Felicola subrostratus Felis catus wszołowica Source: own study 194

195 List of figures Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9 Fig. 10 Fig. 11 Fig. 12 Fig. 13 Fig. 14 Fig. 1. Najedzona samica Ixodes ricinus (Fot. Ze zbiorów Zakładu Zoologii Bezkręgowców i Parazytologii) 195

196 Fig. 2. Samica Ixodes hexagonus Fot. Ze zbiorów Zakładu Zoologii Bezkręgowców i Parazytologii) Fig. 3. Demodex canis Fig. 4. Sarcoptes scabiei var canis Fig. 5. Cheyletiella yasguri Fig. 6. Ctenocephalides canis Fig. 7. Linognathus setosus Fig. 8. Trichodectes canis Fig. 9. Demodex cati Fig. 10. Otodectes cynotis Fig. 11. Notoedres cati Fig. 12. Cheyletiella blakei Fig. 13. Ctenocephalides felis Fig. 14. Felicola subrostratus References 1. Blagburn B. L., Todd K. S., Herman G. A Pediculosis (Linognathus setosus) in a dog. Mod. Vet. Pract. 62(7): Bogdaszewska Z Występowanie i ekologia kleszcza łąkowego Dermacentor reticulatus (Fabricius, 1794) w ognisku mazurskim. I. Określenie obecnego zasięgu występowania. Wiad. Parazytol. 50(4): Bowman D. D Parazytologia weterynaryjna. Georgis. Wrocław, Elsevier Urban & Partner. 4. Bronswijk J. E. M. H., Kreek E. J Cheyletiella (Acari: Chryletiellidae) of dog and cat and domesticated rabbit, a review. J. Med. Entomol. 13(3): Dautel H., Dippel C., Oehme R., Hartelt K., Schettler E Evidence for an increased geographical distribution of Dermacentor reticulatus in Germany and detection of Rickettsia sp., RpA4. Int. J. Med. Microbiol. 296: Dembele K Nużyca psów i kotów (Demodicosis). Mag. Wet. 9: Estrada -Peña A., Oteo J., Estrada-Peña R., Cortazar C., Osacar J., Moreno J., Castella J Borrelia burgdorferi sensu lato in ticks (Acari: Ixodidae) from 2 different foci in Spain. Exp. Appl. Acarol. 19(3): Fagasińki A Cheyletielloza u psów i kotów. Mag. Wet. 9: Furmaga S Choroby pasożytnicze zwierząt domowych. Warszawa, Państwowe Wydawnictwo Rolnicze i Leśne. 10. Gauguere E Główne ektoparazytozy psów i kotów. Mag. Wet Hillyard P.D Ticks of North-West Europe. The Linnean Society of London and The Estuarine and Coastal Sciences Assocation by Field Studies Council. London, The Natural History Museum. 12. Kadulski S Pasożyty zewnętrzne lisa (Vulpes vulpes L.) na Pomorzu Gdańskim. Wiad. Parazytol. 53 (supl.): Kadulski S., Izdebska J.N New data on distribution of Dermacentor reticulatus (Fabricius, 1794) (Acari: Ixodidae) in Poland. In: A. Buczek, C. Błaszak (eds.), Stawonogi. Inwazje i ich ograniczenia. Lublin, Wydawnictwo Akapit:

197 14. Kilar P Ticks attacking domestic dogs in the area of the Rymanów district, Subcarpathian province, Poland. Wiad. Parazytol. 57(3): Klockiewicz M Inwazje pasożytniczych roztoczy u kotow i psów. Mag. Wet. 5: Kocoń A., Nowak-Chmura M., Kłyś M., Siuda K Ticks (Acari: Ixodida) attacking domestic cats (Felis catus L.) in southern Poland. In: A. Buczek, C. Błaszak (eds.), Stawonogi: w środowisku miejskim i podmiejskim. Lublin, Koliber: Kotomski G Przegląd chorób pasożytniczych kotów wywoływanych przez stawonogi. Mag. Wet Lasota-Moskalewska A Zwierzęta udomowione w dziejach ludzkości. Warszawa, Wydawnictwo UW: Michalik J., Sikora B., Górecki G., Wierzbicka A., Wodecka A Fall-winter infestation of red foxes (Vulpes vulpes) with ixodid ticks in west-central Poland. In: A. Buczek, C. Błaszak (eds.), Stawonogi. Ekologiczne i patologiczne aspekty układu pasożyt-żywiciel. Lublin, Wydawnictwo Akapit: Mierzejewska E.J., Pawełczyk A., Radkowski M., Welc-Falęciak R., Bajer A. Pathogens vectored by the tick, Dermacentor reticulatus, in endemic regions and zones of expansion in Poland. Parasit. Vectors. 8: Nowak M Discovery of Dermacentor reticulatus (Fabricius, 1794) (Acari: Amblyommidae) standings in the Lubuskie Province (Western Poland). Exp. Appl. Acarol. 54: Nowak-Chmura M., Siuda K Ticks of Poland. Review of contemporary issues and latest research. Ann. Parasitol. 58(3): Nowak-Chmura M Fauna kleszczy (Ixodida) Europy Środkowej. Kraków, Wydawnictwo Naukowe Uniwersytetu Pedagogicznego. 24. Patyk S Choroby inwazyjne zwierząt domowych. Warszawa, Państwowe Wydawnictwo Rolnicze i Leśne. 25. Petney T.N., Pfäffle M.P., Skuballa J.D An annotated checklist of the ticks (Acari: Ixodida) of Germany. Syst. Appl. Acarol. 17(2): Sadzikowski A. B., Gundłach J. L Parazytologia i parazytozy zwierząt. Warszawa, Państwowe Wydawnictwo Rolnicze i Leśne. 27. Saevik B. K., Bredal W., Ulstein T. L Cheyletiella infestation in the dog: observations on diagnostic methods and clinical signs. J. Small Anim. Pract. 45(10): Sandner H Owady. Warszawa, Państwowe Wydawnictwo Naukowe. 29. Siuda K Kleszcze Polski (Acari: Ixodida). Część II. Systematyka i rozmieszczenie. Warszawa, Polskie Towarzystwo Parazytologiczne. 30. Siuda K., Nowak M., Gierczak M., Wierzbowska I., Faber M Kleszcze (Acari: Ixodida) pasożytujące na psach i kotach domowych w Polsce. Wiad. Parazytol. 53 (supl.): Siuda K., Nowak M., Gierczak M Confirmation of occurence of Ixodes (Pholeoixodes) rugicollis Schulze et Schlotke, 1929 (Acari: Ixodidae) in Poland, including the morphological description and diagnostics features of this species. Wiad. Parazytol. 56: Siuda K., Nowak-Chmura M Fauna of ticks (Ixodida) in the Beskid Wyspowy. In: A. Buczek., C. Błaszak (eds.), Stawonogi. Pasożyty człowieka i zwierząt. Lublin: Wydawnictwo Akapit: Stefański W Parazytologia weterynaryjna II. Warszawa, Państwowe Wydawnictwo Rolnicze i Leśne. 34. Szymański S Przypadek masowego rozwoju kleszcza Rhipicephalus sanguineus (Latreille, 1806) w warszawskim mieszkaniu. Wiad. Parazytol. 25: Szymański S Distribution of the tick Dermacentor reticulatus (Fabricius, 1794) (Ixodidae) in Poland. Acta Parasitol. 31: Zygner W., Wiśniewski M Choroby przenoszone przez kleszcze zagrażające psom w Polsce. Wiad. Parazytol. 52(2):

198 37. Zygner W., Gójska O., Rapacka G., Jaros D., Wędrychowicz H Hematological changes during the course of canine babesiosis caused by large Babesia in domestic dogs in Warsaw (Poland). Vet. Parasitol. 145,: Zygner W., Jaros S., Wędrychowicz H Prevalence of Babesia canis, Borrelia afzelli and Anaplasma phagocytophilum infection in hard ticks removed from dogs in Warsaw (central Poland). Vet. Parasitol. 153: Welc-Falęciak R., Rodo A., Siński E., Bajer A Babesia canis and other tickborne infections in dogs in Central Poland. Vet. Parasitol. 166: Verginelli F., Capelli C., Coia V., Musiani M., Falchetti M., Palmirotta R., Tagliacozzo A., De Grosii Mazzorin I., Mariani-Costantini R Mitochondrial DNA from Prehistoric Canids Highlights Relationships Between Dogs and South-East European Wolves. Mol. Biol. Evol. 22(12): a-17.pdf 198

199 Mite fauna (Parasitiformes: Gamasida) associated with nests of selected species of native bumblebees (Hymenoptera: Apidae: Bombus spp.) Elżbieta Rożej-Pabijan 1, Wojciech Witaliński 2, Waldemar Celary 3 1Institute of Biology, Pedagogical University, Podchorążych 2, Kraków, elarozej@vp.pl 2Institute of Zoology and Biomedical Research, Jagiellonian University, Department of Comparative Anatomy, Gronostajowa 9, Kraków 3 Institute of Biology, Jan Kochanowski University of Kielce, ul. Świętokrzyska 15, Kielce, Poland Abstract: Bumblebee nests are annual microhabitats that can be attractive for various microarthropods including mites. Bumblebee nests ensure a stable microclimate, food and possibility to spread to new habitat with adult bumblebees. The fauna of Gamasida mites inhabiting wild bumblebee nests is almost unknown - mite species associated with wild bumblebees have been described only based on phoretic forms collected from foraging individuals. This study was conducted on three bumblebee nests of three different bumblebee species: Bombus hortorum (Linnaeus, 1761), Bombus ruderarius (Müller, 1776) and Bombus pascuorum (Scopoli, 1763). The mite species composition and abundance were determined from a total of 355 mites. Nine mite species from four families were found in bumblebee nests. The predominant mite species was Leiodinychus orbicularis (C.L. Koch, 1839) (Tremauridae). The second most numerous was Dinychus woelkei Hirschmann & Zirngiebl-Nicol, 1969 (Dinychidae). Representatives of families Laelapidae and Parasitidae were least numerous. Most of the identified mite species were at the deutonymphal developmental stage. Key words: Social insect nests; Microhabitats; Bumblebee; Commensal species; Acari, Gamasid mites. Introduction The most important groups of pollinators in the temperate climatic zone of Europe are wild bees (Apoidea), hoverflies (Syrphidae) and butterflies (Lepidoptera) (Kevan 1999). Due to the close relationship between bees and flowering plants, wild bees are considered one of the most valuable pollinators (Potts et al. 2006, Celary 2007, Inouye 2007). Strong food specialization and specific requirements for nesting sites mean that the disappearance of some plants or habitats causes the extinction of bee species (Perez-Barrales et al. 2007). Bumblebees are major pollinators of crops and wildflowers in northern temperate regions. They are efficient pollinators - one individual visits twice as many flowers per minute as a honey bee (Corbet 1993, Dag and Kammer 2001). Body size and the dense body hair of bumblebees enables them to work at lower temperatures as well as under infavorable weather conditions, and their working day is 2-3 hours longer than honey bees (Corbet 1993, Willmer et al. 1994). An additional advantage of bumblebees as pollinators is the fact that they have long tongues and effectively pollinate plants with long tubular flowers (Dylewska 1996, Goulson 2003). Therefore knowledge of bumblebee ecology, parasites and commensals is vital for effective planning of conservation strategies in semi natural and agricultural landscape as well as understanding threats in managed colonies. 199

200 Bumblebees live in annual colonies that are founded by single queens (Dylewska 1996, Goulson 2003). The queen emerges from hibernation in spring and feeds on pollen and nectar until her ovaries develop. She finds a suitable nesting site either underground (e.g. B. lucorum and B. terrestris), or within grass, moss or other dense vegetation on or just above the surface of the ground (subgenus Thoracobombus). All species build nests from dry grass, moss or feathers (Goulson 2003). The queen supplies the nest with pollen and nectar, and lays her first eggs (Banaszak 1993). The queen stays in the nest after the first workers hatch. She produces several broods of workers that forage and care for the brood. In established nests the temperature is remarkably stable at around 30 +/-1 (Goulson 2003). Temperature fluctuations are greater during early stages of colony development, with variation by no more than 2,5 once many workers are present (Goulson 2003). At the end of summer the colonies produce males and young queens. Sexual forms leave the nest and mate. The young inseminated queens overwinter singly in the soil. The old nest-foundress, her workers and the males die before winter. Thus, during the existence of an annual bumblebee family, the bumblebee nest is a microhabitat with specific conditions that are appropriate for many microarthropods, including mites. Bumblebee nests are colonized by several mite species (Eickwort 1994). Some live in the soil and incidentally invade the nests from the surrounding environment, but many are specialists that rely on the provisions in the nest. These specialists spend their whole life-cycle associated with bumblebees. They reproduce inside the nest and have specialized phoretic instars that attach to adult bumblebees for transport. When the colony declines in autumn, the phoretic instars attach to the young queens and accompany them to their hibernation sites (Schwarz and Huck 1997). Four to six mite species may be found on an overwintered queen, and more than 20 individuals of some species may be present (Schwarz et al. 1996). The aim of this study was to detect mite species associated with bumblebee nests. We investigated three nests of three different bumblebee species (B. hortorum, B. ruderarius, B. pascuorum). Mite species composition and abundance were assessed. Materials and Methods Three nests of three different bumblebee species were studied. They were collected in eastern and southern Poland in autumn (September October) of , at the stage of nest degradation, with few adult bumblebees inside. We obtained nests of the following bumblebee species: the garden bumblebee Bombus hortorum (Linnaeus, 1761), the common carder bee Bombus pascuorum (Scopoli, 1763) and the red-shanked bumblebee Bombus ruderarius (Müller, 1776). These are common species present in most of Europe in a wide variety of habitats such as meadows, pastures, wasteland, road edges, and field margins, as well as gardens and forest edges. The Bombus hortorum nest was collected from compost in a private garden in Puławy (Eastern Poland). The Bombus ruderarius nest was obtained from Wisla lewee system close to Puławy. The Bombus pascuorum nest was collected from meadow and forest border close to Sułkowice (Southern Poland). Adult bumblebees were caught and set free in the field. Nests were removed and placed on Tullgren funnels for 1 week (Walter and Krantz 2009) in order to extract mites from the nest material. This extracted material was preserved in 75% alcohol and examined in the laboratory for mite presence and species composition. All mites extracted from the nests were segregated under stereomicroscope. Gamasid mites were mounted in Hoyer s medium (Krantz 1978) on microscope slides, then counted and identified using an Olympus BX51 microscope and standard references (Micherdziński 1969; Hughes 1976; Hyatt 1980; Karg 1993, Kontschán et al. 2016). Representatives of Trematuridae and Dinychidae families were consulted for identification with prof. Jerzy Błoszyk from Department of General Zoology, Adam Mickiewicz University, Poznań. 200

201 Results In nests of three native bumblebee species we found 355 individuals belonging to Gamasida, representing nine mite species from four families: Trematuridae: Leiodinychus orbicularis (C.L. Koch, 1839); Dinychidae: Dinychus woelkei Hirschmann & Zirngiebl-Nicol, 1969; Laelapidae: Pneumolaelaps (=Hypoaspis) marginepilosa (Sellnick, 1938), Pneumolaelaps (=Hypoaspis) hyatti (Evans and Till, 1966), Pneumolaelaps (=Hypoaspis) bombicolens (Canestrini, 1884); Parasitidae: Parasitellus fucorum (De Geer, 1778), Parasitellus ignotus (Vitzthum, 1930), Parasitellus crinitus (Oudemans, 1903), Parasitellus talparum (Oudemans, 1913). The most numerous species in studied material was Leiodinychus orbicularis 195 individuals (55% of the examined material), Dinychus woelkei 65 individuals (18%) and Pneumolaelaps hyatti - 53 indoviduals (15%). Species present in the nests of all three bumblebee species were representatives of two families: Trematuridae Leiodinychus orbicularis and Dinychidae Dinychus woelkei. The least numerous were representatives of Laelapidae and Parasitidae families, 87 and 8 individuals, respectively. The most abundant developmental stage detected in bumble nests were deutonymphs 230 individuals, then females 100, and males 25. The mite species composition varied between nests of different bumblebee species. Two nests Bombus hortorum and Bombus ruderarius, contained representatives of six mite species, while in the Bombus pascuorum nest only two mite species were detected. Most numerous in mite individuals was the Bombus hortorum nest 223 (63%; Table 1), second was the Bombus ruderarius nest 88 (25%; Table 2), and the least numerous both in mite individuals and species was the Bombus pascuorum nest 44 (12%; Table 3). Discussion This study documented the occurrence and species composition of mites associated with nests of three common European bumblebees. The tested material contained nine mite species not all were already known from bumblebees and their nests. However the mite species detected in the studied nests are common and widely distributed throughout Europe. We detected gamasid mites, but did not find any strictly parasitic mite species such as the tracheal mite, Locustacarus buchneri (Stammer) (Prostigmata: Podapolipidae), that lives within the tracheae of adult bees (Husband and Sinha, 1970) and finding it in the nest material would be rather accidental, as they leave the nest with its host. The nest of B. hortorum was found in compost in a private garden in Puławy (Eastern Poland). B. hortorum are commonly found in grassland environments with abundant flowers that they can feed on (Goulson et al. 2011). Bombus hortorum queens most frequently build their nest underground along forest and field boundaries and in open uncultivated fields (Svensson et al 2000). They need moss and dried grass in order to successfully build the nest. Thus, they prefer sunlit grassland habitats to ensure secure and warm nests beneath the ground (Carvell 2002). This species, together with B. pratorum, is known to build nests in unusual places ( The nest of B. hortorum collected for this study from compost can surely be considered unusual. As compost is organic matter with high humidity and rich in nutrients, it s appropriate for fungivorous mites, that were most numerous in the studied nest. In the sample two dominant species were detected Leiodinychus orbicularis and Dinychus woelkei with the former predominating, reaching 71% with 58% of deutonymphs. The Bombus ruderarius nest was collected from the Wisla lewee system close to Puławy (Eastern Poland). The nests of this species are usually constructed of grass or moss, on or slightly below ground, and typically contain 50 to 100 workers (Benton 2006). Often, old mouse nests in open grassland are used. The species can also appear in urban areas with gardens and wasteland ( nest sample is second in terms of number of mite individuals, however 88 individuals from B. ruderarius nest makes up only 39% of mite number found in the B. hortorum nest. What is worth mentioning the sample from the B. ruderarius nest is equally rich in species with a similar composition, excluding Pneumolaelaps hyatti. P. 201

202 hyatti is also the most numerous among mite species in the B. ruderarius nest. Pneumolaelaps bombicolens was present only in the B. hortorum nest but not in the B. ruderarius nest. In both nests two species of Parasitellus were detected, however in the nest of B. ruderarius we found P. talparum and P. fucorum, while in B. hortorum nest we found P. ignotus and P. crinitus. L. orbicularis and D. woelkei that dominated in the sample from compost were the least numerous in the sample from B. ruderarius. The dominant mite species was Pneumolaelaps hyatti that accounted for 60% of mite number in the B. ruderarius nest sample. The Bombus pascuorum nest was collected from Sułkowice (southern Poland) from a decaying wooden nest box laying on the ground, where bumblebees set their colony. The nest was situated in the forest edge. Suitable places to nest for this species are forest edges, cavities such as holes in the ground or niches in dead wood and grass. This bumblebee species is associated with forests and scrubs (Krzysztofiak et al. 2004). The nest can be constructed above or underground, preferably in old mouse nests, but also in bird nests, barns, and sheds. The sample from this locality contained in total 44 mite individuals belonging only to two species L. orbicularis and D. woelkei. However, no phoretic species (Pneumolaelaps spp., Parasitellus spp.) were found. The detected mites can be divided into two ecological groups: soil-dwellers and commensals. Among soil dwellers there are two species: Leiodinychus orbicularis and Dinychus woelkei. They are rather weakly associated with bumblebees and use their nest as alternative to soil or litter environment. Commensal species are the ones that live in the bumblebee nest and feed on pollen, nest debris, and microfauna (Schmid-Hempel 1998). These mites have phoretic life stages that are attached on the exterior of the bees (Schwarz et al. 1996) therefore they are much better associated with bumblebees. The commensal group includes seven mite species: Pneumolaelaps marginepilosa, Pneumolaelaps hyatti, Pneumolaelaps bombicolens and Parasitellus fucorum, Parasitellus talparum, Parasitellus ignotus, Parasitellus crinitus. Both species from the ecological group of soil-dwellers live directly in the soil or in decaying wood and nests of birds. Mite species inhabiting decaying wood benefit from this habitat, because it is rich in fungi, nonvascular plants (lichens, algae and mosses) and many groups of animals, even such as cavity-nesting birds, small mammals, insects and other invertebrates (Pyle and Brown 2002). Moreover, small fungivorous mites, for instance by transporting fungal spores and feeding on hyphae, may make an indirect contribution to wood decay (Gwiazdowicz et al. 2011). The soil-dwelling mites were most frequent in two studied bumblebee nests from humid places. The nest of B. hortorum from compost contained the most representatives of L. orbicularis and D. woelkei in this sample both species reached a total of 211 individuals. The second most numerous in representatives of L. orbicularis and D. woelkei was the nest of B. pascuorum located in a decaying wooden nest box laying on the ground. This sample contained 44 representatives of both species. Leiodinychus orbicularis was recorded from the nests of other animals, especially birds. It was recorded from nests of such species as: the Eurasian griffon vulture (Gyps fulvus Hablizl, 1783) in Croatia (Błoszyk et al. 2011), western marsh-harrier Circus aeruginosus (L., 1758), pied flycatcher Ficedula hypoleuca (Pallas, 1764), great tit Parus major L., 1758 and the common redstart Phoenicurus phoenicurus (L., 1758), Ciconia ciconia (L., 1758) and black stork Ciconia nigra (L., 1758) (Błoszyk and Gwiazdowicz 2006). Since now it was recorded at high rates from perennial nests of birds of prey and other bird species, however, our study showed for the first time that L. orbicularis also occurs in annual nests of bumblebees. Data presented in another study showed that L. orbicularis is a common species in microhabitats including dead wood, tree holes, mammal nests, bird nests and ant nests (Napierała and Błoszyk 2013). Dinychus woelkei is a dead wood indicator. D. woelkei is especially frequent in coarse woody debris (CWD), and according to studies performed in Finland is considered to be CWD specialist in aspen wood (Huhta et al. 2012). This species was recorded in a study by Napierała and Błoszyk (2013) in decaying wood, tree holes and ant hills. 202

203 Second in abundance in the studied nests were representatives of the family Laelapidae (three species: Pneumolaelaps marginepilosa, P. bombicolens and P. hyatti). These species are associated to a various degree with other animals, both vertebrates and invertebrates (Mašán and Stanko 2005; Berghoff et al. 2009; Faraji and Halliday 2009). They have been previously recorded from wild bumblebee nests (Bregetova 1977) and rodent nests and are commonly found in Europe as predators feeding on smaller arthropods. Phoretic forms of P. marginepilosa were observed by Chmielewski and Baker (2008) on foraging wild bumblebees in central Poland. They are associated with bees mainly because of transportation, but probably they also profit from living in their nests, feeding on honey and surface lipids of pollen provisions (Royce and Krantz 1989). The least numerous in representatives was the family Parasitidae (genus Parasitellus). Generally, representatives of Parasitidae can be found in moss, forest litter and grassland humus, decaying organic substrates and the nests of small mammals and insects (Micherdziński 1969; Hyatt 1980; Karg 1993; Mašán and Stanko 2005; Lindquist et al. 2009). All species of Parasitellus are obligatory associates of bumblebees in the Holarctic region, incidentally recorded from other insects, mammalian nests or nests of birds (Hyatt 1980). Under natural conditions, P. fucorum deutonymphs overwinter on young bumblebee queens. Adult females and deutonymphs feed mainly on pollen, wax, and nectar (Schmid-Hempel 1998; Koulianos and Schwarz 1999). Protonymphs are oophagous and predatory and in bumblebee nests they can decrease the abundance of other arthropods harmful for their host. Acknowledgments We wish to thank prof. J. Błoszyk (Dept. of General Zoology, Institute of Experimental Biology, Adam Mickiewicz University, Poznań) for verifying identification of Trematuridae and Dinychidae species. Table1. Mite species detected in Bombus hortorum nest Species N F M DN Leiodinychus orbicularis (C.L. Koch, 1839) Dinychus woelkei Hirschmann & Zirngiebl- Nicol, 1969 Pneumolaelaps marginepilosa (Sellnick, 1938) Pneumolaelaps bombicolens (Canestrini, 1884) Parasitellus ignotus (Vitzthum, 1930) Parasitellus crinitus (Oudemans, 1903) Explanations: N total, F females, M males, DN deutonymphs Table2. Mite species detected in Bombus ruderarius nest Species N F M DN 203

204 Pneumolaelaps hyatti (Evans and Till, 1966) Pneumolaelaps marginepilosa (Sellnick, 1938) Leiodinychus orbicularis (C.L. Koch, 1839) Parasitellus fucorum (De Geer, 1778) Parasitellus (Oudemans, 1913) talparum Dinychus woelkei Hirschmann & Zirngiebl- Nicol, 1969 Explanations: N total, F females, M males, DN deutonymphs Table3. Mite species detected in Bombus pascuorum nest Species N F M DN Leiodinychus orbicularis (C.L. Koch, 1839) Dinychus woelkei Hirschmann & Zirngiebl- Nicol, Explanations: N total, F females, M males, DN deutonymphs References 1. Banaszak J Trzmiele Polski. Wydawnictwo Uczelniane Wyższej Szkoły Pedagogicznej w Bydgoszczy. 2. Benton T Chapter 9: The British Species. In: Bumblebees. London, UK: Harper Collins Publishers. pp ISBN Berghoff S.M. Wurst E. Ebermann E. Sedova-Franks A.B. Rettenmeyer C.W., Franks N.R Symbionts of societies that fission: mites as guests or parasites of army ants. Ecol Entomol 34: Błoszyk J. Tvrtko D. Gwiazdowicz D.J. Halliday B. Bart_lomiej Gołdyn B. Agnieszka Napierała A. Rybska E Biologia 66/2: , Section Zoology 5. Błoszyk J. Gwiazdowicz D.J Acarofauna of nests of the White Stork Ciconia ciconia, with special attention to mesostigmatid mites, pp In: Tryjanowski P. Sparks T.H. and Jerzak L. (eds), The White Stork in Poland: Studies in Biology, Ecology and Conservation, Bogucki Wydawnictwo Naukowe, Poznań. 6. Bregetova N.G Family Laelaptidae. In: Giliarov MS (ed) Guide to soil-living mites Mesostigmata. Nauka, Leningrad, pp (in Russian). 204

205 7. Carvell C Habitat use and conservation of bumblebees (Bombus spp.) under different grassland management regimes. Biological Conservation. 103 (1): Celary W Sto lat dla pszczół. Akademia 1: Chmielewski W, Baker RA (2008) Mites (Acarina) phoretic on some common bumblebee species (Bombus spp.) from the Puławy area (South-Eastern Poland). J Apic Sci 52: Corbet S.A Temperature and the pollinating activity of social bees. Ecological Entomology 18: Dag A., Kammer Y Comparison between the effectiveness of honey bee (Apis mellifera) and bumble bee (Bombus terrestris) as pollinators of greenhouse sweet pepper (Capsicum annum). American Bee Journal 141: Dylewska M Nasze trzmiele. Ośrodek Doradztwa Rolniczego, APW Karniowice. 13. Eickwort GC (1994) Evolution and life-history patterns of mites associated with bees. In: Houck MA (ed) Mites: ecological and evolutionary analyses of life-history patterns. Chapman and Hall, New York, pp Faraji F. Halliday B Five new species of mites (Acari: Laelapidae) associated with large Australian cockroaches (Blattodea: Blaberidae). Int J Acarol 35: Goulson D Bumblebees; their behaviour and ecology. Oxford University Press, Oxford 16. Gwiazdowicz, D.J., Kamczyc, J. Rakowski, R Mesostigmatid mites in four classes of wood decay. Exp Appl Acarol 55: Huhta V. Siira-Pietikäinen A. Penttinen R Importance of dead wood for soil mite (Acarina) communities in boreal old-growth forests. Soil organisms Vol. 84 (3) pp Hughes A.M The Mites of Stored Food and Houses. 2nd ed. Ministry of Agriculture, Fisheries and Food, Technical Bulletin 9. Her Majesty's Stationery Office, London. 19. Hyatt K.H Mites of the subfamily Parasitinae (Mesostigmata: Parasitidae) in the British Isles. Bull Brit Mus (Nat Hist), Zool 38: Inoue D.W The value of bees. Biological Conservation 140: Karg W Acari (Acarina), Milben-Parasitiformes (Anactinochaeta) Cohors Gamasina Leach-Raubmilben. 2nd ed. Die Tierwelt Deutschlands 59, G. Fischer Verlag, Jena, 523 pp 22. Kevan P.G Pollinators as bioindicators of the state of environment: species, activity and diversity. Agriculture, Ecosystems and Environment 74: Koulianos S. Schwarz HH Reproduction, development and diet of Parasitellus fucorum (Mesostigmata: Parasitidae), a mite associated with bumblebees (Hymenoptera: Apidae). J Zool, (London) 248: Krzysztofiak A. Krzysztofiak L. Pawlikowski T Trzmiele Polski przewodnik terenowy, ISBN Lindquist EE. Krantz GW. Walter DE Order Mesostigmata. In: Krantz GW, Walter DE (eds) A manual of acarology. Texas Tech University Press, Lubbock, TX, pp Mašán P. Stanko M Mesostigmatic mites (Acari) and fleas (Siphonaptera) associated with nests of mound-building mouse, Mus spicilegus Petényi, 1882 (Mammalia, Rodentia). Acta Parazitol 50: Micherdziński W Die Familie Parasitidae Oudemans, 1901 (Acarina, Mesostigmata). PWN, Kraków, p Napierała A. Błoszyk J Unstable microhabitats (merocenoses) as specific habitats of Uropodina mites (Acari: Mesostigmata) Exp Appl Acarol 60:

206 29. Perèz-Barrales R., Arroyo J., Armbruster W.S Differences in pollinator fauna may generate geographic differences in flora morphology and integration in Narcius papyraceus (Amaryllidaceae). Oikos 116: Potts S.G., Petanidou T., Roberts S., O Toole C., Hulbert A., Willmer P Plantpollinator biodiversity and pollination services in a complex Mediterranean landscape. Biological Conservation 129: Royce LA, Krantz GW (1989) Observations on pollen processing by Pneumolaelaps longanalis (Acari: Laelapidae), a mite associate of bumble bees. Exp Appl Acarol 7: Micherdziński W (1969) Die Familie Parasitidae Oudemans, 1901 (Acarina, Mesostigmata). PWN, Kraków, p Krantz GW (1978) A manual of acarology, 2nd edn. Oregon State University, Corvallis, OR 509 pp. 34. Kontschán, Jenő & Ripka, Géza. (2016). New species of Dinychus Kramer, 1886 from fragments of the former Gondwanaland (Acari: Uropodina: Dinychidae). Zootaxa /zootaxa Pyle C, Brown MM 2002 The effects of microsite (Logs versus ground surface) on the presence of forest floor biota in a second-growth hardwood forest. Proceedings of symposium the ecology and management of dead wood in western forests, pp , Reno, Nevada, 2 4 November Schmid-Hempel P The parasites and their biology: mites. In: Parasites in social insects. Princeton University Press, Princeton, NJ, pp Schwarz HH. Huck K. Schmid-Hempel P Prevalence and host preference of mesostigmatic mites (Acari: Anactinochaeta) phoretic on Swiss bumble bees (Hymenoptera: Apidae). J Kan Entomol Soc 69 (Suppl): Schwarz HH, Huck K (1997) Phoretic mites use flowers to transfer between foraging bumblebees. Insect Soc 44: Svensson B., Lagerlöf, J., Svensson Bo Habitat Preferences of Nest-seeking Bumble Bees (Hymenoptera: Apidae) in an Agricultural Landscape. Agriculture, Ecosystems & Environment. 77: Walter DE, Krantz GW (2009) Collecting, rearing, and preparing specimens. In: Krantz GW, Walter DE (eds) A manual of acarology. Texas Tech University Press, Lubbock, TX, pp Willmer P.G. Bataw A.A.M. Hughes J.P The superiority of bumblebees to honeybees as pollinators: insect visits to raspberry flowers. Ecological Entomology 19: Bombus pratorum, the Early bumblebee Retrieved Red Shanked Carder Bee - Bombus ruderarius. Brickfields Country Park. Retrieved

207 Beetles from the Chrysomelidae family harmful to urban trees Natalia Malejky¹, Małgorzata Kłyś¹, Anna Kocoń², Aleksandra Izdebska¹ ¹Department of Ecology and Environmental Protection, Institute of Biology, Pedagogical University of Cracow, Podbrzezie 3, Kraków, Poland ²Department of Invertebrate Zoology and Parasitology, Institute of Biology, Pedagogical University of Cracow, Podbrzezie 3, Kraków, Poland Abstract In this study, species of beetles from the Chrysomelidae family have been reviewed, which damage trees growing in the urbanized areas of our country. These include: Agelastica alni L., Phyllodecta laticollis Suffrian, Altica quercetorum Foudr., Phytodecta quinquepunctata Fabr. A typical symptom of their emergence is the skeletal formation and eating of leaf tissue leading to the complete consumption of the leaves by the beetles, which hinders the functioning of trees and is conducive to the occurrence of their infection. Due to the safety of residents in cities, there are no chemical methods to control these pests. Larval stages attacking the urban greenery are sensitive to biological preparations based on Bacillus thuringiensis subspecies tenebrionis. Introduction Trees play extremely important roles in urbanized areas. One of the most important arguments for their preservation and planting new specimens is the production of oxygen. In addition, trees isolate people and residential buildings from dust, which are, among others, a fuel combustion derivative (Błaszczyk and Kosmala 2009). Their impact on the urban climate is also important they cool it down through the phenomenon of transpiration. Thus, they eliminate the phenomenon of heat islands that occur most frequently in cities (Szczepanowska 2012). It should also be noted that trees reduce the outflow of rainwater, which is why they play an important role for water management affecting the restoration of groundwater resources and limiting the flood states (Szczepanowska 2007). In addition, trees, especially deeply rooted and fast growing, improve water quality. As a result of the detoxification process, they purify groundwater from heavy metals, and the bacteria that accompany the plants break down a number of organic compounds (Suchocka 2013, Józefczuk et al. 2017). The occurrence of trees in places with high noise levels, for example by roads, is not without significance as it reduces its feeling by up to 50 % (Suchocka 2013). Due to the mentioned benefits resulting from the presence of trees in the urban area, one should take into account their longest preservation and keeping them in a good condition. Various types of tree disease symptoms, such as leaf wilting, 207

208 distortion of shoots, growths, cores, necrosis and spots, mycelium coating or dying of entire plants may be evidence of developing infections. Biotic factors (infections) that cause plant diseases are called pathogens. They include plant organisms (parasitic and semi-parasitic flowering plants, e.g. mistletoe), animal organisms (nematodes, insects, mites, snails, rodents) and fungi (Łukasiewicz and Łukasiewicz 2016). This study presents species of beetles from the Chrysomelidae family, which are pathogens of trees growing in cities along with a review of damage caused by them and ways of combating them. Beetles from the Chrysomelidae family attacking urban greenery Beetles from the Chrysomelidae family include small or medium sized insects, reaching 2-15 mm in length in domestic conditions. Their body is oval, more or less convex. The medium-sized head is usually hypognathically set with filamentous tentacles, usually quite long. Cover wings are long, covering the top of the abdomen or shortened, revealing its last segments. Uniform or multi-coloured colouring, usually with a metallic shine. Less often the covers are matte or covered with flattened hairs. The second pair of wings is generally well developed, although many species are reluctant to fly, and some are completely non-flying. A racing type of legs, sometimes a third jumpy pair. A layered set flattened foot members. The fertility of the leaf beetles is generally high and ranges from 100 to 500 eggs, although sometimes it can be up to 3000 eggs. Their larvae are oligopod, with short legs and a massive abdomen, less often flat with finger-like side processes (Węgorek 1972, Bunalski et al. 2010, Boczek and Lewandowski 2016). Beetles from the Chrysomelidae family are herbivorous species. They cause the damages both as adult individuals imagines feeding on the leaves and as larvae feeding on various plant organs, also inside tissues. A typical symptom of their occurrence is skeletal and leaf vein tissue leading to the complete consumption of leaves. These beetles, due to the bite-type mouth apparatus, take up solid food, gnawing the plant organs. Depending on the place of feeding and the species, they can eat different shapes of wounds, canals and holes, often invisible on the surface. This type of damage impedes the functioning of the plant and also promotes the occurrence of infection. They often bite the parenchyma tissue of the leaves, leading to their stiffening. As a result of this process, the plant loses assimilation surfaces and its decorative qualities deteriorate considerably. This phenomenon is even more pronounced when the insects eat all the green tissue causing the previously mentioned total consumption of leaves. Beetles belonging to the Chrysomelidae family occurring on trees attack mainly: willows, poplars, alders, elms, oaks (Czerniakowski and Dudek 2013). Among the leaf beetles causing damage in the urban tree stand of our country are: Agelastica alni L., Phyllodecta laticollis Suffrian, Altica quercetorum Foudr., Phytodecta quinquepunctata Fabr. ( Below is a short characteristic of each species. Agelastica alni L. The species of this beetle occurs throughout the Palearctic. It was also dragged to North America. In Poland, it is common throughout the country, especially in humid places along watercourses and water bodies. The beetle has a size of 5 to 7,5 mm. The appearance of adult wintering insects occurs from April to May, while 208

209 individuals of the new generation from the turn of June to July. These insects are found in deciduous and mixed forests and in parks. Their host plants include bird cherry (Prunus padus, P. serotina) and sometimes common sorrel (Sorbus aucuparia). In many areas, A. alni exhibits tendency to annual mass appearances. It is especially dangerous for young alders. Its feeding can lead to complete leaf consumption, premature leaf drying and sometimes the death of infested trees ( Phyllodecta laticollis Suffrian The species of this beetle inhabits the entire Palearctic, with the exception of its African part. In Poland, it occurs throughout the country, it is very common in the lowlands. An adult beetles reaches a size of 3,5 to 5,0 mm. The emergence of adults the wintering generation is from early spring, while the new generation from the end of July to autumn. The environment that is settled by this species includes deciduous and mixed forests, as well as parks with the participation of aspen. The main food plants are: aspen, Italian poplars and willows. The P. laticollis beetles overwinter in the litter or under the bark of dead trees. They start feeding in the spring, attacking buds at first, then developed leaves. Eggs are laid at the beginning of June in the amount of dozen or so pieces. At the beginning, young larvae feed in groups on the underside of the leaves. With age, they begin to feed individually. They bite the ground tissue, usually leaving veins and the upper layer of the leaf peel as a whole. Such feeding leads to gradual browning of parts or whole leaves and premature falling. Adult larvae get into the soil where they undergo pupation. Young beetles leave the soil after about 2 weeks and undertake intensive supplemental feeding on the leaves. In autumn, they stop feeding, but they can still be observed in large clusters on the upper side of the aspen leaves. There is usually one generation of P. laticollis in a year. In the warmer years, the second generation may also develop. Beetles do damage to the attacked tree stand. Both intensive feeding of beetles and larvae often appearing in large numbers leads to characteristic browning of the leaves and their premature falling. These damages significantly reduce the aesthetic values of trees ( Altica quercetorum Foudr. This insect is common in southern and central Europe and the southern part of Norway and Sweden. In Poland, it is present all over the country, in some years very numerous. The beetle reaches a length of approx. 4-5 mm. The appearance of beetles occurs from May to autumn. The environment of their existence are deciduous and mixed forests and parks. The host plants of A. quercetorum include: mainly oak (Quercus spp.), alder (Alnus spp.), hazel (Corylus avellana) and birch (Betula spp.). Beetles winter in litter or in bark crevices. They appear on trees in May. The signs of their intensive feeding are extensive leaf surfaces covered with numerous small holes. After copulation, the females lay eggs on the underside of the leaves. Larvae hatching after about 2 weeks feed in groups at first, and at a later stage individually. They bite the ground tissue of leaves leaving the veins undamaged. As a result of their activity, the stiffened leaves brown and dry prematurely. In July, adult larvae go down to the soil where they undergo pupation. After about 2 weeks, young beetles come out, feeding on the leaves until autumn. This beetle occurs on trees of all age classes, where damage is caused by both adult insects and larvae. The most dangerous are its mass 209

210 appearances in forest nurseries. In forests and urban parks, premature mass browning and leaf drying significantly reduce the aesthetic value of trees ( Phytodecta quinquepunctata Fabr. This beetle is found in northern and central Europe, reaching the Alps and the Carpathians to the south. In Poland, it is common throughout the country. It reaches a size of 5 to 7,5 mm. Its appearance is observed in the case of wintering individuals from April to May, and new generation beetles from the turn of June and July. It occurs in deciduous and mixed forests, but also in parks. The food plants of this species include bird cherry (Prunus padus, P. serotina) and occasionally common sorrel (Sorbus aucuparia). The beetles which inhabit trees in early spring winter with the development of leaves. It is a viviparous species. Young larvae appear in April and in early May. Throughout their development, they feed individually, but often several on one leaf. They bite numerous, several millimetre-long holes in the lamina, and in the case of massive appearance they leave only the main veins on the leaf. Adult larvae fall into the soil where they undergo pupation. Young beetles which come out after about 2 to 3 weeks, feed for some time on the leaves and soon disappear, probably hidden in the litter, or under the bark of dead trees, where they later winter. An indication of the mass occurrence of the larvae is the characteristic perforation of the leaves, which in the case of controlling the entire tree crowns leaves the unpleasant appearance of bare trees until the end of the season. These trees do not lose their vitality and can survive yearly the repetitive attacks of P. quinquepunctata larvae ( Pest control in green areas We distinguish two main types of pest control methods in herbaceous areas: indirect and direct methods. The indirect methods include: quarantine, agrotechnical methods and breeding methods. Quarantine aims to prevent the transmission of diseases and pests from the country to the country. Agrotechnical methods include treatments, among others, based on proper plant breeding, fertilization, irrigation, weed control and dead parts of plants. On the other hand, breeding methods include activities based on the use of varieties resistant to diseases and pests (Łukasiewicz and Łukasiewicz 2016). The direct methods include: biological methods, mechanical methods, physical methods and chemical methods. In biological methods for controlling diseases and pests, microorganisms such as bacteria, fungi, viruses as well as nematodes, predatory insects and birds are used. In mechanical methods, the destruction of diseases and pests occurs by removing infected parts of plants or using baits and traps. Physical methods include low and high temperatures, ultrasound, and exposure to various rays to decontaminate the soil and plant material. Chemical methods prevent and inhibit the development of diseases and pests through the use of pesticides. They have the greatest importance in combating them due to their high effectiveness. For chemical methods, we distinguish several ways of distributing a chemical agent, by dusting, spraying, watering, gassing, dressing or fogging. The use of chemical plant protection products, apart from positive effects in the form of eradicated diseases or pests, also has negative effects. Numerous pesticides with toxic properties remain in the environment, even for many years, causing poisoning of plants, animals and people. 210

211 In extreme cases, they cause mutagenic and carcinogenic changes (Łukasiewicz and Łukasiewicz 2016). Currently, integrated methods are used, combining different methods, which gives the best results, e.g., by combining agrotechnical, biological and chemical methods (Łukasiewicz and Łukasiewicz 2016). The pest control methods of the pests discussed in the previous chapter vary depending on where they occur. In the case of their mass occurrences in forest nurseries, contact or stomach insecticides are recommended. The situation is different in the case of beetles on trees growing in green areas in the parks, squares, strips of street greeneries, etc. because due to the need to maintain the safety of resident in the cities, no chemical treatments are carried out. The results of research currently conducted at the Institute of Plant Protection National Research Institute indicate that the larval stages of A. alni, P. laticollis, A. quercetorum and P. quinquepunctata are sensitive to the biological preparations based on the Bacillus thuringiensis subspecies tenebrionis, and the pupae on insecticidal nematodes from the Heterorhabditis and Steinernema types ( Fig.1. Agelastica alni L. adult ( 211

212 Fig.2. Agelastica alni L. larva ( Fig.3. Phyllodecta laticollis Suffrian adult ( 212

213 Fig.4. Phyllodecta laticollis Suffrian larvae ( Fig.5. Altica quercetorum Foudr. pupa ( 213

214 Fig.6. Altica quercetorum Foudr. larvae and eggs ( Fig.7. Phytodecta quinquepunctata Fabr. adult ( 214

215 Fig.8. Phytodecta quinquepunctata Fabr. larva ( References 1. Błaszczyk M., Kosmala M Rola i znaczenie drzew w krajobrazie aleje przydrożne i przyuliczne. Zeszyty komunalne [w:] Przegląd Komunalny 8 (80): Boczek J., Lewandowski M Nauka o szkodnikach roślin uprawnych. Wydawnictwo SGGW. Warszawa: Bunalski M., Piekarska-Boniecka H., Wilkaniec B Entomologia szczegółowa 2. PWRiL Sp. z o.o. Poznań: Czerniakowski Z.W., Dudek T Pielęgnacja i ochrona drzew i krzewów w terenach zieleni. Wydawnictwo Uniwersytetu Rzeszowskiego. Rzeszów: Józefczuk J., Szmigiel-Franz A., Zienkiewicz A Poradnik przyjaciół drzew. Fundacja EkoRozwoju. Wrocław. pp Łukasiewicz A., Łukasiewicz S Rola i kształtowanie zieleni miejskiej. Wydawnictwo Naukowe Uniwersytetu im. Adama Mickiewicza w Poznaniu. Poznań: Suchocka M Drzewo jako element zielonej infrastruktury. T. XXXVI.: Szczepanowska H. B Ekologiczne, społeczne i ekonomiczne korzyści z drzew na terenach zurbanizowanych. Człowiek i Środowisko 31 (3-4): Szczepanowska H. B Miejsce terenów zieleni w strukturze zintegrowanego projektowania, zarządzania i oceny ekologicznej inwestycji miejskich. Człowiek i środowisko 36 (1-2). 10. Węgorek W Nauka o szkodnikach roślin. Państwowe Wydawnictwo Rolnicze i Leśne. Warszawa:

216

217 Medicinal plants and their impact on Oryzaephilus surinamensis (Linnaeus, 1758) (Coleoptera, Silvanidae) Natalia Malejky¹, Małgorzata Kłyś¹, Lidia Chomicz², Wanda Baltaza², ³ ¹Department of Ecology and Environmental Protection, Institute of Biology, Pedagogical University of Cracow, Podbrzezie 3, Kraków, Poland ²Department of Medical Biology, Faculty of Health Sciences, Medical University of Warsaw, Nowogrodzka 73, Warsaw, Poland ³Department of Disaster Medicine, Medical University of Warsaw, Żwirki and Wigury 81, Warsaw, Poland Abstract The paper was based on a literature review on the insecticidal and repellent effects of plants on Oryzaephilus surinamensis, a dangerous pest of stored food products. Scientific works were isolated, in which plants showing positive-medicinal effects on humans were used as potential insecticides and/or repellents. It was found that the insecticidal effect on O. surinamensis was demonstrated by the following medicinal plants: Artemisia absinthium L., Datura stramonium L., Marrubium vulgare L., Matricaria chamomilla L., Salvia officinalis L. While the repellent effects were demonstrated by: A. absinthium, D. stramonium, M. vulgare and M. chamomilla. The essential oil of M. chamomilla proved to be the strongest repellent and insecticide against O. surinamensis. It was found that the increasing exposure time as well as the increasing concentration of a given substance influences the intensification of the insecticidal and/or repellent effect. Introduction The search for effective methods of controlling harmful storage insects is still valid. The first factor confirming this formulation was the elimination of methyl bromide as a fumigant after Due to the destruction of the ozone layer by this compound, on January 1, 2005 it was withdrawn from use. This method was characterized by high efficiency, ease of application, good penetration of products and fast action. Therefore, finding a substitute with comparable effectiveness was and still is a big challenge (Olejarski and Nawrot 2008). The second factor intensifying the search for effective forms of pest control was the introduction in all European Union countries of legally binding legal standards obliging to implement and apply food safety systems. They are aimed at, among others: securing the production plant against pests and controlling the effectiveness of these protections, and also eliminating contaminants from food in the form of pests or fragments of their bodies (Olejarski and Ignatowicz 2010). Another factor proving the constant search for effective methods of pest control is the fact that currently used methods are not always 100% effective. As of today, the best and most effective method of safe pest reduction is integrated defence (IPM), mainly involving non-chemical methods of reducing the number of pests. The use of chemical methods in the integrative fight is possible, but only in the case of ineffective non-chemical methods, but their negative impact on human and animal life and the environment must be kept to a minimum (Olejarski and Ignatowicz 2011). Due to this, more and more scientific research is associated with the search for effective, non-chemical methods of pest control, mainly due to the lack of their negative effects on 217

218 humans. The plants and substances contained in them offer great possibilities in this area. A lot of scientific studies concern the substances of natural-plant origin, limiting the number of harmful insects. Plants, among others, are sought, in which the compounds contained exhibit repellent or insecticidal activity against harmful insects in storehouses. One of the most common pests of stored food products in Poland is the saw-toothed grain beetle Oryzaephilus surinamensis. This species was brought to Europe in the 18 th century together with food products of vegetable origin. In Poland, it was first discovered in the 19 th century in the area of Silesia, Greater Poland and Lesser Poland. This beetle feeds primarily on shredded cereal products. It also destroys dried fruits, seeds, less often products like bread or confectionery. It is very difficult to combat the saw-toothed grain beetle due to several factors that characterize it, such as: high fertility, short development period, and high migration abilities (Kłyś 2013). Characteristics of medicinal plants limiting the abundance of Oryzaephilus surinamensis Plants with repellent and insecticidal properties against storage pests are a new category in the field of methods of their eradication. Moreover, their effective search may lead to their replacement of plant protection chemicals. It should also be noted that when using substances of plant origin limiting the number of harmful insects, as means of their eradication, it is important that they do not have a negative effect on human. For this purpose, literature on the insecticidal and repellent interactions of plants on O. surinamensis was reviewed and isolation of positions, in which insecticides or repellents were used as plants with positive medicinal effects on humans (Tab. 1). The characteristics of plants limiting the abundance of O. surinamensis with the list of basic active compounds contained therein and a description of their medicinal effects on humans are presented below. Artemisia absinthium L. (grand wormwood) is a perennial from the Compositae family, widespread almost throughout Europe, western Asia, North Africa and North America. It occurs all over Poland on roadsides, bays, wastelands, stony places and forest clearings. Sometimes it is grown on plantations. It is a plant with raised, branched and silver-haired shoots reaching 80 cm in height. Its leaves are silphilophylly, grey-green from the upper side, whitish underside, 1-3-times feathery with oblong-lanceolate, blunt sections. It has small, yellowish flowers, collected in small, inconspicuous cups (Ożarowski and Jaroniewski 1989). Basic active compounds The mugwort herb contains guaianolide bitterness (e.g. absinthe, artabsine). In addition, this plant contains about 0,5 % of essential oil, which includes, among others: thujone (up to 50 %), tujole (approx. 10 %), phellandrene, pinene, chamazulene. It also contains flavonoids (e.g. artemetin), pelanolide compounds (e.g. ketopelanolide A and B), organic acids, tannins and mineral salts. Leaves have a similar chemical composition, contain less essential oil (Bukowiecki and Furmanowa 1972, Rumińska 1981, Ożarowski and Jaroniewski 1989). Medicinal effect: - stimulates the secretion of gastric juices, - improves digestion and assimilation of food, - increases the amount of urine output (especially in people with impaired glomerular filtration), - it has a poisonous effect on pinworms and skin parasites, such as mites and lice (Ożarowski and Jaroniewski 1989). Datura stramonium L. (jimsonweed) is a one-year plant from the Solanaceae family, originating from the southern areas of the Caspian Sea and the Black Sea. Currently, it is 218

219 widespread throughout Europe. In Poland, it is often found in lowlands near homes, on debris and in gardens. The stem of the plant reaches 1 metre in height, it is strongly developed, widespread branched. It has long-tailed leaves, with egg-shaped outline, coarsely serrated. The plant produces short-pedicel flowers in the fork of twigs. The crown up to 10 cm long, white, sometimes purple. The fruit is an ovoid-shaped capsule from 2 to 5 cm, spiky, sometimes smooth (Rumińska 1981, Ożarowski and Jaroniewski 1989). Basic active compounds The leaves of the plant contain 0,2 0,6 % tropane alkaloids, mainly: L-hyoscyamine, scopolamine and atropine. Moreover, the leaves contain: tannins, flavonoids, hydroxymumarin and mineral salts. The plant s seeds contain slightly more alkaloids (Bukowiecki and Furmanowa 1972, Rumińska 1981, Ożarowski and Jaroniewski 1989). Medicinal effect: - relaxation of smooth muscles of internal organs, - inhibits the secretion of sweat, mucus, saliva and gastric juice, - stimulates some brain centres, - anti-asthma agent (Rumińska 1981, Ożarowski and Jaroniewski 1989). Marrubium vulgare L. (white horehound) is an aromatic perennial from the Labiatae family, covering the area from the Canary Islands to Central Asia. In Poland, it occurs commonly in rubble and at buildings in the lowlands and in lower mountain parts. Sometimes it is grown. The plant produces a stem reaching up to 50 cm in height. Lower leaves are heartshaped, upper ovate, wrinkled, unevenly corrugated. Stems and lower sides of leaves are grey-haired. The plant flowers are double-headed, dorsal, collected in groups in the axils of the leaves. The crown is white, 5-6 mm long (Ożarowski and Jaroniewski 1989). Basic active compounds The herb of this plant contains a mixture of diterpenic compounds, which include murrabine, premarubine and vulgarol. In addition, it contains tannins, phytosterols, triterpenes, betonicin, choline, organic acids, mucus, sugars and mineral salts (Bukowiecki and Furmanowa 1972, Rumińska 1981, Ożarowski and Jaroniewski 1989). Medicinal effect: - causes relaxation of the smooth muscles of the bile ducts which facilitates the flow of bile into the duodenum, and thus prevents stagnation in the gall bladder, - improves the process of digestion and assimilation of food by stimulating the secretion of gastric juice, - stimulates the monthly bleeding, - facilitates expectoration, - diuretic, - choleretic, - anti-inflammatory and bactericidal (Ożarowski and Jaroniewski 1989). Matricaria chamomilla L. (wild chamomile) is an annual plant from the Compositae family. It occurs throughout Europe, in many parts of Asia, North America and Australia. In Poland, it grows as a grass weed in bays and wasteland around the lowland and in the lower part of the mountain zone. It is often grown on plantations. Chamomile has a branched, bare stem reaching a height of 60 cm. The leaves are 2- or 3-times pinnate with equally narrow sections. The plant flowers are collected in cups, arranged individually at the ends of the stem branches. The bottom of the capsule is cone-shaped, empty inside. The plant is highly aromatic (Ożarowski and Jaroniewski 1989). Basic active compounds Flowers contain from 0,3 to 1,3 % of essential oil, and it contains: chamazulene (6-18 %), α-bisabolol and its oxides (25-50 %), spiroether, β-pharnezene, myrcene, cadinene and others. In addition, the flowers include: flavonoids, coumarin derivatives, spirocyclic 219

220 polyacetylenes, mucus, choline, carotenoids and mineral salts (Bukowiecki and Furmanowa 1972, Rumińska 1981, Ożarowski and Jaroniewski 1989). Medicinal effect: - anti-inflammatory effect on mucous membrane and skin, - antiallergic effect, - inhibits the secretion of histamine, serotonin, bradykinin substances that cause inflammation, - has a diastolic effect on the intestinal smooth muscles, - choleretic - soothing effect (Rumińska 1981, Ożarowski and Jaroniewski 1989). Salvia officinalis L. (medicinal sage) is a semi-bush from the Labiatae family, naturally occurring in the countries of the Mediterranean zone. In Poland, this plant has been cultivated for several centuries. Sage producing numerous stems up to 75 cm tall, erected, woody at the bottom, quadro-angular. Sage leaves are opposite, long-tailed, narrow elliptical or lanceolate, rounded or wedge-shaped in the base, finely cornered at the margin. The nerves form a fine mesh, highlighted from the lower side. Both sides of the leaf are grey-haired. The leaf blade reaches up to 8 cm in length. Flowers are dorsal, double-lipped, purple-blue, sometimes whitish. The plant is characterized by a strong, specific smell (Rumińska 1981, Ożarowski and Jaroniewski 1989). Basic active compounds The most important component of the leaves is the essential oil, in an amount of up to 2,5 %, which consists of numerous terpenes thujone, cineole, camphor and sesquiterpenes humulene, caryophyllene. In addition, the leaves contain catechin tannins, multi-phenolic acids (caffeic, chlorogenic), triterpene sapogenins, the bitter compound picrosavin, unknown estrogenic and antiperspirant substance and mineral salts. The herb contains the same active compounds as leaves, but in smaller quantities (Bukowiecki and Furmanowa 1972, Rumińska 1981, Ożarowski and Jaroniewski 1989). Medicinal effect: - anti-inflammatory, - antiseptic, bacteriostatic, fungicidal, astringent, - prevents excessive fermentation and painful bloating (Rumińska 1981, Ożarowski and Jaroniewski 1989). Effect of medicinal plants on limiting the abundance of Oryzaephilus surinamensis As a result of a review of literature on the impact of plants and substances contained in them on O. surinamensis, 5 species of medicinal plants were stated: Artemisia absinthium L., Datura stramonium L., Marrubium vulgare L., Matricaria chamomilla L., Salvia officinalis L. exhibits toxic and/or repellent effect on O. surinamensis. Their potential to limit the number of O. surinamensis is described below. Artemisia absinthium L. The influence in terms of migration activity and mortality of powdered Artemisia absinthium L. on O. surinamensis was studied by Kłyś (2011). The conducted experiments were based on the phenomenon of one-way migration, i.e. emigration. For this purpose, a set of two vessels was used smaller ones with holes that allowed the emigration of insects were placed in a larger vessel. The smaller dish had legs, this made it possible for the tested insects to return to its interior. 40 g of food was added to both dishes oatmeal cereal. 0,5 g of the studied powdered plant was added to the smaller dish and 40 adult insects were introduced into it, constituting the initial population. Controls of experiments were carried out at monthly intervals, while maintaining a constant mass of food (40 g), which allowed for long-term research. The obtained results allow to conclude that for O. surinamensis 220

221 beetles, wormwood is a repellent because it causes a very significant migration from the food to which this plant was added. In the initial research period, i.e. after 30 days and at the end, after 150 days, the migration rate was higher by up to 30 % compared to the control sample, while at other intervals it was higher by an average of 13 %. In addition, wormwood has insecticidal properties, causing their high mortality. Datura stramonium L. Najafabadi et al. (2014) studies the effect of plant leaf extracts on O. surinamensis, including, among others, the medicinal plant Datura stramonium. Small plastic jars (50 ml capacity) were used for the experiment, where one set of two jars was connected with a transparent plastic tube with a diameter of 1 cm. One jar of each set was provided with 10 g of grains with extract, while the other jar was empty. The extract was diluted with a solvent of ethyl alcohol (20 mg / ml). Extracts were applied locally at doses of 10 mg / g grains (0,1 g of extract in 5 ml of a solvent). 10 adult insects were let into each jar of grain and extract. The jars with the extract repelled the insects by forcing them to move to an empty jar through a plastic pipe or led to death, indicating the insecticidal properties of the examined extract. Data on insecticidal and repellent properties of the extract were recorded for 14 days with an interval of 24 hours. Studies of the tested plant extract on O. surinamensis showed that the extract from Datura showed 35,26 ± 3,21 % of morbidity. Moreover, the extract from the dermis showed a high repellent effect of 33,09 ± 2,35% compared to O. surinamensis. Marrubium vulgare L. A natural ethanolic plant extract, including Marrubium vulgare, has been tested for its insecticidal and repellent efficacy in relation to O. surinamensis by Alqurashi and Bakhashwain (2010). They used Petri dishes for experiments, at the bottom of which filter papers were placed. To check the insecticidal properties, the entire filter paper was soaked with the test extract, and then 50 g of wheat grain and 30 larvae or adult beetles were placed on it. The mortality percentage was registered after 2, 4 and 6 days of exposure. To determine the repellent properties of the extract the Petri dishes were divided into two equal parts, where wheat grain of one half of the dish was treated with the test extract. Then, 20 adults of O. surinamensis were allowed to enter the middle of the dish. The number of insects present on each half of Petri dishes was counted in 2-hur intervals. For both studied properties of the M. vulgare extract, its four concentrations were tested: 200, 400, 600 and 800 ppm. The extract showed high toxicity. The highest concentration (800 ppm) of the M. vulgare extract after the longest exposure time 6 days, showed the highest mortality: in adults, at the level of 82,2 %, while in larvae 83,3%. It was also observed that with increasing concentration of the extract, the mortality of insects increased. In the case of the tested repellent properties, also the highest concentration of extract (800ppm) gave the strongest repellent effect on the level of 54,36 %. Matricaria chamomilla L. Al-Jabr (2006) examined the toxic and repellent properties of essential oils on O. surinamensis, including the essential oil from Matricaria chamomilla. For both properties, five concentrations of each essential oil were tested (0,125, 0,25, 0,5, 0,75 and 1%). Adult beetles have been exposed to essential oils for two weeks. Mortality was observed in 250 cm 3, where 20 g of wheat grain was placed, which was previously sprayed with the tested concentration of the essential oil. 10 adult beetles were placed into the flasks. The mortality percent was recorded after 3, 7 and 14 days. The results showed that total mortality of O. surinamensis was achieved by M. chamomilla at concentrations greater than 0,5% and 7 days of exposure. A significant increase in mortality was observed with increasing exposure time. To test the properties of repellent etheric oils, an apparatus consisting of T-shaped tubes was used, where bags were attached to two shorter arms. One bag contained wheat treated with the studied essential oil, the other wheat without oil. 20 adult beetles were let into the longer tube. The results of the experiment were read after 48 hours of exposure. 221

222 M. chamomilla showed high repellence - 81,94% at a concentration of 1% against O. surinamensis. Salvia officinalis L. Kłyś (2011) studied the impact in terms of migratory activity and mortality of powdered Salvia officinalis on O. surinamensis. The experiment was carried out using the phenomenon of emigration and a set of two dishes a smaller one in a larger one. Oatmeal (40 g) with oily vegetable powder (0,5 g) was placed in a smaller dish, oatmeal (40 g) on its own was added to a larger dish. 40 adult beetles (constituting the initial population) were admitted to a smaller dish. The results were read at monthly intervals. The tested plant did not show repellent properties, but showed a slight insecticidal activity. Mortality in the initial population and among the migratory insects was low throughout the study period, however, a slight increase in mortality to over 20% was observed in the final experimental period. All the above-analysed medicinal plants showed lethal effects on O. surinamensis. Among them, the strongest insecticidal activity was noted for the essential oil from M. chamomilla resulting in 100% mortality at concentrations greater than 0,5%. A very high mortality rate of 82,2 % for adult beetles and 83,3 % for larvae was obtained using a concentration of 800 ppm of extract from M. vulgare. The weakest insecticidal activity was shown by the powdered S. officinalis. The repellent effect against O. surinamensis was noted for four plants: A. absinthium, D. stramonium, M. vulgare and M. chamomilla, where the M. chamomilla essential oil turned out to be the strongest repellent. This plant has repellent properties recorded at the level of 81,94% at a 1% concentration. Both for the studied repellent effect, as well as the insecticidal effect of the analysed plants and the substances contained in them, it was observed that the increasing exposure time and the increasing concentration of a given substance affect the increase of the insecticidal and/or repellent effect. Table 1. List of medicinal plants showing insecticidal and/or repellent effects on Oryzaephilus surinamensis Plant species Solvent/product References Artemisia absinthium L. powder Kłyś (2011) Datura stramonium L. ethanol extract Najafabadi et al. (2014) Marrubium vulgare L. extract Alqurashi and Bakhashwain (2010) Matricaria chamomilla L. essential oil Al-Jabr (2006) Salvia officinalis L. powder Kłyś (2011) References 1. Al-Jabr M.A Toxicity and repellency of seven plant essential oils to Oryzaephilus surinamensis (Coleoptera: Silvanidae) and Tribolium castaneum (Coleoptera: Tenebrioidae). Sci. J. King. Faisal. Univ. 7: Alqurashi A.D., Bakhashwain A.A Insecticidal and repellent effect of some indigenous plant extracts against saw-toothed grain beetle, Oryzaephilus surinamensis (L.) (Coleoptera: Sivanidae). J. Plant Prot. and Path., Mansoura Univ. 1: Bukowiecki H., Furmanowa M Botanika farmaceutyczna. Państwowy Zakład Wydawnictw Lekarskich. Warszawa: 287, Kłyś M The influence of the herbs sage and wormwood on the migrational activity of saw-toothed grain beetles Oryzaephilus surinamensis L. (Coleoptera, Cucujidae) populations. Integrated Protection of Stored Products IOBC/wprs Bulletin 69: Kłyś M Wpływ ziół na niektóre gatunki chrząszczy szkodliwe w magazynach i przechowalniach. Wydawnictwo Naukowe Uniwersytetu Pedagogicznego. Kraków:

223 6. Najafabadi Modarres S. S., Beiramizadeh E., Zarei R Repellency and toxicity of Tyree plants leaves extraction against Oryzaephilus surinamensis L. and Tribolium castaneum Herbst. Journal of Biodiversity and Environmental Sciences (JBES). Vol. 4, No. 6: Ożarowski A., Jaroniewski W Rośliny lecznicze i ich praktyczne zastosowanie. Instytut Wydawniczy Związków Zawodowych. Warszawa. 435ss. 8. Olejarski P., Nawrot J Nowoczesne metody i techniki zwalczania szkodników magazynowych. Postępy w Ochronie Roślin 48(3): Olejarski P., Ignatowicz S Szkodniki magazynowe w produktach spożywczych. Postępy w Ochronie Roślin 50(2): Olejarski P., Ignatowicz S Integrowana metoda zwalczania szkodników magazynowych podstawą zapewnienia wysokiej jakości przechowywanego ziarna zbóż. Postępy w Ochronie Roślin 51(4): Rumińska A Rośliny lecznicze. Państwowe Wydawnictwo Naukowe. Warszawa. 548ss. 223

224 224

225 Medicinal plants with repellent effect on Rhyzopertha dominica (FABRICIUS, 1792) (Coleoptera; Bostrichidae) a dangerous pest of the stored food products Natalia Malejky¹, Małgorzata Kłyś¹, Anna Kocoń² ¹Department of Ecology and Environmental Protection, Institute of Biology, Pedagogical University of Cracow, Podbrzezie 3, Kraków, Poland ²Department of Invertebrate Zoology and Parasitology, Institute of Biology, Pedagogical University of Cracow, Podbrzezie 3, Kraków, Poland natalia.malejky@up.krakow.pl malgorzata.klys@up.krakow.pl anna.kocon@up.krakow.pl Abstract Storage pests, as organisms occurring in stored products of plant and animal origin, expose food manufacturers to huge damages. In addition to eating the stored products, the pests contaminate them with molts, dead individuals, droppings, they moisten and heat the products, and infect them with fungi and bacteria. They pose a threat to human health. Due to this, new and effective methods of combating or deterring them from the stored cereals and food products are still being sought. For this purpose, the impact on storage pests of substances of vegetable origin used in various forms, e.g. powders, oils, extracts or a combination thereof, is applied. The paper reviews the literature on the repellent impact of plants on R. dominica and the isolation of the position, in which the plants showing positive-healing effects on humans were used as potential repellents. It was found that the repellent effect on R. dominica was demonstrated by the following medicinal plants: Capsicum annuum L., Carum carvi L., Curcuma longa L., Lavandula officinalis L. and Salvia officinalis L. Usually the repellent effects increase with increasing the powder dose or extract from these plants and exposure time. Introduction According to Nawrot (2001), storage pests are organisms present on/in stored products of plant and animal origin, belonging to a specialized group of insects adapted to living in enclosed spaces. Originally, these organisms occurred in nests of birds, rodents and insects, feeding on dead plant or animal material. The settled human lifestyle associated with the accumulation of stocks, including crops, has contributed to the control of the new food base by pests. In addition, more and more improved storage rooms for products, among others, cereals, offer better conditions for the development of storage pests (Nawrot 2001). What s more, the invasion of numerous storage pests into new regions of the world has become possible through well-developed international trade in goods and tourism. These organisms colonize food at various stages of its production and during its transport and storage (Kłyś 2013). The presence of storage pests in stored food products exposes food producers to huge losses. Insects, through feeding on/in the product, lead to weight loss and lowering its quality. They contaminate the article with faeces, dead insects and ecdysis. They lead to moistening and heating of the attacked products (Nawrot 2001, Olejarski and Ignatowicz 2010). 225

226 Furthermore, the consumption of cereal-based products containing cuticula from insect body cover may contribute to inflammation and intestinal disorders (Kłyś 2013). Quantitative, qualitative and economic losses, as well as the threat to human health caused by the occurrence of storage pests in the stored food products leads to the search for new and effective methods of combating them. Natural plant substances are becoming increasingly important as preventive measures against pests of storage products. In the literature, we can find a lot of information about plants that limit the development of storage pests. The impact of plant substances in various forms is tested on storage pests, e.g., powders, oils, extracts or combinations thereof, which show a broad spectrum of effects, as insecticidal, antifeedant and repellent agents. Rhizopertha dominica is one of the dangerous pests of stored cereals occurring in Poland. This species comes from India, is common in Australia, Mexico, Africa, India, southern US states. In our country, it can develop throughout the year, but in heated rooms. The products attacked by R. dominica include: grains of all kinds of cereals and products of cereal origin, pasta, beans, dried fruits and vegetables, pumpkin seeds, wood (Nawrot 2001). This review article presents the impact of medicinal plants and active substances contained in them on this species of pest. Characteristics of medicinal plants showing repellent effects on R. dominica Currently, the best and the most effective method of safe pest reduction is the integrated combat, in which pest control mainly involves non-chemical methods. The use of chemical methods is allowed only with the ineffective effect of non-chemical methods with minimal negative effects on human and animal life and the environment (Olejarski and Ignatowicz 2011). In addition, non-chemical methods make it possible to reduce or even completely eliminate the use of pesticides that pose a threat to human and animal health (Boczek and Stępień 1981). Therefore, more and more scientific research concerns nonchemical methods of pest control due to their harmless nature. Plants exhibiting repellent properties against storage pests constitute a new category in this field, and their effective search may lead to replacement of plant protection chemicals with them. In addition, if repellents are used as measures for deterring storage pests, it is important that they do not have a negative effect on humans. For this purpose, a review of the literature on the repellent impact of plants on R. dominica was done and the positions were isolated, in which the plants showing positive-medicinal effects on humans were used as potential repellents (Tab. 1). Capsicum annuum L. is an annual plant from the Solanaceae family, originating from the tropical part of Central and South America, is widely grown in many countries, including Poland. It requires a warm climate. The plant produces a strong pile root and an elevated, slightly branched, not hairy stem reaching up to 1 metre in height. It has long-tail leaves, elliptical or ovate, sharpened at the top, about 5 cm long. White, radiant flowers. The fruit is a multigrain berry, empty inside (Rumińska 1981, Ożarowski and Jaroniewski 1989). Basic active compounds The most important active ingredient is capsaicin in the amount of 0,12-1,69 %. It is a substance with a very sharp and burning taste. In the fruits, together with its related compounds, it forms a capsaicin complex. These also include: dihydrocapsaicin, homocapsaicin, homodvydrocapaicin and others. There are relatively few capsaicin and other compounds in the plant s seeds. On the other hand, they contain steroidal saponins with an antibiotic effect, called capsidine and up to 30 % of oil. In addition, carotenoids can be found in the fruits, among others: capsanthin, capsorubin, zeaxanthin, lutein, kryptoxanthin and α- and β-carotene. Flavonoids are also present (among others, apiina and luteolin-7-glucoside), leukoantocyanides, essential oil in the amount of up to 1,25 %, vitamin C, B 2 and E, and mineral salts. The essential oil in its composition contains terpenes, limonene and linalool (Bukowiecki and Furmanowa 1972, Rumińska 1981, Ożarowski and Jaroniewski 1989). 226

227 Medicinal effect: - stimulates the secretion of saliva abundant in amylase and mucopolysaccharides and gastric juice, - relieves rheumatic, arthritic pains, neuralgias and myalgias (Rumińska 1981, Ożarowski and Jaroniewski 1989). Carum carvi L. is a biennial plant from the Umbelliferae family, it occurs in Europe from France through Germany beyond the eastern borders of Poland to the Urals and Asia in Siberia to the Himalayans. In Poland, it is common in meadows, bays, roadsides and pastures. Cultivated in many countries, sometimes on a large scale. In the first year of vegetation, the plant creates an earthbound rosette of leaves and produces a thick storage root. In the second year, it produces a stem up to 80 cm high, bare, angular and bipartite branched. Its leaves are three times feathery, long-tailed, with bladelike sections. Small, usually white (sometimes pink) flowers have sharpened petals, bent inwards at the top, gathered in the inflorescence composed of 5-10 umbels, embedded on uneven peduncles. The fruit is an elongated acacia longitudinally furrowed and disintegrating into two achenes (Rumińska 1981, Ożarowski and Jaroniewski 1989). Basic active compounds Fruits contain essential oils in the amount of up to 8,2 %, which includes, among others, 75 % carvone and limonene. The fruits also have up to 22% of fatty oil, up to 25% of protein compounds and sugars, flavonoids, organic acids, coumarin compounds, mineral salts and others (Rumińska 1981, Ożarowski and Jaroniewski 1989). Medicinal effect: - it relaxes smooth intestinal muscles, bile ducts and Oddi sphincter, regulating the inflow of bile and pancreatic juice into the duodenum, - it stimulates the secretion of gastric juice, improves appetite and digestion, - a carminative, - it has a choleretic and cholagogic, diuretic and bactericidal effects (Rumińska 1981, Ożarowski and Jaroniewski 1989). Curcuma longa L. is a tropical perennial reaching up to 1,5 metre in height, belonging to the Zingiberaceae family. It probably comes from East India. It is cultivated in India, Pakistan, China, the Malay Peninsula, Ceylon and the Antilles. The plant produces a tuberous root rhizome and numerous young, thickened rhizomes. A floral shoot arises from the rhizome and covers it with 4-6 leafage, lanceolate, up to 50 cm long, set on long petioles. The flowers are quite large, dorsal, yellow, collected in a stiff spike. A capsule is the fruit (Ożarowski and Jaroniewski 1989). Basic active compounds The plant rhizomes contain up to 5% of a mixture of yellow dyes, called curcuminoids, which include: curcumin and di-desmethoxycurcumin. In addition, up to 5% of essential oil, a lot of starch, up to 6% of fat and mineral salts occur in the rhizome (Ożarowski and Jaroniewski 1989). Medicinal effect: - bile-forming, - diastolic, - bactericidal, - anti-inflammatory (Ożarowski and Jaroniewski 1989). Lavandula officinalis L. is a semi-bush from the Labiatae family, most likely from Persia or the Canary Islands. In ancient times, it was moved to the Mediterranean basin. Currently, it is grown in many countries, including Poland. The medicinal lavender i san aromatic plant with straight or slightly bent stalks, strongly branched, woody at the bottom reaching 0,5 metre in height. It has short-tailed or sessile leaves, equally narrow or longitudinally lanceolate, with the whole margin slightly 227

228 folded, placed opposite on the stem. The flowers are dorsal, double-lipped, collected in inflorescences similar to the ear, mounted on the tops of stems. Each inflorescence is composed of several whorls of flowers growing from the elongated filaments. Flowers are quite small, 8 mm long. The floral cup is bluish-grey or blue, hairy crown, violet-blue or grey-brown (Ożarowski and Jaroniewski 1989). Basic active compounds Lavender flowers contain an essential oil in an amount up to 3%. It includes: linalool and its esters with acetic, butyric, caproic and isovaleric acid, as well as β-cymene, α-terpineol, geraniol, β-myrcene and other terpenes. Lavender flowers also contain tannins, triterpene compounds, coumarin derivatives, anthocyanins, organic acids, phytosterols and mineral salts (Ożarowski and Jaroniewski 1989). Medicinal effect: - improves digestion and food assimilation processes, - it has a diastolic effect on the smooth muscles of the intestines, bile ducts and urinary tract, - it reduces the state of nervous tension, feeling of anxiety and difficulty in falling asleep, - it destroys many strains of pathogenic bacteria (Ożarowski and Jaroniewski 1989). Salvia officinalis L. is a semi-bush from the Labiatae family, naturally occurring in the countries of the Mediterranean zone. In Poland it has been cultivated for several centuries. A plant with a strong, peculiar aroma that produces numerous stems reaching up to 75 cm in height, erected at the bottom, woody, four-leafed. It has opposite, long-tailed, narrowelliptical or lanceolate leaves, rounded or wedge-shaped in the base, finely cornered on the edge. Strongly branched veneering, forming a fine mesh, highlighted from the lower side. Both sides of the leaf are grey-silvery hairy. The length of the leaf blade is up to 8 cm. Flowers are dorsal, double-lipped, purple-blue, sometimes whitish (Rumińska 1981, Ożarowski and Jaroniewski 1989). Basic active compounds The leaves and herbs contain the same active compounds, however in the case of herbs in smaller amounts. The most important component is the essential oil in the amount of up to 2,5 % in the leaves, which includes numerous terpenes thujone, cineole, camphor and sesquiterpenes humulene, caryophyllene. In addition, the leaves contain tannins, multiphenolic acids (caffeic, chlorogenic), triterpene sapogenins, a bitter picrosalvin compound, an unknown estrogenic and antiperspirant substance, and mineral salts (Bukowiecki and Furmanowa 1972, Rumińska 1981, Ożarowski and Jaroniewski 1989). Medicinal effect: - anti-inflammatory, - it destroys many strains of pathogenic microorganisms or inhibits their growth, - it inhibits the intense growth of the saprophytic bacterial flora in the digestive tract, - it prevents excessive fermentation and painful bloating, - it inhibits the secretion of sweat (Rumińska 1981, Ożarowski and Jaroniewski 1989). Repellent effect of medicinal plants on R. dominica As a result of a review of the literature on the repellent effect of plants on R. dominica it was found that 5 species of medicinal plants: Capsicum annuum L., Carum carvi L., Curcuma longa L., Lavandula officinalis L., Salvia officinalis L. exhibit repellent effects on R. dominica. Their repellent potential against R. dominica is described below. Capsicum annuum L. Shayesteh and Ashouri (2010) examined the repellent effect of the powdered chilli pepper fruits C. annuum on R. dominica. The cup bioassay technique was used for the experiment, based on a unidirectional migration of insects. Insects 20 pieces, were placed in a cylindrical vessel with perforations on the side wall enabling them to escape. In addition, the 228

229 bottom of the container was made of mesh. The dish contains 200 g of grain with the addition of powdered plants in various concentrations 0.25, 0.75, 1.5 and 2.5 % on the weight of plant material/weight of grain (w/w) basis. Insects emerging from the cylinder fell into the larger contained underneath. The experiment was controlled after 1, 6 and 24 h. The highest repellent effect nearly 50 % was obtained at the highest applied concentration (2.5 %) and the longest exposure time of red pepper powder, that is after 24 h. Carum carvi L. The influence of powdered Carum carvi L. fruits on R. dominica was examined by Kłyś (2011). One-way migration (emigration) was used for experiments. For this purpose, a set of dishes was used smaller, equipped with holes allowing the emigration of insects placed in a larger dish. The smaller dish was placed on legs that prevent the return of insects from the larger dish. 40 g of food wheat was added to both dishes. In a smaller dish, an additional 0,5 g of powdered plant was placed, and then 40 adult R. dominica individuals were introduced to it, which constituted the initial population. Controls of the emigrated individuals were carried out after 40 days, and then at 30-day intervals, with simultaneous replenishment of the food, to maintain a constant weight of 40 g of grain. This treatment enabled a long-lasting experiment. The addition of powdered cumin to wheat, which is a substrate for the parent population, resulted in an increase in the emigration process compared to the control sample, mainly at the early stage of experiments, i.e. after 40, 70 and 130 days. Starting from day 190 to day 250, more than 70% of individuals leave the original population, as in the control breed. Curcuma longa L. Shah et al. (2015) examined the repellent influence of the extract, among others, from the roots of Curcuma longa on R. dominica. They used 3 extract concentrations for the research 25, 50 and 75 %, interacting with them on the test object for 10 days, controlling the experiment every day. The filter paper was used for the experiment, placed on a petri dish, cut into two equal parts, where one was soaked in the test extract and the other with water. 30 adults of R. dominica were released into the middle of the dishes. The repellent effect increased with increasing the dose and exposure time of the extract. The highest repellent effect (66,67%) was obtained with the highest 75 % concentration of the extract, after the longest exposure time 10 days. The repellent effect of curcuma Curcuma longa on R. dominica, but in a different form powdered roots, was studied by Shayesteh and Ashouri (2010). The experiment was based on the cup bioassay technique (described in detail in the analysis of Capsicum annuum L.), based on the unidirectional migration of insects. Twenty pieces of beetles were placed in a dish, where 200 g of grain with the addition of powdered plants in various concentrations was added 0.25, 0.75, 1.5 and 2.5 % on the weight of plant material/weight of grain (w/w) basis. The experimental control was performed after 1, 6 and 24 h. The highest repellent effect over 40 % was achieved by the authors with the highest applied concentration (2.5 %) and the longest exposure time of turmeric powder, that is after 24 h. Lavandula officinalis L. Kłyś (2011) conducted experiments on the repellent potential of powdered fruits of Lavandula officinalis L. against R. dominica. For this purpose, she used the phenomenon of oneway migration (emigration) for experiments. On 40 g of wheat feed in the starting dish, from which the beetles emigrated, was placed an additional 0,5 g of the powdered plant, and then 40 adult R. dominica were allowed inside it (constituting the initial population). Controls were carried out after 40 days and then at 30-day intervals, with simultaneous replenishment of the medium to maintain a constant weight of 40g of grain. Lavender showed very high repellent potential. The addition of powdered lavender to wheat resulted in an increase in emigration compared to the control culture during the 190 days of experiments. From the beginning of experiments to the 160 th day, the emigration rate was very high and ranged from 100% to 70%. 229

230 After 40 th and 70 th day of the experiment, 100% of the emigration of R. dominica individuals was observed from wheat with the addition of lavender. Salvia officinalis L. The effect of pulverised sage Salvia officinalis L. on R. dominica was studied by Kłyś (2007). The one-way migration (emigration) phenomenon was used for the experiments. For the purpose of the experiment the following was used: 40 g of food (wheat), 40 adult beetles, 0,5 g powdered plant. Controls of the migrated individuals were carried out after 40 days, and then at 30-day intervals, with simultaneous replenishment of the wheat substrate. The studies have shown that the introduction of powdered sage increased the initial rate of emigration, and the colonisation of grain located outside the resident population range. The emigration ratio was already very high, peaking at 90% at 40 days. However, after a long period of exposure of sage to R. dominica, there was no high increase in emigration of the starting population of beetles in comparison to the control sample. From the 70th day onwards, about 70% individuals emigrated from the resident population zone, a similar level to the emigration rate in the control culture. It was found that powdered C. longa and C. annum applied in a concentration of 2.5% showed the highest repellence against R. dominica after 24 hours. While with the prolonged exposure to R. dominica of the plants: C. carvi, L. officinalis and S. officinalis, the strongest repellence was demonstrated by L. officinalis. Table 1. List of medicinal plants showing repellent effects on Rhyzopertha dominica. Plant species Solvent/product References Capsicum annuum L. powder Shayesteh and Ashouri (2010) Carum carvi L. powder Kłyś (2011b) Curcuma longa L. powder Shayesteh and Ashouri (2010) extract Shah et al. (2015) Lavandula officinalis L. powder Kłyś (2011b) Salvia officinalis L. powder Kłyś (2007) References 1. Boczek J., Stępień Z Szkodniki żywności. Entomologia a Gospodarka Narodowa. PWN, Warszawa: Bukowiecki H., Furmanowa M Botanika farmaceutyczna. Państwowy Zakład Wydawnictw Lekarskich. Warszawa: 404, , Jilani G., Saxena R.C Repellent and feeding deterrent effects of turmeric oil, sweetflag oil, neem oil, and a neem-based insecticide against lesser grain borer (Coleoptera: Bostrychidae). J. Econ. Entomol. 83: Kłyś M The influence of the herbs sage and wormwood on the migration of Rhyzopherta dominica (F.) (Coleoptera: Bostrichidae) populations. J. Stored Prod. Res. 43: Kłyś, M Repellent effect of the plants lavender and caraway on the migration of Rhyzopertha dominica F populations (Coleoptera: Bostrichidae). Ent. Generalis 33: Kłyś M Wpływ ziół na niektóre gatunki chrząszczy szkodliwe w magazynach i przechowalniach. Wydawnictwo Naukowe Uniwersytetu Pedagogicznego. Kraków: Nawrot J Owady szkodniki magazynowe. Wyd. Themar. Warszawa: Olejarski P., Ignatowicz S Szkodniki magazynowe w produktach spożywczych. Postępy w Ochronie Roślin 50(2):

231 9. Olejarski P., Ignatowicz S Integrowana metoda zwalczania szkodników magazynowych podstawą zapewnienia wysokiej jakości przechowywanego ziarna zbóż. Postępy w Ochronie Roślin 51(4): Ożarowski A., Jaroniewski W Rośliny lecznicze i ich praktyczne zastosowanie. Instytut Wydawniczy Związków Zawodowych. Warszawa. 435ss. 11. Rumińska A Rośliny lecznicze. Państwowe Wydawnictwo Naukowe. Warszawa. 548ss. 12. Shah T.B., Saeed M., Khan I., Khan A., Khan G.Z., Farid A., Khan S.M Repellency evaluation of selected indigenous medicinal plant materials against Rhyzopertha dominica (Herbst) (Coleoptera: Tenebrionidae). J. Ent. Zool. Stud. 3: Shayesteh N., Ashouri S Effect of four powdered spices as repellents against adults of Rhyzopertha dominica (F.), Sitophilus granarius (L.) and Tribolium castaneum (Herbst) in laboratory conditions. Mat. 10 th Int. Work. Conf. Stored Prod. Protec., 27 June 2 July 2010, Estriol, Portugal:

232 232

233 Awareness of human health threats caused by food pests Plodia interpunctella (Arthropoda, Insecta) among high school and medical school students Wanda Baltaza 1, Monika Dybicz 2, Konrad Perkowski 3, Marcin Padzik 1, Małgorzata Kłyś 4, Natalia Malejky 4, Milena Żerańska 1*, Marcin Wieliczko 1*, Lidia Chomicz 1 1Department of Medical Biology, Faculty of Health Science, Medical University of Warsaw, 73 Nowogrodzka Str., Warsaw, Poland. wanda.baltaza@gmail.com 2Chair and Department of General Biology and Parasitology, Medical University of Warsaw, ul. Chałubinskiego 5, Warsaw, Poland, 3Department of Orthodontics, Medical University of Warsaw, ul. Nowogrodzka 59, Warsaw, Poland 4Department of Ecology and Environmental Protection, Institute of Biology, Pedagogical University of Cracow, Podbrzezie 3, Kraków, Poland; 1*Department of Medical Biology, University s Scientific Circle, Medical University of Warsaw, Warsaw, Poland Abstract The common food pests belonging to species Plodia interpunctella (Hübner 1813) occur in various areas where food products are stored: in commodities, warehouses, grain bins. The pyralids often infest different spaces of households and also human households. The insects cause economic losses in foodstuffs in many developmental countries. Especially, larval forms of the insects damaged stored food products that change flavor and smell, and became useless for consumption. Various chemicals are applied to control P. interpunctella populations, however, effectiveness of these agents is limited and a resistance to many insecticides develops. The intensified dispersion of pyralids was observed by us for more than 5 years in households and public use facilities: schools, hospital kitchens, pharmacy warehouses. As no systematic studies were earlier conducted in terms of possible transmission by the arthropods of microbiota potentially pathogenic for humans, interdisciplinary epidemiological studies have been undertaken by us on the question; students of Scientific Circle participated in the studies. Results our previous investigation showed that the insects cause not only economic losses in foodstuffs but may act as sources of opportunistic and allergenic microorganisms. In the present study, results of further investigations on pyralid s infestation of selected space of human environment confirmed role of pyralids as possible sources of microbiota infectious for humans. The level of knowledge of 100 nursing, midwifery, medical analytics students and high-school students. about the risk for the health caused by P. interpunctella pests was also assessed. The questionnaire consisting of 15 questions concerning epidemiology and prevention of the pest s dispersion in human environment was used.. Awareness of human health threats caused by the food pests differs particular analyzed student groups. Expanded knowledge about transmission by the pests of 233

234 opportunistic and allergenic microbiota is essential for better understanding of the health risk caused by the pyralids in human environments. Introduction The cosmopolitan insects of Plodia interpunctella (Hubner 1813) occur in various areas where food is prepared and stored (Ignatowicz 1998, Mason 2003, Rees 2004, Mohandass et al. 2007, Fasulo and Knox 2007, Cranshaw 2008, Olejarski and Ignatowicz 2010, Arthur et al. 2013). The harmful arthropods were the first time described in 1931 in the state of California (USA) as grain, nut, candy pests (Hamlin and al. 1931). The pyralids are found in mills, factories producing foodstuffs, bakeries, gastronomic enterprises, shops, storage areas. The insects often infest different spaces of human households, also out of food products; they are mainly active at evening and night. The pests feed and reproduce on the surfaces of commodities and ready products; they develop during all year. Females lay eggs several times through the whole season, in the vicinity or on products that young larvae will feed. Larvae of P. interpunctella are considered as the most harmful for stored foodstuffs; these stages contaminate surfaces of products, spin massive amounts of the silk web that accumulate insect feces, egg shells and remnants of damaged products. The developmental forms can feed on different types of food: groats, rice, pastas, breakfast cereals, cookies, chocolate, coffee, dried milk, dried fruits, peanuts, spices; also, dry pet food for dogs, cats, birds, fish may also be affected (Ignatowicz 1998, Mason 2003, Rees 2004, Beckemeyer and Shirk2004, Mohandass et al. 2007, Olejarski and Ignatowicz 2010, Siemińska 2010). The larvae damage stored food products that change flavor and smell, and became useless for consumption (Siemińska 2010, Chomicz et al. 2011, 2012, 2013, Sady 2014). The infestation of food storage areas by the pests cause losses in foodstuffs that are many years problem of food industry in various regions of world; also in Poland. In different regions of world searches to prevent pyralid s dispersion and effective eliminate the harmful insects are conducted. (Yue 2003, Pourmirza et al. 2007, Nansen and Philips 2004). Various chemicals investigated and applied to control the pyralid populations indicate limited effectiveness, among other, because of the development of an insecticide resistance. Different control measures are applied to reduce damages caused by P. interpunctella in areas where foodstuffs are produced and stored. As it has been revealed that the temperature and light influence the pyralid development (Mason 2003, Rees 2004, Mohandass 2007, Fasulo and Knox 2007, Johnson et al. 1992, Nansen and Philips Sambaraju and Phillips 2008, Ignatowicz 2011), thus freezing of infested products for several days in temperature -18 C kills insects, however many products can t be frozen. Also, the pyralids are killed in temperature 54 C - 66 C for 24 hours (Johnson et al.1992, Mahroof and Subramanyam 2006, Fontenot et al. 2012). Nontoxic pheromone traps are recently useful and commonly applied as good monitoring tool for early detection and reduction of pyralid s infestation in areas where food or grain products are stored (Mankin et al. 1999,. Kłyś 2013, Chomicz et al. 2012, 2013, Chruścikowska et al. 2014, Zawadzki et al. 2016a,b) Although larval forms, their webs and feces are common contaminates of the stored products, and adult moths live in human environments also out of food, no systematic studies were earlier conducted in terms of possible transmission by the arthropods of microbiota potentially pathogenic for humans. The dispersion of food pests in human environment increase during the last years. The intensified spread of pyralids is observed by us for more than 5 years in households and public use facilities: schools, hospital kitchens, pharmacy warehouses. It inspired us to undertake interdisciplinary epidemiological studies on the question; students of Scientific Circle participated in the studies (Chomicz et al. 2011, 2012, 2013, Chruścikowska et al. 2014, Zawadzki et al. 2016a,b). Results of these studies reveal that the insects cause not only economic losses in stored food products.- they may transmit different microorganisms, including infectious for humans. These are the first such studies in 234

235 Poland on dynamics of infestations of human environment by this pests that show important role of the pyralids as possible sources of microorganisms potentially pathogenic for humans. As in the last years the intensified dispersion of pyralids was observed in various areas where food is prepared and stored, the threat for the public health should be taken into consideration. Therefore, in this report, we present results of further studies on effects of pyralid infestation of human environments. The aim of the study was also to investigate the level of knowledge and awareness of health risk caused by food pests Plodia interpunctella among high school and medical school students. Material and Methods The material for this study was collected during winter months 2018 in kitchen and adjacent spaces of two flats in the multi - family houses in the urban environment. Inside the houses / flats investigated, the temperature was C. Some imago forms were collected during flight and directly from food products; adult moths were also taken with application of Jh pheromone traps. The moths captured, identified as belonging to Plodia interpunctella species, were examined in term of possible source of microbiota infective for humans. Direct microscopic preparations were used for detailed analysis. For preliminary identification of Gram- positive and Gram-negative bacteria strains, morphological features were assessed in Gram - stained slides. The conventional in vitro techniques were also used to identify bacterial and fungal strains. The bacteriological agar and agar with 5% defibrinated sheep blood, Chapman s plate growth medium for recovery and isolation of Staphylococci, and Mc Conkey s medium for identification of Enterobacteriaceae were used..sabouraud medium and Chromagar - Candida BBL plates were applied to detect fungi. In the second part of the study, the level of knowledge and awareness of the health risk caused by food pests Plodia interpunctella was investigated. The 4 study group consisted of adolescents: nursing, midwifery, medical analytics students and high school students, 25 respondents in each group, who were aged and 16-18, respectively, in the year In the conducted study, the questionnaire has been applied consisted of 15 questions that concerned the knowledge about pyralids, the pests as possible source of microbiota infective for humans, as well as preventive measures.. Results The assessment of microscopic preparations and examination of in vitro cultures of 85 moths taken from pheromone traps in kitchen and adjacent spaces of two flats in the multifamily houses, revealed the presence of various strains of bacteria and moulds potentially pathogenic for humans. Among of Gram-positive bacteriae Enterococcus faecalis, E. faecium, Staphylococcus epidermidis, Micrococcus luteus, Bacillus sp., and among of Gram- negative bacteria strains - Escherichia coli and Klebsiella oxytoca have been found. Among mould strains of genus Aspergillus: Aspergillus niger, A. flavus, A. versicolor and Aspergillus sp. have been isolated. Results of the second part of the study concerning the level of knowledge and the awareness of the health risk caused by food pests P. interpunctella showed clear differences between particular analyzed student groups: nursing, midwifery, medical analytics students and high school students. Only 5/25 high school students indicated that possess a knowledge about pyralid pests, while 23/25 students of midwifery declared this answer. The forms indicated as the contaminating food products were mainly larvae of the insects. The food pests as possible source of agents, infective for humans were indicate only by one respondent of high school. Results of the analysis concerning the knowledge about human health risk caused by food pests Plodia interpunctella declared by 100 respondents are presented in Table I. 235

236 Discussion and conclusions Comparative assessment of results of the present studies showed that infestation of household spaces by the pyralids may cause additional contamination of food products with microbiota dispersed by the insects and thus increased risk for human health. The threats is special medical importance in respect to increasing prevalence of person of high risk group with immune dysfunctions. Gram- positive cocci E. faecium and E. faecalis, detected in pyralid moths may cause life -threatening opportunistic infections in elderly persons; some strains of the bacteria are detected with increasing frequency in hospital-acquired infections: pneumonia, stomatopathy, nosocomial urinary tract infections (Murray et al. 2007). Gram positive bacteria of Micrococcus luteus living in the human mouth and the upper pharynx, considered as non-pathogenic saprophytes, in persons with weakened immune system may cause serious pneumonia, septic arthritis, and, also infections associated with surgical procedures. Gram-negative Escherichia coli particularly in persons with immunological disability may cause respiratory tract, urinary tract infections, severe diarrhea in adults and children, also nosocomial infections and sepsis. The detected in pyralids Klebsiella oxytoca, human colon symbionts may infect different tissues and organs; in persons with weakened immune system the bacteria cause serious systemic diseases; some drug resistant Klebsiella strains are known as causative agents of hospital-acquired infections. Among of fungi, spores and mycotoxins (aflatoxines, ochratoxines) produced by Aspergillus strains, often found in these pests, may cause serious health risk for humans (Dutkiewicz and Górny 2002, Murray et al. 2007, Krzysiak et al. 2011). The mould conidia that may be inhaled from air, dust or water droplets are the causative agents of serious pulmonary, also allergenic human infections. An invasive aspergillosis may develop in persons with weakened immune system that is recorded as an multi-organ opportunistic disease. Additionally, it should be underlined that a resistance to some anti-fungal azoles revealed for A. niger strains detected by us in Plodia interpunctella may be a factor influencing poor treatment efficacy (Zawadzki et al.2 016b.). Production and storage of food as important problem of public health, and practical aspects of food hygiene have to include the specific activities for foodstuffs safety (Turlejska 2003). Food pests not only can contaminate products with their webs and feces, but also cause increase in temperature and humidity in their living areas thus influence conditions favorable for multiplying of microbiota (Siemińska 2010, Sady 2014). Results of our studies show that P. interpunctella insects contaminating foodstuffs not only damage stored food products and cause economic losses but may induce serious threat for human health as possible reservoirs /sources of infectious microbiota including allergenic and opportunistic strains. Moreover, although there were significant differences in the level of knowledge of nursing, midwifery, medical analytics students in comparison to high-school students, the investigations show that the level of knowledge and awareness of the health risk caused by food pests Plodia interpunctella is insufficient. Threats for individual and public human health caused by P. interpunctella food pests as still poor known sources of infectious microbiota should be taken into account, and the observance sanitary and controlling standards applied in food produce and distribution is of great importance. Expanded knowledge about transmission by the pests of opportunistic and allergenic microbiota is essential for a prevention of the health risk caused by the pyralids in human environments. The threat is special medical importance, Therefore, it should be taken into consideration that educational efforts are desirable for the better understanding of the risk for human health induced by the P. interpunctella and a role of the food pests in spread of infectious microbiota in human environments. 236

237 Acknowledgements The authors thank Aga Kuryłowicz, Kamelia Łukasik and Weronika Marzęta, the students of Department of Medical Biology University s Scientific Circle for help with collecting material and polling. Table I. The knowledge about human health risk caused by food pests Plodia interpunctella declared by 100 respondents Respondent's groups analyzed nursing students of students of high school students midwifery medical analytics students number of respondents* who declared listed answers possess of a knowledge about pyralid pests media indicated radio, tv, newspaper as sources of internet the knowledg school, study others detected larvae developmental imago forms moults of pests fragments of and other product glued contaminations by the cocoon recommended use of products after procedure with removing pests food products removal of the contaminated entire product with pests lack of knowledge of how to proceed P. interpunctella bacteriae as possible source yeast- like fungi of agents, infective and/or molds for humans: viruses lack of this knowledge methods of traps with preventing apple vinegar pest traps with dried citrus peels / cedar wood pheromone traps traps with glue

238 others plastic bags storage of food plastic packaging prevention against paper packaging contamination glass packaging with pyralids metal packaging others * in relation to 25 persons involved in each respondent groups Fig.1. Adult moths of Plodia interpunctella on Jh pheromone traps. References 1. Arthur F.H., Campbell J.F. Toews M. D Distribution, abundance, and seasonal patterns of Plodia interpunctella (Hubner) in a commercial food storage facility. J. of Stor. Prod. Res. 43: Beckemeyer E.F., Shirk, P.D Development of the larval ovary in the moth, Plodia interpunctella. J. Insect. Physiol. 50: Bulpa P., Dive A., Sibille V Invasive pulmonary aspergillosis in patients with chronic obstructive pulmonary disease. ERJ. 30: Chomicz L., Chruścikowsk, A., Starościak B., Padzik M., Olędzka G., Baltaza W., Olczak M Plodia interpunctella (Arthropoda: Insecta) as a risk factor for spread of opportunistic/ pathogenic microorganisms in different areas of human environment. In: Buczek A., Błaszak C. (eds.), Arthropods. The medical and veterinary aspects, Koliber, Lublin: Chomicz L., Chruścikowska A., Starościak B., Padzik M., Olędzka G., Baltaza W., Olczak M Plodia interpunctella (Arthropoda: Insecta) as a risk factor for spread of opportunistic/ pathogenic microorganisms in different areas of human environment. In: Buczek A., Błaszak C. (eds.), Arthropods. The medical and veterinary aspects, Koliber, Lublin: Chomicz L., Starościak B., Chruścikowska A., Kryczka T., Iwańczyk B., Olędzka G Microorganisms transmitted by pests from genus Plodia (Insecta: Lepidoptera, Pyralidae) as a risk for human health. In: Buczek A., Błaszak C. (eds.), Arthropods. Human and animal parasites. Akapit, Lublin:

239 7. Chomicz L., Starościak B., Chruścikowska A., Olędzka G., Iwańczyk B., Padzik M., Baltaza W Evaluation of drug susceptibility/resistance of microorganisms transmitted by pyralid moths (Arthropoda: Insecta) occurring in human household environment. In: Buczek A. Błaszak C. (eds.), Arthropods. The medical and economic importance. Akapit, Lublin: Chomicz L., Starościak B., Chruścikowska A., Olędzka G., Iwańczyk B., Padzik M., Baltaza W Evaluation of drug susceptibility/resistance of microorganisms transmitted by pyralid moths (Arthropoda: Insecta) occurring in human household environment. In: Buczek A., Błaszak C. (eds.), Arthropods. The medical and economic importance. Akapit, Lublin: Chruścikowska A., Chomicz L., Starościak B., Padzik M., Asman M, Baltaza W., Olczak M The infestation of selected household areas in Poland with pyralid pests, health risk factors as reservoirs/vectors for human pathogens. In: Buczek A., Błaszak C. (eds.), Arthropods. Threat to human and animal health, Koliber, Lublin: Cranshaw W.S Home & Garden - Indian Meal Moth. Colorado State University Extension. 5: Dutkiewicz J., Górny R.L Biologiczne czynniki szkodliwe dla zdrowia klasyfikacja i kryteria oceny narażenia. Med. Pr. 53: Fasulo T.R., Knox M.A Indian meal moth, Plodia interpunctella (Hübner). University of Florida IFAS Extension. EENY Fontenot E.A., Arthur F.H., Nechols J.R., Throne J.E Using a population growth model to simulate response of Plodia interpunctella Hübner to temperature and diet. J. Pest Sc.85: Hamlin J.C., Reed W.D., Phillips M.E Biology of the Indianmeal moth on dried fruits in California. USDA Technical Bulletin. 242: Ignatowicz S Wykrywanie szkodników magazynowych w przechowywanym zbożu i produktach jego przemiału. Zastosowanie pułapek z feromonami płciowymi i atraktantami pokarmowymi. Przeg. Zboż-Młyn. 8: Ignatowicz S Zapobieganie występowaniu omacnicy spichrzanki i mklików w magazynach paszowych. Ogólnopolski Informator Drobiarski.4: Johnson J.A., Wofford P.L., Whitehand L.C Effect of diet and temperature on development rates, survival and reproduction of the Indian meal moth (Lepidoptera: Pyralidae). J. Econ. Entomol. 85: Kłyś M Various aspects of the harmful impact of arthropod pests on stored cereal grain and food products. In: Buczek A., Błaszak C. (eds.) Arthropods. The medical and veterinary aspects. Lublin, Koliber, Krzysiak P., Skóra M., Macura A.B Atlas grzybów chorobotwórczych człowieka. Med. Pharm., Polska. 20. Mahroof R., Subramanyam B.H Susceptibility of Plodia interpunctella (Lepidoptera: Pyralidae) developmental stages to high temperatures used during structural heat treatments. Bull. Entomol. Res. 96: Mankin R.W., Arbogast R.T., Kendra P.E., Weaver D.K Active spaces of pheromone traps for Plodia interpunctella (Lepidoptera: Pyralidae) in enclosed environments. Physiological and Chemical Ecology. 28: Mason L.J Indianmeal moth Plodia interpunctella (Hübner). Purdue University, Department of Entomology. Grain Insect Fact. Sheet. E-223-W. 23. Mohandass S., Arthur F.H., Zhu K.Y., Throne J.E Biology and management of Plodia interpunctella (Lepidoptera: Pyralidae) in stored products. J. Stored. Prod. Res. 43: Murray, P.R., Baron, E.J., Jorgensen, J.H., Landry, M.L., Pfaller, M.A Manual of clinical microbiology. 9th edition. ASM Press, Washington, USA 239

240 25. Nansen C., Philips T. W Attractancy and toxicity of an attracticide for indianmeal moth, Plodia interpunctella (Lepidoptera: Pyralidae). J. of Econ. Entomol. 97: Olejarski P., Ignatowicz S Szkodniki magazynowe w produktach spożywczych. Prog. Plant. Prot. 50: Pourmirza A.A., Nasab F.S., Zadeh A.H Evaluation of acetone vapors toxicity on Plodia interpunctella (Hübner) (Lepidoptera: Pyralidae) eggs. Pak. J. Biol. Sci. 10: Rees D Insects of Stored Products. CSIRO Publishing, Collingwood, Australia. 29. Sady E Latajaca sublokatorka - Plodia interpunctella. _latajaca-sublokatorka.php 30. Sambaraju K.R., Philips T.W Responses of adult Plodia interpunctella (Hübner) (Lepidoptera: Pyralidae) to light and combinations of attractants and light. J. Insect Behav. 21: Siemińska E Szkodliwe motyle. Omacnica Spichrzanka- Plodia interpunctella Hübner Turlejska H Zasady GMP/GHP oraz system HACCP jako narzędzia zapewnienia bezpieczeństwa zdrowotnego żywności. Warszawa, FAPA. 33. Yue B., Wilde G.E., Arthur F.H Evaluation of thiamethoxam and imidacloprid as seed treatments to control European corn borer and Indian meal moth larvae. J. Econ. Entomol. 96: Zawadzki P.J., Starościak B., Baltaza W., Dybicz M., Pionkowski K., Pawłowski W., Kłyś M., Chomicz L. 2016a. The threats for human health induced by food pests of Plodia interpunctella as reservoirs of infectious microbiota / Zagrożenia zdrowia człowieka indukowane przez szkodniki żywności Plodia interpunctella jako rezerwuary infekcyjnych microbiota. Przegl. Epidemiol. 70, 4: Zawadzki P.J., Starościak B., Dybicz M., Perkowski K., Baltaza W., Kłyś M., Pionkowski K., Jaśniewska E., Chomicz L b. Opportunistic strains - risk factors of infections in humans - detected in synanthropic arthropods occurring inside and in vicinity of health facilities. In: Arthropods. Interrelations in the host-ectoparasite-pathogen system. Edited by A. Buczek, C. Błaszak. Lubin: Koliber,

241 Millipedes (Diplopoda) their parasites, hosts, predators and symbionts. Part I Grzegorz Kania Chair and Department of Biology and Parasitology, Medical University of Lublin Abstract The aim of this paper is to describe some examples of natural enemies of Diplopoda. The revision includes parasites that belong to: Gregarines, Planarians, Acanthocephalans, Cestoda: Cyclophyllidea, Nematoda: Rhigonematida; Oxyurida: Thelastomatidae and Nematomorpha: Gordioidae. Control of millipede s populations by parasites, host, predators, symbionts and commensals was noted. Introduction Millipedes (Diplopoda) are diverse arthropods that include 16 orders representing species in 145 families. Millipedes are a major component of terrestrial ecosystems in the temperate, subtropical and tropical areas of the world (Golovatch and Kime 2009, Minelli and Golovatch 2013, Enghoff, 2015). The millipede Oxidus gracilis C. L. Koch (syn.: Orthomorpha gracilis L. Koch, 1887) (Diplopoda: Polydesmida: Paradoxosomatidae) is indigenous to Southeast Asia, is free-living throughout the tropics, subtropics and warm temperate areas (Enghoff et al. 2015). This species also occurs in Japan (Niijma 2001) and in the southern part of North America (O Neill and Reichle 1970, Bennett and Kerr 1973). O. gracilis often develops in massive populations in the synanthropic habitats (Niijma 2001). The species inhabits mainly the humid warm habitats, the hot parts of Botanical gardens, and in greenhouses in temperate regions including Siberian Botanical Gardens (Nefediev et al. 2014). It is an introduced alien species in Europe (Mock 2001, Stoev et al. 2010, Kania 2011, Kocourek 2013, Decker et al. 2014).The dispersal of this species within Europe is related to the trading and growing of tropical plants in the greenhouses. It is considered as a pest of ornamental plants (Kania 2009, 2017). The millipede Chamberlinius hualienensis Wang, 1956 (Diplopoda: Polydesmida). As an invasive and alien species on the subtropical island of Hachijojima with its lack of predators, populations of the species increased rapidly. The mass migration of the millipede Ch. hualienensis in the Japanese Izu Island of Hachijojima were observed and described. In the autumn of 2014 the largest mass occurrence of Chamberlinius hualienensis to date was seen on the island (Meyer-Rochov 2015). Data on natural enemies of Diplopoda is necessary for control millipede s populations. The aim of the paper is to describe parasites, host, predators, symbionts and commensals of millipede species. Protozoa: Gregarines (Eugregarinida, Apicomplexa) Cephaline gregarines belong to order Eugregarinida, class Sporozoea, and phylum Apicomplexa. The Eugregarinida are all parasitic and are restricted to invertebrates. The anterior part possesses hooks, suckers, simple filaments, or a knob 241

242 for anchoring the parasite the cells of the host (Allaby 2003, Clopton 2009). The gregarines fauna inhabiting the intestines of invertebrate species. They also live in Malpighian tubules, fat tissue, hemolymph, and body cavity of invertebrates (Margulis et al. 1993). Infection by cephaline gregarines is common and widespread in insects and millipedes. Levine (1970) described 120 species of gregarines from the eight genera that can infect millipedes. Gregarines commonly occurs in the different host millipede species. Stenophora caudata Lipa, 1967was found in the millipede Megaphyllum projectum (Lipa, 1967a). juli (Frantzius, 1846, Labbe, 1899) was observed in the following milipedes: Craspedosoma alemannicum, Cylindroiulus londinensis, Cylindroiulus silvarum, Julus terrestris, Ophyiulus falax, Ommatoiulus rutilans, Ommatoiulus sabulosus and Tachypodoiulus albipes (Geus, 1969, Lipa, 1975). Stenophora juli was recorded in the millipede Pachyiulus hungaricus (Golemansky and Lipa 1991). Stenophora julipusilli (Leidy, 1853) Crawley, 1903 was observed in the millipede species: Craspedosoma alemannicum, Cylindroiulus londinensis, Hypsoiulus alpivagus, Leptophyllum nanum, Leptoiulus proximus, Ommatoiulus sabulosus, Tachypodoiulus albipes and Unciger foetidus (Geus, 1969), and in Cylindroiulus boleti (Valigurova & Matis, 2001), and in Rossiulus kessleri (Julidae) (Brygadyrenko Svyrydchenko 2015). Analysis of the contents of the intestines of Rossiulus kessleri revealed presence of Stenophora dauphinia Watson and Stenophora juli, respectively. Stenophora beroni n.sp. (Gregarinida: Stenophoridae) was found in the millipede Balkanopetalum armatum Verhoeff (Golemansky 1973 a). Stenophora bulgarosomae n. sp. (Gregarinida: Stenophoridae) was indicated in the millipede Bulgarosoma bureschi Verhoeff (Golemansky 1973 b), and in the millipede Bulgarosoma meridionale Tabacaru (Golemansky and Lipa 1991). Stenophora gervaisiae n. sp. It was found in the troglophilic millipede Trachysphaera (=Gervaisia) costata Waga (Golemansky and Lipa 1991). Trachysphaera costata Waga, 1857 is widespread European millipede species. It inhabits the leaf litter of the forests on limestone, and caves as troglophile. Stenophora orthomorphae (Lipa, 1967) It was found in the flat-backed millipede Orthomorpha gracilis = Oxidus gracilis C. L. Koch (Geus 1969, Lipa, 1967a, Golemansky and Lipa 1991, Golemansky 2010, Golemansky et al. 2010). S. orthomorphae was also identified in the striped millipede Ommatoiulus sabulosus (Valigurova and Matis, 2001). Three species of eugregarines were also observed in Oxidus gracilis: Stenophora nematoides Leger et Duboscq, 1903, Stenophora robusta Ellis, 1912, and Fonsecaia polymorpha Pinto, 1922 (Golemansky 2010, Golemansky et al. 2010). Stenoductus carlogoni n. sp. A cephaline gregarine recovered from the Indian millipede, Carlogonus palmatus Demange, 1977 (Janardanan and Ramachandran, 1979) Gregarina polymorpha (Apicomplexa: Eugregarinida) in the haemocoel of the stripped millipede Ommatoiulus sabulosus (Kania 1998). Monoductus lunatus (Monoductidae) and the family Stenophoridae (Apicomplexa: Eugregarinida). Most of the gregarines were found in the anterior and middle parts of the alimentary canal in the rusty millipede Trigoniulus corallinus (Spirobolida) (Bush et al. 2001, Chang Wei-Luen et al. 2004). Stenophora bristili n.sp. (Apicomplexa, Sporozoea) The endoparasitic cephaline gregarine Stenophora bristili was found in the gut content of millipede Chondromorpha severini (Silvestri) (Bhandari and Nikam, 2013). 242

243 The pathogenic effect of Eugregarines in insects leading to pathological changes of the intestinal epithelium, physiological influence on host and increase of the rate death among the insects via co-infections was reported by Lipa (1967b, 1976), and Valigurova (2012). According to Hopkin and Read (1992), heavy infestations of gregarines may cause the development of gangrene in the legs of millipedes, and the legs may decay leaving stumps. According to Chang Wei-Luen et al. (2004) millipede gregarines caused unusual impaired motion on the central and posterior body parts, and the millipede died of infection. Besides of gregarines, Levine (1986) has been identified Gibbsia archiuli (Apicomlexa, Eucoccidiorida) in the millipede Ommatoiulus (=Archiulus) moreleti (Diplopoda: Julida). The protozoan parasite Nyctotherus spirostreptae (Protozoa: Ciliate) was described from the intestine contents of the millipede Spirostreptus sp. (Lalpotu 1980). Tricladida (Planarians, class Turbellaria). The Turbellaria are able to go without food for long periods, but during starvation they grow smaller. This reduction in size is accompanied by the absorption and digestion of the internal organs, which disappear in a regular order. The first things to go are eggs which are ready for laying, then follow the yolk glands and the remainder of the generative apparatus. Finally the ovaries and the testes disappear, so that the animal is reduced to sexual immaturity. Next the parenchyma, the gut and the muscles of the body wall are reduced and consumed. On feeding these starved forms will regenerate all the lost organs and return to the normal size. The systematic arrangement of the Turbellaria is based primarily on the structure of the gut. This is an order of Platyhelminthes (or flatworms) which have a divided intestine and a pharynx. In the order Tricladida the gut is divided into three divisions with numerous lateral diverticula from each division. Nearly all are free-living predators, feeding on small invertebrates and sucking the contents out of larger ones by means of their eversible pharynges. A considerable degree of host specificity is manifested by these worms. Most symbionts are commensals, but few are true parasites (Schmidt and Roberts 1989). Land planarians are predators of a wide variety of animals including snails, slugs, woodlice, beetle larvae, earthworms, centipedes and millipedes (Schubart 1955, Stojałowska 1961). The blue land planarian, Caenoplana coerulea (Moseley) (Tricladida: Geoplanidae), is a predator of the black Portugese millipede, Ommatoiulus moreleti (Lucas) (Diplopoda: Julidae) (Terrace and Baker, 1994). The phylum Acanthocephala The phylum Acanthocephala is composed of thorny-headed worms, so-called because of the many thorn-like hooks on the proboscis. Acanthocephala which are also known as spiny-headed worms because of their characteristic spine-studded proboscis. A retractable proboscis covered with the recurved spines that give the animals their common name. The main characteristic of the Acanthocephala ist he protrusibler, armed proboscis at the anterior terminal. Proboscis is used to penetrate into the intestinal lining of their definitive host. All acanthocephalans worm-like organisms are endoparasitic. Each species of Acanthocephala uses two hosts in its life cycle (Loker and Hofkin, 2015). The first is an insect e.g. beetles (Coleoptera), crustaceans: terrestrial isopods (Oniscoidea), or millipedes (Myriapoda). Many species of arthropod, when eaten by a vertebrate that is an unsuitable definitive host, can penetrate the gut and encyst in some location where they survive without further development. This unsuitable vertebrate becomes a parathenic host, since fit is eaten 243

244 by the proper definitive host. The fully embryonated larva that is infective to the arthropod intermediate host is called the acanthor. At the end of development, the juvenile is an infective stage called a cystacanth. The parasite then must be eaten by the definitive host, fish, birds, and mammals (Schmidt, Roberts 1989, Lonc and Okulewicz, 2009). The acanthocephalan Macracanthorhynchus ingens were observed in the posterior portion of the midgut in spirobolid millipedes, Floridobolus penneri and Narceus gordanus. Epithelial cells penetrated by the parasite were destroyed completely (Bowen, 1967). Cystacanths of acanthocephalan were removed from the body cavity of millipede Narceus americanus. N. americanus is a intermediate host of an acanthocephalan (Crites, 1964). Chicobolus spinigerus (Diplopoda: Spirobolidae) is an intermediate host of Macracanthorhynchus ingens (Acanthocephala: Oligacanthorhynchidae) (Richardson et al. 2016). Cestoda, Cyclophyllidea Tapeworms of the order Cyclophyllidea have a scolex with four suckers and a rostellum that is located at the apex and frequently armed with hooks. In the intestine of various arthropods the egg hatches and the oncosphere penetrates into the hemocel, where it metamorphoses into a cysticercoid larva. The life cycle requires an intermediate host in which the cysticercoids develop. Arthropods serve as obligatory intermediate hosts. In case of Hymenolepis diminuta, they include insects, the lepidopterans e.g. Tinea granella, the larval stage of fleas e.g. Pulex irritans, and grain beetles Tenebrio molitor (larva), Tribolium castaneum, and millipedes e.g. Pleuroloma flavipes =Fontaria virginensis (Polydesmida: Xystodesmidae) (Wigand and Mattes 1958, Beaver et al. 1984). The millipede, Glomeris connexa was found as an intermadiate host for tapeworm Sobolevitaenia verulamii (Cestoda, Cyclophyllidea) (Vakarenko and Kornyushin 2002). The millipede, Fontaria virginensis was found as an intermadiate host for tapeworm Hymenolepis diminuta (Cestoda, Cyclophyllidea). H. diminuta is a common rat and mouse tapeworm, and only occasionally gets into man. The cysticercoids of Anomotaenia constricta Molin, Hymenolepis pistillum Duj. and Hymenolepis scalaris Duj. have been found in some species of pill millipedes Glomeris (Remy 1950). Nematoda: Rhigonematida; Oxyurida: Thelastomatidae; Rhabditida The nematodes of the subclass Phasmidia. They possess phasmids, the minute, paired of sensory glands, found posterior to the tail and functioning as a chemoreceptor. Many species of Oxyurids (Oxyuroidea) nematodes have been reported in insects and millipedes. Species of rhigonematid and thelastomatid nematodes described in the pill millipede Procyliosoma tuberculata (Clark 1978). Oxyuroid nematodes were found in the millipede, Narceus annularis (Wright 1979). Oxyurid nematodes from family Thelastomatidae were often found in the hindgut of millipede e.g. Ommatoiulus moreleti (Julida) (Baker 1985). Family Rhigonematidae, characterized by four double papillae that form the outer circlet and two copulatory spicules of equal length in males, includes, among others, the genera Rhigonema in millipedes (Adamson 1981, 1987a, Hunt 1981). Rhigonematid parasites was indicated in the millipede Scaphiostreptus seychellarum (Diplopoda: Spirostreptida) (Adamson 1987b) and Orthoporus americanus (Diplopoda: Spirobolida) (Adamson 1987a, b). Rhigonema euprepeia is described from the gut of a glomerid millipede. Millipede species was not identified to species (Hunt and Spiridonov 1995). Heth and Ruizia (Nematoda: Rhigonematida) were isolated from 244

245 the millipede Anadenobolus molinicornis (Diplopoda: Rhinocricidae) (Carreno et al. 2013). Heth impalutiensis n. sp. (Nematoda: Ransomnematoidea: Hethidae) is spirostreptid millipede (Spirostreptida: Harpagophoridae) parasite (Malysheva et al. 2015). Three groups of nematodes have been reported as associates of millipedes: Rhigonematida, Oxyurida, Thelastomatoidea, and Rhabditida. The first two nematode groups are parasites, but the rhabditids are mutualistic associates. Rhigonematida millipede gut species (Adamson 1981, 1987a, Hunt 1981, Spiridonov 1989, Malysheva and Pham Van Luc, 2012, Carreno et al. 2013), the nematode Carnoya kermarreci (Rhigonematidae, Nematoda) were isolated from the millipede Anadenobolus politus (Rhinocricidae, Diplopoda) (Adamson and van Waerebeke 1985), and Rhabditida: Oscheius (=Rhabditis) myriophilus in the millipede Oxidus gracilis (Poinar, 1986) and Oscheius (=Rhabditis) necromenus (Sudhaus and Schulte, 1989). Schulte (1989) reported that the nematode Rhabditis necronema (=Oscheiusnecronema) negatively affects the millipede Ommatoiulus moreleti in Australia. Nematodes are associates as commensals or parasites of arthropods. Kania (2000) have reported high lethality of the millipede Ommatoiulus sabulosus when infected with nematodes of the species Heterorhabditis bacteriophora (Poinar, 1976) and Steinernema carpocapsae (Weiser, 1955), respectively. No encapsulation reaction occurred in O. sabulosus infected with these enthomopathogenic nematodes. The encapsulation response was observed in the case of the soil dwelling nematode Rhabditis strongyloides (Schneider, 1886). Nematodes were discovered within the gut of the invasive millipede species Chamberlinius hualienensis (Meyer-Rochov 2015). Two nematodes (Nematoda: Diplogastridae, Rhabditidae) were identified as juvenile Oscheius sp. cf. necromenus (Sudhaus and Schulte, 1989) (Rhabditidae), and juvenile and adult Fictor sp. cf hessi (Steiner, 1914) (Diplogastridae) (Carta et al. 2016). Nematomorpha: Gordioidae Commonly called horse-hair or gordiacean worms, the nematomorphans are long, slender, cylindrical animals. The body surface is covered by a thin layer of cuticle. Approximately 350 species of nematomorphs or Gordian worms have been described. Adults are free-living in aquatic environments, whereas larvae are parasitic in arthropods. They are confused with mermithid nematodes (Loker and Hofkin 2015). Members of the Gordioidae (Nematomorpha) parasitize julid millipedes and known to castrate their male hosts (Sahli 1972). Nematomorphs of the genus Gordius parasitized Ommatoiulus moreleti. Larval Gordius sp. was found in the haemocoel of the millipede O. moreleti juveniles stadia. The level of parasitism was highly variable depending on the season and habitat. The gonopods on seven segment were rudimentary, and the parasitized males were castrated (Baker 1985). References 1. Adamson M. L Two new species of Heth Cobb, 1898 (Nematoda, Rhigonematidae) from south American Diplopods. Bull. Mus. Natn. Hist. Nat. Paris 4: Adamson M. L. 1987a. Nematodes parasites de Orthoporus americanus (Diplopoda: Spirobolida) from Paraguay. Can J Zool. 65 (11): Adamson M. L. 1987b. Rhigonematid (Rhigonematida: Nematoda) parasites of Scaphiostreptus seychellarum (Spirostreptida: Diplopoda) in the Seychelles with comments on the ovejector structure in Rhigonema Cobb, Can. J. Zool. 65 (1):

246 4. Adamson M. L., Waerebeke D. van Carnoya kermarreci, n. sp. (Rhigonematidae, Nematoda) from Anadenobolus politus (Rhinocricidae, Diplopoda) from Guadeloupe. Syst Parasit. 7 (1): Allaby M Oxford Dictionary of Zoology. Oxford New York Oxford University Press p Baker G. H Parasites of the millipede Ommatoiulus moreleti (Lucas) (Diplopoda: Julidae) in Portugal, and their potential as biological control agents in Australia. Aust J Zool. 33: Beaver P. Ch., Jung R. C., Cupp E. W Chapter 31. Cyclophyllidean Tapeworms In: Clinical Parasitology p Lea & Febiger Philadelphia 8. Bennett D. R., Kerr S. H Millipedes in and around structures in Florida. Fla. Entomol.56: Bhandari J. C., Nikam S. V Description of a new species cephaline gregarine Stenophora bristili (Apicomplexa, Sporozoea) from millipede (Chondromorpha severini) in Aurangabad district (M.S.). India J Appl Nat Sci. 5(1): Bowen R. C Defense reactions of certain spirobolid millipedes to larval Macracanthorhynchus ingens. J Parasitol. 53,5: Brygadyrenko V. V., Svyrydchenko A. O Influence oft he gregarine Stenophora julipusilli (Eugregarinorida, Stenophoridae) on the trophic activity of Rossiulus kessleri (Diplopoda, Julidae). Folia Oecol. 42: Bush A. O., Fernandez J. C., Esch G. W., Seed J. R Parasitism: the diversity and ecology of animal parasites. Cambridge University Press p Carta L. K., Thomas W. K., Meyer-Rochov V. B Two nematodes (Nematoda: Diplogastridae, Rhabditidae) from the invasive millipede Chamberlinius hualienensi Wang, 1956 (Diplopoda, Paradoxosomatidae) on Hachijojima Island in Japan. J Nematol. 14. Carreno R. A., Ordosch D., Koltek J. K., Hamill D. R., Tuhela L First United States records of the rhigonematid genera Heth and Ruizia (Nematoda:Rhigonematida) from the introduced millipede, Anadenobolus molinicornis (Diplopoda: Rhinocricidae) in Key Largo, Florida, USA. Comp Parasitol. 80: Chang Wei-Luen, Yang Chuh-Ya, Chao D Prevalence and observation of intestine-dwelling gregarines in the millipede Trigoniulus corallinus (Spirobolida: Pachybolidae) collected from Shoushan, Kaohsiung, Taiwan. Formosan Entomol. 24 : Clark W. C New species of rhigonematid and thelastomatid nematodes from the pill millipede Procyliosoma tuberculata (Diplopoda: Oniscomorpha). New Zealand J Zool. 5: Clopton R. E Phylogenetic relationships, evolution, and systemic revision of the septate gregarines (Apicomplexa: Eugregarinorida: Septatorina). Comp Parasitol. 76: Crites J. L A millipede, Narceus americanus, as a natural intermediate host of an Acanthocephalan. J Parasitol. 50: Decker P., Reip H. S., Voigtlander K Millipedes and centipedes in German greenhouses (Myriapoda: Diplopoda, Chilopoda). Biodiversity Data J. e1066: Enghoff H Diplopoda - geographical distribution. In: The Myriapoda. Treatise on Zoology-Anatomy, Taxonomy, Biology. A. Minelli (ed.). Brill, Leiden-Boston Vol. 2: Enghoff H., Golovatch S. I., Short M., Stoev P., Wesener T Diplopoda- taxonomic 246

247 22. overview. In: The Myriapoda. Treatise on Zoology- Anatomy, Taxonomy, Biology. Minelli A. (ed.). Brill, Leiden-Boston Vol. 2: Geus A Sporentierchen, Sporozoa, die Gregarinida der Land und Susswasser bewohnenden Arthropoden Mitteleuropas. In: Die Tierwelt Deutschlands und der angrenzenden Meerestelle. Teil 57. Jena: Gustav Fischer. p Golemansky V. 1973a. Stenophora beroni n.sp. (Gregarinida: Stenophoridae) une nouvelle eugregarine du Diplopode troglophile Balkanopetalum armatum Verhoeff (Diplopoda : Lysiopetalidae). Zool Anz. Leipzig. 191 (1/2): Golemansky V. 1973b. Stenophora bulgarosoma n. sp. une nouvelle eugregarine (Gregarinida: Stenophoridae) de diplopode troglobie Bulgarosoma bureschi Verhoeff. Zool Anz. Leipzig. 190 (3/4): Golemansky V., Lipa J Gregarines (Apicomplexa: Eugregarinida) from cave and terrestrial arthropods in Bulgaria. Acta Protozool. 30: Golemansky V Septate gregarines (Apicomplexa: Eugregarinida) of the alien invasive millipede Oxidus gracilis C. L. Koch, 1847 from Bulgaria. Acta Zool. Bulgarica 62(2): Golemansky V. Pilarska D., Georgiev G., Takov D., Todorov M., Pilarski P Protozoan parasites and pathogens of forest pest arthropods. Silva Balcanica 11(1): Golovatch S. I., Kime R. D Millipede (Diplopoda) distributions: A review. Soil Organisms 81(3): Hopkin S. P., Read H. J Predators, parasites, and defenses. In: The biology of Millipedes. Hopkin S. P. and Read H. J. (eds.) Oxford University Press, Oxford, UK. p Hunt D. J Two new species of Rhigonema (Oxyurida: Rhigonematidae). Rev Nematol. 4(2): Hunt D. J., Spiridonov S Rhigonema euprepeia n. sp. (Nematoda: Rhigonematida: Rhigonematidae), a parasite from a glomerid millipede (Diplopoda: Oniscomorpha) from Vietnam. Syst Parasitol. 32: Janardanan K. P., Ramachandran P Observations on a new species of cephaline gregarine from the millipede, Carlogonus palmatus Demange, Zool Anz. 203 (5/6) : Kania G Gregarina polymorpha (Apicomplexa: Eugregarinida) in the body cavity of Ommatoiulus sabulosus L. (Arthropoda: Diplopoda). Ann Parasitol. 44: 464. (in Polish) 35. Kania G Susceptibility of the millipede Ommatoiulus sabulosus (Diplopoda, Julida: Julidae) to infection with nematodes. Fragm Faun. 43: Kania G The economic and medical significance of millipedes (Diplopoda) with emphasis on Ommatoiulus sabulosus. Ceske Budejovice, Czech Republic Contributions to Soil Zoology in Central Europe III. Tajovsky K., Schlagamersky J. and Pizl J. (eds.): Kania G Millipedes (Diplopoda) recorded in the town of Lublin (Poland). Urban Fauna Studies of animal biology, ecology and conservation in European cities. Indykiewicz P., Jerzak L., Kavanagh B. (eds.) UTP Bydgoszcz :

248 38. Kania G Znaczenie gospodarcze krocionogów (Diplopoda). In: Nauki rolnicze i przyrodnicze wybrane zagadnienia. Szala M., Maciąg K. (eds.) Wyd Nauk. Tygiel, Lublin p Kocourek P Mnohonozky (Myriapoda: Diplopoda) Prahy. Natura Pragensis 21: Levine N.D Gibbsia archiuli (Apicomlexa, Eucoccidiorida) n.g.,n.sp., from the millipede Archiulus moreleti. J Protozool. 33: Levine N. D Phylum Apicomplexa. In: An illustrated guide to the Protozoa. Society of Protozoologists, J. J. Lee, S.H. Hutner and E. C. Bovee (eds.) Lawrence K. S. p Lalpotu P. A Studies on Ciliates of the genus Nyctotherus Leidy, 1849 III. Parasites of millipedes. Arch Protistenk. 123: Lipa J. 1967a. Studies on gregarines (Gregarinomorpha) of arthropods in Poland. Acta Protozool. 5: Lipa J. 1967b. Zarys patologii owadów. Warszawa PWRiL. 45. Lipa J An outline of Insect Pathology. Dep. NCSTEI, Warszawa, Lipa J Protozoa as regulators of pest insects populations. Wiad Parazytol. 22: Loker E. S., Hofkin B. V Parasitology A Conceptual Approach. Garland Science Taylor & Francis Group New York and London p Lonc E., Okulewicz A Typ: Kolcogłowy Acanthocephala. In: Zoologia Bezkręgowce (bez stawonogów). Wyd Nauk PWN. Warszawa p Malysheva S. V., Mohagan A. B. & Spiridonov S. E Heth impalutiensis n. sp. (Nematoda: Ransomnematoidea: Hethidae) a millipede parasite from Central Mindanao, Philippines. Zootaxa 3926 (1): Malysheva S. V., Pham Van Luc Cattiena fansipanis n. sp (Nematoda: Rhigonematida: Carnoyidae) from a millipede (Myriapoda: Diplopoda: Spirobolida) in North Vietnam. Syst Parasitol. 81(2): Margulis L., Mckham H. I., and Olendzenski L Illustrated glossary of Protista. Jones and Barlett Publishers, London. p Meyer-Rochow V. B New observations - with older ones reviewed - on mass migrations in millipedes based on a recent outbreak on Hachijojima (Izu Islands) of the polydesmid diplopod (Chamberlinius hualienensis, Wang 1956): Nothing appears to make much sense. Zool Research 36(3): Minelli A. Golovatch S. I Myriapods. Encyclopedia of Biodiversity 5: Mock A Millipedes (Diplopoda) in hothouses first records from Slovakia. Biologia, Bratislava 56(5): 468, Nefediev P., Nefedieva J., Dyachkov Y.V A review of the anthropochore 56. fauna of Asian Russia, with new records from the Altai Province, Siberia (Diplopoda). 57. Arthropoda Selecta 23: Niijma K The outbreak of the millipede Oxidus gracilis Koch stopped trains. 59. Edaphologia 68: O Neill R. V., Reichle D. E Urban infestation by the millipede, Oxidus gracilis. 61. J Tennessee Acad Sci. 45: Poinar G. O. Jr Rhabditis myriophilis sp.n. (Rhabditidae: Rhabditida), associated with the millipede, Oxidus gracilis (Polydesmida: Diplopoda). Proc. Helminthol. Soc. Wash. 53: Richardson D. J., Hammond Ch. I., Richardson K. E The Florida Ivory Millipede, Chicobolus spinigerus (Diplopoda: Spirobolidae): A Natural 248

249 Intermediate Host of Macracanthorhynchus ingens (Acanthocephala: Oligacanthorhynchidae). Southeastern Naturalist 15 (1): Sahli F Modifications des caracteres sexuels secondaires males ches les Julidae (Myriapoda, Diplopoda) sous l influence de Gordiaces parasites. C. R. Academy Sciences Serie D. 274: Schmidt G. D., Roberts L. S Foundations of Parasitology. Times Mirror/Mosby College Publishing St. Louis, Toronto, Boston, Los Altos p Schubart O Taussenfüβer als Nahrung im Tierreich. Nachrichten des Naturw. Museums der Stadt Aschaffenburg 49: Schulte F The association between Rhabditis necromena Sudhaus & Schulte 1989 (Nematoda: Rhabditidae) and native and introduced millipedes in south Australia. Nematologica 35: Spiridonov S. E New species of Rhigonematidae (Nematoda) from the Cuban Spirobolid Rhinocricus sp. (Diplopoda). Folia Parasitol. 36 (1): Stoev P., Zapparoli M., Golovatch S., Enghoff H., Akkari N., Barber A Myriapods (Myriapoda). Chapter In: Alien terrestrial arthropods of Europe. Roques A., Kenis A., 70. Lees D., Lopez-Vaamonde C., Rabitsch W., Rasplus J-Y., Roy B. D. BioRisk 4: doi: /biorisk Stojałowska W Krocionogi (Diplopoda) Polski. Wyd Nauk PWN Warszawa p Sudhaus W., Schulte F Rhabditis necromena sp. n. (Nematoda: Rhabditidae) from south Australian Diplopoda with notes on its siblings R. myriophilus Poinar, 1986 and R. caulleryi Maupas, Nematologica 35: Terrace T. E., Baker G. H The blue land planarian, Caenoplana coerulea Moseley (Tricladida: Geoplanidae), a predator of Ommatoiulus moreleti (Lucas) (Diplopoda: Julidae) in Southern Australia. J Entomol Austr Soc. 33: Vakarenko E.G., Kornyushin V. V Description of a cysticercoid of Sobolevitaenia verulamii (Cestoda, Cyclophyllidea) from its intermediate host Glomeris connexa (Diplopoda, Glomeridae). Vest Zool. 36(6): Valigurova A., Matis D Nalezy gregarin (Eugregarinida, Apicomplexa) vo viacnozkach (Myriapoda) na uzemi Slovenska. Folia faun Slovaca 6: Valigurova A Sophisticated adaptations of Gregarina cuneata (Apicomplexa) feeding stages for epicellular parasitism. PloS ONE, 7(8): e Wigand R., Mattes O Helminthen und Helminthiasen des Menschen. Veb Gustav Fischer Jena p Wright K.A Trichomycetes and oxyuroid nematodes in the millipede, Narceus annularis. Proc. Helminthol. Soc. Wash. 46,

250 Millipedes (Diplopoda) their parasites, host, predators and symbionts. Part II Grzegorz Kania Chair and Department of Biology and Parasitology, Medical University of Lublin Abstract The aim of this paper is to describe some examples of natural enemies of Diplopoda. The revision includes predators and parasites such as insects e.g. Diptera: Sciomyzidae, Diptera: Phoridae, Diptera: Eginiidae, Coleoptera: Phengodidae, Coleoptera: Scarabeidae, Hemiptera: Reduviidae: Ectrichodiinae, Hymenoptera: Formicidae, and mites e.g. Acari: Mesostigmata, Acari: Astigmata. Data on natural enemies of Diplopoda is necessary for control millipede s populations. The majority of millipedes prey species were reported from the Julida, Spirobolida Spirostreptida and Polydesmida orders. Introduction All millipedes are strictly terrestrial and most species are found in forest leaf litter or in rotten wood, under the bark of the dead trees e.g. Proteroiulus fuscus (Julida), on and in the soil (Tracz 1984, Kania 2011). Millipedes also occur in compost e.g. Brachydesmus superus (Polydesmida) (Kania and Kłapeć 2012), and Trigoniulus corallinus (Spirostreptida) (de Souza Antunes et al. 2016). The millipede Ommatoiulus moreleti (Lucas, 1860) (Diplopoda: Julida) is indigenous to Portugal. It has been accidentally introduced into south-eastern Australia in Millipedes are most active during autumn and spring. The species reached high population densities and became rapidly severe nuisance pest, entering houses in large numbers. Millipedes can be so abundant they can prevent trains from achieving traction on railway lines because of their squashed remains. As well as invading urban areas, O. moreleti is found in abundance in agricultural habitats e.g. strawberries, seedling canola. Dense populations of O. moreleti have been recorded in woodlands and grasslands in southern Australia (Baker 1979, 2013). Parasites and predators of O. moreleti have been described (Baker 1985a, b). Methods for controlling of O. moreleti population based primarily on the use of pesticides or physical barriers to prevent entry of millipedes to buildings. The millipede Urostreptus atrobrunneus (Pierrozzi & Fontanetti 2006) (Diplopoda: Spirostreptida) has infested city of Campinas, Sao Paulo, Brazil during The number of millipedes has been annually increasing. Thousands of millipedes have moved from farm into houses during day-time at spring and summer. Methods for controlling of Urostreptus atrobrunneus based on the insecticide and burned oil in order to reduce millipede populations (Fontanetti et al. 2010). The mass occurrence and migration of Ommatoiulus sabulosus (Linnaeus, 1758) (Diplopoda: Julida) in Dąbrowa Górnicza, Jaworzno and Chrzanów in the years and in Kraków in years in Poland and in Görlitz since 1994 to 2001 in Germany have been observed and described. Outbreaks of O. sabulosus caused a considerable nuisance to people (Kania and Tracz 2005, Voigtlander 2005, Kania and 250

251 Kłapeć 2012, Kania 2017). Mass migrations of O. sabulosus, pose threat to humans due to their penetration of human dwellings throughout Europe, and transmission of pathogenic bacteria e.g. Citrobacter freundii, Pantoea agglomerans, Raoutella planticola, and Salmonella arizonae (Kania 2009, Kania and Kłapeć 2012). Our knowledge of millipede natural enemies is scarce. The aim of the paper is to describe parasites, predators and symbionts of millipede species. The Polyxenida, Julida, Spirobolida, Spirostreptida and Polydesmida are attracted to insects and mites. Parasitoids Parasitoid is an organism that spends part of its life as a parasite and part as a predator and is a parasite during larval stages and a predator when being mature (Allaby 2003). Parasitoids represent a specialized parasite in the insect, in which the association between the host and parasitoid always culminates in death of the host. The larvae feed on a host during their development and kill the host during the process (Wojtusiak 1991). The term parasitoid is restricted to certain parasitic insects e. g. larval hymenopterans and true flies (Diptera) whose hosts are exclusively other insects although a few species attack crustaceans, spiders, millipedes, centipedes and earthworms. Parasitoids are all parasitic during their larval stage and the adult insect is free living and feeds on nectar, pollen or is predatory, depending on the species. Parasitoids are effective for the control of agricultural pests (Gunn and Pitt 2012). Some dipteran insects in the genera Pelidnoptera (Sciomyzidae), Eginia (Muscidae), Megaselia (Phoridae) are parasitoids of Julida millipede species: Ommatoiulus moreleti, Ommatoiulus sabulosus, Cylindroiulus meinerti, and Ophyiulus fallax. The phengodid beetle, Phengodes laticolis (Coleoptera: Phengodidae) are parasitoids of Spirobolida millipede Floridobolus penneri. Diptera, Sciomyzidae Pelidnoptera nigripennis (Fabricius) (Diptera, Sciomyzidae) is one of a few species of dipteran parasitoids distinguished from millipedes. Bailey (1989) reported a millipede parasitoid which laid eggs on the head, the collum or the first rings of julid millipedes, once hatched, the larva enters the host through ventrally located sort tissues and formed and forms a breathing tube Adults of Pelidnoptera nigripennis have been recorded in Europe. Vala s et al. (1990) paper provides morphologal descriptions of the eggs, three larval stages, and the pupa of the fly Pelidnoptera nigripennis. It is unusual amongst the Sciomyzidae as it parasitizes only the millipedes. P. nigripennis has been imported under quarantine in 1988 to Adelaide, Australia as a biological agent against the millipede Ommatoiulus moreleti (Lucas) (Diplopoda: Julida: Julidae) in Australia (Bailey 1989). P. nigripennis could prove useful in biological controlling of O. moreleti in South Australia, particularly around Adelaide (Baker et al. 2013). Diptera, Phoridae Megasella cuspidata Schmitz (Diptera: Phoridae) is a facultative parasitoid of the stripped millipede Ommatoiulus sabulosus (Picard 1930). Meyers (1934) has recorded a case of parasitism of a black Julid millipede by a Phorid fly, Megaselia juli Brues. The fly was constantly on the move, with short runs, hops and flights, springing upon the back of the millipede, and running towards the head, leaping off again to avoid, just in time, a crush from the hard, massive coils. Whenever it approached the victim s head its ovipositor (very long) was extended and carried thus 251

252 for some time. The millipede, for its part, as soon as it felt the fly on its back, coiled and uncoiled with great force and rapidly, at the same time turning that part of its body near the fly dideways, and then crashing it against the adjacent part of the coil. Finally the millipede would rear up on a few of its posterior segments and dash its whole body from side to side. As soon as the millipede floundered more or less flat again, there, on or near its head, was the fly. Always the head was the goal (Meyers 1934). Larvae of Megaselia juli Brues parasitize millipedes of the Blaniulidae, Julidae and Spirobolidae. Larvae of Megaselia elongata Wood is known as a facultative parasitoid of Julidae millipedes (Durska and Matusik, 2011). A new genus of Phoridae (Diptera) Ritchiephora diplopodae Disney sp. n. was described. Ritchiephora diplopodae parasitizes an afrotropical millipede (Diplopoda, Odontopygidae, Spirostreptida) (Disney and Ritchie 1997). Diptera, Eginiidae The muscoid fly Eginia ocypterata Meigen, Eginiidae, is known from Europe. Parasitism of E. ocypterata was recorded on julid millipedes: Cylindroiulus meinerti (Verhoeff), Ophyiulus fallax (Meinert) and Ommatoiulus sabulosus (Linnaeus). It is phenologically correlated to the activity of fly and activity of millipede. No parasitized millipedes were found in the soil or litter. Eggs, larvae and pupae of a muscoid Eginia sp. were found on and in Ommatoiulus moreleti. Eggs were attached to the head, collum and anterior segments of O. moreleti. The larva hatched from the eggs and entered the millipede through the soft tissues ventral to the collum. The larva fed in the region of the collum, and molt into the pupal instar. Millipedes which contained pupae of Eginia sp. were dead (Baker 1985 a). The adults lay their eggs on their hosts in spring. The parasitoid spends the summer as first-instar larva, kills the host during the autumn when in third-instar phase and overwinter in the pupal stage inside the host. An adult E. ocypterata parasitizes the millipede Ommatoiulus sabulosus (Oostebroek de Jong 2005). Coleoptera, Phengodidae The larva of the phengodid beetle, Phengodes laticolis, feeds on the millipede, Floridobolus penneri Causey 1957 (Spirobolida, Floridobolidae). Eisner et al. (1998) established that the initial bite by the larva Phengodes laticolis results in the injection of a toxin enteric fluid through its hollow mandibles. The millipede is paralyzed almost immediately and is unable to open the valves of its repugnatorial glands. The P. laticolis larva kills F. penneri by severing the nerve cord of the millipede. The beetle enteric fluid also digests the soft tissues, which are sucked up by the beetle larva. At the end of the meal only the millipede s exoskeleton and glandular sacs of defensive glands remain uneaten. Beetle Phengodes laticolis feeds on the millipede Floridobolus penneri, without risking exposure to the repellent benzoquinones ejected by the millipede from its defensive glands when disturbed or attacted. The P. laticolis larva has an effective strategy for circumventing the defense of F. penneri. It kills the millipede without inducing it to discharge secretion and subsequently ingest it without rupturing the glands. Coleoptera, Scarabeidae; necrophagous beetles specialized on dead millipedes Many species of Scarabeidae have become facultatively or obligatorily necrophagous. The necrophagous dung beetle Onthophagus latigibber d Orbigny (Coleoptera Scarabeidae) was attracted in large numbers to millipede carcasses. These beetles are attracted by a repellent, they have became the first and exclusive users of 252

253 freshly dead millipedes Pelmatojulus tigrinus Hoffman & Mahsberg 1996 (Spirobolida: Pachybolidae) (Krell et al. 1997). The carcasses of large millipedes are an important resource exploited by beetles, some of which are generalists and a few of which seem to specialize on dead millipedes (Schmidt et al. 2004). Schmidt et al. (2004) using not only natural secretions obtained from spirobolidans Pelmatojulus tigrinus, but also an array of synthesized benzoquinones known to occur in the secretions of P. tigrinus, as well as other benzoquinones as controls. Thus they were able to show that a mixture of 2-methoxy-3-methyl-1,4-benzoquinone and 2-methyl-1,4-benzoquinone was the most effective bait in attracting Ontophagus beetle species (Coleoptera: Scarabaeidae). This mixture consisted of the two most important components of Pelmatojulus tigrinus secretion, and the beetles are specialists in millipede scavenging. Many animals may kill millipedes accidentally as potential food, but neglect them afterwards because of the repellant smell. Phorid flies parasitize millipedes (Disney and Ritchie 1997). These facts results in fresh millipede carcasses or unused parts of them being available for exploitation by necrophages. The millipede carcasses are regularly available resource for necrophages. Quinone mixture is attractant for necrophagous dung beetles specialized on dead millipedes (Schmitt et al. 2004). From coprophagy to predation: a dung beetle that kills millipedes Dung beetles (Coleoptera: Scarabaeidae) feed primarily on dung, and carrion, and sometimes to fungus or dead millipedes. The dung beetle Deltochilum valgum killed and consumed millipedes. Beetles killed millipedes much larger than themselves. Millipedes were killed by disarticulation, and through decapitation. D. valgum was attracted exclusively to millipedes, and showed a distinct preference for live, but injured individuals, which it would kill and eat. The millipedes were not identified. The preference of D. valgum for injured millipedes may be because injured millipedes emitted much more odours than uninjured millipedes. D. valgum is an obligate predatory dung beetle, in contrast to other non-predatory dung-feeding Deltochilum species (Larsen et al. 2009). Hemiptera: Reduviidae: Ectrichodiinae Many insects possess salivary pumps for injecting poison into the bodies of their prey, such as assassin-bugs (Reduviidae), use the same mechanism in defence, or in spraying their enemies with poison (Cloudsley-Thompson 1988). The Ectrichodiinae, or assassin bugs are specialized predators on millipedes. Observations involved millipedes in the order of Spirostreptida, in Spirobolida, and in Polydesmida. Rhiginia cinctiventris Stal 1872 preys on Spirobolida and Polydesmida. Ectrichodiinae primarily target the millipede s ventral ganglia or the supra-oesophageal ganglion to expose the nervous system to toxic salivary secretions. The millipede s ventral or head-collum region may be selected to avoid inserting stylets into laterally or dorsally located defensive glands along the trunk during millipede immobilization and consumption. Ectrichodiinae have been documented to prey exclusively on millipede, with a preference for the benzoquinone producing Juliformia (Bodner et al. 2016, Kania et al. 2016). The millipede s defense gland reservoirs are targeted by assassin bugs to sequester toxic secondary metabolities. The predator-prey association between Ectrichodiinae genera and millipedes has been documented in the literature (Forthman and Weirauch, 2012). Hymenoptera: Formicidae, Naturally aggressive to foreign organisms, ants appear to be friendly towards beneficent or trophobiont insects such as aphids (Homoptera) e.g. Tuberolachnus 253

254 salignus, and larvae of Lycaenidae (Lepidoptera) e.g. Maculinea arion (Ramade 1968, Le Masne 1994, Hölldobler and Wilson, 1998, Gulan and Cranston 2015). Wood ants (Formica) possess a vestigial sting which is no longer suitable for stinging, but concentrations of formic acid up to 70% are secreted by the venom glands and prove an effective deterrent when sprayed at any animal that disturbs the nest (Cloudsley- Thompson 1988). Ants are usually harmless to symbiotic for Diplopoda. Species of Pyrgodesmidae order Polydesmida as myrmecophiles appear in the army ants (Dorylinae) nests (Schubart 1950, Loomis 1959, Rettenmeyer 1962). Many species of millipede orders Polyxenida, Glomerida, Julida, Spirostreptida, Spirobolida and Polydesmida occur in ant nests but a few, nearly all representing tropical Pyrgodesmidae, are termed as obligate myrmecophiles (Schubart 1950). The small myrmecophile Myrmecodesmus hastatus Schubart 1945 (Pyrgodesmidae: Polydesmida) occurs mostly in South America (Golovatch and Adis 2004, Enghoff 2015). Myrmecophiles are described as symbionts, commensals or predators. In case of symbiosis between ants and millipedes, millipedes remove waste products outside the nest which prevent the ants from pathogenic microorganisms (Crosland 1994, Kania 1995). The pantropical millipede Glyphiulus granulatus Gervais (Spirostreptida) indicated in the nests of the ant Harpegnathos venator Smith in Southeast Asia. Harpegnathos ants aggressively attack, sting, and paralyze a wide variety of arthropods for food (Crosland 1994). The Southeast Asian Probolomyrmex ants are specialized predators of Polyxenida (Ito 1998). Facultative myrmecophiles among millipedes are common in tropical and temperate environments (Schubart 1950, Conde 1971, Kania 1995, Stoev and Lapeva-Gjonova 2005). Several species from Polyxenida are typical myrmecophiles. Schubart (1939) reported millipedes species of: Polyxenus lagurus, Polydesmus denticulatus, Proteroiulus fuscus, Blaniulus guttulatus, Julus scandivius, Cylindroiulus latestriatus, and Cylindroiulus britannicus in the nest of ants. Wiśniewski (1968) found the millipedes Polyxenus lagurus, Polydesmus complanatus and Proteroiulus fuscus in the nest of ant Formica polyctena Foerster, The millipede Polyxenus lagurus, and Proteroiulus fuscus were found in nests of Formica polyctena (Mazur 1988). The adult specimens of julidans Ommatoiulus sabulosus and Megaphyllum projectum kochi were found in nests of Formica fusca Retzius, 1783 (Kania 1995). The millipedes Polyxenus lagurus, Polydesmus complanatus and Cylindroiulus horvathi were found in the nests of Formica pratensis and Polyxenus lagurus in the nests of Formica rufa Linnaeus, 1758 (Stoev and Lapeva-Gjonova 2005). Phoresy of mites on millipedes Phoresy is a method of dispersal in which an animal clings to the body of a much larger animal of another species and is carried some distance before releasing its grip and falling (Allaby 2003). Phoresy is named after Greek phora: to carry or bear. However, it denotes occasionally a well defined active association between an insect and a mite (Binns 1982, Seeman 2001, Gwiazdowicz 2012). Phoresy of mites on other arthropods e.g. larvae of the mite Dinothrombium southcotii attached to a theridiid spider, larvae of the mite Leptus waldocke from scorpion Lychas alexandrinus, and deutonymph of the mite Histiostoma feroniarum from the centipede Cornocephalus aurantiipes (Fain 1991). Mites Oodinychus ovalis (C L Koch, 1839) and Uroobovella pulchella (Berlese, 1904) (Acari: Mesostigmata) were found on centipede Lithobius forficatus (Linnaeus, 1758) (Błoszyk et al. 2006, Napierała et al. 2015). Phoresy is a phenomenon in which one animal actively seeks out and attaches itself to the outer surface or another animal for a limited time, during which feeding and development cease. This attachment results in movement away from 254

255 areas unsuited for further development, either of the phoretic individual or its progeny. It is therefore a mechanism by which dispersal and migration take place. Waiting stages, marked by the depression of growth-promoting functions, occur within the life cycles of phoretic mites. The hypopus is a typical phoretic stage, whose association with the host is an adaptation for survival in different environmental conditions (Cloudsley-Thompson 1988). Phoresy provides a means of finding a new host or food source. This relationship benefits the carried and does not directly affect the carrier, although in some cases its progeny may be disadvantaged (Gullan and Cranston 2015). Millipede- mite association has been described by numerous authors (see table below). Acari: Mesostigmata Heterozerconidae Heterozercon pachybolus Fain, 1988 Heterozercon spirostreptus Fain, 1988 Afroheterozercon ancoratus, Maracazercon joliveti, Heterozercon microsuctus Fain, 1989 Narceoheterozercon ohioensis n.g., n. sp. Trigynapsida: Paramegistidae Meristomegistus vazquezus n. gen., n.sp. Trigynapsida:Costacaridae Costacarus reyesi Millipede (Diplopoda) species or genus Pachybolus macrosternus Spirostreptus cornutus Locality Africa Kwango River, Zaire Africa Mayumbe forest, Zaire References Fain Fain 1988 Myriapoda Brazil Fain 1989 Narceus annularis (Rafinesque) Aceratophallus sp. (Polydesmida: Rhachodesmidae) Ohio, USA America: Mexico Gerdeman et al Gerdeman and Klompen 2003 Kim, Klompen 2002 only millipedes America: Mexico Hunter 1993 Acari: Laelapidae Hypoaspis spirostrepti Oudmemans Spirostreptus sp. Africa Andre 1943 Hypoaspis indicus Spirostreptus sp. India Andre 1943 Scissuralaelaps bipartitus, Acladocricus phillipinus Phillipine island, Scissuralaelaps breviseta Wang Mindanao Ishikawa 1988 Scissuralaelaps grootaerti, S. hirschmanni, S. joliveti, S. irianensis Myriapoda New Guinea Fain 1992 Trichoaspis julus gen. et sp.nov. Jacobsonia andrei n. sp, Jacobsonia puylaerti n.sp., Jacobsonia africanus n. sp. Julolaelaps spirostrepti Oudmemans Julus terrestris China Gu Yi-Ming et al Myriapoda Africa Fain 1994 Afrotropical Myriapoda, Fain 1987b 255

256 Acari, Astigmata Chetochelacarus mamillatus, Lophonotacarus minutes Diplopodocoptes transkeiensis gen. n and sp. n. - Spirostreptus sp. Afrotropical Myriapoda, Julidae Glomeridae Odontopygidae Zaire South Africa Kenya Fain 1987a Heterozerconid mites are primarily associated with millipedes (Gerdeman et al. 2000, Gerdeman and Klompen 2003). Most records of Heterozerconidae identify hosts as afrotropical myriapods (Fain 1987a, b, 1989, 1992, 1994). In Africa, the large groups of millipedes (Afrotropical) are: Oxydesmidae, Gomphodesmidae and Odontopygidae. Other dominant ones are e.g. Chelodesmidae, Pachybolidae, Spirostreptidae, and Sphaerotheriidae in southern Africa (Enghoff 2015). Millipede mites can be quite host specific, as shown by studies on Heterozercon pachybolus on Pachybolus macrosternus, and Heterozercon spirostreptus on Spirostreptus cornutus in Africa (Fain 1988), and Narceoheterozercon ohioensis on Narceus annularis in North America (Gerdeman and Klompen 2003). It has been observed mites on the outer surface of the millipede Ommatoiulus sabulosus during mass migration of this species (Kania, Tracz, 2005). Large numbers of immature instars and hypopi (thousands per host millipede) from Anoetidae (Astigmata) family were noted as attaching to juveniles and adults O. sabulosus (Acari identified Solarz K., pers. comm.). Neomegistus remus sp. nov. (Acari: Mesostigmata: Paramegistidae) is described on the millipede Proporobolus sp. (Spirobolida: Rhinocricidae) in Queensland. This new mite species is the second for the genus, which was previously known from millipedes in South Africa and Madagascar (Baker and Seeman 2008). A new species of Scissuralaelaps (Acari: Laelapidae: Iphiopsidinae), S. huberi sp. nov., is described from the millipede Acladocricus sp. (Spirobolida: Rhinocricidae) in the Philippines. The new species is close to S. bipartitus Ishikawa (Seeman, Alberti, 2015). Four millipede species, Doratogonus cristulatus (Porat, 1872) and Orthoporoides pyrhocephalus (C. L.Koch, 1865) (Spirostreptida), Centrobolus anulatus (Attems 1934) (Spirobolida) and Sphaerotherium giganteum (Porat, 1872) (Sphaerotheriida) were recorded in South Africa. All the species, except D. cristulatus, were arboreal. The sex ratio in D. cristulatus was strongly male-biased compared to O. pyrhocephalus and Centrobolus anulatus. Adult Neomegistus julidicola Trägärdh 1906 (Acari, Mesostigmata) were recorded only on males of D. cristulatus and O. pyrhocephalus. The abundance, incidence and infestation intensity of mites on millipedes were all higher at the beginning of the rainfall season when millipedes emerged than at any other time during the season. Most of the mites were found on the anterior third of the male millipede body. This association between Orthoporoides pyrhocephalus millipede and Neomegistus julidicola mite is a new record (Mwambu 2014). On the outer surface of Chamberlinius hualienensis millipede deutonymphs of a mite of the genus Histiostoma (Acari identified Farfan M. A) were identified. They are phoretic mites, known as myriapodophile mites and they have been reported from various species of millipedes (Meyer-Rochow 2015). Mites are associated with the millipede Julida (Gu Yi-Ming et al. 1991, pers. comm.), Spirobolida (Ishikawa 1988, Gerdeman et al. 2000, Baker & Seeman 2008, Mwambu 2014, Seeman, Alberti, 2015), the Spirostreptida (Andre 1943, Fain 1987, Farfan and Klompen 2012, Mwambu 2014), the Sphaerotheriida (Mwambu 2014), and the Polydesmida (Kim and Klompen 2002, Meyer-Rochow 2015). 256

257 References 1. Andre M Acariens rencontres sur des Myriapodes. Bull Mus. 15 (4): Allaby M Oxford Dictionary of Zoology. Oxford New York Oxford University Press p Bailey P. T The millipede parasitoid Pelidnoptera nigripennis (F.) (Diptera, Sciomyzidae) for the biological control of the millipede Ommatoiulus moreletii (Lucas) (Diplopoda: Julida: Julidae) in Australia. Bull Entomol Res. 79: Baker G. H Eruptions of the introduced millipede, Ommatoiulus moreleti (Diplopoda: Julidae) in Australia, with notes on the native Australiosoma castaneum (Diplopoda, Paradoxosomatidae). South Austr Naturalist 53: Baker G.H. 1985a. Parasites of the millipede Ommatoiulus moreleti (Lucas) (Diplopoda: Julidae) in Portugal, and their potential as biological control agents in Australia. Austr J Zool. 33: Baker G.H. 1985b. Predators of Ommatoiulus moreleti (Lucas) (Diplopoda: Julidae) in Portugal and Australia. J Austr Entomol Soc. 24: Baker M.R., Seeman O. D Mites and millipedes: a new Neomegistus (Acari: Mesostigmata: Paramegistidae) from Australia. Syst Appl Acarol. 13: Baker G. H., Grevinga L., Banks N Invasions of the Portuguese millipede, Ommatoiulus moreleti, in southern Australia. Pedobiol. 56: Binns E. S Phoresy as migration some functional aspects of phoresy in mites. Biol. Rev. 57: Błoszyk J., Klimczak J., Leśniewska M Phoretic relationships between Uropodina (Acari: Mesostigmata) and centipedes (Chilopoda) as an example of evolutionary adaptation of mites to temporary microhabitats. Eur J Entomol. 103: Bodner M., Vagalinski B., Makarov S. E., Antić D. Ž., Vujisić L. V., Leis H. J., Raspotnig G Quinone Millipedes reconsidered: evidence for a mosaic-like taxonomic distribution of phenol-based secretions across the Julidae. J Chem Ecol. 42: Cloudsley-Thompson J. L Enemies of Myriapods. Naturalist 10/12: Cloudsley-Thompson J. L Dispersal and migration In: Evolution and adaptation of terrestrial arthropods. Springer -Verlag Berlin Heidelberg New York p Conde B Diplopodes Penicillates des nids bresiliens de Camponotus rufipes. Rev. Ecol. Biol. Sol. 8 (4): Crosland M. W. J Millipede myrmecophile, Glycyphiulus granulates, found with the primitive ant Harpegnathos venator. J Entomol Sci. 29 (1): Disney R. H. L., Ritchie J. M A new genus of Phoridae (Diptera) that parasitizes an afrotropical millipede (Diplopoda, Odontopygidae). Entomol Monthly Mag. 133 : de Souza Antunes L. F., Sridhar K. R., Nogueira Scoriza R., da Silva D. G., Fernandez Correira M. E Production and efficiency of organic compost generated by millipede activity. Ciencia Rural Santa Maria 46(5):

258 18. Durska E., Matusik K Interesujący gatunek zadrowatych (Diptera: Phoridae) uprawy sosnowej. An interesting species of the scuttle flies (Diptera: Phoridae) of pine plantation. Dipteron 27: Eisner T., Eisner M., Attygalle A. B., Deyrup M., Meinwald J Rendering the inedible edible: Circumvention of a millipedes chemical defense by a predaceous beetle larva (Phengodidae). Proc. Natl. Acad. Sci. 95: Enghoff H Diplopoda - geographical distribution. In: Treatise on Zoology-Anatomy, Taxonomy, Biology. (ed. A. Minelli). The Myriapoda Vol. 2: Fain A. 1987a. Notes on mites associated with Myriapoda. I. Three new astigmatic mites from Afrotropical Myriapoda (Acari, Astigmata). Bulletin de l institut Royal des Sciences Naturelles de Belgique Entomologie 57: Fain A. 1987b. Notes on mites associated with Myriapoda: II. Four new species of the genus Julolaelaps Berlese, 1916 (Acari, Laelapidae). Bull l inst Royal Sci Natur Belgique Entomol. 57: Fain A Notes on mites associated with Myriapoda. III. Two new species of the genus Heterozercon Berlese, 1888 (Acari, Mesostigmata) from Afrotropical Myriapods. Bull l inst Royal Sci Natur Belgique Entomol. 124: Fain A Notes on mites associated with Myriapoda. IV. New taxa in the Heterozerconidae (Acari, Mesostigmata). Bull l inst Royal Sci Natur Belgique Entomol. 59: Fain A Notes on mites parasitic or phoretic on Australian centipedes, spiders and scorpion. Res. West. Austr Museum 15, Fain A Notes on mites associated with Myriapoda: V. the genus ScissuralaelapsWomersley, 1945 (Acari, Mesostigmata): description of four new species from New Guinea. Bull l inst Royal Sci Natur Belgique Entomol. 62: Fain A Notes on mites associated with Myriapoda: VI. The genus Jacobsonia Berlese, 1910 (Acari, Laelapidae): description of four new species from New Guinea. J African Zool. 108: Farfan M, Klompen H Phoretic mite associates of millipedes (Diplopoda, Julidae) in the northern Atlantic region (North America, Europe). Intern J Myriapodology 7: Fontanetti C. S., Calligaris I. B., Souza T. S A millipede infestation of an urban area of the city of Campinas, Brazil and preliminary toxicity studies of insecticide Bendiocarb to the Urostreptus atrobrunneus Pierozzi & Fontanetti, Arq. Inst. Biol., Sao Paulo 77: Forthman M., Weirauch Ch Toxic associations: A review of the predatory behaviours of millipede assassin bugs (Hemiptera: Reduviidae: Ectrichodiinae). Eur J Entomol. 109: Gerdemann B. S., Klompen H A new north american Heterozerconid, Narceoheterozercon Ohioensis n. g., sp., with first description of immatures of Heterozerconidae (Acari: Mesostigmata). International Journal of Acarology 29, 4, Gerdemann B. S., Klompen H., Tanigoshi L Insights into the biology of a mite-millipede association. Fragm Faun. 43: Gwiazdowicz D. J, Kamczyc J, Teodorowicz E, Błoszyk J Mite communities (Acari, Mesostigmata) associated with Ips typographus (Coleoptera, Scolytidae) in managed and natural Norway spruce stands in Central Europe. Centr Eur J Biol. 7:

259 34. Golovatch S. I. & Adis J Myrmecodesmus hastatus (Schubart, 1945), a widespread Neotropical millipede (Diplopoda, Polydesmida, Pyrgodesmidae). Fragm Faun 47(1): Golovatch S. I., Kime R. D Millipede (Diplopoda) distributions: A review. Soil Organisms 81(3): Gu Yi-Ming, Wang Chu-Sheng, Li Jian-Hua A new genus and species of Gamasides of Julus terrestris and a new family proposed (Acari: Dermanyssoidea). Acta Zootaxonomica Sinica 16(4) : Gullan P.J., Cranston P.S The Insects An outline of Entomology. Wiley- Brackwell Publishing p Gunn A. Pitt S. J Parasitology An Integrated Approach. Wiley-Blackwell Publishing p Hölldobler B. Wilson E. O Podróż w krainę mrówek. Dzieje badań naukowych (Journey to the ants. A story of scientific Exploration). Wyd. Prószyński i S-ka. Warszawa p Hunter P. E A new family of mites, Costacaridae (Mesostigmata, Trigynaspida, Celaenopsidae) associated with millipedes in Mexico. Israel J. Zool. 39(2): Ishikawa K Two new species of Scissuralaelaps (Acarina, Laelapidae) associated with Philippine millipedes. Bull. Natn. Sci Museum Tokyo 14: Ito F Colony composition and specialized predation on millipedes in the enigmatic ponerine ant genus Probolomyrmex (Hymenoptera, Formicidae). Insectes Society 45, Kania G Współzależności między mrówkami (Formicidae) a dwuparcami (Diplopoda) jako jedna z form myrmekofillii. Przegląd Zool. 39 (1-2): (in Polish) 43. Kania G The economic and medical significance of millipedes (Diplopoda) with emphasis on Ommatoiulus sabulosus. Contributions to Soil Zoology in Central Europe III. Ceske Budejovice, Czech Republic, Tajovsky K., Schlagamersky J., Pizl J. (eds.): Kania G Millipedes (Diplopoda) recorded in the town of Lublin (Poland). Urban Fauna Studies of animal biology, ecology and conservation in European cities. UTP Bydgoszcz. Indykiewicz P., Jerzak L., Kavanagh B. (eds.): Kania G., Kowalski R., Pietraś R Defensive secretions in millipede species of the order Julida (Diplopoda). Acta Soc Zool Bohemicae. 80: Kania G Znaczenie gospodarcze krocionogów (Diplopoda). In: Nauki rolnicze i przyrodnicze wybrane zagadnienia. Szala M., Maciąg K. (eds.) Wyd Nauk Tygiel, Lublin p Kania G., Kłapeć T Seasonal activity of milipedes (Diplopoda) - their economic and medical significance. Ann Agricult Environ Medicine 19(4): Kania G., Tracz H Mass occurrence and migration of Ommatoiulus sabulosus (Linnaeus, 1758) (Diplopoda, Julida: Julidae) in Poland. Peckiana 4: Kim Ch-M., Klompen H A new genus and species of Paramegistidae (Mesostigmata: Trigynapsida) associated with millipedes from Mexico. Acarologia 62 (1): Krell F.-Th., Schmitt T., Linsenmair K. E Diplopod defensive secretions as attractants for necrophagous scarab beetles (Diplopoda; Insecta, Coleoptera: Scarabaeidae). Entomologica Scand Suppl. 51:

260 51. Larsen T. H., Lopera A., Forsyth A., Genier F From coprophagy to predation: a dung beetle that kills millipedes. Biology Letters 5: Le Masne G Remarques sur l evolution du comportement des myrmecophiles. Memorabilia Zool. 48: Loomis H. F New myrmecophilous millipedes from Barro Colorado Island, Canal Zone, and Mexico. J Kansas Entomol Soc. 32 (1): Mazur S Ocena udatności zabiegu sztucznej kolonizacji mrówki ćmawej (Formica polyctena Forst.). Sylwan 8: Meyer-Rochow V. B New observations - with older ones reviewed - on mass migrations in millipedes based on a recent outbreak on Hachijojima (Izu Islands) of the polydesmid diplopod (Chamberlinius hualienensis, Wang 1956): Nothing appears to make much sense. Zool Reaserch 36(3): Minelli A. Golovatch S. I Myriapods. Encyclopedia of Biodiversity 5: Myers J. G Aggressive parasitism of a millipede by a Phorid. Proc Entomol Soc London 9: Mwabvu T Surface-active millipedes (Diplopoda) and associated mites (Acari, Mesostigmata) in Pigeon Valley Nature Reserve in Durban, South Africa. Soil Organisms 86: Napierała A., Książkiewicz Z., Leśniewska M., Gwiazdowicz D. J., Mądra A. & Błoszyk J Phoretic relationships between uropodid mites (Acari: Mesostigmata) and centipedes (Chilopoda) in urban agglomeration areas. Internat J Acarol. DOI: / Oosterbroek P., de Jong H Eginia ocypterata (Diptera: Muscidae) in the Netherlands. Entomol Berichten 65(5): Picard F Sur le parasitisme d un Phoride (Megasella cuspidata Schmitz) aux depens d un Myriapode. Bull Soc Zool. 55: Ramade F Świat mrówek. Wyd Nauk PWN Warszawa p Remy P On the enemies of Myriapods. Naturalist Rettenmeyer C. W The behavior of millipedes found with neotropical army ants. J Kansas Entomol Soc. 35(4): Seeman O Myriad Mesostigmata associated with log-inhabiting arthropods. In: Acarology Proceedings of the 10th International Congress. Halliday R. B., Walter D. E., Proctor H. C., Norton R. A. and Colloff M. J. (eds.) Melbourne p Seeman O., Alberti G A new species of Scissuralaelaps (Acari: Mesostigmata: Laelapidae) from millipedes in the Philippines. Syst Appl Acarol. 20(6): Schmidt G. D., Roberts L. S Foundations of Parasitology. Times Mirror/Mosby College Publishing St. Louis, Toronto, Boston, Los Altos p Schmitt T., Krell F. T., Linsenmair E Quinone mixture as attractant for necrophagous dung beetles specialized on dead millipedes. J Chem Ecol. 30 (4): Schubart O Über die Besiedlung der Bauten und Nester mitteleuropäischer Säuger und Vögel mit Diplopoden. Zool Anz. 125: Schubart O Ameisen und Diplopoden in ihren gegenseitigen Beziehungen. Rev. Entomol. (Rio de Janeiro) 21: Schubart O Taussenfüβer als Nahrung im Tierreich. Nachrichten des Naturw. 72. Mus Stadt Aschaffenburg 49:

261 73. Stoev P., Lapeva- Gjonova A Myriapods from ant nests in Bulgaria (Chilopoda, Diplopoda). Peckiana 4: Tracz H Studies on the ecology of Proteroiulus fuscus (Am Stein, 1857) 75. (Diplopoda, Blaniulidae). Acta Zool Cracov. 27(21): Vala J- C., Bailey P., Gasc Ch Immature stages of the fly Pelidnoptera nigripennis (Fabricius) (Diptera: Phaeomyiidae), a parasitoid of millipedes. Syst Entomol 15: Voigtlander K Mass occurrences and swarming behavior of millipedes (Diplopoda: Julidae) in Eastern Germany. Peckiana 4: Wiśniewski J Isopoda, Chilopoda i Diplopoda występujące w mrowiskach Formica polyctena Forst. w nadleśnictwie doświadczalnym Zielonka. Prace Komisji Nauk Rolniczych i Komisji Nauk Leśnictwa. PTPN 25: Wojtusiak J Podstawy etologii owadów. Wyd Uniwersytetu Jagiellońskiego p

262 262

263 Some aspects of millipede s biology (Diplopoda) Grzegorz Kania, Monika Jung Chair and Department of Biology and Parasitology, Medical University of Lublin grzegorz.kania@umlub.pl Abstract The diplopods are one of the oldest groups of terrestrial arthropods. They are diverse group of millipedes that are the most important of detritus consumer found in many ecosystems. This article is a review of two aspects of their biology e.g. bioluminescence and stridulation. The ability of an organism to emit light, is one of nature's most amazing phenomena, as evolutionary adaptation has appeared several times across the tree of life. Among millipede genera only the following are luminous: Motyxia (Polydesmida), and Paraspirobolus and Salpidobolus (Spirobolida). Bioluminescent integument system of millipede is considered as a new type of ATP dependent one. Bacteria are not involved in bioluminescence. The sound production of millipedes is limited to stridulation and restricted to orders of Glomerida e.g. Loboglomeris and Sphaerotheriida. Stridulation sounds are part of courtship behavior during mating. Introduction Typical habitats of the millipedes are leaf litter, in or on soil, and the dead trees. Millipedes are of considerable ecological importance for litter breakdown within the decomposition cycle. They inhabit boreal deciduous and coniferous forest, subtropical or tropical humid forest, grasslands, ecotones, compost, and greenhouses. In their feeding habitats, millipedes are quite diverse (Stojałowska 1961, Seifert 1961, Hoffman 1980, Sierwald and Bond 2007, Golovatch and Kime 2009). The presence of millipedes in various and unusual habitats have been described e.g. in caves e.g. Apfelbekia insculpta (Ilić et al. 2017). The millipede order Callipodida prey on animal or feed on remnants of other animals (Stoev et al. 2008). A few species are arboreal, e.g. the sphaerotheriids Sphaerotherium punctulatum in South Africa and Zoosphaerium arborealis in Madagascar, which climb trees for feeding (Wesener and Sierwald 2005). S. punctulatum was found climbing during all times of the day. Climbing animals did not prefer a special direction, some walking on vertical trunks with head up or down, others sitting on horizontal branches or tree-climbing to provide new food resources. Climbing S. punctulatum were observed to feed on soft bark and leaves (Haacker and Fuchs 1972). Similar behavior has been observed many times in the millipede Ommatoiulus sabulosus, which climb bushes and trees e.g. Stawska Góra near Chełm, Chrzanów, Jaworzno (Górny Śląsk), Kraków and Lublin in Poland (Kania and Tracz 2005, Kania and Kłapeć 2012, pers. observation of the first author). Several species have adapted to semiaquatic or aquatic environments. One of them is littoral julid Thalassisobates litoralis (Julida: Nemasomatidae) which can be found among stranded decaying matters on the seashore (Barber 2009). A larger number of species live near rivers and have adapted to survive periodic flooding. Millipedes escape flooding by migrating for months on floating trees. The Amazonian species, e.g. Myrmecodesmus adisi (Polydesmida: Pyrgodesmidae) whose juveniles can live submerged over the annual flood period of 5 7 months, actively grazes on algae growing on tree trunks, where it breathes through a thin air layer trapped along the cuticle (Adis et al. 1996). The polydesmid Serradium semiaquaticum 263

264 (Polydesmida: Polydesmidae) is a troglobitic species which exhibits remarkable modified, broom-like mouthparts, combined with hydrophobic microtrichia in the spiracles that enable it to remain submerged for four weeks (Adis et al. 1997). Millipedes, centipedes, and terrestrial isopods were collected after floods during autumn 2002 in a floodplain forest. The dominant species of the millipede Polyzonium germanicum survives under water for longer than two months. Submerged animals use oxygen dissolved in water. Smaller species survived for a longer time, because of higher surface to volume ratio (Tufova and Tuf 2005). Ecomorphology Following Manton s (1977) approach in distinguishing locomotory-based ecomorphological types in Diplopoda, Golovatch and Kime (2009) recognized five millipede life forms: a. bulldozers or rammers, represented mainly by the long-bodied orders Julida, Spirobolida and Spirostreptida; b. wedge types, or litter-splitters, with short-bodied Polydesmida equipped with strong paraterga being the most typical order; c. borers, typified by the mainly flat-bodied orders Chordeumatida, Polyzoniida, Platydesmida and Siphonophorida; d. rollers, represented by Glomerida and Sphaerotheriida capable of conglobation; e. bark dwellers, typified by the tiny, soft-bodied and swift Polyxenida. The bristly millipedes, such as Polyxenus lagurus (Polyxenida) are bark dwellers, and are covered with bristles (Kania 1995, Enghoff 2015). They do not possess a strong burrowing capability. Morphotypes These millipede morphotypes are distributed among the following universal terrestrial arthropod life forms: a. stratobionts, restricted to litter and the uppermost soil, dominant in the Diplopoda and represented by all five morphotypes; b. pedobionts, or geobionts, mainly restricted to mineral soil and represented by the smaller juloid, glomeroid and polydesmoid morphotypes, usually implying body size minimalisation or elongation. Evolutionary adaptation is shortening of appendages, often decoloration of the teguments and loss of eyes. Geoglomeris subterranea (Glomerida) occurs in the uppermost soil, and ranges from 10 to 20 cm deep. This species is soil-dwelling and often live in caves (Gruber 1985, Kime 2004, Kocourek et al. 2017). c. troglobionts, likewise represented by the juloid, glomeroid and polydesmoid morphotypes, demonstrate elongation of the extremities, depigmentation of the teguments, blindness, occasionally mouthpart modifications e.g. Trachysphaera costata (Glomerida), Brachychaeteuma bradeae (Chordeumatida), and Hungarosoma bokori (Chordeumatida) (Kania et al. 2005, Tuf and Tufova 2008, Gruber 2009, Kocourek et al. 2017, Rendos et al. 2016, Mock et al. 2016). d. xylobionts, or subcorticoles live under-bark of dead or live trees, represented by all five morphotypes, with either particularly flat-bodied (polydesmoids, platydesmoids) or miniature (polyxenoids, glomeroids), often also particularly thin (juloids) e.g. Proteroiulus fuscus Am Stein, 1857 (Julida: Blaniulidae) live under bark of dead trees and tree-trunk (Tracz1984, Tuf and Tufova 2008, Kania 2011). e. epiphytobionts, again with all five morphotypes involved, characterised by very small body sizes to tiny millipedes. Several small genera of Apomus (Polydesmida), Catharosoma (Polydesmida) have been described from bromeliads (Golovatch and Kime 2009, Enghoff 2015). Several brightly coloured, aposematic species of Desmoxytes (Polydesmida) are characteristic of arboreal vegetation in Southeast Asia. Desmoxytes purpurosea sp. n. has been found and described in Thailand (Enghoff et al. 2007). 264

265 Most of the millipedes are macroinvertebrates, adult forms size vary from a few millimeters e.g. Nemasoma varicorne C. L. Koch to 26 cm body length in Archispirostreptus gigas (Enghoff 1992). World s leggiest animal is millipede Illacme plenipes (Siphonophorida). Latin translation is literally in highest fulfillment of feet and individuals of this species can have maximum 750 legs (Marek and Bond 2006, Marek et al. 2012). Although smaller number of legs was noticed, in German name of millipede is Tausendfüßer, which means thousand legs (Seifert 1961). Bioluminescence Bioluminescence is a property of many types of bacteria, dinoflagellates, insects and centipedes and millipedes. Among centipedes e.g. Orphnaeus brevilabiatus (Oryidae) (Geophilomorpha) is distributed in the tropical and subtropical regions of the world. This means production by living organisms of light without heat (Allaby 2003, Oba et al. 2011). Some insects possess symbiotic bacteria or fungi, but self-luminescence is found in a few dipteran fungus gnats, and several families of coleopterans. Among insects, luminous coleopteran families are: Elateridae, Lampyridae and Phengodidae (Oba et al. 2011, Gullan and Cranston 2015, Owens et al. 2018). The ability to emit light functions could be promotion of mating recognition, prey attraction, or in contrary, camouflage but also aposematism (Hopkin and Read 1992, Shelley 1997, Marek and Moore 2015). In the phengodid larvae (Coleoptera), the function of luminescence has been suggested as an aposematic signal (Oba et al. 2011). Aposematism is a biological phenomenon where a feature deters predators, which can be exemplified by appearance like vivid coloration, shape of body, sound and smell caused by chemical defense secretions of repugnatorial glands (Shear 2015). Signals are sent with or without purpose (Marek et al. 2011). On a dark night glowing millipedes can be noticed from distance of 10 meters, and in mass occurrence resemble starry sky in the night (Causey and Tiemann 1969a). Motyxia species occur in live oak and giant sequoia forests. All Motyxia species are nocturnal. During the day, individuals are burrowed beneath the soil (Causey and Tiemann 1969 b). Motyxia (Chamberlin, 1941) genus includes all known bioluminescent polydesmid millipedes that are found in a small region of the Sierra Nevada mountain. Motyxia sequoiae (= Luminodesmus sequoiae) Loomis and Davenport, 1951 (Polydesmida) lives in California and western North America (Causey and Tiemann 1969 a, b, Shelley 1997). Late adult stages present bright pink-orange pigmentation, with darker longitudinal dorsal stripe. This millipede is large in size with average length of 30 to 40 mm and width 8mm (Davenport et al. 1952). It lacks eyes and photosensitive structures (Causey and Tiemann 1969 a, b). Moreover, Polydesmida secretes hydrogen cyanide toxin and other compounds (Shear 2015). Motyxia genus bioluminescence is noted at 495 nm or 496 nm wavelength of greenish blue-white in colour that is detected in the dark (Davenport et al. 1952, Hastings and Davenport 1957, Shimomura 1981, Marek et al. 2011). The luminescence is continuous and conspicuous. Entire exoskeleton of millipede and its appendages and body rings emit vivid light. Egg masses and millipede s internal organ and single first instars do not glow. The latter stages and the juveniles exhibit bioluminescence, immediately after exposure to the dark or before previous disturbance (Davenport et al. 1952, Shelley 1997). Detached legs and other parts of body remain fluorescent. Faint light is emitted for many hours until millipedes either die or are preserved (Shelley 1997). Recognition as disputed function of bioluminescence was discounted by Davenport et al. (1952) as Polydesmid are blind. Marek et al. (2011) at night field research, conducted on living and artificial model, proved aposematic function of luminescence exhibited by M. sequoia against grasshopper mouse (Onychomys torridus) predation. Bioluminescence strongly deterred nocturnal predators. 265

266 M. sequoia luminescent exoskeleton contains photoprotein that includes chromophore with porphyrin functional group (Shimomura 1984). M. sequoia reveal bioluminescence being activated in the presence of O 2 (molecular oxygen), ATP and Mg 2+ (Shimomura 1981, Kuse et al. 2001). Compound 7,8 - dihydropterin-6-carboxylic acid was detected as light emmiter of L. sequoia centered at a wavelength of average 500 nm (Kuse et al. 2001). The common feature of bioluminescence is that energy must be derived from the enzymatic oxidation of substrate with oxygen supply (Hastings and Davenport 1957). In millipede luminescence additional organic substrate is not necessary. The light originates from photoprotein, different from photogenic molecule luciferase, characterizing firefly beetles (Photinus pyralis, Coleoptera). The enzyme luciferase oxidizes a substrate, luciferin, in the presence of an energy source of adenosine triphosphate (ATP) and oxygen, to produce oxyluciferin, carbone dioxide, and light (Viviani 2002, Gullan and Cranston 2015). Photogenic mechanism resembles more green fluorescent protein (GFP) in jellyfish (Aequorea vicoria) bioluminescence. Although the emission spectrum peak is in the green 495 nm, there is no dependence on bioluminescent bacteria (Hasting and Davenport 1957). Fluorescent compound and glowing pattern are biologically varied significantly than with other arthropods chemiluminescence. Bioluminescent system of millipede is considered as a new type of ATP dependent, hardly diffusible, therefore useful as cellular metabolism detector (Hastings and Davenport 1957, Shimomura 1981, 1984). Rediscovery of the millipede Xystocheir bistipita, in San Luis Obispo California in 2013 reveals bioluminescent activity, and apparent homologies to Motyxia species. Daylight colour of found specimens is of dry oak leaf colour and orange pink spots are present on paranota. Close phylogenetic relationship and soft blue green glow bioluminescence trigger formation of the new combination of the name Motyxia bistipita (Marek and Moore 2015). Redefined Motyxia is nowadays the only bioluminiscent genus of millipede in the order of Polydesmida (Shelley 1996, Shelley1997, Marek and Moore 2015). The millipede Paraspirobolus lucifugus belongs to Spirobolida and is endemic to Japan, Taiwan and Micronesia. Although the species is equipped with eyes, there is no evidence that bioluminescence is key to intraspecific communication within this species (Korsos 2004, Oba et al. 2011). Among millipede genera only the following are luminous: Motyxia (= Luminodesmus), Paraspirobolus and Salpidobolus (= Dinematocricus) (Causey and Tiemann 1969b, Herring 1978, Oba et al. 2011, Makarov 2015). Indication of millipede cyanogenic toxicity by predators could be related to both evolutionary unlearnt and acquired avoidance. Events such as mouthful of spines or cyanide toxicity lead to dietary conservatism. That promotes natural selection within both the prey and predator population. Further investigation of the subject could reveal medical application of millipede s photogenic substances as metabolic rate markers (Makarov 2015, Marek and Moore 2015). Stridulation The production of sounds by insects rubbing one part of the body against another. Stridulation is typical of the Orthoptera (grasshoppers) and Homoptera e.g. cicadas in which the purpose of the sounds is to bring the sexes together, and these are also used in territorial behavior (Oxford Dictionary of Biology 2015). The sound production of millipedes is limited to stridulation and restricted to orders Glomerida and Sphaerotheriida (Haacker 1968 a,b, 1969 a,b,c, Wesener et al. 2011, Enghoff et al. 2015). Order Glomerida Leach, 1814 Family Glomeridae Leach Loboglomeris Verhoeff, Species is always with colour pattern. Male are with stridulation organ on posterior side of telopods and at inner margin of anal shield, is a characteristic unique 266

267 of the order. Haacker (1974) has described mating behavior in Loboglomeris. Activities include stridulation, drumming on the ground, and touching. Stridulation is a part of the sexual behavior. Loboglomeris pyrenaica possesses a group of ribs on the femur of the telopods and fine striations on the ventral margin of the pygidium. The female senses only the vibrations without sounds (Haacker 1969a). The three species of the pill-millipede (order Glomerida) genus Loboglomeris produce stridulation sounds as courtship behavior during mating (Haacker 1968a). Loboglomeris pyrenaica Latzel, 1886, and L. rugifera Verhoeff, 1906 occur in northeast Spain (Haacker 1968a, 1969a, c, Enghoff et al. 2015). Loboglomeris pyrenaica Latzel, 1886 is a Pyrenean endemic. This species lives in the leaf litter of forests at altitudes of m. It also occurs in meadows up to 2200m. Loboglomeris haasi Attems, 1927 is endemic to Pyrenean region. This species inhabits the leaf litter of coniferous, deciduous forest and evergreen oakwood. Loboglomeris rugifera Verhoeff, 1906 is endemic from the Cantabrian mountains to the Pyrenees. It occurs in coniferous, and deciduous forest (Kime and Enghoff 2011). Order Sphaerotheriida Brandt, 1833 The millipedes order Sphaerotheriida are so-called giant pill-millipedes, the Malagasy- Indian Arthrosphaeridae, where males and females possess stridulation organs, and the South African Sphaerotheriidae, where males stridulate. Adult body length reaches an average mm, rolled-up the size of a ping-pong ball, or even that of a baseball (volvation), with head very wide and short, laterally with large antennal grooves. Legs consist of six podomeres, long and massive, and knife-shaped. Male leg-pairs 22 and 23 are modified into anterior and posterior telopods, both pairs may carry stridulation organs (Wesener et al. 2010, Enghoff et al. 2015). More than 340 described species in five families with 24 genera, are distributed in South Africa, Madagascar, Seychelles islands, southeastern Asia, Philippines, Java and Suwalesi, Australia and New Zealand (Haacker 1969b, Jeekel, 1974, Van den Spiegel 2002, 2003, Wongthamwanich et al. 2012, Enghoff 2015). Family Sphaerotheriidae Brandt, 1833 Anterior telopods with three or four podomeres are distal to syncoxite. Inner horns of syncoxite are elongated and slender. Telopoditomere 2 of posterior telopods carrying a stridulation organ on its posterior side producing species-specific, audible sounds (Enghoff et al. 2015). The Sphaerotherium male stridulates only when in contacts with a female to initiate mating. Stridulation sounds are produced with a special field of ribs on the posterior telopod, which is actively moved over a field of sclerotized nubs on the inner margin of the anal shield (Wesener et al. 2011). Sphaerotherium dorsale Gervais, the giant pill-millipede species from South Africa. S. dorsale is one of nine species of genus Sphaerotherium group of millipedes that produce sounds (Haacker 1968b, Wesener et al. 2011). Family Arthrospheridae Jeekel, 1974 Anterior telopods forming a pair of clamps, telopoditomeres 2 and 3 each possesses a field of sclerotized knobs. First telopodimere of the anterior telopods is enlarged, and carries the harp, a stridulation organ consisting of 1-12 large stridulation ribs. Example of species: Arthrosphaera brandtii (Enghoff 1978, Enghoff et al. 2015). Arthrosphaera Pocock, 1895 Anterior telopods with four podomeres distal to syncoxite, telopoditomere 4 has lobe covered with sclerotized spots, harp carrying one or two stridulation ribs. Female with stridulation ribs on the subanal plate named, washboard (Wesener and Sierwald 2005). There are 40 species, mm long in southern India and Sri Lanka. Example of species : Arthrosphaera magna (Ashwini and Sridhar 2006, 2008, Alagesan and Ramanathan 2013, Enghoff et al. 2015). Microsphaerotherium Wesener & Van den Spiegel, 2007 Anterior telopod possesses three podomeres distal to syncoxite and harp carrying a single stridulation rib. This is the smallest giant pill-millipedes, e.g. Microsphaerotherium ivohibiense, 267

268 length of less than 10 mm, lives in rainforest of Madagascar (Wesener and Van den Spiegel, 2007, Wesener 2009). Sphaeromimus de Saussure and Zehntner, 1897 Anterior telopod with four podomeres distal to syncoxite, telopodimere 4 always possesses three spines, harp carrying 3-10 stridulation ribs. Female washboard : up to 20 stridulation ribs. Sphaeromimus musicus inhabits Madagascar (de Saussure and Zehntner 1902, Wesener et al. 2014). Moritz and Wesener (2017) have described two new species: Sphaeromimus kalambatritra sp. nov. and S. midongy sp. nov. of Malagasy giant pill-millipedes. Zoosphaerium Pocock, 1895 Anterior telopod has three podomeres distal to syncoxite, and harp carrying one or two stridulation ribs and posterior telopods with three telopodimeres. Female washboard with up to eight stridulation ribs. Largest described species: Zoosphaerium arborealis and Z. villosum (Wesener and Sierwald 2005). References 1. Adis J., Golovatch S. I., Hamann S Survival strategy of the terricolous millipede Cutervodesmus adisi Golovatch (Fuhrmannodesmidae, Polydesmida) in a blackwater inundation forest of central Amazonia (Brazil) in response tot he flood pulse. Memoires Museum Nat. d hist Nat. 169: Adis J., Caoduro G., Messner B., Enghoff H On the semiaquatic behaviour of a new troglobitic millipede from northern Italy (Diplopoda, Polydesmida, Polydesmidae). Entomol Scand Suppl. 51: Alagesan P., Ramanathan B Diversity of Millipedes in Alagar Hills Reserve Forest in TamilNadu, India. Internat J Biodiversity Allaby M Oxford Dictionary of Zoology. Oxford New York Oxford University Press. p Ashwini K. M., Sridhar K.R Seasonal abundance and activity of pill millipedes (Arthrosphaera magna) in mixed plantation and semi-evergreen forest of southern India. Acta Oecol. 29: Ashwini K. M., Sridhar K. R Distribution of pill millipedes (Arthrosphaera) and associated soil fauna in the Western Ghats and west coast of India. Pedosphere. 18: Barber D. A Littoral Myriapods: a review. In: Xylander W. & Voigtlander K. (eds.) Proccedings oft he 14th International Congress of Myriapodology. Soil Organisms. 81(3): Causey N. B. and Tiemann D. L A revision of the bioluminescent millipedes of the genus Motyxia (Xystodesmidae: Polydesmida). Proc American Philosophical Acad. 113: Causey N. B. and Tiemann D. L The bioluminescent millipedes of the Genus Motyxia (Xystodesmidae: Polydesmida). Bulletin du Museum National D Histoire Naturelle. 41: Davenport D The luminescence of the millipede Luminodesmus sequoiae. Biol Bull. 113(1): Davenport D., Wootton D. M., Cushing J. E The biology of the Sierra luminous millipede, Luminodesmus sequoia, Loomis and Davenport. Biol Bull. 102: De Saussure H., Zehntner L Myriapodes de Madagascar. In: Histoire, Physique, Naturelle et Politique de Madagascar Grandidie (ed.). 27 (53): Enghoff H Arthrosphaera cf. brandti (Humbert), a giant pill-millipede found in Tanzania, probably introduced from Sri Lanka. Rev Zool Afric. 91(4):

269 14. Enghoff H The size of a millipede. Proc. 8th International Congress of Myriapodology, Innsbruck, Austria, July 15-20, Berichte Nat.-med. Verein Innsbruck. Suppl. 10: Enghoff H. Chirasak Sutcharit and Panha S The shocking pink dragon millipede, Desmoxytes purpurosea, a colourful new species from Thailand (Diplopoda: Polydesmida: Paradoxosomatidae). Zootaxa. 1563: Enghoff H Diplopoda - geographical distribution. In: Treatise on Zoology- Anatomy, Taxonomy, Biology. The Myriapoda. Minelli A. (ed.). Brill, Leiden-Boston. 2: Enghoff H., Golovatch S. I., Short M., Stoev P., Wesener T Diplopoda- taxonomic overview. In: Treatise on Zoology- Anatomy, Taxonomy, Biology. The Myriapoda Minelli, A. (ed.). Brill, Leiden-Boston. 2: Golovatch, S. I., Kime R. D Millipede (Diplopoda) distributions: A review. Soil Organisms 81(3): Gruber J Geoglomeris subterranea Verhoeff, 1908, neu für Österreichs Fauna (Diplopoda, Glomerida). Anz Österreichischen Akademie der Wissenschaften, mathematisch-naturwissenschaftliche Klasse. 121 (7): Gruber J Zür Verbreitung von Trachysphaera costata (Waga, 1857) in Niederosterreich - eine für Osterreichs Fauna neue Diplopodenart (Diplopoda: Glomerida: Doderiidae). Contributions Nat Hist. 12: Gullan P. J., Cranston P. S The Insects. An outline of Entomology. Wiley- Brackwell Publishing. p Hopkin S. P., Read H. J The Biology of Millipedes. Oxford University Press. p Herring P. J Bioluminescence of invertebrates other than insects. Bioluminescence in Action Herring P. J (ed.), Academic Press New York, p Haacker U. 1968a. Stridulation bei Loboglomeris (Diplopoda). Die Naturwissenschaften. 12: Haacker U. 1968b. Sperma-Transport beim Kugeltausendfüssler (Sphaerotherium). Die Naturwissenschaften. 2: Haacker U. 1969a. Der stridulationsapparat von Loboglomeris und seine function im sexualverhalten. Vie et Milieu Serie C: Biol. Terrestre. 20 (1): Haacker U. 1969b. Das Sexualverhalten von Sphaerotherium dorsale (Myriapoda, Diplopoda). Verhandlungen der Deutschen Zoologischen Gesellschaft 32: Haacker U. 1969c. Zur Systematik von Loboglomeris Verhoeff (Diplopoda: Glomeridae). Ent. Mitt. Zool. Museum Hamburg.4 (67): Haacker U., Fuchs S Tree climbing in pill-millipedes. Oecologia 10: Haacker U Patterns of communication in courtship and mating behaviour of millipedes (Diplopoda). Symp Zool Soc. London. 32: Hastings J. W., Davenport D The luminescence of the millipede Luminodesmus sequoiae. Biol Bull. 113(1): Hoffman R. L Classification of the Diplopoda. Muséum d Hist Nat. Genève, Switzerland. p Ilić B. S., Mitić S., Makarov S. E Sexual dimorphism in Apfelbekia insculpta (L. Koch, 1867) (Myriapoda: Diplopoda: Callipodida). Arch Biol Sci. 69: Jeekel C. A. W The group taxonomy and geography of the Sphaerotheriida (Diplopoda). Symp Zool Soc London. 32: Kania G Obserwacje nad morfologią Polyxenus lagurus (Diplopoda: Polyxenidae). Przegląd Zool. 39: (in Polish) 35. Kania G., Wytwer J., Mock A Trachysphaera costata (Waga, 1857) krocionóg odkryty podczas podróży naturalistów do Ojcowa. In: Zróżnicowanie i przemiany 269

270 środowiska przyrodniczo-kulturowego Wyżyny Krakowsko-Częstochowskiej.Ojców Tom 3, Supplement: (in Polish) 36. Kania G., Tracz H. 2005: Mass occurrence and migration of Ommatoiulus sabulosus (Linnaeus) (Diplopoda, Julida: Julidae) in Poland. Peckiana. 4: Kania G Millipedes (Diplopoda) recorded in the town of Lublin (Poland). Urban Fauna. Studies of animal biology, ecology and conservation in European cities. In: Piotr Indykiewicz, Leszek Jerzak, Jörg Böhner and Brendan Kavanagh (eds.) UPT Bydgoszcz, p Kania G., Kłapeć T Seasonal activity of millipedes (Diplopoda) their economic and medical significance. Ann Agricult Environm Med. 19: Kime R. D The Belgian millipede fauna (Diplopoda). Bulletin de L Institut Royal des sciences Naturelles de Belgique. 74: Kime R. D., Enghoff H Atlas of European Millipedes (Class Diplopoda): volume 1. Orders Polyxenida, Glomerida, Platydesmida, Siphonocryptida, Polyzoniida, Callipodida, Polydesmida Sofia-Moscow: Pensoft. p Korsós Z Checklist and bibliography of millipede (Diplopoda) of Taiwan. Coll Res. 17: Kocourek P., Tajovsky K., Dolejs P New species of millipedes occurring in the Czech Republic: species discovered in the period Schubartiana. 6: Kuse M., Kanakubo A., Suwan S., Koga K., Isobe M., Shimomura O ,8- Dihydropterin-6-carboxylic Acid as a Light Emmiter of Luminous Millipede, Luminodesmus sequoia. Bioorg Med Chemistry Letters. 11: Makarov S. E Diplopoda-Integument. Treatise on Zoology- Anatomy, Taxonomy, Biology. In: Minelli A. (ed).the Myriapoda Brill. 2: Manton S. M The Arthropoda. Habits, functional morphology and evolution. Clarendon Press, Oxford p Marek P. E., Bond J. E Rediscovery of the world's leggiest animal. Nature 44: Marek P. E., Papaj D., Yeager J., Molina S., Moore W Bioluminescent aposematism in millipedes. Current Biol. 21: Marek P. E., Shear W. E., Bond J. E A redescription of the leggiest animal, the millipede Illacme plenipes, with notes on its natural history and biogeography (Diplopoda, Siphonophorida, Siphonorhinidae). ZooKeys. 241: Marek P.E., Moore W Discovery of a glowing millipede in California and the gradual evolution of bioluminiscence in Diplopoda. Proc Nat Acad Sci. 112: Mock A, Tajovský K., Žurovcová M., Jarošová A., Kocourek P., Gruber J., Angyal D. & Spelda J Hungarosoma bokori Verhoeff, 1928 (Diplopoda: Chordeumatida): new insights into its taxonomy, systematics, molecular genetics, biogeography and ecology. Zootaxa 4178 (2): Moritz L., Wesener T Integrative description of two new species of Malagasy chirping giant pill-millipedes, genus Sphaeromimus (Diplopoda: Sphaerotheriida: Arthrosphaeridae), Eur J Taxonomy. 381: Oba Y, Branham M. A. and Fukatsu T The Terrestrial Bioluminescent Animals of Japan. Zool Sci. 28(11): Owens A.C.S., Meyer-Rochow V.B., Yang E.C Short- and mid-wavelength artificial light influences the flash signals of Aquatica ficta fireflies (Coleoptera: Lampyridae). 13(2): Oxford Dictionary of Biology Oxford University Press. p Rendoš M., Mock A., Miklisova D Terrestrial isopods and myriapods in a forested scree slope: subterranean biodiversity, depth gradient and annual dynamics. J Nat Hist. 50:

271 56. Seifert G Die Tausendfüssler. Die Neue Brehm- Bucherei. A. Ziemsen Velag Wittenberg Luthrstadt. p Sierwald P., Bond J Current status of the myriapod class Diplopoda (millipedes): taxonomic diversity and phylogeny. Ann Rev Entomol. 52: Shear W. A The chemical defenses of millipedes (Diplopoda): biochemistry, physiology and ecology. Biochem Syst Ecol. 61: Shelley R.M Revision of the millipede genus Xystocheir Cook Polydesmida: Xystodesmidae). Can J Zool. 74: Shelley R.M A re-evaluation of the millipede genus Motyxia Chamberlin, with a re-diagnosis of the tribe Xystocheirini and remarks on the bioluminescence (Polydesmida: Xystodesmidae). Insecta Mundi. 11: Shimomura O A new type of ATP- Activated bioluminescent system in the millipede Luminodesmus sequoiae. North-Holland Biomedical Press. 128: Shimomura O Porphyrin chromophore in Luminodesmus photoportein. Comp Biochem Physiol. Part B. 79(4): Stoev P., Sierwald P., Billey J. A An annotated world catalogue of the millipede order Callipodida (Arthropoda: Diplopoda). Zootaxa. 1706: Stojałowska W Krocionogi (Diplopoda) Polski. Wyd Nauk PWN Warszawa p Tracz H Studies on the ecology of Proteroiulus fuscus (Am Stein, 1857) (Diplopoda, Blaniulidae). Acta Zool Cracov. 27(21): Tufova J.; Tuf I. H Survival under water - comparative study of millipedes (Diplopoda), centipedes (Chilopoda) and terrestrial isopods (Oniscidea). In: Tajovsky K.; Schlaghamersky J. Pizl V. (eds.): Ceske Budejovice Contributions to Soil Zoology in Central Europe: Tuf I. H.; Tufova J Proposal of ecological classification of centipede, millipede and terrestrial isopod faunas for evaluation of habitat quality in Czech Republic. Čas Slezského Muzea v Opavě. 57 : Van den Spiegel D On the occurrence of Sphaerotherium punctulatum in Malawi (Diplopoda: Sphaerotheriidae). Ann Museum Royal Africa Central (Zoologique) 290: Van den Spiegel D., Golovatch S. I., and Hamer M Revision of some of the oldest species in the millipede genus Sphaerotherium, Brandt, 1833, (Diplopoda, Sphaerotheriida, Sphaerotheriidae), with new synonymies. African Invertebrates. 43: Viviani V. R The origin, diversity, and structure function relationships of insect luciferases. Cellular and Molecular Life Sciences. 59: Wesener T., Sierwald P The Giant Pill-Millipedes of Madagascar: Revision of the genus Sphaeromimus, with a Review of the Morphological Terminology (Diplopoda, Sphaerotheriida, Sphaerotheriidae). Proc California Acad Sci. 56 (29): Wesener T, Van den Spiegel D Microsphaerotherium ivohibiense, a new genus and species of Giant-Pill Millipedes from Madagascar (Diplopoda, Sphaerotheriida, Arthrosphaerinae). J Afrotrop Zool. 3: Wesener T Unexplored richness: discovery of 31 new species of Giant Pill- Millipedes endemic to Madagascar, with a special emphasis on microendemism (Diplopoda, Sphaerotheriida). Zootaxa 2097: Wesener T, Raupach MJ, Sierwald P The origins of the Giant Pill-Millipedes from Madagascar (Diplopoda: Sphaerotheriida: Arthrosphaeridae). Molecular Phylogen Evol. 57:

272 75. Wesener T., Köhler J., Fuchs S, Van den Spiegel D How to uncoil your partner- mating songs in giant pill-millipedes (Diplopoda: Sphaerotheriida). Naturwissenschaften. 98(11): Wesener T., Le D. M-T., Loria S. F Integrative revision of the giant pill-millipede genus Sphaeromimus from Madagascar, with the description of seven new species (Diplopoda, Sphaerotheriida, Arthrosphaeridae). ZooKeys 414: Wongthamwanich N, Panha S, Sierwald P, Wesener T, Thirakhupt K A new species of the giant pill-millipede genus Sphaerobelum Verhoeff, 1924 from northern Thailand, with an extensive description and molecular characters (Diplopoda: Sphaerotheriida: Zephroniidae). Zootaxa. 3220:

273 Editors are deeply grateful to Authors of all papers that had been published in our monographies for cooperation and to Mr. Sebastian Buczek for covers designs Alicja Buczek and Czesław Błaszak Here we present covers of our monographies. Pictures link you directly to full text file Covers designes by Sebastian Buczek, 273

274 Covers designes by Sebastian Buczek, 274