Jajko czy kura? czyli gdzie dwóch się bije, tam trzeci korzysta

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "Jajko czy kura? czyli gdzie dwóch się bije, tam trzeci korzysta"

Transkrypt

1 Jajko czy kura? czyli gdzie dwóch się bije, tam trzeci korzysta Jacek Śmietański IIMK UJ Jajko czy kura

2 Pytanie tytułowe Co było na początku? Jajko czy kura? Rother M., 2012

3 Pytanie tytułowe Co było na początku? DNA czy Białko? Rother M., 2012

4 Odpowiedź Odpowiedź: RNA Rother M., 2012

5 RNA: RNA różni się od DNA Izolacja kwasów nukleinowych z różnych organizmów. Odkryto, że budulce cząsteczki RNA: ATP i GTP są podstawowymi źródłami energii (czyli życia) w komórce.

6 RNA: RNA produkuje białka Zidentyfikowano trzy rodzaje RNA biorące udział w tłumaczeniu informacji z DNA na białko: informacyjne (matrycowe) RNA (mrna) przenośnik informacji genetycznej transferowe RNA (trna) fizyczny łącznik między RNA a białkiem rybosomalne RNA (rrna) obecne w rybosomach, fabrykach białek. Odkryto kod genetyczny: trzy nukleotydy kodują jeden aminokwas. Wyizolowano polimerazę RNA, enzym syntetyzujący RNA. RNA jest nośnikiem informacji genetycznej w wirusach.

7 RNA: Pierwsze niekodujące RNA Analiza trna: zsekwencjonowanie (pierwsza zsekwencjonowana duża cząsteczka RNA) przewidzenie struktury drugorzędowej (4-listna koniczynka) rozwiązanie struktury 3D (krystalografia rentgenowska; kształt-l). Izolacja mrna; odkryto niekodowane nukleotydy (cap, polya, CCA) Opis odwrotnej transkryptazy (enzym przepisujący RNA na DNA); osłabienie centralnego dogmatu: DNA > RNA > białko.

8 RNA: Splicing RNA introny rozdzielają fragmenty genu i są usuwane z pierwotnego transkryptu Małe kompleksy RNA-białko są kluczowe w procesie splicingu. Porównanie sekwencji rybosomalnych RNA u wielu gatunków.

9 RNA: RNA jako enzym (RNase P) Spliceosom duży kompleks białko-rna odpowiedzialny za splicing. Alternatywny splicing różne białka z jednego genu. Katalityczna rola RNA ważną przesłanką dla hipotezy świata RNA.

10 Splicing

11 RNA: Modyfikacje RNA Doświadczenia in vitro funkcjonalne RNA może ewoluować Utrzymywanie końcówek chromosomów szablony RNA w telomerazie. Rybosomy największe enzymy RNA katalizują powstawanie wiązania peptydowego.

12 RNA: Regulatorowe RNA Małe cząsteczki RNA reguluję ekspresję przez potranskrypcyjne wyciszanie genów. Xist: pierwsze duże niekodujące RNA (lncrna) regulujące ekspresję genów. Epigeneza kontrolowana przez niekodujące RNA. Większa częśćgenomu jest transkrybowana. Ryboprzełączniki: regulacja ekspresji genu pod wpływem obecnych w komórce metabolitów. Mobilne DNA wykorzystuje pośrednictwo RNA.

13 Centralny dogmat tradycyjnie

14 ...nie uwzględnia niekodujących RNA

15 Centralny dogmat nowa wersja

16 RNA: struktury drugorzędowe i trzeciorzędowe

17 RNA: motywy Przykład: częste motywy strukturalne. (RNA HUB)

18 RNA: modyfikacje potranskrypcyjne Przykład dla adeniny. (Modomics)

19 Projekt: przewidywanie oddziaływań idea. To construct a predictor of base pairs in RNA structures that are imperfect and in a simplified representation. It may be useful for validation and optimization of predicted 3D models.

20 Model zredukowany Pyrimidines: N1, C2 and C4 Purines: N9, C2, C6

21 Model rozmyty Each atom is moved in random direction for random distance up to 1Å.

22 RNA base pairs: edges and orientations Leontis, 2002

23 12 interaction types (Leontis classification) cww cws cwh css csh chh tww tws twh tss tsh thh

24 FR3D database

25 Pairing information

26 1J6S - FR3D and McAnnotate output FR3D: McAnnotate:

27 1J6S - structures Assymetric unit: Biological assemble:

28 Multi-models structure Example: 28SP

29 Statystyki Dane dla elementów ciągu uczącego (ok struktur). Kreska (-) oznacza, że taka para nie powinna występować w przyrodzie.

30 Porównanie różnych klasyfikatorów Waleń, 2014

31 Polskie Towarzystwo Bioinformatyczne Członkostwo: - składka studencka: 40 zł/rok (opłaca się, jeżeli planujemy uczestniczyć w przynajmniej jednej konferencji PTBI) Konferencje: - BIT Toruń, VI Sympozjum PTBI, Białystok, IX.2016 Konkursy: - na najlepszą pracę magisterską - na najlepszą pracę doktorską

32 RNA-Puzzles Przewidywanie struktur 3D dla cząsteczek rozwiązanych eksperymentalnie, ale jeszcze nie opublikowanych. Np.: Jaka jest struktura poniższej cząsteczki? 5'-GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCG GCAACCACUAGUCUAGCGUCAGCUUCGGCUGACGCUAGGCUA GUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCA-3'

33 RNA-Puzzles Rozwiązanie

34 RNA-Puzzles wyniki

35 Wyzwania bioinformatyki RNA Wydobywanie nietrywialnych informacji z dużych zbiorów danych. - Big data - Data mining - Machine learning Przewidywanie 2D - Przewidywanie 3D - Identyfikacja kontaktów wewnątrz cząsteczki - Modyfikacje RNA - Miejsca wiązania jonów metali - Oddziaływania RNA-białko - Inne oddziaływania międzycząsteczkowe - Przewidywanie ncrna - Przewidywanie celów dla mirna - Identyfikacja i porównywanie sieci powiązań - Analiza transkryptomów -...

36 Zapraszam do współpracy - realizacja projektów w ramach koła - prace licencjackie - prace magisterskie pokój 2163, konsultacje czw

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II 10 października 2013: Elementarz biologii molekularnej www.bioalgorithms.info Wykład nr 2 BIOINFORMATYKA rok II Komórka: strukturalna i funkcjonalne jednostka organizmu żywego Jądro komórkowe: chroniona

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe

TATA box. Enhancery. CGCG ekson intron ekson intron ekson CZĘŚĆ KODUJĄCA GENU TERMINATOR. Elementy regulatorowe Promotory genu Promotor bliski leży w odległości do 40 pz od miejsca startu transkrypcji, zawiera kasetę TATA. Kaseta TATA to silnie konserwowana sekwencja TATAAAA, występująca w większości promotorów

Bardziej szczegółowo

Wykład 1. Od atomów do komórek

Wykład 1. Od atomów do komórek Wykład 1. Od atomów do komórek Skład chemiczny komórek roślinnych Składniki mineralne (nieorganiczne) - popiół Substancje organiczne (sucha masa) - węglowodany - lipidy - kwasy nukleinowe - białka Woda

Bardziej szczegółowo

Dr. habil. Anna Salek International Bio-Consulting 1 Germany

Dr. habil. Anna Salek International Bio-Consulting 1 Germany 1 2 3 Drożdże są najprostszymi Eukariontami 4 Eucaryota Procaryota 5 6 Informacja genetyczna dla każdej komórki drożdży jest identyczna A zatem każda komórka koduje w DNA wszystkie swoje substancje 7 Przy

Bardziej szczegółowo

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański

BIOINFORMATYKA. edycja 2016 / wykład 11 RNA. dr Jacek Śmietański BIOINFORMATYKA edycja 2016 / 2017 wykład 11 RNA dr Jacek Śmietański jacek.smietanski@ii.uj.edu.pl http://jaceksmietanski.net Plan wykładu 1. Rola i rodzaje RNA 2. Oddziaływania wewnątrzcząsteczkowe i struktury

Bardziej szczegółowo

TRANSKRYPCJA - I etap ekspresji genów

TRANSKRYPCJA - I etap ekspresji genów Eksparesja genów TRANSKRYPCJA - I etap ekspresji genów Przepisywanie informacji genetycznej z makrocząsteczki DNA na mniejsze i bardziej funkcjonalne cząsteczki pre-mrna Polimeraza RNA ETAP I Inicjacja

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Transkrypcja RNA SPIS TREŚCI: I. Wprowadzenie. II. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. III. Karty pracy. 1. Karta

Bardziej szczegółowo

The Role of Maf1 Protein in trna Processing and Stabilization / Rola białka Maf1 w dojrzewaniu i kontroli stabilności trna

The Role of Maf1 Protein in trna Processing and Stabilization / Rola białka Maf1 w dojrzewaniu i kontroli stabilności trna Streszczenie rozprawy doktorskiej pt. The Role of Maf1 Protein in trna Processing and Stabilization / Rola białka Maf1 w dojrzewaniu i kontroli stabilności trna mgr Tomasz Turowski, promotor prof. dr hab.

Bardziej szczegółowo

Marek Kudła. Rybozymy. RNA nośnik informacji i narzędzie katalizy enzymatycznej

Marek Kudła. Rybozymy. RNA nośnik informacji i narzędzie katalizy enzymatycznej Marek Kudła Rybozymy RNA nośnik informacji i narzędzie katalizy enzymatycznej Właściwości RNA umożliwiają ce kataliz ę enzymatyczną Możliwo ść tworzenia skomplikowanej struktury II i III rzędowej przez

Bardziej szczegółowo

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier.

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier. ID Testu: F5679R8 Imię i nazwisko ucznia Klasa Data 1. Na indywidualne cechy danego osobnika ma (maja) wpływ A. wyłacznie czynniki środowiskowe. B. czynniki środowiskowe i materiał genetyczny. C. wyłacznie

Bardziej szczegółowo

Geny, a funkcjonowanie organizmu

Geny, a funkcjonowanie organizmu Geny, a funkcjonowanie organizmu Wprowadzenie do genów letalnych Geny kodują Białka Kwasy rybonukleinowe 1 Geny Występują zwykle w 2 kopiach Kopia pochodząca od matki Kopia pochodząca od ojca Ekspresji

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Budowa rybosomu Translacja

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ 1. Gen to odcinek DNA odpowiedzialny

Bardziej szczegółowo

Transkrypcja i obróbka RNA. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Transkrypcja i obróbka RNA. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Transkrypcja i obróbka RNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Centralny dogmat biologii molekularnej: sekwencja DNA zostaje

Bardziej szczegółowo

Nowoczesne systemy ekspresji genów

Nowoczesne systemy ekspresji genów Nowoczesne systemy ekspresji genów Ekspresja genów w organizmach żywych GEN - pojęcia podstawowe promotor sekwencja kodująca RNA terminator gen Gen - odcinek DNA zawierający zakodowaną informację wystarczającą

Bardziej szczegółowo

Dr Marek Daniel Koter / dr hab. Marcin Filipecki

Dr Marek Daniel Koter / dr hab. Marcin Filipecki Szkoła Główna Gospodarstwa Wiejskiego w Warszawie Międzywydziałowe Studium Biotechnologii Katedra Genetyki, Hodowli i Biotechnologii Roślin Dr Marek Daniel Koter / dr hab. Marcin Filipecki Struktura RNA

Bardziej szczegółowo

Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii

Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii Możliwości współczesnej inżynierii genetycznej w obszarze biotechnologii 1. Technologia rekombinowanego DNA jest podstawą uzyskiwania genetycznie zmodyfikowanych organizmów 2. Medycyna i ochrona zdrowia

Bardziej szczegółowo

WPROWADZENIE DO GENETYKI MOLEKULARNEJ

WPROWADZENIE DO GENETYKI MOLEKULARNEJ WPROWADZENIE DO GENETYKI MOLEKULARNEJ Replikacja organizacja widełek replikacyjnych Transkrypcja i biosynteza białek Operon regulacja ekspresji genów Prowadzący wykład: prof. dr hab. Jarosław Burczyk REPLIKACJA

Bardziej szczegółowo

Nośnikiem informacji genetycznej są bardzo długie cząsteczki DNA, w których jest ona zakodowana w liniowej sekwencji nukleotydów A, T, G i C

Nośnikiem informacji genetycznej są bardzo długie cząsteczki DNA, w których jest ona zakodowana w liniowej sekwencji nukleotydów A, T, G i C MATERIAŁ GENETYCZNY KOMÓRKI BIOSYNTEZA BIAŁEK MATERIAŁ GENETYCZNY KOMÓRKI Informacja genetyczna - instrukcje kierujące wszystkimi funkcjami komórki lub organizmu zapisane jako określone, swoiste sekwencje

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

DNA musi współdziałać z białkami!

DNA musi współdziałać z białkami! DNA musi współdziałać z białkami! Specyficzność oddziaływań między DNA a białkami wiążącymi DNA zależy od: zmian konformacyjnych wzdłuż cząsteczki DNA zróżnicowania struktury DNA wynikającego z sekwencji

Bardziej szczegółowo

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

Gen eukariotyczny. Działanie i regulacja etapy posttranskrypcyjne

Gen eukariotyczny. Działanie i regulacja etapy posttranskrypcyjne Gen eukariotyczny Działanie i regulacja etapy posttranskrypcyjne Definicja genu Region DNA, który określa dziedziczoną cechę organizmu; zwykle koduje pojedyncze białko lub RNA. Zawiera całą funkcjonalną

Bardziej szczegółowo

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :.

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :. CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A imię i nazwisko :. klasa :.. ilość punktów :. Zadanie 1 Przeanalizuj schemat i wykonaj polecenia. a. Wymień cztery struktury występujące zarówno w komórce roślinnej,

Bardziej szczegółowo

TRANSLACJA II etap ekspresji genów

TRANSLACJA II etap ekspresji genów TRANSLACJA II etap ekspresji genów Tłumaczenie informacji genetycznej zawartej w mrna (po transkrypcji z DNA) na aminokwasy budujące konkretne białko. trna Operon (wg. Jacob i Monod) Zgrupowane w jednym

Bardziej szczegółowo

Gen eukariotyczny. Działanie i regulacja etapy posttranskrypcyjne

Gen eukariotyczny. Działanie i regulacja etapy posttranskrypcyjne Gen eukariotyczny Działanie i regulacja etapy posttranskrypcyjne Literatura Allison, r. 13 Brown, r. 12.2 Definicja genu Region DNA, który określa dziedziczoną cechę organizmu; zwykle koduje pojedyncze

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

TEORIA KOMÓRKI (dlaczego istnieją osobniki?)

TEORIA KOMÓRKI (dlaczego istnieją osobniki?) Wstęp do biologii 2. TEORIA KOMÓRKI (dlaczego istnieją osobniki?) Jerzy Dzik Instytut Paleobiologii PAN Instytut Zoologii UW 2017 WSPÓLNE WŁAŚCIWOŚCI dzisiejszych organizmów procesy życiowe katalizowane

Bardziej szczegółowo

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 ALEKSANDRA ŚWIERCZ Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 Ekspresja genów http://genome.wellcome.ac.uk/doc_wtd020757.html A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH

Bardziej szczegółowo

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją).

Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Historia informacji genetycznej. Jak ewolucja tworzy nową informację (z ma ą dygresją). Czym jest życie? metabolizm + informacja (replikacja) 2 Cząsteczki organiczne mog y powstać w atmosferze pierwotnej

Bardziej szczegółowo

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz.

Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. Księgarnia PWN: B. Alberts, D. Bray, K. Hopkin, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter Podstawy biologii komórki. Cz. 1 ROZDZIAŁ 1. KOMÓRKI WPROWADZENIE 1 Jedność i różnorodność komórek 1

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 4 Jak działają geny?

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A...

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A... 1. Zadanie (0 2 p. ) Porównaj mitozę i mejozę, wpisując do tabeli podane określenia oraz cyfry. ta sama co w komórce macierzystej, o połowę mniejsza niż w komórce macierzystej, gamety, komórki budujące

Bardziej szczegółowo

Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne)

Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne) Joanna Wieczorek Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne) Strona 1 Temat: Budowa i funkcje kwasów nukleinowych Cel ogólny lekcji: Poznanie budowy i funkcji: DNA i RNA Cele szczegółowe:

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Czy priony zawsze są szkodliwe? SPIS TREŚCI: Wprowadzenie. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. Karty pracy. 1.

Bardziej szczegółowo

na podstawie artykułu: Modeling Complex RNA Tertiary Folds with Rosetta Clarence Yu Cheng, Fang-Chieh Chou, Rhiju Das

na podstawie artykułu: Modeling Complex RNA Tertiary Folds with Rosetta Clarence Yu Cheng, Fang-Chieh Chou, Rhiju Das na podstawie artykułu: Modeling Complex RNA Tertiary Folds with Rosetta Clarence Yu Cheng, Fang-Chieh Chou, Rhiju Das wykonała: Marta Szynczewska bioinformatyka Uniwersytet Jagielloński Struktura I-rzędowa

Bardziej szczegółowo

Zaoczne Liceum Ogólnokształcące Pegaz

Zaoczne Liceum Ogólnokształcące Pegaz WYMAGANIA EGZAMINACYJNE ROK SZKOLNY 2015/2016 Semestr jesienny TYP SZKOŁY: liceum ogólnokształcące PRZEDMIOT: biologia SEMESTR: II LICZBA GODZIN W SEMESTRZE: 15 PROGRAM NAUCZANIA: Program nauczania biologii

Bardziej szczegółowo

Kombinatoryczna analiza widm 2D-NOESY w spektroskopii Magnetycznego Rezonansu Jądrowego cząsteczek RNA. Marta Szachniuk

Kombinatoryczna analiza widm 2D-NOESY w spektroskopii Magnetycznego Rezonansu Jądrowego cząsteczek RNA. Marta Szachniuk Kombinatoryczna analiza widm 2D-NOESY w spektroskopii Magnetycznego Rezonansu Jądrowego cząsteczek RNA Marta Szachniuk Plan prezentacji Wprowadzenie do tematyki badań Teoretyczny model problemu Złożoność

Bardziej szczegółowo

Zgodnie z tzw. modelem interpunkcji trna, cząsteczki mt-trna wyznaczają miejsca

Zgodnie z tzw. modelem interpunkcji trna, cząsteczki mt-trna wyznaczają miejsca Tytuł pracy: Autor: Promotor rozprawy: Recenzenci: Funkcje białek ELAC2 i SUV3 u ssaków i ryb Danio rerio. Praca doktorska wykonana w Instytucie Genetyki i Biotechnologii, Wydział Biologii UW Lien Brzeźniak

Bardziej szczegółowo

Kwasy Nukleinowe. Rys. 1 Struktura typowego dinukleotydu

Kwasy Nukleinowe. Rys. 1 Struktura typowego dinukleotydu Kwasy Nukleinowe Kwasy nukleinowe są biopolimerami występującymi w komórkach wszystkich organizmów. Wyróżnia się dwa główne typy kwasów nukleinowych: Kwas deoksyrybonukleinowy (DNA) Kwasy rybonukleinowe

Bardziej szczegółowo

TEORIA KOMÓRKI (dlaczego istnieją osobniki?)

TEORIA KOMÓRKI (dlaczego istnieją osobniki?) Wstęp do biologii 2. TEORIA KOMÓRKI (dlaczego istnieją osobniki?) Jerzy Dzik Instytut Paleobiologii PAN Instytut Zoologii UW 2015 WSPÓLNE WŁAŚCIWOŚCI dzisiejszych organizmów procesy życiowe katalizowane

Bardziej szczegółowo

etyloamina Aminy mają właściwości zasadowe i w roztworach kwaśnych tworzą jon alkinowy

etyloamina Aminy mają właściwości zasadowe i w roztworach kwaśnych tworzą jon alkinowy Temat: Białka Aminy Pochodne węglowodorów zawierające grupę NH 2 Wzór ogólny amin: R NH 2 Przykład: CH 3 -CH 2 -NH 2 etyloamina Aminy mają właściwości zasadowe i w roztworach kwaśnych tworzą jon alkinowy

Bardziej szczegółowo

Gen eukariotyczny. Działanie i regulacja etapy posttranskrypcyjne

Gen eukariotyczny. Działanie i regulacja etapy posttranskrypcyjne Gen eukariotyczny Działanie i regulacja etapy posttranskrypcyjne 1 Definicja genu } Region DNA, który określa dziedziczoną cechę organizmu; zwykle koduje pojedyncze białko lub RNA. } Zawiera całą funkcjonalną

Bardziej szczegółowo

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka Wstęp do obsługi biologicznych baz danych i analizy porównawczej białek i genów Katedra Fizjologii i Biotechnologii Roślin Pok. 113 CB jan.jastrzebski@uwm.edu.pl bioinformatyka@gmail.com www.ebiology.net

Bardziej szczegółowo

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA

TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA TECHNIKI ANALIZY RNA DNA 28SRNA 18/16S RNA 5SRNA mrna Ilościowa analiza mrna aktywność genów w zależności od wybranych czynników: o rodzaju tkanki o rodzaju czynnika zewnętrznego o rodzaju upośledzenia szlaku metabolicznego

Bardziej szczegółowo

GENOM I JEGO STRUKTURA

GENOM I JEGO STRUKTURA GENOM I JEGO STRUKTURA GENOM Ogół materiału genetycznego (kwasu nukleinowego niosącego informację genetyczną) zawartego w pojedynczej części składowej (komórce, cząstce wirusa) organizmu 1 Genom eukariotyczny

Bardziej szczegółowo

Zadania bioinformatyki

Zadania bioinformatyki BIOINFORMATYKA edycja 2016 / 2017 wykład 1 Zadania bioinformatyki dr Jacek Śmietański jacek.smietanski@ii.uj.edu.pl http://jaceksmietanski.net Bioinformatyka w praktyce IIMK UJ Bioinformatyka, wykład 1

Bardziej szczegółowo

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej Wprowadzenie do Informatyki Biomedycznej Wykład 1: Podstawy bioinformatyki Wydział Informatyki PB Podstawy biologiczne - komórki Wszystkie organizmy zbudowane są z komórek komórka jest skomplikowanym systemem

Bardziej szczegółowo

Wprowadzenie do biologii molekularnej.

Wprowadzenie do biologii molekularnej. Wprowadzenie do biologii molekularnej. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Biologia molekularna zajmuje się badaniem biologicznych

Bardziej szczegółowo

cytoplazma + jądro komórkowe = protoplazma Jądro komórkowe

cytoplazma + jądro komórkowe = protoplazma Jądro komórkowe Komórka eukariotyczna http://pl.wikipedia.org/w/index.php?title=plik:hela_cells_stained_with_hoechst_33258.jpg cytoplazma + jądro komórkowe = protoplazma W cytoplazmie odbywa się: cała przemiana materii,

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta

Bioinformatyka Laboratorium, 30h. Michał Bereta Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecność Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

ZNACZENIE RNA W REGULACJI EKSPRESJI GENÓW

ZNACZENIE RNA W REGULACJI EKSPRESJI GENÓW 26 BIOLETYN 17/III/2015 Ścieżki wiedzy ZNACZENIE RNA W REGULACJI EKSPRESJI GENÓW ANNA DANIŁOWICZ ekspresja genów, sirna, RNA, CRISPR Przed naukowcami zajmującymi się biotechnologią postawiono trudne zadanie

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo

BUDOWA I FUNKCJA GENOMU LUDZKIEGO

BUDOWA I FUNKCJA GENOMU LUDZKIEGO BUDOWA I FUNKCJA GENOMU LUDZKIEGO Magdalena Mayer Katedra i Zakład Genetyki Medycznej UM w Poznaniu 1. Projekt poznania genomu człowieka: Cele programu: - skonstruowanie szczegółowych map fizycznych i

Bardziej szczegółowo

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów Zawartość 139585 Wstęp 1. Historia wirusologii 2. Klasyfikacja wirusów 3. Struktura cząstek wirusowych 3.1. Metody określania struktury cząstek wirusowych 3.2. Budowa cząstek wirusowych o strukturze helikalnej

Bardziej szczegółowo

GENETYKA. Budowa i rola kwasów nukleinowych Geny i genomy Replikacja DNA NM G

GENETYKA. Budowa i rola kwasów nukleinowych Geny i genomy Replikacja DNA NM G GENETYKA Budowa i rola kwasów nukleinowych Geny i genomy Replikacja DNA 1 Podręcznik Biologia na czasie 3 Maturalne karty pracy 3 Vademecum 2 Zadanie domowe Na podstawie różnych źródeł opisz historię badań

Bardziej szczegółowo

Numer pytania Numer pytania

Numer pytania Numer pytania KONKURS BIOLOGICZNY ZMAGANIA Z GENETYKĄ 2016/2017 ELIMINACJE SZKOLNE I SESJA GENETYKA MOLEKULARNA KOD UCZNIA. IMIĘ i NAZWISKO. DATA... GODZINA.. Test, który otrzymałeś zawiera 20 pytań zamkniętych. W każdym

Bardziej szczegółowo

Czy żywność GMO jest bezpieczna?

Czy żywność GMO jest bezpieczna? Instytut Żywności i Żywienia dr n. med. Lucjan Szponar Czy żywność GMO jest bezpieczna? Warszawa, 21 marca 2005 r. Od ponad połowy ubiegłego wieku, jedną z rozpoznanych tajemnic życia biologicznego wszystkich

Bardziej szczegółowo

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1

Generator testów 1.3.1 Biochemia wer. 1.0.5 / 14883078 Strona: 1 Przedmiot: Biochemia Nazwa testu: Biochemia wer. 1.0.5 Nr testu 14883078 Klasa: zaoczni_2007 IBOS Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Do aminokwasów aromatycznych zalicza się A) G, P oraz S B) L,

Bardziej szczegółowo

Ewolucja informacji genetycznej

Ewolucja informacji genetycznej 1 Ewolucja informacji genetycznej Czym jest życie? metabolizm + informacja (replikacja) Cząsteczki organiczne mog y powstać w atmosferze pierwotnej Ziemi Oparin, Haldane Miller, 1953 Co by o najpierw?

Bardziej szczegółowo

Przewidywanie struktur białek

Przewidywanie struktur białek Łukasz Ołdziejewski Wydział Chemii UW Przewidywanie struktur białek czyli droga do projektowania indywidualnych leków Sprawozdanie studenckie 2007/2008 1 Indywidualność jednostki KaŜdy człowiek jest indywidualnym

Bardziej szczegółowo

Regulamin Wojewódzkiego Konkursu Biologicznego dla uczniów pierwszych klas liceum ogólnokształcącego ZMAGANIA Z GENETYKĄ [2017/2018]

Regulamin Wojewódzkiego Konkursu Biologicznego dla uczniów pierwszych klas liceum ogólnokształcącego ZMAGANIA Z GENETYKĄ [2017/2018] Regulamin Wojewódzkiego Konkursu Biologicznego dla uczniów pierwszych klas liceum ogólnokształcącego ZMAGANIA Z GENETYKĄ [2017/2018] 1. Organizatorzy konkursu. Iwona Paprzycka nauczyciel biologii VI Liceum

Bardziej szczegółowo

RMSD - Ocena jakości wybranych molekularnych struktur przestrzennych

RMSD - Ocena jakości wybranych molekularnych struktur przestrzennych RMSD - Ocena jakości wybranych molekularnych struktur przestrzennych Joanna Wiśniewska Promotor: dr inż. P. Łukasiak Spis treści 1. Zakres pracy magisterskiej 2. Struktura białka 3. Struktura kwasów nukleionowych

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

Bioinformatyka. Michał Przyłuski

Bioinformatyka. Michał Przyłuski Bioinformatyka Michał Przyłuski Plan prezentacji Wstęp biologiczny Biologia molekularna genetyka Bioinformatyka Przykłady zastosowań: sekwencjonowanie mikromacierze filogenetyka Czemu wstęp biologiczny?

Bardziej szczegółowo

Gen eukariotyczny. Działanie i regulacja etapy posttranskrypcyjne

Gen eukariotyczny. Działanie i regulacja etapy posttranskrypcyjne Gen eukariotyczny Działanie i regulacja etapy posttranskrypcyjne 1 Geny eukariotyczne Procesy transkrypcji i translacji są rozdzielone w przestrzeni i czasie Każdy gen ma własny promotor, nie występują

Bardziej szczegółowo

WETERYNARIA Ćwiczenia laboratoryjne X DNA i RNA

WETERYNARIA Ćwiczenia laboratoryjne X DNA i RNA WETERYNARIA Ćwiczenia laboratoryjne X DNA i RNA (1) Rozdział RNA oraz fragmentów DNA metodą elektroforezy w żelu agarozowym, określenie wielkości fragmentów DNA (produktów PCR) na podstawie porównania

Bardziej szczegółowo

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu

GENOMIKA FUNKCJONALNA. Jak działają geny i genomy? Poziom I: Analizy transkryptomu GENOMIKA FUNKCJONALNA Jak działają geny i genomy? Poziom I: Analizy transkryptomu Adnotacja (ang. annotation) pierwszy etap po uzyskaniu kompletnej sekwencji nukleotydyowej genomu analiza bioinformatyczna

Bardziej szczegółowo

Budowa kwasów nukleinowych

Budowa kwasów nukleinowych Bioinformatyka (wykład monograficzny) wykład 2. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas Budowa kwasów nukleinowych Kwasy nukleinowe (DA i RA) zbudowane są z nukleotydów

Bardziej szczegółowo

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP

WYNALAZKI BIOTECHNOLOGICZNE W POLSCE. Ewa Waszkowska ekspert UPRP WYNALAZKI BIOTECHNOLOGICZNE W POLSCE Ewa Waszkowska ekspert UPRP Źródła informacji w biotechnologii projekt SLING Warszawa, 9-10.12.2010 PLAN WYSTĄPIENIA Umocowania prawne Wynalazki biotechnologiczne Statystyka

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

Badanie funkcji genu

Badanie funkcji genu Badanie funkcji genu Funkcję genu można zbadać różnymi sposobami Przypadkowa analizy funkcji genu MUTACJA FENOTYP GEN Strategia ukierunkowanej analizy funkcji genu GEN 1. wprowadzenie mutacji w genie 2.

Bardziej szczegółowo

Rozkład materiału z biologii dla klasy III AD. 7 godz / tyg rok szkolny 2016/17

Rozkład materiału z biologii dla klasy III AD. 7 godz / tyg rok szkolny 2016/17 Rozkład materiału z biologii dla klasy III AD zakres rozszerzony LO 7 godz / tyg rok szkolny 2016/17 Biologia na czasie 2 zakres rozszerzony nr dopuszczenia 564/2/2012 Biologia na czasie 3 zakres rozszerzony

Bardziej szczegółowo

IZOLACJA KWASÓW NUKLEINOWYCH WARUNKI ZALICZENIA PRZEDMIOTU- 7 ECTS PRZEDMIOT PROGOWY!!!

IZOLACJA KWASÓW NUKLEINOWYCH WARUNKI ZALICZENIA PRZEDMIOTU- 7 ECTS PRZEDMIOT PROGOWY!!! WARUNKI ZALICZENIA PRZEDMIOTU- 7 ECTS PRZEDMIOT PROGOWY!!! W1-4p W2-4p W3-4p W4-4p W5-4p W6-4p W7-4p W8-4p W9-4p W10-4p min 21p wyjściówka I 40p wyjściówka II 40p egzamin I egzamin II min 21p 60p 60p min

Bardziej szczegółowo

ĆWICZENIA Z BIOCHEMII

ĆWICZENIA Z BIOCHEMII ĆWICZENIA Z BIOCHEMII D U STUDENTfiW WYDZIAŁU LEKARSKIEGO Pod redakcją Piotra Laidlera, Barbary Piekarskiej, Marii Wróbel WYDAWNICTWO UNIWERSYTETU JAGIELLOŃSKIEGO ĆWICZENIA Z BIOCHEMII DLA STUDENTÓW WYDZIAŁU

Bardziej szczegółowo

Test kwalifikacyjny Lifescience dla licealistów 2015

Test kwalifikacyjny Lifescience dla licealistów 2015 Test kwalifikacyjny Lifescience dla licealistów 2015 Imię nazwisko (pseudonim): 1. Daltonizm (d) jest cechą recesywną sprzężoną z płcią. Rudy kolor włosów (r) jest cechą autosomalną i recesywną w stosunku

Bardziej szczegółowo

Temat: Komórka jako podstawowa jednostka strukturalna i funkcjonalna organizmu utrwalenie wiadomości.

Temat: Komórka jako podstawowa jednostka strukturalna i funkcjonalna organizmu utrwalenie wiadomości. SCENARIUSZ LEKCJI BIOLOGII DLA KLASY I GIMNAZJUM Temat: Komórka jako podstawowa jednostka strukturalna i funkcjonalna organizmu utrwalenie wiadomości. Cele: Utrwalenie pojęć związanych z budową komórki;

Bardziej szczegółowo

Prokariota i Eukariota

Prokariota i Eukariota Prokariota i Eukariota W komórkach organizmów żywych ilość DNA jest zazwyczaj stała i charakterystyczna dla danego gatunku. ILOŚĆ DNA PRZYPADAJĄCA NA APARAT GENETYCZNY WZRASTA WRAZ Z BARDZIEJ FILOGENETYCZNIE

Bardziej szczegółowo

Spis treści 1 Komórki i wirusy Budowa komórki Budowa k

Spis treści 1 Komórki i wirusy Budowa komórki Budowa k Spis treści 1 Komórki i wirusy.......................................... 1 1.1 Budowa komórki........................................ 1 1.1.1 Budowa komórki prokariotycznej.................... 2 1.1.2

Bardziej szczegółowo

części określano skrótem vrna8. Cząsteczka ta, o długości 875 nukleotydów, koduje dwa białka, białko niestrukturalne (NS1, ang.

części określano skrótem vrna8. Cząsteczka ta, o długości 875 nukleotydów, koduje dwa białka, białko niestrukturalne (NS1, ang. STRESZCZENIE Grypa corocznie wywołuje epidemie i sporadycznie pandemie. Światowa Organizacja Zdrowia podaje, że każdego roku na grypę choruje 5-15% populacji ludzkiej, w tym u 3-5 milionów ludzi obserwuje

Bardziej szczegółowo

MultiSETTER: web server for multiple RNA structure comparison. Sandra Sobierajska Uniwersytet Jagielloński

MultiSETTER: web server for multiple RNA structure comparison. Sandra Sobierajska Uniwersytet Jagielloński MultiSETTER: web server for multiple RNA structure comparison Sandra Sobierajska Uniwersytet Jagielloński Wprowadzenie Budowa RNA: - struktura pierwszorzędowa sekwencja nukleotydów w łańcuchu: A, U, G,

Bardziej szczegółowo

Przedmiotowe zasady oceniania:

Przedmiotowe zasady oceniania: Przedmiotowe zasady oceniania: Przedmiotowe Zasady Oceniania z biologii obowiązujący w roku szkolnym 2012/13 r. w VIII LO realizowany przez nauczycieli przedmiotu Justynę Baranowską, Mirosławę Drażniuk,

Bardziej szczegółowo

Transport makrocząsteczek (białek)

Transport makrocząsteczek (białek) Transport makrocząsteczek (białek) Transport makrocząsteczek sortowanie białek - sekwencje sygnałowe lata 70-te XX w. - Günter Blobel - hipoteza sygnałowa; 1999r - nagroda Nobla Sekwencja sygnałowa: A

Bardziej szczegółowo

Ekspresja genu. Podstawowe mechanizmy i pojęcia

Ekspresja genu. Podstawowe mechanizmy i pojęcia Ekspresja genu Podstawowe mechanizmy i pojęcia Ekspresja Ekspresja (wyrażanie) genu jest regulowana na wielu etapach Regulacja ekspresji jest podstawowym mechanizmem dla: adaptacji do zmiennych warunków

Bardziej szczegółowo

Bioinformatyka wykład 9

Bioinformatyka wykład 9 Bioinformatyka wykład 9 14.XII.21 białkowa bioinformatyka strukturalna krzysztof_pawlowski@sggw.pl 211-1-17 1 Plan wykładu struktury białek dlaczego? struktury białek geometria i fizyka modyfikacje kowalencyjne

Bardziej szczegółowo

THE UNFOLDED PROTEIN RESPONSE

THE UNFOLDED PROTEIN RESPONSE THE UNFOLDED PROTEIN RESPONSE Anna Czarnecka Źródło: Intercellular signaling from the endoplasmatic reticulum to the nucleus: the unfolded protein response in yeast and mammals Ch. Patil & P. Walter The

Bardziej szczegółowo

Kwasy nukleinowe i białka

Kwasy nukleinowe i białka Metody bioinformatyki Kwasy nukleinowe i białka prof. dr hab. Jan Mulawka Kwasy nukleinowe DNA Kwas dezoksyrybonukleinowy jest to należący do kwasów nukleinowych wielkocząsteczkowy organiczny związek chemiczny,

Bardziej szczegółowo

Generator testów Bioinformatyka wer / 0 Strona: 1

Generator testów Bioinformatyka wer / 0 Strona: 1 Przedmiot: Nazwa przedmiotu Nazwa testu: Bioinformatyka wer. 1.0.6 Nr testu 0 Klasa: V zaoczne WNB UZ Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Analiza porównawcza białek zwykle zaczyna się na badaniach

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

Regulacja ekspresji genów. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego.

Regulacja ekspresji genów. Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Regulacja ekspresji genów Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Problem: jak sprawić aby z jednej komórki powstał wielokomórkowy

Bardziej szczegółowo