KLUCZ ODPOWIEDZI DO ZADAŃ ZAMKNIĘTYCH

Wielkość: px
Rozpocząć pokaz od strony:

Download "KLUCZ ODPOWIEDZI DO ZADAŃ ZAMKNIĘTYCH"

Transkrypt

1 Konkurs Biologiczny dla gimnazjalistów województwa zachodniopomorskiego w roku szkolnym 2014/2015 Etap wojewódzki KLUCZ ODPOWIEDZI DO ZADAŃ ZAMKNIĘTYCH Za każde z pytań testowych można uzyskać 1 pkt. Nr pytania Oczekiwana odpowiedź 1 A 2 C 3 A 4 C 5 A 6 C 7 D 8 B 9 A 10 A 11 B 12 C 13 A 14 C 15 B 16 C 17 A 18 B 19 A 20 B 1

2 KARTA ODPOWIEDZI DO ZADAŃ OTWARTYCH Za zadania otwarte możliwa do zdobycia ilość punktów podana jest przy każdym zadaniu. W poniższym schemacie oceniania prezentowane są przykładowe prawidłowe odpowiedzi. W nawiasach podane są nieobowiązujące uzupełnienia odpowiedzi, zaś sformułowania rozdzielone ukośnikiem są traktowane jako równoważne. 21 (4 pkt) 1 G A M E T O F I T 2 L I Ś C I E Ń 3 P Y Ł E K 4 R O D N I A 5 Z I A R N I A K 6 S Z Y S Z K A 7 Z A L Ą Ż E K 8 B I E L M O za wskazanie 8 prawidłowych odpowiedzi - 4 pkt; za wskazanie 6 lub 7 prawidłowych odpowiedzi - 3 pkt; za wskazanie 4 lub 5 prawidłowych odpowiedzi - 2 pkt; za wskazanie 2 lub 3 prawidłowych odpowiedzi - 1 pkt; 2

3 22 ( 3 pkt) Nazwa choroby Objawy choroby zespół Turnera; 4 mukowiscydoza; 6,8 albinizm; 2 anemia sierpowata; 3 pląsawica Huntingtona. 1,7 zespół Klinefeltera 5 za wskazanie 6 prawidłowych odpowiedzi - 3 pkt; za wskazanie 4 lub 5 prawidłowych odpowiedzi - 2 pkt; za wskazanie 2 lub 3 prawidłowych odpowiedzi - 1 pkt; 23 (4 pkt) a. glista ludzka - skażona żywność/ woda, brudne ręce, tasiemiec nieuzbrojony - skażone mięso (wołowe), owsik - skażona żywność/ woda, nieprzestrzeganie higieny (osobistej), brudne ręce, ręczniki. grypa - drogą powietrzno-kropelkową od zarażonej osoby, wirus HCV - poprzez zarażoną krew, zabiegi medyczne i kosmetyczne, w czasie stosunków płciowych, matka może zarazić dziecko w trakcie porodu, włosień krętym - mięso zawierające larwy. za wskazanie 6 prawidłowych odpowiedzi - 3 pkt; za wskazanie 4 lub 5 prawidłowych odpowiedzi - 2 pkt; za wskazanie 2 lub 3 prawidłowych odpowiedzi - 1 pkt; Uwaga: Na poprawność odpowiedzi nie ma wpływu określenie stadium inwazyjnego pasożyta. 3

4 b. spożywanie wyłącznie mięsa przebadanego przez weterynarza/ obróbka termiczna 24 (2 pkt) a. Zdania błędne to zdania numer 2, 4, 7 za wskazanie 2 prawidłowych odpowiedzi - 1 pkt; b. Chemosynteza - jeden z rodzajów autotrofizmu. Przeprowadzają ją organizmy, dla których źródłem energii do asymilacji dwutlenku węgla są reakcje chemiczne. Uwaga: zalicza się odpowiedzi jednocześnie odwołujące się do autotrofizmu i wykorzystania energii innej niż energia świetlna. 25 (2 pkt) DNA: TCTGATGGCGTAATGACCCAGTAG a. RNA: AGACUACCGCAUUACUGGGUCAUC b Arg - Leu - Pro - His - Tyr - Trp - Val - Ile Uwaga: Jeżeli w pkt a utworzono RNA na podstawie nici kodującej DNA odpowiedź nie jest uznawana. Jeżeli jednak w pkt b utworzono na jej podstawie prawidłowy peptyd, przyznaje się 1 pkt. 4

5 26 (4 pkt ) a. 1. wsierdzie, 2. śródsierdzie, 3. osierdzie/ nasierdzie, 5. żyły (płucne), 6. utlenowaną, 7. układ wieńcowy. 4. zastawki (przedsionkowo-komorowe), za wskazanie 7 lub 6 prawidłowych odpowiedzi - 3 pkt; za wskazanie 4 lub 5 prawidłowych odpowiedzi - 2 pkt; za wskazanie 2 lub 3 prawidłowych odpowiedzi - 1 pkt; b. krew należy do tkanki łącznej płynnej, najbardziej wewnętrzną warstwę tętnic buduje nabłonek jednowarstwowy płaski/śródbłonek za wskazanie 2 prawidłowych odpowiedzi - 1 pkt; 27 (4 pkt ) jest niezbędny do utrzymania ciąży - progesteron - jajniki/ ciałko żółte / łożysko mobilizuje organizm do wysiłku, ucieczki - adrenalina - (rdzeń) nadnerczy zwiększa tempo metabolizmu komórkowego - tyroksyna /trójjodotyronina - tarczyca podwyższa poziom glukozy we krwi - glukagon - trzustka. za wskazanie każdej prawidłowej odpowiedzi - 1 pkt. Uwaga: zalicza się odpowiedzi dotyczące wyłącznie nazw hormonów - poprawne wymienienie wszystkich - 2 pkt, poprawne wymienienie 3 nazw - 1 pkt. 5

6 28 (3 pkt ) numer zdania P P P F P F ocena poprawności za wskazanie 6 lub 5 prawidłowych odpowiedzi - 3 pkt; za wskazanie 3 lub 4 prawidłowych odpowiedzi - 2 pkt; za wskazanie 2 prawidłowych odpowiedzi - 1 pkt; 29 (2 pkt) rośliny nagonasienne 1a. igły na krótkopędach w pęczkach po sztuk 1b.igły pojedyncze 2a. szyszki stojące 2b.szyszki zwisające 2c.nasiona okryte czerwoną lub żółtą osnówką modrzew europejski świerk kłujący jodła pospolita cis pospolity za wskazanie 4 prawidłowych opisów - 2 pkt; za wskazanie 3 prawidłowych opisów - 1 pkt; za wskazanie mniej niż 3 prawidłowych opisów - 0 pkt. Uwaga: Zalicza się jedynie schematy zgodne z zasadami konstruowania klucza. Punkt dotyczący szyszki modrzewia nie wpływa na ocenę. 6

7 30 (3 pkt) a. numer zdania ocena poprawności P F P F P za wskazanie 5 prawidłowych odpowiedzi - 2 pkt; za wskazanie 3 lub 4 prawidłowych odpowiedzi - 1 pkt; za wskazanie mniej niż 3 prawidłowych odpowiedzi - 0 pkt. b. Dobór naturalny preferuje osobniki najlepiej przystosowane do danych warunków środowiska, w doborze sztucznym rolę selekcjonera pełni człowiek. Uwaga: nie zalicza się odpowiedzi odnoszących się do organizmów "najsilniejszych" lub odpowiedzi bardzo ogólnych ( typu: selekcjonerem jest przyroda ). 31 (4 pkt) a. 1.mitochodrium - przeprowadza (ostatnie) etapy oddychania wewnątrzkomórkowego/ stanowi centrum energetyczne komórki 2. aparat Golgiego - zachodzi w nim przebudowa związków organicznych ( cukrów, białek, lipidów ) /odpowiada za transport substancji wewnątrz komórki / na zewnątrz komórki. 3. retikulum endoplazmatyczne / siateczka wewnątrzkomórkowa - synteza białek/ tłuszczy/ dzieli komórkę na przedziały, w których zachodzą różne reakcje biochemiczne. za wskazanie każdej prawidłowej odpowiedzi - 1 pkt; b. 1, 2, 3. 7

8 32 (5 pkt). Zwierzęta, które: są stałocieplne to: 4, 6, 9, 11, 12. nie posiadają ani jednego kręgu szyjnego to: 1, 7. składają skrzek to: 2, 5, 10. posiadają bezjądrzaste erytrocyty to: 4, 6, 12. wytwarzają owodnię to: 3, 4, 6, 8, 9, 11, 12. za wskazanie każdej prawidłowej odpowiedzi - 1 pkt; 8

Konkurs Biologiczny dla gimnazjalistów województwa zachodniopomorskiego w roku szkolnym 2016/2017. Etap wojewódzki

Konkurs Biologiczny dla gimnazjalistów województwa zachodniopomorskiego w roku szkolnym 2016/2017. Etap wojewódzki Konkurs Biologiczny dla gimnazjalistów województwa zachodniopomorskiego w roku szkolnym 2016/2017 Etap wojewódzki KLUCZ ODPOWIEDZI DO ZADAŃ ZAMKNIĘTYCH Za każde z pytań testowych można uzyskać 1 pkt. Nr

Bardziej szczegółowo

Klucz odpowiedzi i kryteria oceniania etap szkolny 2014/2015 Biologia

Klucz odpowiedzi i kryteria oceniania etap szkolny 2014/2015 Biologia Klucz i kryteria oceniania etap szkolny 2014/2015 Biologia 1. Litera Nazwa sposobu ułożenia liści na Przykład rośliny łodydze A naprzeciwległe jasnota/ fuksja B skrętolegle krwawnik/ trzykrotka C okółkowe

Bardziej szczegółowo

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI D B D C B B B D C D B C A A B A B D C D

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI D B D C B B B D C D B C A A B A B D C D Nr zad. KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI zadanie 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 D B D C B B B D C D B C A A B A B D C D poprawna odpowiedź W zadaniach 1-20 za każdą

Bardziej szczegółowo

Profil metaboliczny róŝnych organów ciała

Profil metaboliczny róŝnych organów ciała Profil metaboliczny róŝnych organów ciała Uwaga: tkanka tłuszczowa (adipose tissue) NIE wykorzystuje glicerolu do biosyntezy triacylogliceroli Endo-, para-, i autokrynna droga przekazu informacji biologicznej.

Bardziej szczegółowo

MODEL ODPOWIEDZI I SCHEMAT PUNKTOWANIA: Konkurs Biologiczny 2014/2015 etap wojewódzki.

MODEL ODPOWIEDZI I SCHEMAT PUNKTOWANIA: Konkurs Biologiczny 2014/2015 etap wojewódzki. MODEL ODPOWIEDZI I SCHEMAT PUNKTOWANIA: Konkurs Biologiczny 2014/2015 etap wojewódzki. - Za rozwiązanie wszystkich zadań można uzyskać maksymalnie 60 punktów. - W zadaniach zamkniętych (jednokrotnego wyboru)

Bardziej szczegółowo

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :.

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :. CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A imię i nazwisko :. klasa :.. ilość punktów :. Zadanie 1 Przeanalizuj schemat i wykonaj polecenia. a. Wymień cztery struktury występujące zarówno w komórce roślinnej,

Bardziej szczegółowo

Klucz odpowiedzi i kryteria oceniania etap wojewódzki 2014/2015 Biologia. Przewidywana odpowiedź

Klucz odpowiedzi i kryteria oceniania etap wojewódzki 2014/2015 Biologia. Przewidywana odpowiedź Klucz i kryteria oceniania etap wojewódzki 2014/2015 Biologia Numer 1. A - torebka nefronu (kłębuszka), B kłębuszek nerkowy/kłębuszek naczyń włosowatych, C - kanalik nerkowy nazwy elementu A, B i C Proces

Bardziej szczegółowo

GIMNAZJUM SPRAWDZIANY SUKCES W NAUCE

GIMNAZJUM SPRAWDZIANY SUKCES W NAUCE GIMNAZJUM SPRAWDZIANY BIOLOGIA klasa III SUKCES W NAUCE II GENETYKA CZŁOWIEKA Zadanie 1. Cechy organizmu są warunkowane przez allele dominujące i recesywne. Uzupełnij tabelę, wykorzystując poniższe określenia,

Bardziej szczegółowo

TEST - BIOLOGIA WERONIKA GMURCZYK

TEST - BIOLOGIA WERONIKA GMURCZYK TEST - BIOLOGIA WERONIKA GMURCZYK Temat: Układ nerwowy i hormonalny Zadanie 1. Zaznacz poprawną odpowiedź. Co to są hormony? a) związki chemiczne wytwarzane w gruczołach łojowych, które regulują pracę

Bardziej szczegółowo

Gruczoły wydzielania wewnętrznego - oddają swoją wydzielinę bezpośrednio do krwi - wydzielają hormony. anatomia i fizjologia człowieka

Gruczoły wydzielania wewnętrznego - oddają swoją wydzielinę bezpośrednio do krwi - wydzielają hormony. anatomia i fizjologia człowieka Gruczoły wydzielania wewnętrznego - oddają swoją wydzielinę bezpośrednio do krwi - wydzielają hormony Gruczoły dokrewne człowieka PRZYSADKA mózgowa Przysadka mózgowa jest gruczołem wielkości ziarna grochu

Bardziej szczegółowo

Biologia. Klasa VII. Prywatna Szkoła Podstawowa i Gimnazjum im. Z. I J. Moraczewskich w Sulejówku

Biologia. Klasa VII. Prywatna Szkoła Podstawowa i Gimnazjum im. Z. I J. Moraczewskich w Sulejówku Biologia 2017 Klasa VII Dział I : HIERARCHICZNA BUDOWA ORGANIZMU CZŁOWIEKA, SKÓRA, UKŁAD RUCHU 1. Organizm człowieka jako zintegrowana całość 2. Budowa i funkcje skóry 3. Choroby skóry oraz zasady ich

Bardziej szczegółowo

Egzamin maturalny 2013 biologia poziom podstawowy przykładowe odpowiedzi:

Egzamin maturalny 2013 biologia poziom podstawowy przykładowe odpowiedzi: przykładowe odpowiedzi: Zad. 1 Zad. 2 a) Najważniejszą funkcją mitochondriów jest oddychanie tlenowe/zaopatrują komórkę w energię/w organellach tych powstaje użyteczna biologicznie energia(atp/adenozyno-5'-trifosforan)

Bardziej szczegółowo

KRYTERIA OCENIANIA ODPOWIEDZI Próbna Matura z OPERONEM. Biologia Poziom podstawowy

KRYTERIA OCENIANIA ODPOWIEDZI Próbna Matura z OPERONEM. Biologia Poziom podstawowy KRYTERIA OCENIANIA ODPOWIEDZI Próbna Matura z OPERONEM Biologia Poziom podstawowy Listopad 2013 W niniejszym schemacie oceniania zadań otwartych są prezentowane przykładowe poprawne odpowiedzi. W tego

Bardziej szczegółowo

Klub Honorowych Dawców Krwi PCK

Klub Honorowych Dawców Krwi PCK O krwi Czym jest krew? Krew to płynna tkanka w skład której wchodzą: - Krwinki czerwone(erytrocyty) są to komórkowe składniki krwi nie zawierające jądra, zawierające barwnik krwi hemoglobinę, odpowiedzialne

Bardziej szczegółowo

Konkurs Przedmiotowy z biologii dla uczniów gimnazjów województwa lubuskiego finał 2013. Model odpowiedzi, kryteria przyznawania punktów.

Konkurs Przedmiotowy z biologii dla uczniów gimnazjów województwa lubuskiego finał 2013. Model odpowiedzi, kryteria przyznawania punktów. Konkurs Przedmiotowy z biologii dla uczniów gimnazjów województwa lubuskiego finał 201 Model odpowiedzi, kryteria przyznawania punktów. Za rozwiązanie zadań z arkusza konkursowego można uzyskać 60 punktów.

Bardziej szczegółowo

Zadania zamknięte wyboru wielokrotnego. Za każdą poprawną odpowiedź uczestnik otrzymuje 1 punkt. D B C C D D A C D D B A C C C B D A D B

Zadania zamknięte wyboru wielokrotnego. Za każdą poprawną odpowiedź uczestnik otrzymuje 1 punkt. D B C C D D A C D D B A C C C B D A D B Nie przyznaje się połówek punktów. WOJEWÓDZKI KONKURS BIOLOGICZNY MODEL ODPOWIEDZI I SCHEMAT PUNKTOWANIA Zadania zamknięte wyboru wielokrotnego. Za każdą poprawną odpowiedź uczestnik otrzymuje 1 punkt.

Bardziej szczegółowo

Praca kontrolna z biologii LO dla dorosłych semestr V

Praca kontrolna z biologii LO dla dorosłych semestr V Praca kontrolna z biologii LO dla dorosłych semestr V Poniższa praca składa się z 15 zadań. Przy każdym poleceniu podano liczbę punktów możliwą do uzyskania za prawidłową odpowiedź. Za rozwiązanie zadań

Bardziej szczegółowo

Fizjologia nauka o czynności żywego organizmu

Fizjologia nauka o czynności żywego organizmu nauka o czynności żywego organizmu Stanowi zbiór praw, jakim podlega cały organizm oraz poszczególne jego układy, narządy, tkanki i komórki prawa rządzące żywym organizmem są wykrywane doświadczalnie określają

Bardziej szczegółowo

KONKURS BIOLOGICZNY ETAP REJONOWY KLUCZ ODPOWIEDZI

KONKURS BIOLOGICZNY ETAP REJONOWY KLUCZ ODPOWIEDZI KONKURS BIOLOGICZNY ETAP REJONOWY KLUCZ ODPOWIEDZI Nr zad. Max ilość punktów Prawidłowe odpowiedzi Punktacja Uwagi 1. 3 pkt Komórki: b i e Mięśnie poprzecznie prążkowane potrzebują dużo energii do wykonywania

Bardziej szczegółowo

UKŁAD ODDECHOWY

UKŁAD ODDECHOWY Zadanie 1. (1 pkt). Na rysunku przedstawiono pęcherzyki płucne oplecione siecią naczyń krwionośnych. Określ znaczenie gęstej sieci naczyń krwionośnych oplatających pęcherzyki płucne.... Zadanie 2. (2 pkt)

Bardziej szczegółowo

KARTA ODPOWIEDZI konkurs biologiczny ETAP WOJEWÓDZKI B A B D B C C B B A B B D C D B B B

KARTA ODPOWIEDZI konkurs biologiczny ETAP WOJEWÓDZKI B A B D B C C B B A B B D C D B B B KARTA ODPOWIEDZI konkurs biologiczny ETAP WOJEWÓDZKI zadanie 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 B A B D B C C B B A B B D C D B B B poprawna odpowiedź Nr zad. W zadaniach 1-18 za każdą poprawną

Bardziej szczegółowo

KONKURS Z BIOLOGII DLA UCZNIÓW Z WOJEWÓDZTWA WARMIŃSKO-MAZURSKIEGO W ROKU SZKOLNYM 2016/2017 ETAP WOJEWÓDZKI Klucz odpowiedzi i punktowania zadań

KONKURS Z BIOLOGII DLA UCZNIÓW Z WOJEWÓDZTWA WARMIŃSKO-MAZURSKIEGO W ROKU SZKOLNYM 2016/2017 ETAP WOJEWÓDZKI Klucz odpowiedzi i punktowania zadań KONKURS Z BIOLOGII DLA UCZNIÓW Z WOJEWÓDZTWA WARMIŃSKO-MAZURSKIEGO W ROKU SZKOLNYM 2016/2017 ETAP WOJEWÓDZKI Klucz odpowiedzi i punktowania zadań Zad. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

Bardziej szczegółowo

Plan działania opracowała Anna Gajos

Plan działania opracowała Anna Gajos Plan działania 15.09-15.10 opracowała Anna Gajos Jakie zagadnienia trzeba opanować z następujących działów: 1. Budowa chemiczna organizmów. 2. Budowa i funkcjonowanie komórki 3. Cykl komórkowy 4. Metabolizm

Bardziej szczegółowo

Wojewódzki Konkurs Przedmiotowy z Biologii dla uczniów gimnazjum woj. śląskiego w roku szkolnym 2013/2014 ETAP REJONOWY

Wojewódzki Konkurs Przedmiotowy z Biologii dla uczniów gimnazjum woj. śląskiego w roku szkolnym 2013/2014 ETAP REJONOWY Wojewódzki Konkurs Przedmiotowy z Biologii dla uczniów gimnazjum woj. śląskiego w roku szkolnym 2013/2014 ETP REJONOWY Rozwiązania zadań i schemat punktowania Zadanie 1. D Zadanie 2. tętnica, D lub, D,

Bardziej szczegółowo

I BIOLOGIA JAKO NAUKA

I BIOLOGIA JAKO NAUKA I BIOLOGIA JAKO NAUKA Zadanie. Rozwiąż krzyżówkę, a następnie odczytaj i wyjaśnij hasło. 0. Bada skład chemiczny organizmów i zachodzące w nich reakcje.. Zajmuje się procesami dziedziczenia.. Przedmiotem

Bardziej szczegółowo

KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP REJONOWY 2015/16

KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP REJONOWY 2015/16 KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP REJONOWY 2015/16 Nr Max ilość zad. punktów 1. 2 pkt Mechanizmy termoregulacyjne 1.Podskórne naczynia krwionośne (rozszerzają się / zwężają się) Prawidłowe odpowiedzi

Bardziej szczegółowo

KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP SZKOLNY 2015/16

KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP SZKOLNY 2015/16 KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP SZKOLNY 2015/16 Nr Max ilość zad. punktów 1. 4 pkt A. WIRUSY ROŚLINNE Jako materiał genetyczny mają RNA. Do komórki gospodarza wnikają całe, po wcześniejszym

Bardziej szczegółowo

WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z BIOLOGII DLA UCZNIÓW GIMNAZJUM WOJEWÓDZTWO POMORSKIE. etap wojewódzki 9 marca 2017 r.

WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z BIOLOGII DLA UCZNIÓW GIMNAZJUM WOJEWÓDZTWO POMORSKIE. etap wojewódzki 9 marca 2017 r. WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z BIOLOGII DLA UCZNIÓW GIMNAZJUM WOJEWÓDZTWO POMORSKIE etap wojewódzki 9 marca 2017 r. Zadanie 1 (0-1) Maksymalna liczba punktów 55 1 F 2 P 3 F 4 P 2 p. za 4 prawidłowe

Bardziej szczegółowo

WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z BIOLOGII DLA UCZNIÓW GIMNAZJUM WOJEWÓDZTWO POMORSKIE. etap wojewódzki 9 marca 2017 r.

WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z BIOLOGII DLA UCZNIÓW GIMNAZJUM WOJEWÓDZTWO POMORSKIE. etap wojewódzki 9 marca 2017 r. WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z BIOLOGII DLA UCZNIÓW GIMNAZJUM WOJEWÓDZTWO POMORSKIE etap wojewódzki 9 marca 2017 r. Zadanie 1 (0-1) Maksymalna liczba punktów 55 1 F 2 P 3 F 4 P 1 p. za 4 prawidłowe

Bardziej szczegółowo

Tematy- Biologia zakres rozszerzony, klasa 2TA,2TŻ-1, 2TŻ-2

Tematy- Biologia zakres rozszerzony, klasa 2TA,2TŻ-1, 2TŻ-2 Tematy- Biologia zakres rozszerzony, klasa 2TA,2TŻ-1, 2TŻ-2 Nr lekcji Temat Zakres treści 1 Zapoznanie z PSO, wymaganiami edukacyjnymi i podstawą programową PSO, wymagania edukacyjne i podstawa programowa

Bardziej szczegółowo

2. 1 Prawidłowa odpowiedź -C Za zaznaczenie poprawnej odpowiedzi 1 pkt

2. 1 Prawidłowa odpowiedź -C Za zaznaczenie poprawnej odpowiedzi 1 pkt KARTA ODPOWIEDZI KONKURS BIOLOGICZNY - /etap szkolny/ Nr Max Prawidłowe odpowiedzi Punktacja Uwagi zad. punktów 1. 2 U człowieka: - większa mózgoczaszka w stosunku do trzewioczaszki - żuchwa z wystającą

Bardziej szczegółowo

Zaznacz wykres ilustrujący stałocieplność człowieka. A. B. C. D.

Zaznacz wykres ilustrujący stałocieplność człowieka. A. B. C. D. I. Organizm człowieka. Skóra powłoka organizmu 1. Zadanie Napisz, czym zajmuje się anatomia............................................................................................................................

Bardziej szczegółowo

JAK DZIAŁA WĄTROBA? Wątroba spełnia cztery funkcje. Najczęstsze przyczyny chorób wątroby. Objawy towarzyszące chorobom wątroby

JAK DZIAŁA WĄTROBA? Wątroba spełnia cztery funkcje. Najczęstsze przyczyny chorób wątroby. Objawy towarzyszące chorobom wątroby SPIS TREŚCI JAK DZIAŁA WĄTROBA? Wątroba spełnia cztery funkcje Wątroba jest największym narządem wewnętrznym naszego organizmu. Wątroba jest kluczowym organem regulującym nasz metabolizm (każda substancja

Bardziej szczegółowo

Zadania zawarte w arkuszach egzaminacyjnych CKE w latach 2002-2007. Układ krążenia zadania

Zadania zawarte w arkuszach egzaminacyjnych CKE w latach 2002-2007. Układ krążenia zadania Zadania zawarte w arkuszach egzaminacyjnych CKE w latach 2002-2007 Zadanie 1 (2 pkt.) Schemat przedstawia budowę tętnicy. Układ krążenia zadania Podaj z uzasadnieniem, dwie cechy budowy tętnicy świadczące

Bardziej szczegółowo

V REGULACJA NERWOWA I ZMYSŁY

V REGULACJA NERWOWA I ZMYSŁY V REGULACJA NERWOWA I ZMYSŁY Zadanie 1. Na rysunku przedstawiającym budowę neuronu zaznacz elementy wymienione poniżej, wpisując odpowiednie symbole literowe. Następnie wskaż za pomocą strzałek kierunek

Bardziej szczegółowo

Model odpowiedzi i schemat punktowania do Arkusza II

Model odpowiedzi i schemat punktowania do Arkusza II Model odpowiedzi i schemat punktowania do Arkusza II Zasady oceniania: Za rozwiązanie zadań z arkusza II można uzyskać maksymalnie 50 punktów. Model odpowiedzi uwzględnia jej zakres merytoryczny, ale nie

Bardziej szczegółowo

A. cytologia B. histologia C. anatomia D. genetyka E. systematyka

A. cytologia B. histologia C. anatomia D. genetyka E. systematyka Zadanie 1 (0-2) Do opisów dziedzin biologii dobierz nazwy tych dziedzin. Opis nauki Dziedzina biologii 1. Zajmuje się budową tkanek. A B C D E 2. Zajmuje się dziedziczeniem cech i zmiennością organizmów.

Bardziej szczegółowo

Układ wydalniczy (moczowy) Osmoregulacja to aktywne regulowanie ciśnienia osmotycznego płynów ustrojowych w celu utrzymania homeostazy.

Układ wydalniczy (moczowy) Osmoregulacja to aktywne regulowanie ciśnienia osmotycznego płynów ustrojowych w celu utrzymania homeostazy. Układ wydalniczy (moczowy) Osmoregulacja to aktywne regulowanie ciśnienia osmotycznego płynów ustrojowych w celu utrzymania homeostazy. Wydalanie pozbywanie się z organizmu zbędnych produktów przemiany

Bardziej szczegółowo

Układ wewnątrzwydzielniczy

Układ wewnątrzwydzielniczy Układ wewnątrzwydzielniczy 1. Gruczoły dokrewne właściwe: przysadka mózgowa, szyszynka, gruczoł tarczowy, gruczoły przytarczyczne, nadnercza 2. Gruczoły dokrewne mieszane: trzustka, jajniki, jądra 3. Inne

Bardziej szczegółowo

Wojewódzki Konkurs Przedmiotowy z Biologii dla uczniów gimnazjów województwa śląskiego w roku szkolnym 2014/2015

Wojewódzki Konkurs Przedmiotowy z Biologii dla uczniów gimnazjów województwa śląskiego w roku szkolnym 2014/2015 Wojewódzki Konkurs Przedmiotowy z Biologii dla uczniów gimnazjów województwa śląskiego w roku szkolnym 04/05 KOD UCZNIA Etap: Data: Czas pracy: rejonowy 9 stycznia 05 r. 90 minut Informacje dla ucznia.

Bardziej szczegółowo

Zadania dla I klasy gimnazjum BIOLOGIA

Zadania dla I klasy gimnazjum BIOLOGIA Część I zadania zamknięte (0-1) Zadania dla I klasy gimnazjum BIOLOGIA 1. Najmniejszą jednostką budującą organizm, która może samodzielnie żyć jest a. narząd b. tkanka c. organella d. komórka 2. Zaznacz

Bardziej szczegółowo

1.8. Funkcje biologiczne wody wynikają z jej właściwości fizycznych i chemicznych. Oceń

1.8. Funkcje biologiczne wody wynikają z jej właściwości fizycznych i chemicznych. Oceń 1 1.8. Funkcje biologiczne wody wynikają z jej właściwości fizycznych i chemicznych. Oceń każdą podaną w tabeli informację, wybierając Prawdę, jeśli jest ona prawdziwa, lub, jeśli jest fałszywa. 1) Ilość

Bardziej szczegółowo

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP REJONOWY

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP REJONOWY KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP REJONOWY Nr zad. Max punktów 1. 7 pkt. 2. 3 pkt. Prawidłowe odpowiedzi Punktacja Uwagi 1. F R U K T O Z A 2. R Y B O Z A 3. I N S U L I N A 4. F I B R Y N O G

Bardziej szczegółowo

Recenzja pracy. BIOLOGIA poziom podstawowy. pieczątka/nazwa szkoły. klasa 1 LO PK nr 1 semestr I /2011/2012

Recenzja pracy. BIOLOGIA poziom podstawowy. pieczątka/nazwa szkoły. klasa 1 LO PK nr 1 semestr I /2011/2012 pieczątka/nazwa szkoły BIOLOGIA poziom podstawowy klasa 1 LO PK nr 1 semestr I /2011/2012 Uwaga! Strona tytułowa stanowi integralną część pracy kontrolnej. Wypełnij wszystkie pola czytelnie drukowanymi

Bardziej szczegółowo

Komórka organizmy beztkankowe

Komórka organizmy beztkankowe Grupa a Komórka organizmy beztkankowe Poniższy test składa się z 12 zadań. Przy każdym poleceniu podano liczbę punktów możliwą do uzyskania za prawidłową odpowiedź. Za rozwiązanie całego testu możesz otrzymać

Bardziej szczegółowo

Podstawy mikrobiologii. Wirusy bezkomórkowe formy materii oŝywionej

Podstawy mikrobiologii. Wirusy bezkomórkowe formy materii oŝywionej Podstawy mikrobiologii Wykład 3 Wirusy bezkomórkowe formy materii oŝywionej Budowa wirusów Wirusy nie mają budowy komórkowej, zatem pod względem biologicznym nie są organizmami Ŝywymi! Są to twory nukleinowo

Bardziej szczegółowo

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI Nr Max Prawidłowe odpowiedzi Punktacja Uwagi zad. punktów 1. 2 pkt. Dzięki procesowi koniugacji następuje zwiększenie różnorodności genetycznej bakterii/

Bardziej szczegółowo

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10.

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10. Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016 Ćwiczenie nr 1 (06-07.10.2015) Temat: Wprowadzenie 1. Omówienie regulaminu zajęć Temat: Wprowadzenie

Bardziej szczegółowo

Anatomia i fizjologia człowieka

Anatomia i fizjologia człowieka Powtórzenie do testu nr 1 Anatomia i fizjologia człowieka 1. Podpisz rysunek dotyczący budowy skóry. Wykorzystaj informacje (skóra właściwa, warstwa podskórna, naskórek, włos, gruczoł łojowy, gruczoł potowy,

Bardziej szczegółowo

PRZEDMIOTY PODSTAWOWE

PRZEDMIOTY PODSTAWOWE PRZEDMIOTY PODSTAWOWE Anatomia człowieka 1. Które z białek występujących w organizmie człowieka odpowiedzialne są za kurczliwość mięśni? 2. Co to są neurony i w jaki sposób stykają się między sobą i efektorami?

Bardziej szczegółowo

Wojewódzki Konkurs Biologiczny dla młodzieży gimnazjalnej województwo wielkopolskie etap szkolny 27.10.2011

Wojewódzki Konkurs Biologiczny dla młodzieży gimnazjalnej województwo wielkopolskie etap szkolny 27.10.2011 Wojewódzki Konkurs Biologiczny dla młodzieży gimnazjalnej województwo wielkopolskie etap szkolny 27.10.2011 KOD UCZNIA.. ( wpisuje uczeo) Informacja dla Komisji Konkursowej ( komisja wypełnia po sprawdzeniu

Bardziej szczegółowo

2. Rozdział materiału genetycznego w czasie podziałów komórkowych - mitozy i mejozy

2. Rozdział materiału genetycznego w czasie podziałów komórkowych - mitozy i mejozy Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I (GENETYKA) dla kierunku Lekarskiego, rok I 2017/2018 Ćwiczenie nr 1 (09-10.10.2017) Temat: Wprowadzenie 1. Omówienie regulaminu zajęć

Bardziej szczegółowo

SCENARIUSZ ZAJĘĆ KOŁA NAUKOWEGO. biologiczno - chemicznego

SCENARIUSZ ZAJĘĆ KOŁA NAUKOWEGO. biologiczno - chemicznego SCENARIUSZ ZAJĘĆ KOŁA NAUKOWEGO biologiczno - chemicznego prowadzonego w ramach projektu Uczeń OnLine 1. Autor: Bernadeta Dymek 2. Grupa docelowa: II grupa od 2010 2013 (klasa II) 3. Liczba godzin: 2 4.

Bardziej szczegółowo

FIZJOLOGIA CZŁOWIEKA

FIZJOLOGIA CZŁOWIEKA FIZJOLOGIA CZŁOWIEKA Daniel McLaughlin, Jonathan Stamford, David White FIZJOLOGIA CZŁOWIEKA Daniel McLaughlin Jonathan Stamford David White Przekład zbiorowy pod redakcją Joanny Gromadzkiej-Ostrowskiej

Bardziej szczegółowo

Anatomia i fizjologia człowieka

Anatomia i fizjologia człowieka Powtórzenie do testu nr 4 Anatomia i fizjologia człowieka 1. Podpisz rysunek dotyczący budowy skóry. Wykorzystaj informacje (skóra właściwa, warstwa podskórna, naskórek, włos, gruczoł łojowy, gruczoł potowy,

Bardziej szczegółowo

Temat: Komórka jako podstawowa jednostka strukturalna i funkcjonalna organizmu utrwalenie wiadomości.

Temat: Komórka jako podstawowa jednostka strukturalna i funkcjonalna organizmu utrwalenie wiadomości. SCENARIUSZ LEKCJI BIOLOGII DLA KLASY I GIMNAZJUM Temat: Komórka jako podstawowa jednostka strukturalna i funkcjonalna organizmu utrwalenie wiadomości. Cele: Utrwalenie pojęć związanych z budową komórki;

Bardziej szczegółowo

Kuratorium Oświaty w Lublinie ZESTAW ZADAŃ KONKURSOWYCH Z BIOLOGII DLA UCZNIÓW GIMNAZJUM ROK SZKOLNY 2015/2016 ETAP OKRĘGOWY. Instrukcja dla ucznia

Kuratorium Oświaty w Lublinie ZESTAW ZADAŃ KONKURSOWYCH Z BIOLOGII DLA UCZNIÓW GIMNAZJUM ROK SZKOLNY 2015/2016 ETAP OKRĘGOWY. Instrukcja dla ucznia Kuratorium Oświaty w Lublinie ZESTAW ZADAŃ KONKURSOWYCH Z BIOLOGII DLA UCZNIÓW GIMNAZJUM ROK SZKOLNY 2015/2016 KOD UCZNIA ETAP OKRĘGOWY Instrukcja dla ucznia 1. Zestaw konkursowy zawiera 19 zadań. 2. Przed

Bardziej szczegółowo

ZAGADNIENIA KIERUNKOWE.

ZAGADNIENIA KIERUNKOWE. ZAGADNIENIA KIERUNKOWE www.ams.wroclaw.pl Trening personalny Trener personalny Kulturystyka Sporty siłowe Trening motoryczny Zajęcia funkcjonalne Wysiłek fizyczny Zmęczenie Zakwasy; glikogen TRENING PERSONALNY

Bardziej szczegółowo

KLUCZ PUNKTOWANIA ODPOWIEDZI Z BIOLOGII POZIOM PODSTAWOWY SIERPIEŃ 2010

KLUCZ PUNKTOWANIA ODPOWIEDZI Z BIOLOGII POZIOM PODSTAWOWY SIERPIEŃ 2010 KLUCZ PUNKTOWANIA ODPOWIEDZI Z BIOLOGII POZIOM PODSTAWOWY SIERPIEŃ 00 Zasady oceniania Za rozwiązanie zadań z arkusza można uzyskać maksymalnie 50 punktów. Model odpowiedzi uwzględnia jej zakres merytoryczny,

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ 1. Gen to odcinek DNA odpowiedzialny

Bardziej szczegółowo

MUTACJE GENETYCZNE. Wykonane przez Malwinę Krasnodębską kl III A

MUTACJE GENETYCZNE. Wykonane przez Malwinę Krasnodębską kl III A MUTACJE GENETYCZNE Wykonane przez Malwinę Krasnodębską kl III A Mutacje - rodzaje - opis Mutacje genowe powstają na skutek wymiany wypadnięcia lub dodatnia jednego albo kilku nukleotydów. Zmiany w liczbie

Bardziej szczegółowo

-Trening Personalny : -Trener Personalny: -Kulturystyka: -Sporty siłowe: -Trening motoryczny: -Zajęcia funkcjonalne: -Wysiłek fizyczny : -Zmęczenie:

-Trening Personalny : -Trener Personalny: -Kulturystyka: -Sporty siłowe: -Trening motoryczny: -Zajęcia funkcjonalne: -Wysiłek fizyczny : -Zmęczenie: -Trening Personalny : -Trener Personalny: -Kulturystyka: -Sporty siłowe: -Trening motoryczny: -Zajęcia funkcjonalne: -Wysiłek fizyczny : -Zmęczenie: -Zakwaszenie: -Glikogen: Trening personalny: Indywidualnie

Bardziej szczegółowo

Komentarz do matury z biologii rozszerzonej 2015

Komentarz do matury z biologii rozszerzonej 2015 Komentarz do matury z biologii rozszerzonej 2015 Zad. 1 dotyczyło analizy drzewa filogenetycznego i danych zamieszczonych w tabeli. Na zajęciach analizowaliśmy drzewka filogenetyczne ustalając np. stopień

Bardziej szczegółowo

KRYTERIA OCENIANIA ODPOWIEDZI Próbna Matura z OPERONEM. Biologia Poziom roszerzony

KRYTERIA OCENIANIA ODPOWIEDZI Próbna Matura z OPERONEM. Biologia Poziom roszerzony KRYTERIA OCENIANIA ODPOWIEDZI Próbna Matura z OPERONEM Biologia Poziom roszerzony Listopad 2012 W niniejszym schemacie oceniania zadań otwartych są prezentowane przykładowe poprawne. W tego typu ch należy

Bardziej szczegółowo

Uzależnienia. Nabyta silna potrzeba zażywania jakiejś substancji.

Uzależnienia. Nabyta silna potrzeba zażywania jakiejś substancji. Uzależnienia Nabyta silna potrzeba zażywania jakiejś substancji. Termin uzależnienie jest stosowany głównie dla osób, które nadużywają narkotyków, alkoholu i papierosów. Używki Wszystkie używki stanowią

Bardziej szczegółowo

Wojewódzki Konkurs Biologiczny dla uczniów dotychczasowych gimnazjów i klas dotychczasowych gimnazjów województwa wielkopolskiego

Wojewódzki Konkurs Biologiczny dla uczniów dotychczasowych gimnazjów i klas dotychczasowych gimnazjów województwa wielkopolskiego Kod ucznia Data urodzenia ucznia Dzień miesiąc rok Wojewódzki Konkurs Biologiczny dla uczniów dotychczasowych gimnazjów i klas dotychczasowych gimnazjów województwa wielkopolskiego Instrukcja dla ucznia

Bardziej szczegółowo

Bliskie spotkania z biologią METABOLIZM. dr hab. Joanna Moraczewska, prof. UKW. Instytut Biologii Eksperymetalnej, Zakład Biochemii i Biologii Komórki

Bliskie spotkania z biologią METABOLIZM. dr hab. Joanna Moraczewska, prof. UKW. Instytut Biologii Eksperymetalnej, Zakład Biochemii i Biologii Komórki Bliskie spotkania z biologią METABOLIZM dr hab. Joanna Moraczewska, prof. UKW Instytut Biologii Eksperymetalnej, Zakład Biochemii i Biologii Komórki Metabolizm całokształt przemian biochemicznych i towarzyszących

Bardziej szczegółowo

TEST Z CYTOLOGII - GRUPA I

TEST Z CYTOLOGII - GRUPA I TEST Z CYTOLOGII - GRUPA I Zad. 1 (2 p.) Rysunek przedstawia schemat budowy pewnej struktury komórkowej. Podaj jej nazwę i określ funkcję w komórce. Zad. 2 (4p.) Schematy A i B ilustrują dwie struktury

Bardziej szczegółowo

Dieta ketogenna ARKADIUSZ KOGUT

Dieta ketogenna ARKADIUSZ KOGUT Dieta ketogenna ARKADIUSZ KOGUT Odżywianie oparte na tłuszczach jest coraz częściej stosowane w sportach wytrzymałościowych. Jakie korzyści płyną ze wzrostu spożycia lipidów i kiedy można stosować taką

Bardziej szczegółowo

EGZAMIN MATURALNY 2010 BIOLOGIA

EGZAMIN MATURALNY 2010 BIOLOGIA Centralna Komisja Egzaminacyjna w Warszawie EGZAMIN MATURALNY 2010 BIOLOGIA POZIOM PODSTAWOWY Klucz punktowania odpowiedzi MAJ 2010 2 Zadanie 1. Podanie cech budowy hominidów umożliwiających im wytwarzanie

Bardziej szczegółowo

Opcja konsultacji lekarza (dr n.med.) - eksperta medycyny przyczynowej (dodatkowo płatna, do uzgodnienia w gabinecie).

Opcja konsultacji lekarza (dr n.med.) - eksperta medycyny przyczynowej (dodatkowo płatna, do uzgodnienia w gabinecie). KOMPLEKSOWE BADANIA ORGANIZMU W GABINETACH NOMA MEDICA VOLLA POD KĄTEM DIETETYCZNYM, W TYM BADANIE METABOLIZMÓW (MEDYCYNA PRZYCZYNOWA), Z DOBOREM DIETY LECZNICZEJ Ultranowoczesne kompleksowe badanie -

Bardziej szczegółowo

EDUKACJA PACJENTA I JEGO RODZINY MAJĄCA NA CELU PODNIESIENIE ŚWIADOMOŚCI NA TEMAT CUKRZYCY, DOSTARCZENIE JAK NAJWIĘKSZEJ WIEDZY NA JEJ TEMAT.

EDUKACJA PACJENTA I JEGO RODZINY MAJĄCA NA CELU PODNIESIENIE ŚWIADOMOŚCI NA TEMAT CUKRZYCY, DOSTARCZENIE JAK NAJWIĘKSZEJ WIEDZY NA JEJ TEMAT. EDUKACJA PACJENTA I JEGO RODZINY MAJĄCA NA CELU PODNIESIENIE ŚWIADOMOŚCI NA TEMAT CUKRZYCY, DOSTARCZENIE JAK NAJWIĘKSZEJ WIEDZY NA JEJ TEMAT. Prowadząca edukację: piel. Anna Otremba CELE: -Kształtowanie

Bardziej szczegółowo

II Konkurs Biologiczny NUCLEUS

II Konkurs Biologiczny NUCLEUS XXX Liceum Ogólnokształcące im. Jana Śniadeckiego w Warszawie II Konkurs Biologiczny NUCLEUS Drogi uczniu! W poniższym teście znajduje się 21 zadań, w których możesz zdobyć 30 punktów. Do każdego z tych

Bardziej szczegółowo

Klucz odpowiedzi do konkursu biologicznego dla gimnazjum

Klucz odpowiedzi do konkursu biologicznego dla gimnazjum Klucz odpowiedzi do konkursu biologicznego dla gimnazjum Nr Max zad. punktów Prawidłowe odpowiedzi Punktacja Uwagi 1. 3 Typ: Strunowce Podtyp: Kręgowce Gromada: Ssaki Podgromada: Łożyskowce Rząd: Naczelne

Bardziej szczegółowo

Pobrano ze strony http://biologhelp.com

Pobrano ze strony http://biologhelp.com Pobrano ze strony http://biologhelp.com KLUCZ PUNKTOWANIA ODPOWIEDZI Z BIOLOGII POZIOM PODSTAWOWY SIERPIEŃ 0 Zasady oceniania Model odpowiedzi uwzględnia jej zakres merytoryczny, ale nie jest ścisłym wzorcem

Bardziej szczegółowo

Sprawdzian wiedzy dla uczniów klas szkół gimnazjalnych. (klucz dla nauczyciela).

Sprawdzian wiedzy dla uczniów klas szkół gimnazjalnych. (klucz dla nauczyciela). Multimedialny program Poznajemy nasze drzewa i krzewy stworzono w ramach ogólnopolskiego projektu edukacyjnego Bioróżnorodność poznaj by zachować realizowanego przez Centrum Informacji i Edukacji Ekologicznej

Bardziej szczegółowo

UKŁAD KRĄŻENIA I UKŁAD ODDECHOWY- N.Olszewska

UKŁAD KRĄŻENIA I UKŁAD ODDECHOWY- N.Olszewska UKŁAD KRĄŻENIA I UKŁAD ODDECHOWY- N.Olszewska 1.Trombocyty (płytki kwi)biorą udział w procesie: A.fagocytozy B.transportu tlenu C.oddychania D.krzepnięcia krwi 2. Której z wymienionych funkcji nie pełni

Bardziej szczegółowo

Prawidłowe odpowiedzi Punktacja Uwagi. Nr zad. Za poprawne uzupełnienie każdego z podpunktów po 1 pkt

Prawidłowe odpowiedzi Punktacja Uwagi. Nr zad. Za poprawne uzupełnienie każdego z podpunktów po 1 pkt Nr zad. KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP SZKOLNY Max punktów 1. 3 pkt. Klasyfikacja wirusów ze względu na: a) strukturę wirusa/ kształt otoczki b) rodzaj kwasu nukleinowego, jaki wchodzi w skład

Bardziej szczegółowo

Konkurs Biologiczny etap szkolny

Konkurs Biologiczny etap szkolny Konkurs Biologiczny etap szkolny KARTA ODPOWIEDZI Nr Max Prawidłowe odpowiedzi Punktacja Uwagi zad. punktów 1. 3 pkt. 2. są pasożytami; 3. można je zniszczyć wysoką temperaturą; 4. rozmnażają się; 7. ulegają

Bardziej szczegółowo

Regulacja nerwowo-hormonalna. 1. WskaŜ strzałkami na rysunku gruczoły i napisz ich nazwy: przysadka mózgowa, tarczyca, jajniki, nadnercza.

Regulacja nerwowo-hormonalna. 1. WskaŜ strzałkami na rysunku gruczoły i napisz ich nazwy: przysadka mózgowa, tarczyca, jajniki, nadnercza. Regulacja nerwowo-hormonalna 1. WskaŜ strzałkami na rysunku gruczoły i napisz ich nazwy: przysadka mózgowa, tarczyca, jajniki, nadnercza. 2. Zaznacz nazwę struktury, która koordynuje działalność wszystkich

Bardziej szczegółowo

Układ szkieletowy Iza Falęcka

Układ szkieletowy Iza Falęcka Układ szkieletowy Iza alęcka Zaznacz podpunkt, w którym nie wymieniono kości krótkich. a) kość łokciowa, kość miednicza, rzepka b) kość krzyżowa, paliczki, łopatka c) kość nadgarstka, kręgosłup, kość śródręcza

Bardziej szczegółowo

Mariola Winiarczyk Zespół Szkolno-Gimnazjalny Rakoniewice

Mariola Winiarczyk Zespół Szkolno-Gimnazjalny Rakoniewice Mariola Winiarczyk Zespół Szkolno-Gimnazjalny Rakoniewice Szkolny Konkurs Wiedzy o AIDS i HIV obejmuje dwa etapy. Etap pierwszy przeprowadzany jest ok. 25 października. Biorą w nim udział trój osobowe

Bardziej szczegółowo

Wykaz Ebook dostępnych w bibliotece WSNoZ zakupionych w 2012 r.

Wykaz Ebook dostępnych w bibliotece WSNoZ zakupionych w 2012 r. Wykaz Ebook dostępnych w bibliotece WSNoZ zakupionych w 2012 r. 1. Refleksoterapia stóp. Porady lekarza rodzinnego 2. Refleksoterapia. Stopy, uszy. Encyklopedia zdrowia 3. Jak leczyć reumatoidalne zapalenie

Bardziej szczegółowo

SPIS TREŚCI. CZĘŚĆ PIERWSZA Podstawy histologii. CZĘŚĆ DRUGA Podstawy anatomii i fizjologii człowieka. Przedmowa 11 Wykaz skrótów 13

SPIS TREŚCI. CZĘŚĆ PIERWSZA Podstawy histologii. CZĘŚĆ DRUGA Podstawy anatomii i fizjologii człowieka. Przedmowa 11 Wykaz skrótów 13 SPIS TREŚCI Przedmowa 11 Wykaz skrótów 13 CZĘŚĆ PIERWSZA Podstawy histologii I. TKANKI CZŁOWIEKA (dr Joanna Kaźmierczak) 17 1. Tkanka nabłonkowa 17 1.1. Nabłonek pokrywający 18 1.2. Nabłonek gruczołowy

Bardziej szczegółowo

Wojewódzki Konkurs Biologiczny dla uczniów gimnazjów województwa wielkopolskiego ETAP WOJEWÓDZKI. / 50 pkt. Uczeń został laureatem TAK/NIE

Wojewódzki Konkurs Biologiczny dla uczniów gimnazjów województwa wielkopolskiego ETAP WOJEWÓDZKI. / 50 pkt. Uczeń został laureatem TAK/NIE Kod ucznia Data urodzenia ucznia Wojewódzki Konkurs Biologiczny dla uczniów gimnazjów województwa wielkopolskiego ETAP WOJEWÓDZKI Rok szkolny 2012/2013 Instrukcja dla ucznia 1. Sprawdź czy test zawiera

Bardziej szczegółowo

KARTA ODPOWIEDZI konkurs biologiczny ETAP REJONOWY Prawidłowe odpowiedzi Punktacja Uwagi

KARTA ODPOWIEDZI konkurs biologiczny ETAP REJONOWY Prawidłowe odpowiedzi Punktacja Uwagi Nr zad. Max punktów 1. 3 pkt. A. wiroidy B. wirusy C. priony 2. 5 pkt. KULISTE KARTA ODPOWIEDZI konkurs biologiczny ETAP REJONOWY Prawidłowe odpowiedzi Punktacja Uwagi WYDŁUŻONE BAKTERIE SPIRALNIE SKRĘCONE

Bardziej szczegółowo

Praca kontrolna z biologii LO dla dorosłych semestr V

Praca kontrolna z biologii LO dla dorosłych semestr V Praca kontrolna z biologii LO dla dorosłych semestr V Poniższa praca składa się z 16 zadań. Przy każdym poleceniu podano liczbę punktów możliwą do uzyskania za prawidłową odpowiedź. Za rozwiązanie zadań

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 4 Jak działają geny?

Bardziej szczegółowo

Wymagania edukacyjne biologia,klasa 7

Wymagania edukacyjne biologia,klasa 7 Wymagania edukacyjne biologia,klasa 7 Półrocze I Półrocze II Wymagania ogólne. Uczeń I. Znajomość różnorodności biologicznej oraz podstawowych zjawisk i procesów biologicznych. 1) opisuje, porządkuje i

Bardziej szczegółowo

WOJEWÓDZKI KONKURS BIOLOGICZNY

WOJEWÓDZKI KONKURS BIOLOGICZNY Pieczątka szkoły Kod ucznia Liczba punktów WOJEWÓDZKI KONKURS BIOLOGICZNY DLA UCZNIÓW GIMNAZJÓW W ROKU SZKOLNYM 2014/2015 7.11.2014 r. 1. Test konkursowy zawiera 25 zadań. Są to zadania zamknięte i otwarte.

Bardziej szczegółowo

Wirusy i bakterie. Barbara Lewicka

Wirusy i bakterie. Barbara Lewicka Wirusy i bakterie Barbara Lewicka Budowa wirusa HIV a) glikoproteina 120, b) glikoproteina 41, c) lipidowa osłonka zewnętrzna, d) białkowa osłonka rdzenia, e) proteaza, f) kapsyd, g) RNA, h) odwrotna

Bardziej szczegółowo

Pobrano ze strony

Pobrano ze strony Pobrano ze strony http://biologhelp.com Badanie diagnostyczne z biologii MODEL ODPOWIEDZI I SCHEMAT OCENIANIA ARKUSZA II A1, A4 (A1 arkusz standardowy, A4 arkusz dla słabo widzących) Zasady oceniania Za

Bardziej szczegółowo

METABOLIZM. Zadanie 1. (3 pkt). Uzupełnij tabelę, wpisując w wolne kratki odpowiednio produkt oddychania tlenowego i produkty fermentacji alkoholowej.

METABOLIZM. Zadanie 1. (3 pkt). Uzupełnij tabelę, wpisując w wolne kratki odpowiednio produkt oddychania tlenowego i produkty fermentacji alkoholowej. Zadanie 1. (3 pkt). Uzupełnij tabelę, wpisując w wolne kratki odpowiednio produkt oddychania tlenowego i produkty fermentacji alkoholowej. Zadanie 3. (3 pkt). Schemat mechanizmu otwierania aparatu szparkowego.

Bardziej szczegółowo

NAUKI O CZŁOWIEKU. Biologia kości Terminologia

NAUKI O CZŁOWIEKU. Biologia kości Terminologia NAUKI O CZŁOWIEKU Biologia kości Terminologia PODSTAWOWE INFORMACJE O KOŚCIACH Kośd jest jedną z najmocniejszych substancji biologicznych Szkielet jednak to mniej niż 20% masy ciała FUNKCJE KOŚCI Układ

Bardziej szczegółowo

Przykładowe zadania. przygotowujące do egzaminu maturalnego

Przykładowe zadania. przygotowujące do egzaminu maturalnego Przykładowe zadania z BIOLOGii przygotowujące do egzaminu maturalnego Prezentowane zadania są zgodne z podstawą programową kształcenia ogólnego w zakresie rozszerzonym i podstawowym. Prócz zadań, które

Bardziej szczegółowo

Bliskie spotkania z biologią. METABOLIZM część II. dr hab. Joanna Moraczewska, prof. UKW

Bliskie spotkania z biologią. METABOLIZM część II. dr hab. Joanna Moraczewska, prof. UKW Bliskie spotkania z biologią METABOLIZM część II dr hab. Joanna Moraczewska, prof. UKW Instytut Biologii Eksperymetalnej, Zakład Biochemii i Biologii Komórki METABOLIZM KATABOLIZM - rozkład związków chemicznych

Bardziej szczegółowo

PRÓBNY EGZAMIN MATURALNY Z BIOLOGII

PRÓBNY EGZAMIN MATURALNY Z BIOLOGII POUFNE do dnia... godz.... KOD ZDAJĄCEGO IMIĘ NAZWISKO WPISUJE PISZĄCY PO OTRZYMANIU PRACY - - WPISAĆ PO ROZKODOWANIU PRACY ARKUSZ II PRÓBNY EGZAMIN MATURALNY Z BIOLOGII Czas pracy 120 minut Informacje

Bardziej szczegółowo

Zadania maturalne z biologii - 3

Zadania maturalne z biologii - 3 Koło Biologiczne Liceum Ogólnokształcące nr II w Gliwicach 2015-2016 Zadania maturalne z biologii - 3 Zadania: Zad. 1(Wiktoria Wnuk, Weronika Żak, Tomasz Gojowy 2D) Na podstawie wykresu odpowiedz na pytania.

Bardziej szczegółowo

Zadanie 5. (2 pkt) Schemat procesu biologicznego utleniania glukozy.

Zadanie 5. (2 pkt) Schemat procesu biologicznego utleniania glukozy. Metabolizm Zadanie 1 (1 pkt) Oddychanie jest przykładem procesu katabolicznego. Uzasadnij to stwierdzenie jednym argumentem. Zadanie 2 (2 pkt.) Napełniono termos kiełkującymi nasionami grochu, włożono

Bardziej szczegółowo

Formuła 2 Zestaw witamin i minerałów dla kobiet

Formuła 2 Zestaw witamin i minerałów dla kobiet KARTA OŚWIADCZEŃ PRODUKTOWYCH Formuła 2 Zestaw witamin i minerałów dla kobiet GŁÓWNE OŚWIADCZENIA Równowaga hormonalna: Zawiera witaminę B6 przyczyniającą się do regulacji aktywności hormonalnej. Metabolizm

Bardziej szczegółowo