MATERIAŁY. I Międzynarodowej i VII Ogólnopolskiej Młodzieżowej Konferencji Naukowej. Nauki o człowieku w środowisku na początku XXI w.

Wielkość: px
Rozpocząć pokaz od strony:

Download "MATERIAŁY. I Międzynarodowej i VII Ogólnopolskiej Młodzieżowej Konferencji Naukowej. Nauki o człowieku w środowisku na początku XXI w."

Transkrypt

1 MATERIAŁY I Międzynarodowej i VII Ogólnopolskiej Młodzieżowej Konferencji Naukowej Nauki o człowieku w środowisku na początku XXI w. Uniwersytet Rzeszowski

2 Uniwersytet Rzeszowski Wydział Biologiczno-Rolniczy Studenckie Koło Naukowe Rolników Włościanin Studenckie Koło Naukowe Technologów Żywności Ferment Wydział Wychowania Fizycznego Koło Naukowe Podróżników MATERIAŁY I Międzynarodowej i VII Ogólnopolskiej Młodzieżowej Konferencji Naukowej nt. Nauki o człowieku w środowisku na początku XXI w. Naukowy Patronat Prof. dr hab. Aleksander Bobko Prorektor ds. Badań Naukowych i Współpracy z Zagranicą Dr hab. inż. prof. UR Czesław Puchalski Prorektor ds. Rozwoju i Polityki Finansowej Uniwersytet Rzeszowski Rzeszów, 23 maja

3 Komitet Naukowy Konferencji Prof. dr hab. Bohdan Achrem-Achremowicz Dr hab. inż. prof. UR Lech Lichołai Prof. dr hab. Bogusław Sawicki Dr hab. inż. prof. UR Zbigniew Czerniakowski Prof. dr hab. Kazimierz Obodyński Prof. dr hab. Czesława Trąba Komitet Organizacyjny Przewodniczący Dr inż. Marta Pisarek Członkowie: mgr inż. Bernadeta Alvares, mgr inż. Marta Gargała, dr inż. Jan Gąsior, mgr. Jarosław Herbert, Dorian Kapiszewski, mgr Maciej Kluz, Maciej Kurcz, Arkadiusz Mach, dr inż. Tomasz Olbrycht, Anna Pilch, inż. Magdalena Róg, inż. Monika Róg, inż. Łukasz Rybak, inż. Magdalena Senczyna, inż. Paulina Sidor, inż. Anna Szewkienicz, Ewa Śliwka Opracowanie redakcyjne materiałów konferencyjnych inż. Łukasz Rybak, dr inż. Marta Pisarek Niniejsze opracowanie w całości ani w fragmentach nie może być powielane ani rozpowszechniane za pomocą urządzeń elektronicznych, kopiujących, nagrywających i innych bez pisemnej zgody autorów. Komitet Organizacyjny Konferencji nie ponosi odpowiedzialności za treść zamieszczonych artykułów. Materiały Konferencyjne mogą zawierać zmiany wynikające z opracowania redakcyjnego. Sponsorzy Agencja Restrukturyzacji i Modernizacji Rolnictwa Podkarpacki Odział Regionalny RSM Resmlecz w Trzebownisku PPKiUG KRUSZGEO SA w Rzeszowie Prezydent Miasta Mielca Burmistrz Miasta Ropczyce Burmistrz Miasta i Gminy Kańczuga Burmistrz Tyczyna Burmistrz Kolbuszowej Starosta Powiatu Brzozowskiego Starosta Powiatu Łańcuckiego Starosta Powiatu Leżańskiego Starosta Krośnieński Starosta Powiatu Przemyskiego WELMAT Rzeszów ISBN

4 Wstęp W dniu 23 maja 2011 roku na Uniwersytecie Rzeszowskim odbyła się I Międzynarodowa i VII Ogólnopolska Młodzieżowa Konferencja Naukowa organizowana przez SKN Rolników Włościanin, SKN Technologów Żywności Ferment oraz KN Podróżników nt. Nauki o człowieku w środowisku na początku XXI w. W konferencji tej uczestniczyli studenci i doktoranci z krajowych i zagranicznych ośrodków naukowych: Uniwersytetu Jagiellońskiego, Uniwersytetu Rolniczego w Krakowie, Uniwersytetu Łódzkiego, Uniwersytetu Przyrodniczego w Lublinie, Uniwersytetu Humanistyczno-Przyrodniczego w Kielcach, Uniwersytetu Technologiczno- Przyrodniczego w Bydgoszczy, Uniwersytetu Warszawskiego, Uniwersytetu Gdańskiego, Uniwersytetu Rolniczego w Nitrze, Uniwersytetu Pedagogicznego im. Iwana Franka w Drohobyczu, Uniwersytetu Rzeszowskiego, Politechniki Wrocławskiej, Politechniki Łódzkiej, PWSZ w Chełmie, PWSZ w Sanoku, PWSZ w Sulechowie, WSIiZ w Rzeszowie. Pokłosiem Konferencji jest zbiór artykułów oraz doniesień naukowych młodych adeptów nauki podzielony na cztery grupy tematyczne: 1. Nauki o żywności i żywieniu człowieka, biotechnologia; 2. Perspektywy rozwoju turystyki w Polsce; 3. Wielofunkcyjność obszarów wiejskich; 4. Kształtowanie i ochrona środowiska przyrodniczego i antropogenicznego. W sekcji nauki o żywności i żywieniu człowieka, biotechnologia zamieszczono wyniki badań dotyczące jakości surowców spożywczych pochodzenia roślinnego i zwierzęcego, wpływu różnych substancji zawartych w żywności na zdrowie człowieka oraz zachowań dietetycznych różnych grup społecznych. W sekcji związanej z turystyką zamieszczono artykuły nawiązujące do współczesnych kierunków oraz tendencji rozwojowych zachodzących na rynku usług turystycznych. Dotyczą one turystyki regionalnej oraz aktywizującej wypoczywającego tj. turystyka konna, rowerowa, zdrowotna, górska i agroturystyka. W rozdziale poświeconym wielofunkcyjności obszarów wiejskich znalazły się przed wszystkim artykuły ukazujące zmiany w rozwoju tych terenów będące konsekwencją przyjętych zasad i instrumentów polityki rolnej. W sekcji kształtowania i ochrony środowiska przyrodniczego i antropogenicznego zawarto artykuły dotyczące wpływu zagospodarowania przestani nie tylko na stan środowiska, ale i samopoczucie człowieka. Wszystkim uczestnikom dziękujemy za ubogacenie programu konferencji opracowaniami, które powinny zainspirować szeroką rzeszę naukowców do dalszych badań. 4

5 Sekcja nauki o żywności i żywieniu człowieka, biotechnologia 5

6 BIOTECHNOLOGIA I ORGANIZMY MODYFIKOWANE GENETYCZNIE Autorzy: Olga Lekh, Mariia Chykota Opiekun: mgr. Beata Dec, mgr. Łukasz Stokłosa SKNEP Wyższa Szkoła Informatyki i Zarządzania w Rzeszowie, Wydział Turystyki i Nauk o Zdrowiu Ul. Sucharskiego 2, Rzeszów Słowa kluczowe: biotechnologia, GMO (Organizmy Modyfikowane Genetycznie) Wstęp Od najdawniejszych czasów człowiek wykorzystuje procesy biotechnologiczne w procesie przygotowywania wyrobów piekarskich, mleczarskich, wina itp. Dzięki zasłudze Ludwika Pasteura w połowie XIX wieku tradycyjna biotechnologia otrzymała podstawę naukową. W latach XX wieku, kiedy został przeprowadzony proces biosyntezy penicyliny za pomocą metody fermentacji, rozpoczęła się era antybiotyków, co dało impuls do rozwoju mikrobiologicznej syntezy i tworzenia się przemysłu mikrobiologicznego. W latach XX wieku zaczęła szybko rozwijać się inżynieria komórkowa. Wraz z utworzeniem w 1972 roku przez grupę Paula Berga w USA pierwszej molekuły hybrydy DNA - in vitro, formalnie przyjęto powstanie inżynierii genetycznej, co otworzyło drogę do modyfikacji genetycznej organizmów. Organizmy takie mogą wytwarzać niezbędne dla człowieka produkty i dokonywać niezbędnych procesów. Te dwa obszary zapoczątkowały nowy wizerunek biotechnologii, który ma niewiele wspólnego z prymitywną biotechnologią, którą człowiek wykorzystywał od tysiącleci. Biotechnologia Wprowadzenie Biotechnologia to kompleks nauk podstawowych i stosowanych oraz technologii, mająca na celu uzyskanie i wykorzystanie komórek mikroorganizmów, zwierząt i roślin, a także produktów ich życia: enzymów, aminokwasów, witamin i antybiotyków. Do podstawowych zadań badań naukowych w tej dziedzinie należy badanie struktury materii pod względem molekularnym. Biotechnologia jest interdyscyplinarną dziedziną, która pojawiła się na skrzyżowaniu takich nauk jak biologia, chemia oraz inżynieria. Biotechnologią często nazywa się wykorzystanie inżynierii genetycznej w XX XXI w., ale ten termin odnosi się do szerokiej gamy procesów modyfikacji organizmów biologicznych na potrzeby człowieka, począwszy od modyfikacji roślin i zwierząt domowych drogą sztucznej selekcji i hybrydyzacji. Przy pomocy nowoczesnych metod tradycyjna produkcja biotechnologiczna otrzymała możliwość poprawy jakości żywności i zwiększenia wydajności żywych organizmów. Wraz z rozwojem biotechnologii ludzkość otrzymała możliwość rozwiązania globalnych problemów polepszenia stanu ochrony zdrowia i jakości środowiska, likwidacji niedostatków energii, zasobów. Biotechnologia może przynieść znaczące korzyści w dziedzinie ochrony zdrowia. Natomiast, poprzez 6

7 zwiększenie wartości odżywczej żywności, biotechnologia może być wykorzystana do poprawy jakości żywności. Biotechnologia w przemyśle spożywczym Procesy biotechnologiczne z wykorzystaniem mikroorganizmów i enzymów, na obecnym technicznym poziomie są szeroko stosowane w przemyśle spożywczym. Przemysłowa hodowla mikroorganizmów, komórek roślin i zwierząt wykorzystywana jest w celu uzyskania wielu cennych związków enzymów, hormonów, aminokwasów, witamin, antybiotyków, metanolu, kwasów organicznych (octowego, cytrynowego, mlekowego), itp. Za pomocą niektórych mikroorganizmów przeprowadzono biotransformację jednych związków organicznych w inne (np. sorbitolu we fruktozę). Szerokie zastosowanie w różnych gałęziach przemysłu mają immobilizowane enzymy. Dla wydzielenia aktywnych substancji biologicznych ze złożonych mieszanin wykorzystuje się przeciwciała monoklonalne. W latach A. S. Spirin wprowadził zasadę bezkomórkowej syntezy białek, gdzie zamiast komórek używane są specjalne bioreaktory, zawierające niezbędny zestaw oczyszczonych składników komórkowych. Metoda ta pozwala na uzyskanie różnego typów białek i może być skuteczna w procesie produkcji. Wiele technologii przemysłowych zastępuje się technologią, która wykorzystuje enzymy i mikroorganizmy. Takie biotechnologiczne metody recyklingu rolnych, przemysłowych i domowych odpadów stosowane są do oczyszczania ścieków w celu uzyskania biogazów i nawozów. W wielu państwach za pomocą mikroorganizmów otrzymuje się etanol, który jest stosowany jak paliwo do samochodów (np. w Brazylii, gdzie paliwo na bazie etanolu jest powszechnie stosowane, otrzymuje się go z trzciny cukrowej i innych roślin). Podział biotechnologii EuropaBio, stowarzyszenie 24 biotechnologicznych organizacji narodowych, zaproponowało podział biotechnologii na: Białą - która opiera się na bioprocesach i biokatalizie. Jest to przemysłowa biotechnologia, która wykorzystuje systemy biotechnologiczne w ochronie środowiska i produkcji przemysłowej. Fioletową - stosowaną na w ustawodawstwie, które dotyczy biotechnologii. Czerwoną - wykorzystywaną w ochronie zdrowia. Zieloną - stosowaną w rolnictwie. Obejmuje wykorzystanie metod inżynierii genetycznej, aby udoskonalić produkcję roślinną oraz zwierzęcą. Istnieje także tradycyjny podział biotechnologii na: biotechnologię żywności; biotechnologię zwierząt; biotechnologię roślin. Można również wyróżnić biotechnologię tradycyjną, w której używa się naturalnych enzymów i organizmów niezawierających obcego materiału genetycznego, oraz biotechnologię nowoczesną, która wykorzystuje organizmy, enzymy i białka genetycznie zmodyfikowane. 7

8 Mówiąc o nowoczesnej biotechnologii, mamy na myśli inżynierię genetyczną i komórkową, które stworzyły możliwość przetwarzania genetycznej informacji organizmów. Nowoczesna biotechnologia jest powiązana z wieloma sukcesami i ma wielu wyznawców, ale ma też dużo przeciwników i krytyków. GMO - Organizmy Modyfikowane Genetycznie Wprowadzenie Organizm genetycznie zmodyfikowany - organizm, w którym materiał genetyczny został zmieniony w sposób niezachodzący w warunkach naturalnych wskutek krzyżowania lub naturalnej rekombinacji. 1 Dziedziną nauki zajmującą się modyfikacjami organizmów jest inżynieria genetyczna. Istnieje trzy grupy modyfikacji, jakim podlega organizm: zmiana aktywności genów naturalnie występujących w danym organizmie, wprowadzanie do organizmu dodatkowej kopii jego własnych genów, wprowadzanie genów, pochodzących z organizmu innego gatunku (organizmy transgeniczne). Obce geny zostają wprowadzane do komórek za pomocą agresywnych wirusów lub poprzez wstrzeliwanie za pomocą specjalnych działek. Powstaje, zatem konieczność oddzielenia ich od niezmodyfikowanej części. W tym celu zamiast jednego genu wprowadza się, co najmniej dwa. Dodatkowy gen uodparnia zmieniany organizm na antybiotyki. Następnie zmodyfikowane i niezmodyfikowane organizmy poddawane są działaniu silnych antybiotyków. Przeżywają tylko genetycznie zmienione organizmy, które wyposażono w geny odporności na antybiotyki. Praktyczne cele genetycznej modyfikacji Roślin: zwiększanie odporności na szkodniki oraz środki chemiczne, odporność na choroby wirusowe, grzybowe, bakteryjne, odporność na zasolenie gleby, suszę, mróz oraz inne niekorzystne warunki środowiska, stworzenie organizmów przeznaczonych jedynie do produkcji leków lub przemysłowych środków chemicznych, zmienianie składników odżywczych roślin lub nadanie im nowych cech, których one nigdy wcześniej nie posiadały. Głównym celem wykorzystania genetycznej modyfikacji u zwierząt jest przyspieszenie wzrostu oraz zwiększanie wydajności. 1 8

9 Wyniki badań Badania naukowe Wyniki badań prowadzonych przez niezależnych ekspertów dowiodły, że: Wykorzystanie GMO w rolnictwie nie przyniosło oczekiwanego zwiększania plonów upraw rolnych. Uprawy genetycznie modyfikowanych: soi i rzepaku były obniżone od 5 do 10 % w stosunku do tradycyjnych odmian tych roślin. Eksperymentalne karmienie szczurów kukurydzą zmodyfikowaną genetycznie wywołało różnego rodzaju negatywne skutki, m.in. podwyższoną ilość białych krwinek i zmniejszoną czerwonych (nie do końca rozwinięte czerwone krwinki), wzrost poziomu cukru we krwi, zaburzenie pracy nerek. Podawanie szczurom genetycznie modyfikowanej soi spowodowało wysoką śmiertelność i zaburzenia wzrostu u ich potomstwa. 55,6% ich potomstwa zmarło w ciągu 3 tygodni. Dla porównania, gdy karmiono je naturalną soją umierało tylko 9%. Genetycznie modyfikowana kukurydza i soja mają inne właściwości odżywcze niż ich naturalne odpowiedniki. Ludzie, którzy zamieszkują na terenach, gdzie uprawiane są rośliny genetycznie modyfikowane chorują na alergie. Myszy karmione zmodyfikowaną genetycznie kukurydzą mają poważnie upośledzone zdolności reprodukcyjne. Doprowadza to do niższej płodności i mniejszej masy ciała. Fragmenty zmienionych genów z genetycznie modyfikowanej soi i kukurydzy przenikają do genów, krwi, wątroby, śledziony, nerek oraz płodu organizmów stałocieplnych karmionych genetycznie modyfikowaną żywnością. Jest to wielkim niebezpieczeństwem dla zdrowia ludzi i zwierząt. Szczury laboratoryjne nie chcą jeść modyfikowanych nasion, nawet jeśli są one wymieszane z innymi nasionami rozpoznają je i zjadają tylko te niezmodyfikowane. Aby przeprowadzać eksperymenty naukowcy muszą zmielić wszystkie nasiona i wymieszać je w jednolitą masę. Podawanie krowom transgenicznego hormonu wzrostu powoduje uszkodzenie ich płodu, infekcje układu moczowego oraz wzrost poziomu innego hormonu, który dostaje się do ich mleka i stymuluje u ludzi go pijących raka piersi i prostaty. 9

10 Badania ankietowe 2 Czy Pana(i) zdaniem polscy rolnicy powinni mieć mozliwość uprawy roślin modyfikowanych genetycznie? Czy zapłaciłby Pan/Pani więcej za produkty bez GMO? 13,90% 7,70% 36,60% 13% tak 6,90% 34,80% 28% 59% nie nie wiem zdecydowanie tak zdecydowanie nie raczej tak raczej nie nie wiem Czy uważa Pan/Pani, że produkty pochodzące od genetycznie modyfikowanych zwierząt powinny być oznakowane? 17,10% 3,50% 1,50% 3% Czy dokonałby Pan/Pani zakupu mięsa, wiedząc że do jego wytworzenia użyto paszy zawierającej składniki GMO? 30,60% 7,10% 3% 10,90% 74,90% 48,80% zdecydowanie tak zdecydowanie nie nie wiem raczej tak raczej nie zdecydowanie tak zdecydowanie nie nie wiem raczej tak raczej nie Czy kupiłby Pan/Pani produkt spożywczy wiedząc, że zawiera on składniki GMO? 32,30% 7,50% 4% 13,50% 42,70% zdecydowanie tak raczej tak zdecydowanie nie raczej nie nie wiem Wnioski Inżynieria genetyczna stanowi jeden z najpoważniejszych problemów etycznych w historii nauki. Jej ingerencja w naturalny ład biologiczny ma poważne skutki dla środowiska przyrodniczego oraz zdrowia ludzi, zwierząt i roślin. Oceniając uprawę odmian genetycznie modyfikowanych roślin, 2 Badania przeprowadzone przez UWM w Olsztynie 10

11 w porównaniu z niemodyfikowanymi w okresie kilkuletnim, trzeba stwierdzić, że nie były one wcale lepszej jakości, wręcz przeciwnie. Ochrona przyrody czy biologicznej różnorodności nie jest możliwa przy beztroskim genetycznym zanieczyszczaniu środowiska. Liczne badania naukowe przeprowadzone przez niezależnych badaczy wykazały, że rośliny genetycznie modyfikowane stanowią poważne zagrożenie dla zdrowia zwierząt. Karmione genetycznie modyfikowanymi produktami miały one uszkodzone żołądki, poważne zmiany w komórkach wątroby, trzustki i jąder. Z żywnością genetycznie modyfikowaną związane są liczne choroby alergiczne, mają one dzisiaj tendencję wzrostową. Są one szczególnym zagrożeniem dla ludzi w okresie dziecięcym i w okresie dojrzewania. Z wyników badań ankietowych, prowadzonych przez UWM w Olsztynie wynika, że poziom świadomości Polaków odnośnie stosowania GMO w przemyśle spożywczym jest niewystarczający. Związano to z faktem, iż GMO są nie do końca zbadane oraz z brakiem rozpowszechnienia informacji o negatywnych skutkach GMO na organizm ludzki. Tab. 1 Pozytywne i negatywne strony rozwoju biotechnologii oraz GMO Pozytywne strony Niegatywne strony Wydajniejsze gospodarstwa rolne. Genetycznie modyfikowane organizmy Redukcja szkodliwego oddziaływania na wywołują reakcje alergiczne. środowisko produkcji żywności i procesów Negatywny wpływ na zdrowie człowieka przemysłowych. (zwiększa się ryzyko zachorowania na raka Rekultywacja zniszczonej gleby lub ziemi. piersi, okrężnicy i prostaty). Skutki ujawniają Dłuższe okresy przechowywania produkcji. się również w następnych pokoleniach. Biopaliwa. Zakłócenie równowagi ekosystemów. Szczepionki i leki. Niekontrolowane rozprzestrzenianie. Zubożenie globalnej bioróżnorodności. Biotechnologia pozwala lepiej wykorzystać gospodarstwa rolne, tworzy rośliny odporne na wszystko: od szkodników do niekorzystnych warunków środowiska oraz związków chemicznych, tworzy zwierzęta o większej wydajności, tym samym zwiększając produktywność rolnictwa i ułatwianie pracy rolnikom. Istnieje jednak dużo negatywnych skutków związanych z wykorzystaniem takich metod w rolnictwie. Największym problemem jest to, że niektóre negatywne efekty mogą dać o sobie znać dopiero po kilku latach lub w następnych pokoleniach. Inżynieria genetyczna jest jeszcze młodą dziedziną nauki, dlatego mogą tutaj pojawić się błędy, które dopiero zweryfikuje przyszłość. Literatura 1. Wiąckowski S. K Genetycznie Modyfikowane Organizmy (GMO) obietnice i fakty. Wyd. Ekonomia i Środowisko, Białystok 2. Malepszy S Biotechnologia roślin. Wyd. Naukowe PWN, Warszawa

12 Biotechnology and Genetically Modified Organisms Summary Nature and its biological diversity are the greatest treasures serving mankind. Various plants and animal species create the basis for our existence. During the last few years the development of genetic engineering has increased immediately and the genetic contamination of the environment has become a large problem of nowadays world. The main aim of this project is to introduce the definition of biotechnology and GMO, to present advantages and disadvantages of the subject, and to propose the sustainable way of biotechnology s development. Source materials include: books about genetic engineering and GMO, Internet. The introduction presents information about the history of appearance of the biotechnology and GMO. Second chapter is devoted to biotechnology, concept of this science, types and practical use of biotechnology. The next chapter describes GMO. Particular attention is paid on using GMO in food industry. The fourth chapter results of study is about the influence of biotechnology and about the survey conducted between the Polish people. The last chapter includes conclusions related to the topic. Key words: biotechnology, GMO (Genetically Modified Organisms) 12

13 CZY WŁAŚCIWA DIETA MOŻE OGRANICZYĆ SZKODLIWOŚĆ PALENIA TYTONIU? Autorzy: Teresa Żądło, Mateusz Kosar, Rafał Kordiaka, Paulina Forc, Urszula Wacławska Opiekun: dr inż. Małgorzata Dżugan SKN Technologów Żywności Ferment Sekcja Toksykologii Żywności Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy Ul. Ćwiklińskiej 2, Rzeszów Słowa kluczowe: dieta, studenci, palenie tytoniu, warzywa, owoce Wstęp Na świecie miliard osób (w tym ok. 200mln kobiet) pali papierosy. W Polsce ok. jedna czwarta populacji to palacze, z czego prawie połowa to kobiety. Uzależnienie od tytoniu stanowi istotny problem współczesnego społeczeństwa, tym bardziej, że dotyczy także młodzieży szkolnej i studentów. Badania prowadzone w Polsce i na świecie wykazują, że liczba młodych ludzi, którzy sięgają po pierwszego papierosa gwałtownie rośnie [1]. Młodzi ludzie, sięgając po pierwszego papierosa, nie zdają sobie sprawy z ryzyka uzależnienia od nikotyny. Mówiąc o uzależnieniu mamy na uwadze uzależnienie biologiczne dotyczące układu nerwowego oraz uzależnienie psychiczne odnoszące się do sposobu zachowania [2]. Dym tytoniowy składa się z prawie 4000 związków chemicznych, z tego ponad 40 to substancje rakotwórcze. Ich działanie nie jest ograniczone jedynie do palaczy tytoniu, ale także dotyczy wszystkich tych osób (mężczyzn, kobiet i dzieci), które przebywają w pomieszczeniach, gdzie występuje dym tytoniowy (tzw. "palenie bierne") Oto przykłady niektórych tylko substancji występujących w dymie tytoniowym: aceton - rozpuszczalnik, składnik farb i lakierów, amoniak - stosowany w chłodnictwie, składnik nawozów mineralnych, arsen - stosowany także jako popularna trutka na szczury i inne gryzonie, benzopiren - związek o właściwościach rakotwórczych, wykorzystywany w przemyśle chemicznym, butan - gaz pędny, używany do wyrobu benzyny, chlorek winylu - związek używany np. do produkcji plastiku, wykazuje właściwości rakotwórcze, cyjanowodór - kwas pruski, gaz używany przez hitlerowców w komorach gazowych do masowego ludobójstwa, dibenzoakrydyna - używana przy produkcji barwników, wykazuje działanie rakotwórcze, dimetylonitrozoamina - związek wykorzystywany w przemyśle chemicznym, 13

14 fenole - niszczą rzęski nabłonka wyściełającego oskrzela, które oczyszczają wdychane przez człowieka powietrze i chronią drogi oddechowe przed przenikaniem przez ich ściany substancji i związków chemicznych oraz mikroorganizmów, np. wirusów, formaldehyd - związek stosowany m.in. do konserwacji preparatów biologicznych, np. żab, kadm - silnie trujący metal o właściwościach rakotwórczych, metanol - silne trujący związek chemiczny, używany do produkcji benzyn silnikowych, nikotyna - działa obkurczająco na ściany naczyń krwionośnych (w tym także naczyń wieńcowych zaopatrujących serce), zwiększa ciśnienie krwi, jest odpowiedzialna za niefizjologiczne przyspieszenie akcji serca oraz zaburzenia rytmu serca, a także wpływa negatywnie na gen p53, który powstrzymuje niekontrolowany rozwój komórek, czyli powstawanie nowotworów, polon - radioaktywny pierwiastek, odkryty przez naszą rodaczkę Marię Skłodowską-Curie, wykazuje właściwości rakotwórcze, tlenek węgla (czad, CO) - zmniejszając zawartość tlenu we krwi, w znaczny sposób utrudnia pracę serca i dotarcie tlenu do różnych części i narządów organizmu człowieka, jest bezpośrednią przyczyną śmierci wielu osób w czasie pożarów, toluidyna - stosowana w syntezie chemicznej, posiada właściwości rakotwórcze. uretan - związek o właściwościach rakotwórczych [1]. Niekorzystne skutki palenia papierosów, mogą być ograniczone przez stosowanie diety o wysokiej zawartości przeciwutleniaczy [3]. Związki te, zwane inaczej antyoksydantami, zapobiegają lub opóźniają proces utleniania wiązań chemicznych danej substancji. W organizmach żywych występują przeciwutleniacze enzymatyczne (katalaza, peroksydaza glutationowa, dysmutaza ponadtlenkowa) i nieenzymatyczne (witamina A i beta-karoten, C, E, selen oraz flawonoidy). Owoce i warzywa stanowią podstawowe źródło przeciwutleniaczy w diecie, przy czym rodzaj i zawartość tych substancji jest zróżnicowana gatunkowo. Obfite źródła antyoksydantów to: Prowitamina A (beta karoten): marchew, dynia, morela, papryka czerwona, pomidor, natka pietruszki, szczaw, szpinak, sałata, Witamina A: nabiał, masło, żółtka jaj, tłuste morskie ryby, Witamina E: oleje roślinne, orzechy, kiełki, kukurydza, szpinak, Witamina C: owoce cytrusowe, kiwi, czerwona papryka, natka pietruszki, porzeczki, dzika róża, truskawki, Polifenole: czerwone wino, herbata (zielona, czerwona i biała) [4]. Najważniejszą funkcją związków przeciwutleniających jest neutralizowanie wolnych rodników. Są to wysoce reaktywne, niestabilne cząstki chemiczne (atomy lub grupy atomów) powstające podczas procesów przemiany materii w odpowiedzi na bodźce takie, jak np. ekspozycja na promienie UV, dym tytoniowy czy zanieczyszczenie lub skażenie powietrza. W żywności wolne 14

15 rodniki powstają w wyniku takich procesów jak smażenie i wędzenie, a także przechowywanie [4]. Nadmiar wolnych rodników, które nie zostały zneutralizowane działa niszcząco na struktury komórkowe i tkankowe, dodatkowo przyczyniają się do rozwoju wielu chorób: miażdżyca, cukrzyca, zaćma, choroba Parkinsona czy Alzheimera [3]. Rozróżnia się dwa zasadnicze mechanizmy działania przeciwutleniającego: inhibicja reakcji utleniania (np. rozkład reaktywnych form tlenu) i zatrzymanie łańcuchowych reakcji wolnorodnikowegoutleniania (wiązanie przeciwutleniacza z wolnymi rodnikami) [3]. Celem pracy była analiza problemu uzależnienia od tytoniu oraz wiedzy na temat szkodliwości palenia w kontekście częstotliwości spożycia owoców i warzyw wśród studentów. Materiał i metody Grupę ankietowaną stanowili studenci pierwszego roku kierunku Technologia Żywności i Żywienie Człowieka, Wydziału Biologiczno-Rolniczego Uniwersytetu Rzeszowskiego. Badania przeprowadzono metodą sondażu diagnostycznego, do którego wykorzystano ankiety opracowane dla potrzeb pracy: Ankieta I - Stan wiedzy na temat szkodliwości palenia papierosów (100 uczestników, w tym 79 kobiet), Ankieta II - Rola przeciwutleniaczy w diecie (100 uczestników, w tym 86 kobiet). Kwestionariusz Ankiety I zawierał 21 pytań zamkniętych oraz 2 pytania otwarte, które dotyczyły czynnego i biernego kontaktu z dymem tytoniowym, sytuacji i miejsc, w którym dochodzi do takiego kontaktu. Badano również stan wiedzy ankietowanych w zakresie czynników rakotwórczych występujących w dymie tytoniowym i wpływu palenia tytoniu na ryzyko wystąpienia chorób odtytoniowych. Kwestionariusz Ankiety II zawierał 15 pytań zamkniętych i jedno otwarte, dotyczących ilości spożywanych tygodniowo owoców i warzyw oraz wiedzy na temat przeciwutleniaczy w żywności. W obu ankietach wystąpiły pytania dotyczące danych socjodemograficznych (wiek, płeć, miejsce zamieszkania). Na pytania ankietowani odpowiadali anonimowo. Wyniki W badanej grupie studentów I roku Technologii Żywności i Żywienia Człowieka Uniwersytetu Rzeszowskiego do palenia przyznało się 57% osób. Według ankiety najwięcej studentów zaczęło palić w wieku 16 lat. W odpowiedzi na pytanie otwarte o bierne palenie papierosów, badana społeczność odpowiedziała niemal jednomyślne. Studenci wiedzą (95%), że palenie bierne jest w równym stopniu szkodliwe, co palenie aktywne. Zdecydowana większość (68 %) uważa, że jest dostatecznie poinformowana o negatywnych skutkach palenia tytoniu (Rys. 1). Natomiast ankietowani posiadają 15

16 ograniczoną wiedzę o szkodliwych substancjach chemicznych występujących w dymie tytoniowym (Rys. 2) Liczba osób Tak Nie Liczba osób Tak Nie Brak głosu Rys. 1. Czy uważasz, że jesteś dostatecznie poinformowany o negatywnych skutkach palenia? Rys. 2. Czy wiesz, że w skład dymu tytoniowego wchodzi kwas pruski, używany przez hitlerowców w komorach gazowych Badania prowadzone w ramach Ankiety II wykazały, że częstotliwość spożycia owoców i warzyw przez ankietowanych studentów jest zaskakująco niska (Rys. 3 i 4), co jest szczególnie niepokojące w obliczu rozpowszechnienia nałogu tytoniowego w badanej grupie. śliw ka w iśnie truskaw ki grejpfrut pomarańcza jabłka Rzadziej 1-2 razy w 76 miesiącu 2-4 razy w tygodniu Codzienni Rys. 3. Udział owoców w diecie studentów e Analiza pytania dotyczącego częstotliwości spożywania owoców pozwala wywnioskować, iż średnio połowa badanych spożywa kilka razy w tygodniu jedynie jabłka i pomarańcze. Ponad 50% ankietowanych, wiśnie, śliwki, truskawki oraz grejpfrut spożywa bardzo rzadko Z analizy częstotliwości spożywania warzyw wynika, iż ponad połowa badanych kilka razy w tygodniu spożywa ziemniaki, pomidory oraz marchew. Mniej niż 50% badanych 1-2 razy w miesiącu spożywa kapustę, sałatę, cebulę, kalafior, paprykę. Do rzadko spożywanych warzyw, według ok. 50 % badanych, zaliczyć można brokuły i kalafior. 16

17 kapusta sałata cebula papryka pomidory Rzadziej 1-2 razy w miesiącu 2-4 razy w tygodniu Rys. 4. Udział warzyw w diecie studentów Codzienni e Kwota przeznaczona tygodniowo na zakup owoców i warzyw waha się od 0 zł do 10zł, co świadczy o niemal zupełnym braku w diecie studenta wartościowych składników odżywczych dostarczanych przez te produkty. Dodatkowo ankietowani w ograniczonym zakresie (zaledwie 10%) stosują w celu uzupełnienia diety, preparaty parafarmaceutyczne zawierające przeciwutleniacze tzw. suplementy diety. Analiza ostatniej części ankiety, oceniającej stan wiedzy studentów nt. funkcji antyoksydantów wykazała, że zdecydowana większość ankietowanych (67 %) spotkała się z pojęciem przeciwutleniacze, ale ich roli nie potrafi wskazać aż 50 % studentów (Tabela 1). Tabela 1. Wiedza studentów na temat przeciwutleniaczy w żywności. Rola przeciwutleniaczy Odpowiedzi studentów Zapobiegają jełczeniu tłuszczów 5 Zapobiegają zmianom barwy 5 Zapobiegają utlenianiu innych składników 36 Nie wiem 46 Podsumowanie Analiza postaw studentów I roku Technologii Żywności i Żywienia Człowieka Wydziału Biologiczno-Rolniczego wykazała, że znaczna część (57 %) studentów sięga po papierosy w celu rozładowania emocji, a uzależnienie od tytoniu dotyczy 26 % badanych. Wcześniejsze badania prowadzone, wg tej samej ankiety w ubiegłym roku, wśród studentów I roku Wydziału Medycznego Uniwersytetu Rzeszowskiego wykazały, że uzależnienie od tytoniu dotyczyło niewielkiej grupy studentów (8 10 %). Obecne dane potwierdziły po raz kolejny, że wskaźniki dotyczące rozpowszechnienia nałogu tytoniowego wśród studentów Wydziału Biologiczno-Rolniczego UR są wyższe niż na Wydziale Medycznym. Znaczna część ankietowanych (67%) nie wie, że dym tytoniowy jest źródłem wolnych rodników rozwijających się w organizmie. Nie dostrzega również związku pomiędzy dietą i paleniem 17

18 tytoniu. Większość spotkała się z pojęciem przeciwutleniaczy, lecz nie potrafi określić, jakie funkcje pełnią w organizmie, nie posiada też dostatecznej wiedzy nt. produktów spożywczych o wysokiej zawartości antyoksydantów. Uzyskane wyniki wskazują na potrzebę edukacji studentów zarówno w zakresie toksykologii dymu tytoniowego jak i znaczenia prozdrowotnego składników diety. Edukacyjna funkcja przeprowadzonych ankiet może stanowić element profilaktyki chorób cywilizacyjnych. Tym bardziej, że większość badanej społeczności studentów, ponadto kierunku związanego z żywnością i żywieniem, jest świadoma braku wystarczającej wiedzy i deklaruje potrzebę edukacji w tym zakresie. Literatura 1. Dżugan M., Juszczyk M., 2006 Carcinogenic substances present in cigarette smoke, Zdrowie Publiczne, 116, 4, Piekoszewski W., Florek E., 2006 Tytoń w liczbach na początku nowego stulecia. Przegląd Lekarski, 63, Grajek W., Przeciwutleniacze w żywności. Aspekty zdrowotne, technologiczne, molekularne i analityczne, WNT Warszawa. 4. Włodarek D., Dietetyka, Warszawa, Szary J., Szczepan U., Dżugan M., Postawy wobec palenia tytoniu wśród studentów Wydziału Medycznego Uniwersytetu Rzeszowskiego, Materiały VI Ogólnopolskiej Młodzieżowej Konferencji Naukowej, Iwonicz Is the proper diet can reduce harmfulness of smoking? Summary The aim of this study was to analyze the degree of tobacco addiction and knowledge of the harmful effects of smoking in the context of the frequency of fruit and vegetable consumption among students. Studies have shown the necessity of students education as regards the protective effect of dietary antioxidants against tobacco smoke. Key words: diet, students, smoking, fruits, vegetables 18

19 FITOTESTY JAKO BIOINDYKATORY POSTĘPU PROCESU BIOREMEDIACJI GRUNTÓW ZANIECZYSZCZONYCH OLEJEM NAPĘDOWYM Dorota Wieczorek Opiekun: dr Ewa Kwapisz Politechnika Łódzka, Wydział Biotechnologii i Nauk o Żywności Instytut Biochemii Technicznej Łódź, ul. Stefanowskiego 4/10 Telefon, e mail: (0 42) , (0 42) , Słowa kluczowe: bioremediacja, olej napędowy, fitotesty, monitorowanie, Phytotoxkit, bioindykacja. Wstęp Wzrastające zanieczyszczenie środowiska naturalnego ropą naftową i jej produktami jest problemem globalnym. Substancje ropopochodne są zaliczane do silnie toksycznych i kancerogennych [18,20,23,24]. Powodują skażenie ziemi uprawnej, otwartych zbiorników wodnych i wód gruntowych. Dla tego też, bioremediacja gruntów zanieczyszczonych między innymi olejami ropopochodnymi stała się jednym z ważniejszych działów biotechnologii środowiska. Podstawą tej technologii jest wykorzystanie potencjału metabolicznego wielu gatunków bakterii i grzybów do degradacji toksycznych związków organicznych [8,16]. Bioaugumentacja realizowana w układach otwartych, podlega wpływowi ogromnej ilości czynników, zarówno biologicznych jak i fizykochemicznych i jej przebieg nie jest w pełni przewidywalny [7,10,11,25]. Z tych względów proces taki wymaga wielokierunkowej kontroli. Dostępne narzędzia analityczne pozwalają na stosunkowo szybkie i proste stwierdzenie obecności związków ropopochodnych w gruncie oraz określenie ich ubytku podczas procesu oczyszczania. Pożądane jest również monitorowanie parametrów biologicznych, w tym: badania zbiorowości mikroorganizmów i oznaczanie aktywności wybranych enzymów glebowych [13, 15,16]. Znawcy przedmiotu zwracają ponadto uwagę na niebezpieczeństwo wzrostu toksyczności podczas procesu oczyszczania. Jednym z najczęstszych powodów tego zjawiska jest możliwość pojawienia się metabolitów pośrednich o toksyczności wyższej w porównaniu z zanieczyszczeniami pierwotnymi. Metabolity te mogą powodować mniej lub bardziej długotrwałe zahamowania procesu bioremediacji [2]. Dlatego też, aby biologiczna remediacja przebiegała bez zakłóceń, konieczne jest monitorowanie tego procesu również w aspekcie toksykologicznym. Problemem pozostaje dobór odpowiednich metod oceny poziomu toksyczności zanieczyszczeń w stosunku do biocenozy oczyszczanego gruntu. W ostatnich latach w badaniach bioindykacyjnych zanieczyszczeń środowiska glebowego obserwuje się wyraźny wzrost zainteresowania biotestami roślinnymi. Testy te mają wiele zalet: są tanie i łatwe w użyciu, nie wymagają drogiego sprzętu laboratoryjnego i dają powtarzalne wyniki [4,6,17,21,22]. Celem pracy było zbadanie przebiegu procesu bioremediacji gruntu skażonego olejem napędowym z wykorzystaniem technologii obejmującej inokulację wybranymi szczepami bakterii i 19

20 dodatkiem wybranych, surowych preparatów enzymatycznych. Do oceny efektywności i postępu remediacji użyto gotowe zestawy testów roślinnych PHYTOTOXKIT TM [19]. Metody i materiały Próby bioremediacji prowadzono w warunkach laboratoryjnych stosując kuwety o pojemności 2 l zawierające po 1,8 kg zanieczyszczonej (ON) olejem napędowym (5 % v/w) gleby. Grunt szczepiono jednodniowymi kulturami Gordonia alkanivorans S7 pochodzącymi z kolekcji Instytutu Biochemii Technicznej PŁ. Do części kuwet dodawano również surowy, wysuszony acetonem preparat enzymatyczny grzybni Mucor racemosus zawierający oksygenazy, dehydrogenazy i lipazy. Próbę odniesienia stanowiła gleba zanieczyszczona ON bez dodatku bakterii i preparatu enzymatycznego, w której proces oczyszczania odbywał się jedynie z udziałem mikroflory autochtonicznej. Warunki i kontrola procesu bioremediacji: Podstawowa kontrola bioremediacji prowadzonej w ciągu 4 miesięcy obejmowała: regulację i utrzymywanie zawartości wody w glebie na poziomie 25 % oraz spulchnianie gruntu. Zabiegi te prowadzono w odstępach 2 3 dniowych. Dodatkowo trzykrotnie próby zasilano NH 4 Cl w ilości 75 mg N NH 3 kg 1 gruntu. Zastosowano następujące trzy warianty bioremediacji: A próba z ON, szczepiona G. alkanivorans S7, B próba z ON, szczepiona G. alkanivorans S7 i dodatkiem preparatu enzymów z M.racemosus., K próba kontrolna. W celu oznaczenia stopnia wykorzystania węglowodorów ogółem, próbki gruntu (10 g) poddawano dwuetapowej obróbce mającej na celu ich desorpcję i ekstrakcję z gleby. W pierwszym etapie próbki poddawano działaniu ultradźwięków w ciągu 2 godzin, po czym, w ciągu następnych 2 godzin prowadzono właściwy proces ekstrakcji w aparacie Soxhleta stosując jako czynnik ekstrakcyjny dichlorometan. Próby pozostawiano do odparowania rozpuszczalnika, po czym oznaczano masę wyekstrahowanych węglowodorów. Wartości masy prób odnoszono do wyjściowej zawartości węglowodorów. Fitotesty. Do badań wykorzystano PHYTOTOXKIT TM (MicroBioTests Inc.,Mariakerke (Gent), Belgium test) [19] zestaw do wykonywania testów kiełkowania i wczesnego wzrostu roślin. Płytki testowe wypełniano badaną glebą w ilości 140 g (90 ml) i nawilżano wodą destylowaną do 100% pojemności wodnej i przykrywano bibułowym filtrem. Następnie wysiewno nasiona następujących roślin: gorczycy, rzeżuchy i sorgo w ilości 10 sztuk na płytkę. Płytki testowe inkubowano w pozycji pionowej w temperaturze 25 C w ciągu 3 dni. Testy te prowadzono siedmiokrotnie, w odstępach dniowych. Reakcję roślin na obecność węglowodorów i metabolitów pośrednich ich degradacji określano na podstawie stopnia inhibicji kiełkowania nasion oraz wzrostu korzenia. Rejestracji obrazu dokonano przy użyciu aparatu fotograficznego, a do pomiarów długości korzeni zastosowano program analizy obrazu Image Tools. Wykorzystanie azotu amonowego przez mikroorganizmy oznaczano metodą kolorymetryczną z odczynnikiem Nesslera. Do 5 ml rozcieńczonego przesączu glebowego 20

21 dodawano po 1 kropli stabilizatora mineralnego oraz alkoholu poliwinylowego i dokładnie mieszano Następnie dodawano 0,2 ml odczynnika Nesslera. Po powtórnym wymieszaniu odczekiwano minutę i mierzono absorbancję wobec próby odczynnikowej z wodą destylowaną na spektrofotometrze przy długości fali 425 nm. Wszystkie oznaczenia wykonywano jak i prowadzone warianty procesów bioremediacji w 3 krotnych powtórzeniach. Wyniki i dyskusja W ramach badań nad technologią bioremediacji gruntów zanieczyszczonych ON z udziałem wyselekcjonowanych szczepów bakterii i wspomaganej wybranymi preparatami enzymatycznymi zwrócono uwagę na możliwość wykorzystania fitotestów do oceny przebiegu procesu oczyszczania. Materiałem biologicznym stosowanym w badaniach były opisane wcześniej szczep bakterii Gordonia alkanivorans S7 [9] oraz wysuszony, surowy preparat enzymatyczny z Mucor racemosus [14]. Ubytki węglowodorów podczas prowadzonych procesów bioremediacji gruntu zanieczyszczonego ON obrazuje rys 1. Jak widać w zależności od zastosowanego materiału biologicznego (inokulum bakterii, preparat enzymatyczny) stwierdzono istotne różnice w przebiegu prowadzonych procesów oczyszczania. Rys 1. Ubytek węglowodorów w procesie bioremediacji. W próbie szczepionej bakteriami G. alkanivorans (próba A) uzyskano po 110 dniach bioremediacji redukcję zanieczyszczeń na poziomie 80 %. Dodanie preparatu enzymatycznego (próba B, S7 + Muc) spowodowało zwiększenie stopnia degradacji węglowodorów do 90 %. W próbie kontrolnej odnotowano w tym czasie 65 % ubytek zanieczyszczenia (K, autochtoniczna mikroflora). Uwagę zwraca zróżnicowanie dynamiki bioremediacji między dniem procesu. W tym etapie najintensywniejszą biodegradację węglowodorów obserwowano w próbie B z użyciem kultur 21

22 bakterii oraz preparatu enzymatycznego. Proces rozkładu zanieczyszczeń w próbie A (S7) był w tym czasie niemal całkowicie zahamowany. Podobne zjawisko miało miejsce w próbie kontrolnej. Prowadzone równolegle testy fitotoksyczności gruntu w kolejnych fazach procesu ujawniły ścisłą korelację z wynikami oznaczeń ubytku węglowodorów (rys 1). Obserwacje te prowadzono z użyciem nasion sorgo, rzeżuchy i gorczycy. W ramach badań fitotoksyczności ocenia się najczęściej dwa parametry: zdolność do kiełkowania nasion [12] oraz wzrost korzeni. Z wykonanych przez nas badań wstępnych oraz danych literaturowych wynika, że obecność substancji ropopochodnych ma stosunkowo niewielki wpływ na kiełkowanie nasion [3]. Dużo czulszym okazuje się pomiar zahamowania wzrostu korzeni i parametr ten wybrano jako główny wykładnik oceny toksyczności. Przeprowadzone testy pozwoliły stwierdzić, iż z trzech badanych roślin, najbardziej wrażliwe są nasiona sorgo. Nieco większą tolerancję na obecność węglowodorów ON mają nasiona rzeżuchy i gorczycy. Mimo zróżnicowanej czułości badanych nasion, ograniczenia wzrostu korzeni zachowywały proporcjonalność i dlatego też zdecydowano się na uśrednienie wyników uzyskanych dla wszystkich trzech badanych rodzajów nasion. Dzięki temu można lepiej zobrazować potencjalne zmiany, jakie mogłyby zachodzić podczas oczyszczania naturalnego, wieloskładnikowego ekosystemu, do którego przedostałby się związki ropopochodne. Rys 2. Zmiany toksyczności podczas oczyszczania środowiska na podstawie pomiaru hamowania wzrostu korzeni Dane zawarte na rys. 2 jednoznacznie wskazują na różnice poziomów fitotoksyczności gruntu w zależności od zastosowanej technologii oczyszczania. Najniższe, sukcesywnie obniżające się wartości toksyczności obserwowano w próbie B (S7 + Muc). Wyraźny wzrost toksyczności trwający od 40 do 75 dnia bioremediacji obserwowano w próbie A (tylko z S7). Stopień inhibicji wzrostu korzeni w 55 dniu hodowli przekraczał 80 %. Analogiczny, choć nieco mniejszy, przejściowy wzrost fitotoksyczności obserwowano w próbie kontrolnej ok. 60 %. Uzyskane dane pozwalają przypuszczać, 22

23 że powodem zahamowania procesu bioremediacji, obserwowanym w próbach B i K, miedzy dniem procesu, był wzrost toksyczności pozostałości węglowodorów i gromadzonych metabolitów pośrednich. Zastosowanie dodatku preparatu enzymatycznego (próba B) przyspieszyło prawdopodobnie rozkład toksycznych komponentów zanieczyszczenia umożliwiając tym samym działanie bakterii zaangażowanych w proces biodegradacji. Istotną informacją potwierdzającą współzależność między wzrostem toksyczności gruntu w środkowej fazie procesu bioremediacji, a zahamowaniem procesu degradacji mogą być zmiany stężenia azotu amonowego podczas prowadzonej rekultywacji (rys. 3). Strzałkami zaznaczono dni, w których próby zasilano kolejnymi dawkami NH 4 Cl. Uwagę zwraca intensywne wykorzystanie jonów amonowych w początkowej fazie procesu i zdecydowanie niższe począwszy od dnia bioremediacji. Obserwacje te dotyczą głównie prób A i K. W tych próbach, jak widać (rys. 2) w 55 dniu procesu oczyszczania odnotowano najwyższe wartości toksyczności. Nieco inny przebieg ma krzywa obrazująca zmiany stężenia azotu amonowego w próbie z dodatkiem preparatu enzymatycznego (próba B S7+Muc). Po 40 dniach bioremediacji azot w tej próbie był nadal wykorzystywany, jego stężenie po 55 dniach procesu spadło do poziomu 60 mg N NH 3 kg 1 gruntu. W pozostałych próbach (A i K) stężenie jonów amonowych utrzymywało się natomiast na poziomie mg N NH 3 kg 1 gruntu. Pozwala to wnioskować, że zarówno ON jak i pośrednie produkty jego degradacji mogą negatywnie wpływać na rozwój mikroflory w oczyszczanym środowisku. Odczytany równolegle wzrost fitotoksyczności może być bardzo pomocny w szybkiej ocenie możliwości kontynuowania procesu bioremediacji i określenia przyczyn jej spowolnienia [5]. Rys. 3 Zmiany zawartości azotu amonowego/ jonów amonowych podczas bioremediacji. Dodatek 75 mg N NH 3 kg 1 gruntu 23

24 Wnioski 1. W zależności od zastosowanego w materiału biologicznego (kultura starterowa bakterii, preparat enzymatyczny) stwierdzono istotne różnice w przebiegu prowadzonych procesów bioremediacji. 2. Zastosowanie odpowiednich preparatów enzymatycznych w procesach bioremediacji może przyczynić się do znacznego obniżenia poziomu toksyczności gruntu podczas oczyszczania niwelując przynajmniej w części ewentualne fazy spowolnienia procesu oczyszczania. 3. Czynnikiem przemawiającym za stosowaniem fitotestów do monitorowania procesów bioremediacji jest wyraźna korelacja między stopniem wykorzystania źródła azotu przez mikroorganizmy glebowe, stopniem degradacji węglowodorów, a wynikami testów z udziałem materiału roślinnego. 4. Handlowe fitotesty (Phytotokit) mogą być przydatne do oceny efektywności technologii bioremediacji oraz badania fitotoksyczności gruntu. Podjęte zagadnienia wymagają dalszych badań, zarówno w aspekcie identyfikacji substancji powodujących wzrost toksyczności w oczyszczanym gruncie jak i doboru roślin (naturalna flora zanieczyszczonego gruntu) do prowadzenia fitotestów. Potrzebne są badania z wykorzystaniem roślin stanowiących typową florę oczyszczanego miejsca, co może być później wykorzystane do szybszej odbudowy zniszczonych obszarów leśnych czy rolnych. Literatura 1. Al Mutairi N., Bufarsan A., Al Rukaibi F Ecorisk evaluation and treatability potential of soils contaminated with petroleum hydrocarbon based fuels. Chemosphere 74, Andrzejewski P Zanieczyszczenia środowiska produktami naftowymi i innymi antropogenicznymi zanieczyszczeniami, ich analityka, monitoring i usuwanie. WFOŚ i GW Poznań. 3. Arfsten D.P., Burton D.T., Fisher D.J., Callahan J., Wilson C.L., Still K.R., Spargo B.J Assessment of the aquatic and terrestrial toxicity of five biodegradable polymers. Environ Res. Feb; 94(2): Baran, A., Jasiewicz Cz., Klimek A Reakcja roślin na toksyczną zawartość cynku i kadmu w glebie. Proceedings of EC Opole, Vol. 2, No Coccia A. M., Gucci P. M. B., Lacchetti I., Beccaloni E., Paradiso R. i in Hydrocarbon contaminated soil treated by bioremediation technology: microbiological and toxicological preliminary findings. Environmental Biotechnology 5 (2), Klimowicz-Pawlas A. i in Mat. Konf. Ekotoksykologia w ochronie środowiska glebowego i wodnego. Wyd. IUNG PIB Puławy, Kołwzan B Ekotoksyczne aspekty oddziaływania zanieczyszczeń naftowych na środowisko gruntowo wodne. Poznań, Kołwzan B., Adamiak W., Grabas K., Pawełczyk A Podstawy mikrobiologii w ochronie środowiska. Oficyna Wydawnicza Politechniki Wrocławskiej, Wrocław. 9. Kwapisz E., Wszelaka J., Marchut O., Bielecki S The effect of nitrate and ammonium ions on kinetics of diesel oil degradation by Gordonia alkanivorans S7. International Biodeterioration & Biodegradation, Vol 61, Libudzisz Z., Kowal K Mikrobiologia techniczna. Wyd. Politechniki Łódzkiej. 11. Łebkowska M i in Bioremediation of petroleum products contaminated soil. Contaminated soil: proceedings of the Seventh International Tom 1, Vol 2, Leipzig. 12. Maila M. P., Cloete T. E Germination of Lepidium sativum as a method to evaluate polycyclic aromatic hydrocarbons (PAHs) removal from contaminated soil. International Biodeterioration & Biodegradation 50, Maila M. P., Cloete T. E The use of biological activities to monitor the removal of fuelcontaminants perspective for monitoring hydrocarbon contamination: a review. International Biodeterioration & Biodegradation 55,

25 14. Marchut-Mikołajczyk O., Kwapisz E., Antczak T., Bielecki S Enzymatic preparation of Mucor racemosus enhancing bioremediation of soil contaminated with petroleum hydrocarbons, New Biotechnology, Vol Menendez-Vega D., Gallego J. L. R., Pelaez A., I.,Fernandez de Cordoba G., Moreno J., Munuoz D., Sanchez J Engineered in situ bioremediation of soil and groundwat polluted with weathered hydrocarbons. European Journal of Soil Biology 43, Nowak J Bioremediacja gleb z ropy i jej produktów. Biotechnologia, 1 (80) Obidowska G. i in Ekotoksykologia w ochronie środowiska. Materiały II Konf. Nauk. Ekotoksykologia w ochronie środowiska. Wyd. Polskie Zrzeszenie Inżynierów i Techników Sanitarnych, Szklarska Poręba Perera F., Tang D., Whyatt R., Lederman S.A., Jędrychowski W DNA damage from polycyclic aromatic hydrocarbons measured by benzo(a)pirene DNA adducts in mothers and new borns from northern Manhattan, the World Trade Center area, Poland and China. Cancer Epidemiology, Biomarkers & Prevention 14: Phytotoxkit Seed germination and early growth microbiotest with higher plants. Standard Operational. 20. Rybicki B.A., Rundle A.T., Sankey S.S., Tang D Polycyclic aromatic hydrocarbon DNA adducts in prostate cancer. Cancer Research 64: Sekutowski T., i Sadowski J., Ekotoksykologia w ochronie środowiska. Materiały II Konf. Nauk. Ekotoksykologia w ochronie środowiska. Wyd. Polskie Zrzeszenie Inżynierów i Techników Sanitarnych, Szklarska Poręba, Smreczak B., Maliszewska Kordybach B Seed germination and root growth of selected plants in PAH contaminated soil. Fresenius Env. Bull. 12, (No 8), Wang J., Zhan X., Zhou L., Lin Y Biological indicators capable of assessing thermal treatment efficiency of hydrocarbon mixture contaminated soil. Chemosphere 80, Wang S. Chanock S. D. i in Assessment of interactions between PAH exposure and genetic polymorphisms on PAH DNA adducts in African American, Dominican and Caucasian mothers and newborn. Cancer Epidemiology, Biomarkers & Prevention 17: 2; 25. Yang Si Zhong i in Bioremediation of Oil Spills in Cold Environments: A Review. Pedosphere 19 (3), Phytotoxkit : microbiotest used in monitoring efficiency of diesel oil contaminated soil bioremediation. Summary The object of this study was a soil contaminated with diesel oil (5 % v/w). The soil was treated with using a bioremediation technique. The basic biological tools used in this process were: culture of G. alkanivorans (sample A) and culture of G. alkanivorans + raw enzymatic preparation from M. racemosus (sample B). This study was focused on evaluating the possibility of use trade test,,phytotoxikt TM for assessment changes of level toxicity during the bioremediation. After 110 days of process we have observed differences in diesel oil degradation rates in dependence from used bioremediation variant: sample A (only G. alkanivorans strains) - 80 % degradation, sample B (G alkanivorans + M. racemosus) - 90 % degradation, sample K (control object) - 65 % degradation. We have observed transient phase of higher phytotoxicity in variant A and C. Results of experiments show a good correlation between level of phytotoxicity, N-NH 3 consumption rate and biodegradation efficiency in that phase. The presence of toxic intermediates produced during bioremediation could be the reason of plant growth inhibition, lower nitrogen source uptake and decreasing of hydrocarbon biodegradation by the bacteria. Results present study revealed good relationship between changes of phytotoxicity, hydrocarbon degradation rate and soil microorganisms activity in treated soil. The application of phytotest for example,,phytotoxikt system during bioremediation of diesel oil hydrocarbon contaminated soil appeared to be a good method for monitoring of efficiency these processes. Kay words: bioremediation, diesel oil, phytotest, monitoring, Phytotoxikt, bioindication, phytotoxicity. 25

26 FOSFONIANY - ZASTOSOWANIE I ICH WPŁYW NA ŚRODOWISKO Autorzy: Monika Górak, Ewa Żymańczyk-Duda Opiekun: dr hab. inż. Ewa Żymańczyk-Duda Zakład Chemii Bioorganicznej Politechnika Wrocławska, Wydział Chemiczny Wybrzeże Wyspiańskiego 27, Wrocław Słowa kluczowe: związki fosforoorganiczne, fosfoniany Wstęp Niezwykłe bogactwo związków fosforoorganicznych, ich ogromne zróżnicowani strukturalne, sprawia, że są uniwersalnymi odczynnikami syntetycznej chemii organicznej. Dodatkowo, wiele z nich można odnaleźć w przyrodzie. Jako naturalne metabolity posiadają określoną aktywność biologiczną, najczęściej ściśle związaną z ich konfiguracją absolutną. Optycznie czynne związki fosforoorganiczne są cennymi chiralnymi elementami w syntezie produktów naturalnych. Z powyższego wynika potrzeba poszukiwania i opracowania metod umożliwiających otrzymanie chiralnych związków fosforoorganicznych o zdefiniowanej konfiguracji absolutnej. Cząsteczki różnych pochodnych fosfonianów zawierają stabilne wiązanie węgiel-fosfor. Syntetyczne związki fosforoorganiczne wykorzystywane są m.in. jako pestycydy, plastyfikatory, bojowe środki chemiczne. Związki fosforoorganiczne zawierające stabilne, kowalencyjne wiązanie węgiel-fosfor oraz będące pochodnymi kwasu fosfonowego powszechnie zwane są fosfonianami. Zawierają jedną lub więcej grup C-P(O)(OH) 2 lub C-P(O)(OR) 2 (R = alkil, aryl). Są stosowane m.in. jako czynniki chelatujące, np. w przemyśle papierniczym i włókienniczym do kompleksowania metali ciężkich w wolnych od chloru rozwiązaniach wybielania. W medycynie fosfoniany są wykorzystywane do wiązania nuklidów promieniotwórczych w leczeniu raka kości [7]. Wiele z tych związków pochodzenia naturalnego wykazuje aktywność biologiczną m.in. właściwości antybakteryjne, herbicydowe, przeciwgrzybiczne, przeciwnowotworowe. Te rodzaje aktywności biologicznej zostały przypisane stosunkowo obojętnemu charakterowi wiązania węgielfosfor oraz fizycznemu i strukturalnemu podobieństwu kwasów fosfonowych do biologicznie ważnych cząsteczek. Związki te często działają jako mimetyki substratu i zaburzają procesy enzymatyczne. Np. fosfonowy analog glicyny jest regulatorem wzrostu roślin, zaś fosfonowy analog fenyloalaniny jest kompetycyjnym inhibitorem syntazy fenylalanyl-5-rna [2]. Fosfoniany ponadto stosowane są jako dodatki do detergentów, pełnią funkcje środków chelatujących, środków zmiękczających oraz stabilizatorów wybielaczy. Do grupy fosfonianów o szerokim zastosowaniu należą m.in. aminofosfoniany, hydroksyfosfoniany oraz bisfosfoniany. 26

27 Zastosowanie w medycynie Odkrycie kwasów aminofosfonowych w żywych organizmach spowodowało wzrost zainteresowania tą grupą związków. Kwasy α -aminofosfonowe są uznawane za strukturalne analogi odpowiednich aminokwasów, mogą więc stanowić konkurencyjne inhibitory enzymów metabolizujących aminokwasy. Strukturalna różnica pomiędzy grupą karboksylową a grupą kwasu fosfonowego nie przeszkadza w wykorzystaniu kwasów fosfonowych jako substratów dla niektórych enzymów, które degradują aminokwasy. Jest to możliwe, ponieważ większość enzymów katalizuje reakcję degradacji aminokwasów bez bezpośredniego angażowania grupy karboksylowej. Przykładem może być działanie fosfonowych analogów tyrozyny w tyrozynazie. Wymiana grupy karboksylowej na resztę kwasu fosfonowego doprowadziła do powstania związku, który służy jako syntetyczny substrat tyrozynazy [10]. Aminofosfoniany znalazły zastosowanie m.in. jako inhibitory enzymów, leki przeciwnowotworowe, antybiotyki, neuroprzekaźniki [3], regulatory wzrostu roślin, herbicydy. Przykładem naturalnego fosfonianu będącego analogiem kwasu glutaminowego jest L-fosfinotricyna, która poprzez inhibicję syntetazy glutaminowej występującej w komórkach bakterii i roślin, wykazuje aktywność antybakteryjną i herbicydową [1]. Bardzo ważnym antybiotykiem o szerokim zastosowaniu jest fosfomycyna wyizolowana ze szczepów Streptomyces fradiae i sp. Jest ona inhibitorem transferazy pirogronianowej enzymu biorącego udział w syntezie ściany komórkowej bakterii [7]. Aminofosfonianem, który dzięki swojej budowie jest inhibitorem transkarbamylazy asparaginowej jest kwas N-fosfonoacetylo-L-asparaginowy. Poprzez zahamowanie biosyntezy pirymidyn blokuje on proliferację komórek, dzięki czemu wykazuje właściwości przeciwnowotworowe [9]. Przykładem związków, których aktywność biologiczna nie opiera się na inhibicji enzymów są bisfosfoniany. Związki te w swojej strukturze zawierają wiązanie P-C-P. Bisfosfoniany są analogami naturalnego pirofosforanu, wykazują wysokie powinowactwo do wapnia, tworząc bardzo stabilny kompleks z hydroksyapatytem kostnym. Dodatkowo silnie hamują resorpcję kości poprzez zahamowanie działania osteoklastów. Bisfosfoniany z powodzeniem stosowane są w leczeniu osteoporozy oraz innych chorób kości [10,13]. Do komercyjnie dostępnych leków należą między innymi: alendronat, tiludronat, clodronat, ibandronat, pamidronat i etidronat [3]. Zastosowanie w rolnictwie Główną klasą związków stosowanych w kontroli szkodników są związki fosforoorganiczne, w szczególności kwasy aminofosfonowe. Związków te są aktywne w układzie nerwowowym stawonogów, działają jako klasyczne inhibitory acetylocholinoesterazy. Związki te pozostają jedną z najciekawszych grup insektycydów z handlowego i toksykologicznego punktu widzenia. Insektycydy aminofosfonianowe wykazują względnie niskie ryzyko działania na ssaki i wysoką selektywność. 27

28 Jednym z najbardziej znanych syntetycznych fosfonianów jest glifozat (Nfosfonometyloglicyna), aktywny składnik herbicydu Roundup. Glifozat hamuje działanie bardzo ważnego dla roślin enzymu syntazy EPSPS (syntaza 5-enolopirogroniano-szikimowo-3-fosforanowa), który jest kluczowym enzymem na szlaku metabolicznym kwasu szikimowego związanego z biosyntezą aromatycznych aminokwasów (fenyloalaniny, tyrozyny i tryptofanu) [4]. Również wspomniana wcześniej L-fosfinotricyna wykazuje aktywność herbicydową, wchodzi w skład trójpeptydu bialafosu. Wiele związków fosforoorganicznych będących pochodnymi kwasów fosfonowych zostało wykorzystanych jako gazy bojowe. Należą do nich stosowane na początku XX wieku silnie toksyczne środki, m.in. tabun, sarin, soman i cyklosarin [11]. Kolejnym gazem bojowym podrażniającym układ krwionośny i nerwowy jest VX, który jest przykładem jednego z najsilniejszych inhibitorów acetylocholinoesterazy [12]. Fosfoniany dzięki swoim właściwościom znalazły zastosowanie również jako dodatki do detergentów. Stosowane są jako czynniki chelatujące, inhibitory korozji oraz stabilizatory wybielaczy. Stosowane są przede wszystkim cztery fosfoniany: HEDP (kwas 1-hydroksyetyleno-1,1,- difosfonowy), ATMP (kwas aminotrimetylenofosfonowy), EDTMP (kwas etylenodiaminotetra(metylenofosfonowy) i DTPMP (kwas dietylenotriaminopentametylenofosfonowy). HEDP stosowany jest jako inhibitor tworzenia kryształów CaCO 3. Pozostałe związki są chelatorami metali przejściowych, mają chronić środki wybielające przed rozkładem [8]. Zastępują one wcześniej używane nieorganiczne fosforany ze względu na większą stabilność, mniejszą podatność na hydrolizę oraz zmiany ph i temperatury. Fosfoniany w środowisku Związki fosforoorganiczne z bezpośrednim wiązaniem węgiel-fosfor są szeroko stosowane w przemyśle, rolnictwie oraz w środkach czystości stosowanych w gospodarstwach domowych. Tak więc, tysiące ton syntetycznych fosfonianów zostaje wprowadzonych do środowiska. Zainteresowanie losem tych związków w środowisku jest znaczne, zwłaszcza gdy uwzględnione zostanie bezpośrednie wiązanie fosfor-węgiel, które jest odporne na chemiczną degradację (hydrolizę, termiczny rozkład i fotolizę). Związki fosforoorganiczne są przeważnie nie trwałe w środowisku, ponieważ niektóre mikroorganizmy zapewniają odpowiednie drogi biodegradacji tych związków. Zdolność do katabolizmu fosfonianów jest szeroko rozpowszechniona wśród bakterii i grzybów. Wiele szczepów jest zdolnych do wzrostu w obecności fosfonianów jako jedynego źródła fosforu, azotu i węgla [5]. Hydroliza związków fosforoorganicznych prowadzi do zmniejszenia ich toksyczności dla ssaków o kilka rzędów wielkości. Wśród wielu pozytywnych aspektów stosowania związków fosforoorganicznych ważne jest przytoczenie przykładów negatywnego wpływu tych związków na organizmy żywe. Produkcja i stosowanie środków ochrony roślin, poza niewątpliwymi korzyściami, wiąże się jednak z wieloma 28

29 niepożądanymi skutkami. Nieodpowiednie i nadmierne stosowanie tego typu związków może skutkować zanieczyszczeniem gleby oraz skażeniem wód powierzchniowych i gruntowych. Wiele związków fosforoorganicznych stosowanych jako insektycydy wykazuje wysoką toksyczność względem ryb i niewielkich ssaków oraz charakteryzuje się tendencją do bioakumulacji. Zatem istnieje konieczność usunięcia ich ze środowiska. 1 2 fosfonian Rys.1. Przykłady struktur fosfonianów o zróżnicowanym zastosowaniu. Podsumowanie Fosfoniany są powszechnie występującymi w naturze związkami. Stanowią grupę bioaktywnych struktur, posiadających możliwość komercyjnego zastosowania, zarówno w rolnictwie jak i w medycynie. Wykorzystywane są między innymi jako inhibitory enzymów, leki przeciwnowotworowe, antybiotyki, neuroprzekaźniki, regulatory wzrostu roślin, herbicydy, ale również jako inhibitory korozji oraz detergenty. Wszechstronność zastosowań związków fosforoorganicznych skutkuje możliwością przeniknięcia tych związków do ekosystemów oraz ich akumulację. Zdolność mikroorganizmów do degradacji związków fosforoorganicznych pozwala znacznie ograniczyć wpływ tych związków do środowiska. Badania zostały zrealizowane w ramach Projektu Biotransformacje użyteczne w przemyśl farmaceutycznym i kosmetycznym Nr POIG /09-04 Współfinansowanego ze środków Europejskiego Funduszu Rozwoju Regionalnego w ramach Programu Operacyjnego Innowacyjna Gospodarka

30 Literatura 1. Ahmad I., Malloch D., Interaction of soil microflora with the bioherbicide phosphinothricin. Agriculture. Ecosystems and Environment, 54: Anderson, J. W., Fowden L Amino-2-phenylethane 1-phosphonic acid: a specific competitive inhibitor of phenylalanyl-trna synthetase. Chem.-Biol. Interact., 2: Bigge C, Johnson G, Ortwine D, Drummond J, Retz D, Brahce L, Coughenour L, Marcoux F, Probert A Exploration of Nphosphonoalkyl-, N-phosphonoalkenyl-, and N-(phosphonoalkyl) phenyl-spaced alpha-amino acids as competitive Nmethyl- D-aspartic acid antagonists. J Med Chem 35: Boocock M.R., Coggins J.R., Kinetics of Senolpyruvylshikimate-3-phosphate synthase inhibition by glyphosate. FEBS Lett., 154: Bujacz B., Wieczorek P., Krzyśko-Łipicka T., Goła Z.,Lejczak B., Kafarski P., Organophosphonate Utilization by the Wild-Type Strain of Penicillium notatum. Applied and Environmental Microbiology, 61(8): de Klerk J.M.H., van Dieren E.B., van het Schip A.D., Hoekstra A,. Zonnenberg B.A., van Dijk A, Rutgers D.H., Blijham G.H., van Rijk P.P., Bone Marrow Absorbed Dose of Rhenium-186-HEDP and the Relationship with Decreased Platelet Counts. The Journal of Nuclear Medicine, 37: 7. Gutierrez O.L., Ocampo C.L., Aguilera J.R., Luna J., Sumano L.H., Pharmacokinetics of disodium-fosfomycin in mongrel dogs. Veterinary Science 85: Jaworska J., van Genderen-Takken H., Hanstveit A.,van de Plassche E., Feijtel T., Environmental risk assessment of phosphonates, used in domestic laundry and cleaning agents in the Netherlands. Chemosphere 47: Johnson R.K., Inouye T., Goldin A., Stark G.R.., Antitumor activity of N-(phosphonacetyl)-Laspartic acid, a transition-state inhibitor of aspartate transcarbamylase. Cancer Res 36(8): Kafarski P., Lejczak B., Aminophosphonic Acids of Potential Medical Importance. Curr. Med. Chem. Anti-Cancer Agents, 1: , Karasova J.Z., Kassa J., Pohanka M., Musilek K., Kuca K., Potency of HI-6 to Reactivate Cyclosarin, Soman and Tabun Inhibited Acetylcholinesterase In Vivo Study. Letters in Drug Design & Discovery, 7: Morimoto F., Shimazu T., Yoshioka T., American Journal of Emergency Medicine, 17: Sparidans R.W., Twiss I.M., Talbot S., Bisphosphonates in bone diseases. Pharmacy World & Science, 20(5): Phosphonate application and their impact on the environment Summary The organophosphonates are a group of both synthetic and biogenic organophosphorus compounds, characterized by the presence of a stable, covalent, carbon to phosphorus (C-P) bond. The direct C-P linkage is chemically and thermally very inert. Phosphonates are known as the compounds of great biological and chemical relevance. In most cases, compounds of this group act as antibiotics, enzyme inhibitors or herbicides. The ability of microbes to break down phosphonates has attracted particular attention because of its potential applications in biodegradation. Kay words: organophosphonate compounds, phosphonate 30

31 METODY ZACIERANIA SŁODU BROWARNEGO I ICH WPŁYW NA JAKOŚĆ PIWA Autor: Michał Buda Opiekun: dr inż. Bogna Latacz Koło Naukowe Technologów Żywności Państwowa Wyższa Szkoła Zawodowa w Sulechowie, Instytut Zarządzania i Inżynierii Rolnej ul. Armii Krajowej 51, Sulechów Słowa kluczowe: metody zacierania słodu, piwowarstwo, jakość piwa, enzymy amylolityczne Wstęp Dla każdego browarnika najważniejszym etapem podczas produkcji piwa jest zacieranie. Zacieranie to nic innego jak wydobycie wszystkich składników słodu i rozpuszczenie ich w brzeczce. Białka, cukry i substancje mineralne zawarte w słodzie są istotnym elementem przyszłego piwa. To, między innymi, te składniki nadają smak, barwę, aromat i zdecydowanie wpływają na jakość piwa [1]. Podczas zacierania zachodzą ważne reakcje biochemiczne składników słodu. Dzięki tym przemianom nierozpuszczalne związki wielkocząsteczkowe rozkładane są do mniejszych form rozpuszczalnych, o odmiennych właściwościach. Odpowiedzialne za te reakcje są enzymy, które pełnią funkcję niezbędnych katalizatorów. W słodzie znajdują się głównie proteazy, amylazy i hemicelulazy. Proteazy odpowiadają za rozkład białek, amylazy rozkładają cukry, zaś hemicelulazy degradują ściany komórek roślinnych uwalniając ich zawartość. Aby uzyskać jak największą efektywność zacierania oraz modelować właściwości piwa, stosuje się różnorodne programy ogrzewania surowca słodowego. Istotą tych zabiegów jest zastosowanie przerw, w których enzymy w odpowiedniej temperaturze, kwasowości i czasie mogą wykonać swoje zadanie. W każdej z tych przerw zachodzą inne reakcje, które nadadzą piwu odpowiednie właściwości organoleptyczne [2]. Znając dobrze proces zacierania i właściwości substancji wydobywanych ze słodu możemy sami decydować, jakie piwo chcemy otrzymać. Znając zależność hydrolizy poszczególnych składników od temperatury, możemy kontrolować ilość peptydów, aminokwasów, cukrów fermentujących, które w późniejszych etapach zostaną przekształcone w alkohol etylowy oraz cukrów niepodlegających fermentacji, które nadają charakterystyczny smak różnym rodzajom piwa. Na przykład, jeżeli zależy nam na piwie o dużej zawartości alkoholu to musimy przeprowadzić dłuższą przerwę β-amylazową. Podczas niej powstają cukry zdolne do fermentacji, takie jak glukoza i maltoza. Pomijając przerwę dla β-amylazy bądź ją skracając, stymulujemy wytwarzanie dekstryn, które pozostają w piwie nadając mu słodki smak i zwiększając jego ekstraktywność [2]. 31

32 Składniki słodu browarnego Bielmo ziarna słodowego zawiera liczne składniki niezbędne zarodkowi do życia i rozwoju. Poszczególne komórki otoczone są ścianami, których głównym składnikiem są polisacharydy. W zależności od odmiany jęczmienia ściany zawierają około 70-75% β-d-glukanu, 20-23% arabinoksylanu i około 5% białka. Aby uwolnić zawartość komórek niezbędny jest rozkład ścian, który rozpoczyna się podczas słodowania ziarna, a kontynuowany jest w czasie zacierania surowca. β-glukany są polimerami glukozy o łańcuchach prostych i rozgałęzionych, zwierającymi wiązania β- 1,3 oraz β-1,4-glikozydowe, przy czym dominują te ostatnie (70%). Cząsteczki glukanów często powiązane są wiązaniami estrowymi z białkami lub peptydami błon komórkowych. Przy ich rozkładzie niezbędne jest usunięcie tych wiązań przez odpowiednie enzymy (karboksypeptydazy). Dalszy rozkład glukanów katalizują β-glukanazy, które degradują te polisacharydy, między innymi, do dwucukrów (celobiozy i laminarobiozy) oraz cząsteczek glukozy. Białka słodu tworzą matrycę, w której osadzone są ziarna skrobi. W dobrze rozluźnionym słodzie ponad 40% białka zostało już rozłożone do aminokwasów i peptydów rozpuszczalnych w wodzie. Dzieje się tak, ponieważ w procesie słodowania uaktywnia się wyjątkowo dużo proteaz i peptydaz. Uwalniane aminokwasy są doskonałym źródłem azotu dla fermentujących drożdży piwowarskich. Białka słodu to, przede wszystkim, rozpuszczalne w wodzie albuminy i globuliny oraz nierozpuszczalne w niej - hordeina i glutelina [1]. Skrobia (łac. amylum) jest jednym z najbardziej rozpowszechnionych polisacharydów w przyrodzie. Pełni funkcje materiału zapasowego roślin. Powstaje w procesie fotosyntezy i jest magazynowana np. w nasionach zbóż, bulwach ziemniaczanych. W komórkach roślin występuje w postaci ziarenek, które różnią się wielkością i kształtem w zależności od gatunku rośliny. Ziarno jęczmienia browarnego zawiera około 65% skrobi[1]. Skrobia jest białym proszkiem, bez smaku i zapachu. Ten polisacharyd o wzorze sumarycznym n-c 6 H 10 O 5, zbudowany jest z dwóch rodzajów łańcuchów reszt glukozowych - amylozy i amylopektyny. Amyloza (ok. 25%) jest polimerem liniowym, czyli nierozgałęzionym łańcuchem, zbudowanym z kilkuset do kilku tysięcy reszt glukozowych Reszty glukozowe są ze sobą połączone wiązaniami α-1,4-glikozydowymi. Amylopektyna, w przeciwieństwie do amylozy posiada o wiele dłuższe łańcuchy i jest rozgałęziona. Łańcuchy zawierają głównie wiązania α-1,4-glikozydowe, jedynie rozgałęzienia amylopektyny są połączone z resztą łańcucha wiązaniami α-1,6-glikozydowymi [3, 4]. Skrobia w połączeniu z wodą pęcznieje, a po podgrzaniu tworzy kleik. Pod wpływem enzymów amylolitycznych lub kwasów ulega hydrolizie, co wykorzystywane jest w wielu gałęziach przetwórstwa. Produktami hydrolizy mogą być dekstryny (krótsze łańcuchy polisacharydowe), maltoza (dwucukier), maltotrioza i oczywiście glukoza, będąca substratem fermentacji etanolowej. Już w procesie słodowania około 10% skrobi zawartej w ziarnie jęczmienia ulega hydrolizie. Kontynuacja tego procesu ma miejsce w czasie zacierania [1]. 32

33 Aby wykryć skrobię stosowany jest roztwór jodu w jodku potasu (płyn Lugola). Jod osadza się między resztami glukozowymi i barwi skrobię na granatowo. Zjawisko to pozwala także na określenie aktywności amylaz [4]. Rys. 1. Budowa skrobi amylozy i amylopektyny [4]. Charakterystyka enzymów zawartych w słodzie Dobrze rozluźniony słód jęczmienny jest bogatym źródłem aktywnych enzymów. Dominują tu amylazy, zdolne do rozkładu łańcuchów skrobiowych, ale obecne są też enzymy proteolityczne i, mniej liczne, celulolityczne. Enzymy celulolityczne degradują ścianę komórkową, uwalniając składniki zawarte w jej wnętrzu. W tej różnorodnej grupie szczególne znaczenie w procesie zacierania mają β-glukanazy, rozkładające sacharydowe polimery ścian komórkowych β-glukany. Duża część tych enzymów ulega dezaktywacji w procesie suszenia słodu, szczególnie dotyczy to endo-β-glukanaz. Brak wystarczającej aktywności β-glukanaz uniemożliwia dostateczny rozkład glukanów, co prowadzi do podwyższenia lepkości brzeczki i stwarza problemy technologiczne [1]. Czasem, więc istnieje potrzeba dodania do zacieru β-glukanaz w postaci preparatów pochodzenia bakteryjnego lub grzybowego. Enzymy celulolityczne są szczególnie aktywne w temperaturze 35ºC [2]. Proteazy, czyli enzymy proteolityczne, są związkami katalizującymi rozrywanie długich łańcuchów polipeptydowych na krótsze peptydy i aminokwasy. Ze względu na system działania enzymów proteolitycznych, możemy wyróżnić endopeptydazy i egzopeptydazy. Pierwsze swoje działanie zaczynają od środka łańcucha tworząc krótsze peptydy, zaś drugie działają od końca tworząc pojedyncze aminokwasy [5]. W procesie suszenia słodu część peptydaz (szczególnie endopeptydazy) ulegają dezaktywacji. Bardziej odporne na temperaturę egzopeptydazy stymulują pojawianie się aminokwasów w procesie zacierania. Stwierdzono, że powolne ogrzewanie zacieru sprzyja wytrącaniu białek w postaci osadów garbnikowo-białkowych. Efekt ten jednak przypisuje się bardziej działaniu 33

34 temperatury niż enzymów [1]. Optymalny zakres temperatur dla aktywności enzymów proteolitycznych wynosi 45-55ºC [2]. Enzymy amylolityczne są katalizatorami hydrolizy skrobi do cukrów prostszych, głównie maltozy, glukozy i dekstryn. Proces ten zachodzi wieloetapowo. Stopniowo tworzone są coraz krótsze łańcuchy. Do enzymów obecnych w słodzie zaliczamy głównie α i β-amylazy. Podczas ich pracy długie łańcuchy amylozy i amylopektyny, z których zbudowana jest skrobia, zostają skrócone przez rozerwanie wiązań pomiędzy resztami glulozowymi. β-amylazy są mniej odporne na wyższe temperatury. Optymalne działanie zapewnione jest w temperaturze o C, przy ph 5,4. Aktywna β- amylaza (enzym scukrzający) rozcina, co drugie wiązanie α-1,4-glikozydowe zaczynając od niealdehydowego końca. Wiązanie to posiada zarówno amyloza jak i amylopektyna. W przypadku amylozy hydroliza trwa do powstania jak najkrótszych fragmentów, czyli glukozy i maltozy. W przypadku amylopektyny hydroliza trwa do momentu, gdy β-amylaza napotka wiązanie α-1,6- glikozydowe, obecne na rozgałęzieniach łańcucha. Niestety enzym nie jest w stanie rozłożyć tego wiązania i na tym etapie jego praca się kończy. W rezultacie powstaje maltoza i dekstryny graniczne [5]. α-amylaza jest endoenzymem. Katalizuje hydrolizę wiązań α-1,4-glikozydowych w przypadkowych miejscach łańcucha polisacharydowego. Nazywana jest enzymem upłynniającym, gdyż jej działanie szybko poprawia rozpuszczalność skrobi. Efektem działania α-amylazy jest powstanie dekstryn o zróżnicowanej wielkości oraz stosunkowo niewielkich ilości maltozy i glukozy, a więc cukrów fermentujących [1]. Optymalne warunki działania tego enzymu to 72-75ºC, choć jest on także aktywny w niższych temperaturach, kiedy to współpracuje z β-amylazą, przyspieszając rozkład skrobi do cukrów prostych. α-amylaza ulega uszkodzeniu w temp. 80ºC [2]. Systemy zacierania Zacieranie infuzyjne Zacieranie infuzyjne polega na stopniowym podgrzewaniu całego zacieru do osiągnięcia temperatur odpowiednich dla aktywności konkretnego enzymu. Jest to najprostsza metoda zacierania. Wykonuje się ją w specjalnych naczyniach (kadziach zaciernych) z możliwością regulowania temperatury. Ważnym elementem tej metody jest mieszanie zacieru, tak aby nie doszło do jego przypalenia [6]. Metoda ta znajduje zastosowanie szczególnie w przerobie słodu dobrze rozluźnionego. Jest prosta, stosunkowo mało energochłonna, nie wymaga skomplikowanych urządzeń. Z tych względów znajduje zastosowanie w małych, lokalnych browarach. Zalecana jest szczególnie przy produkcji piw brytyjskich typu ale [7]. Metoda infuzyjna nie powinna być stosowana, gdy przerabiane są surowce niesłodowane (jako dodatki). W porównaniu z metodą dekokcyjną, ekstraktywności otrzymanych piw są zwykle niższe [1]. 34

35 Zacieranie dekokcyjne Zacieranie to polega na odbieraniu części zacieru, gotowaniu go i ponownym łączeniu z pozostałą częścią, co powoduje skokowy wzrost temperatury brzeczki. Ilość gotownego zacieru (dekoktu) leży od temperatury, jaką chcemy osiągnąć. Ilości te oblicza się z odpowiedniego wzoru [7]. Zagotowanie części zacieru skutkuje całkowitym upłynnieniem skrobi, ułatwia ekstrakcję składników słodu i sprzyja wytrącaniu osadów garbnikowo-białkowych. Ta ostatnia właściwość pozwala na usunięcie tych osadów w procesie filtracji brzeczki, co w konsekwencji, poprawia klarowność piwa [1]. W przeciwieństwie do zacierania infuzyjnego, dekokcja jest procesem dłuższym i kosztowniejszym, jednak z technologicznego punktu widzenia bywa często korzystniejsza. Należy pamiętać, aby dekokt był wpompowany do kadzi zaciernej od dołu, a niewlany od góry. Zapobiega to natlenieniu zacieru. Tlen niekorzystnie wpływa na smak przyszłego piwa. Ze względu na liczbę gotowanych dekoktów możemy wyróżnić jedno-, dwu- i trójwarowy system zacierania [3, 6, 8]. Programy zacierania Istnieje wiele różnych programów zacierania brzeczki browarniczej. Ich istotą jest zaplanowanie sekwencji przerw w ogrzewaniu surowca, tak aby stworzyć optymalne warunki działania enzymów, a poprzez to, modelować jakość i charakter przyszłego piwa. Stosowane przerwy Optymalna temperatura podczas zacierania jest bardzo ważna dla enzymów pośrednio tworzących smak i barwę piwa. Wyróżniamy następujące przerwy: Przerwa zakwaszająca ma na celu zakwaszenie środowiska, w jakim będą działały enzymy. Pod wpływem działania fitaz uwalniane zostają jony fosforanowe i wodorowe obniżające ph brzeczki i jednocześnie zwiększające jej buforowość [7]. Skrobia podczas tej przerwy pęcznieje i staje się łatwiej rozpuszczalna, dostępna dla enzymów amylolitycznych [2]. Uaktywniają się też enzymy celulolityczne uwalniając zawartość komórek. Stopniowo obniża się lepkość zacieru [7]. Przerwa powinna nastąpić w temperaturze 35ºC i trwać od 10 minut do nawet 2,5 godziny [2]. Przerwa białkowa, podczas której białka ulegają dalszemu rozpadowi i powstają krótsze polipeptydy i aminokwasy. Przerwa ta jest szczególnie wskazana dla słodów słabo rozluźnionych, a czas jej trwania zależy właśnie od stopnia rozluźnienia. Polipeptydy są związkami pozytywnie wpływającymi na jakość piany. Aminokwasy zaś są potrzebne drożdżom do wzrostu i fermentacji, jako źródło łatwoprzyswajalnego azotu. W brzeczce zawierającej duże ilości aminokwasów fermentacja zachodzi dynamiczniej, a drożdże produkują większe ilości związków aromatycznych [1]. Optymalna temperatura przerwy to o C, w czasie od 10 minut do 2 godzin. Najczęściej stosowana jest przerwa 30 minutowa [2]. 35

36 Przerwa β-amylazowa inaczej zwaną scukrzającą. Podczas tej przerwy stwarzamy optymalne warunki dla działania β-amylazy, w wyniku czego powstają cukry fermentujące. Przerwa ta powinna przebiegać w temperaturze o C nie dłużej niż 1 godzinę [3]. Przerwa α-amylazowa czyli przerwa dla α-amylazy, podczas której skrobia przekształcana jest w cukry rozpuszczalne. Powstają głównie dekstryny, które pozostaną w piwie nadając mu słodki smak, gdyż nie ulegają fermentacji. Przerwa ta sprzyja lepszemu upłynnieniu brzeczki, co ułatwia dalsze procesy technologiczne [1]. Optymalna temperatura przerwy α-amylazowej to 72-75ºC. Najczęściej stosuje się ją w czasie 30 minut. W temperaturze 80ºC α-amylaza traci swoja aktywność. Powyżej tej temperatury zachodzi też niekorzystne wydzielanie niepożądanych garbników [2]. Programy W zależności od charakteru piwa, jakie chcemy otrzymać dokonujemy świadomego wyboru programu zacierania, realizując lub pomijając przerwy enzymatyczne oraz modyfikując czas ich trwania. Najczęściej stosowane są niżej wymienione programy. Program zacierania z czterema przerwami realizujący przerwę zakwaszającą, białkową, β-amylzową i α-amylazową, zakończony ogrzaniem zacieru do temp. 79ºC. Program znajduje szczególne zastosowanie w przypadku wykorzystania słodów słabo rozluźnionych [2]. Program zacierania z trzema przerwami realizowany z pominięciem przerwy zakwaszającej. W przypadku dobrze rozluźnionych słodów zastosowanie tej przerwy nie jest konieczne. Korekty kwasowości można dokonać też poprzez dodatek kwasu do brzeczki [1]. Program z łączeniem przerw amylazowych stosowany jest przez wielu piwowarów. Zauważono, że różnica temperatur optymalnego działania α i β-amylazy jest niewielka, dlatego można podnieść temperaturę do pośredniej wartości dla obu enzymów, czyli 70 o C. Wprawdzie enzymy te nie działają wówczas najefektywniej i przerwa musi zostać wydłużona, jednak rezultaty są zadowalające. Dodatkowo proces zacierania zostaje uproszczony. Ilość cukrów fermentujących i niefermentującychi zostaje w ten sposób wyrównana. Program zacierania bez przerwy białkowej nie zawsze jest możliwy do zastosowania. Przerwa białkowa jest potrzebna do wytworzenia stabilnej piany i dla efektywniejszej fermentacji. Stosowanie przerwy białkowej jest najbardziej uzależnione od rodzaju słodu. Rożne słody zawierają inne ilości białka. Słabo rozluźnione zawierają go więcej niż te dobrze rozluźnione. Pomijając przerwę białkową przy słodzie bogatym w białko, a ubogim w peptydy i aminokwasy wytworzymy piwo o słabej pianie i możemy natrafić na problemy z fermentacją brzeczki [1]. Program zacierania w stałej temperaturze jest najlepszym programem dla domowego piwowara. Polega na pominięciu przerwy zakwaszającej i białkowej, pozostawiając jedynie połączone przerwy amylazowe. Warunkiem niezbędnym do zastosowania tego najprostszego wariantu jest bardzo dobra jakość słodu. Doświadczenia praktyczne opisywane w Internecie i literaturze wskazują, że piwa wytworzone z zastosowaniem tego programu także są udane [2]. 36

37 Wpływ metody zacierania na jakość i charakter piwa Metoda zacierania ma ogromny wpływ na produkt końcowy. Manipulując programami zacierania poprzez dobór ilości przerw, zastosowanie odpowiednich temperatur, czasu trwania przerw możemy stworzyć piwa o zaplanowanych cechach organoleptycznych. Odpowiednio sterując przerwą białkową mamy wpływ na jakość piany, zmętnienie napojui przebieg procesu fermentacji. W dolnych granicach temperaturowych przerwy białkowe (około 45ºC) powstają głównie aminokwasy wspomagające fermentację. Efektem ich obecności jest wzbogacenie aromatów piwa syntezowanych przez drożdże. W górnych granicach tego przedziału (55ºC) wytwarzane są peptydy stabilizujące pianę [2]. Zbyt długa przerwa białkowa bywa niekorzystna. W trakcie jej trwania wydzielają się różnej wielkości peptydy. Wielkocząsteczkowe frakcje powodują zmętnienie piwa, a jego klarowanie staje się bardzo kłopotliwe. Jeżeli zależy nam na piwie o większej zawartości alkoholu, powinno się zastosować osobną przerwę dla β-amylazy. W ten sposób powstaną cukry o najprostszej formie, które w procesie fermentacji zostaną przekształcone w alkohol etylowy. Ponieważ w brzeczce pozostaje wówczas bardzo mało cukrów niefermentujących, wytworzone w ten sposób piwo jest bardziej wytrawne. Poświęcając więcej czasu na działanie α-amylazy, skracając jednocześnie przerwę beta-amylazową, stymulujemy powstawanie dużych ilości dekstryn, które jako cukry niefermentujące, pozostaną w piwie i nadadzą mu słodkawy smak [1]. Zastosowanie przerwy zakwaszającej i ewentualne jej wydłużenie, pozwala na podniesienie estraktywności piwa i zapobiega niektórym rodzajom zmętnień [2]. Literatura 1. Bednarski W., Repsa A Biotechnologia żywności. Wyd. Naukowo Techniczne, Warszawa. 2. Dylkowski W Browarnictwo. Wydawnictwo Szkolne I Pedagogiczne, Warszawa. 3. Kunze W Technologia piwa i słodu. Piwochmiel Sp. z o.o., Warszawa. 4. Lehrl R Domowe warzenie piwa.. Wydawnictwo R M, Warszawa. 5. Leśniak W Biotechnologia żywności. Procesy fermentacji i biosyntezy. Wydawnictwo Akademii Ekonomicznej we Wrocławiu, Wrocław. 6. Lewis M. J., Young T. W Piwowarstwo. Wyd. Naukowe PWN, Warszawa. 7. Mastalerz P Elementarna chemia organiczna. Wyd. Chemiczne, Warszawa. 8. Sobkowicz G Przewodnik do ćwiczeń z ogólnej technologii żywności. Wyd. Akademii Rolniczej we Wrocławiu, Wrocław. Methods of brewing malt mashing and their influence on the quality of beer Summary Malt contains many substances affecting the quality of beer after enzymatic transformations. There are several systems and programs of malt mashing. The process of mashing malt affects the quality and character of beer, for example alcohol content, sweetness, clarity, foam durability. Key words: method of mashing malt, brewing, quality of beer, amylolytic enzymes 37

38 OCENA SPOSOBU ODŻYWIANIA GIMNAZJALISTÓW Z CHEŁMA Autorzy: Małgorzata Stryjecka, Barbara Szpakowska, Karina Bakun, Joanna Wlizło Opiekun: dr inż. Małgorzata Stryjecka Studenckie Koło Naukowe Rolników Sekcja biologiczna Instytut Nauk Rolniczych Państwowa Wyższa Szkoła Zawodowa w Chełmie ul. Nowy Świat 3, Chełm Słowa kluczowe: żywienie, młodzież gimnazjalna Wstęp Badania naukowe w Polsce jak i na Świecie wskazują, że sposób odżywiania się ludzi młodych jest nieprawidłowy i nie sprzyja ich prawidłowemu rozwojowi. Przemawia za tym nieregularność spożywania posiłków, pomijanie posiłków, szczególnie pierwszego śniadania, pojadanie pomiędzy posiłkami, oraz nadmierne spożywanie posiłków wysoko przetworzonych Niewłaściwe nawyki żywieniowe w dzieciństwie i młodości, powodują, że w wieku dorosłym zwiększa się ryzyko wielu chorób takich jak: cukrzyca typu II, osteoporoza, choroby sercowonaczyniowe, nowotwory [1,2,3,4,5,6]. Chełma. Celem niniejszych badań, była ocena zwyczajów żywieniowych młodzieży gimnazjalnej z Materiały i metody Badania przeprowadzono w grupie 112 gimnazjalistów (69 dziewcząt i 43chłopców) Zespołu Szkół Ogólnokształcących nr 6 w Chełmie, w okresie zimowym(grudzień marzec 2011). Średni wiek, wzrost, masa ciała i BMI badanych dziewcząt wynosiły odpowiednio: 14,1±1,0 lat, 164,2±6,3 cm, 55,7±8,9 kg i 19,1±3,2 kg/m 2, zaś chłopców: 14,5±1,0 lat; 167,2±7,2 cm; 59,1±11,5 kg, oraz 20,4±3,1 kg/m 2 Zastosowano metodę badań w postaci wywiadu żywieniowego, obejmującego dzień poprzedzający badanie. Do analizy statystycznej danych użyto programu komputerowego Statistica 6.0. Wyniki i ich omówienie Tabela 1 przedstawia częstotliwość spożywania posiłków w ciągu dnia przez gimnazjalistów. Pierwsze śniadanie było spożywane regularnie przez 84,7% dziewczyny i 79,9% chłopców Jest to zjawisko niekorzystne gdyż, spożywanie śniadania wpływa na: lepsze samopoczucie, wyższą średnią ocen (7), z niższą wartością współczynnika BMI, wyższą podażą wapnia i błonnika pokarmowego, oraz z wpływem na zdolność logicznego myślenia. Wysoki procent badanych dziewcząt jak i chłopców deklarowało pojadanie, odpowiednio 23,4%, oraz 25,7%. 38

39 Tab. 1. Częstotliwość spożywania posiłków przez ankietowanych gimnazjalistów [%] Płeć Posiłki Jadam Jadam W ogóle nie jadam codziennie nieregularnie Dziewczęta Pierwsze śniadanie 84,7 12,1 3,2 n=69 Drugie śniadanie 51,3 43,00 5,7 obiad 90,30 9,70 0,00 podwieczorek 19,7 44,3 36,00 kolacja 71,4 19,40 9,20 obiadokolacja 9,70 24,1 66,2 pojadanie 23,4 59,5 17,1 Chłopcy n=43 Pierwsze śniadanie 79,9 19,1 1,0 Drugie śniadanie 54,4 41,8 3,8 obiad 91,7 8,3 0,00 podwieczorek 18,5 47,4 34,10 kolacja 77,3 17,0 5,7 obiadokolacja 10,2 20,5 69,3 pojadanie 25,7 53,4 20,9 Dominującym wśród ankietowanych gimnazjalistów jest tłuszcz roślinny (odpowiednio dziewczyny 55,8%, chłopcy 51,9%). Najczęściej do smarowania pieczywa respondenci stosują masło (dziewczyny: 50,9 %, chłopcy 47,15%). Zalecana przez dietetyków margaryny miękkie, są stosowane przez 18,7% dziewcząt, oraz przez 26,3% chłopców. Pieczywa nie smaruje żadnym tłuszczem 7,9% dziewczynek i 1,3% chłopców. Ankietowani na pytanie dotyczące smażenia potraw odpowiadali inne oleje, mając na myśli: olej słonecznikowy, kukurydziany, sojowy. Powyższe zależności przedstawiają dane z tab. 2. Tab. 2. Tłuszcze w żywieniu badanych gimnazjalistów [%] Oceniany parametr Płeć Dziewczyny Chłopcy Tłuszcze Roślinne 55,8 51,9 dominujące Zwierzęce 44,2 48,1 Smarowanie Masło 50,9 47,1 pieczywa Margaryny miękki 18,7 26,3 Masło+ margaryna 22,5 25,3 Nie smaruje 7,9 1,3 Smażenie potraw Smalec 12,5 19,8 Olej rzepakowy 9,5 10,1 Inne oleje 47,9 48,3 Różnie 30,1 21,8 W badanej grupie gimnazjalistów podaż produktów mlecznych był nieprawidłowy, gdyż tylko 40,9% dziewcząt, oraz 46,7% chłopców spożywało mleko codziennie. 47,3% badanych dziewczynek i 39

40 45,2% chłopców pije mleko nieregularnie. Wysoki odsetek ankietowanych deklaruje ze w ogóle nie pije mleka (11,8% dziewczynek, oraz 8,1% chłopców). 11,7% dziewcząt i 10,9 % chłopców deklarowało codzienne spożycie sera twarogowego, w sposób nieregularny spożywa go aż 85,7% dziewczynek i 87,5% chłopców. Wśród ankietowanych znajduję się również 2,6% dziewczynek oraz 1,6% chłopców, którzy w ogóle nie spożywają sera twarogowego. W przypadku spożywania sera żółtego odpowiednio 15,3% dziewczynek i 14,4% chłopców codziennie go spożywa. Pośród badanych są również osoby, które w ogóle nie spożywają sera, jest ich odpowiednio 1,2% dziewczynek i 1,5% chłopców. Wszystkie powyższe zależności są przedstawione w tabeli 3. Tab. 3. Częstość spożycia mleka i przetworów mlecznych przez badanych gimnazjalistów [%] Przetwory mleczne Częstość spożycia Płeć Dziewczyny Chłopcy Mleko Codziennie 40,9 46,7 Kilka razy w tygodniu 11,6 12,00 Raz tygodniu 20,0 20,9 Rzadziej 15,7 12,3 Nigdy 11,8 8,1 Sery twarogowe Codziennie 11,7 10,9 Kilka razy w tygodniu 20,4 21,7 Raz tygodniu 50,3 53,8 Rzadziej 15,00 12,00 Nigdy 2,6 1,6 Sery żółte Codziennie 15,3 14,4 Kilka razy w tygodniu 16,9 19,3 Raz tygodniu 55,6 58,8 Rzadziej 11,00 6,00 Nigdy 1,2 1,5 25,2% dziewczynek, oraz 22,3% chłopców deklarowało, że kilka razy dziennie spożywa owoce. Raz dziennie owoce spożywa wśród badanych gimnazjalistów 64,9% dziewczynek, oraz 66,9% chłopców. Nikt wśród ankietowanych nie zadeklarował brak spożywania owoców. W przypadku surowych warzyw 14,7% badanych dziewczynek i 16,3% chłopców kilka razy dziennie spożywa warzywa. Raz dziennie warzywa surowe spożywa 42,5% dziewczynek oraz 45,2% chłopców. Wśród respondentów znajdują się osoby, które nie spożywają warzyw surowych tj. 1,1% badanych dziewczynek, oraz 1,3% ankietowanych chłopców. Zależności te obrazują dane z tabeli 4. 40

41 Tab. 4. Częstość spożycia owoców oraz warzyw surowych wśród ankietowanych gimnazjalistów [%] Częstość spożycia Płeć Dziewczyny Chłopcy Owoce Kilka razy dziennie 25,2 22,3 Raz dziennie 64,9 66,9 Kilka razy w tygodniu 8,2 9,0 Rzadziej 1,7 1,8 nigdy 0,00 0,00 Warzywa surowe Kilka razy dziennie 14,7 16,3 Raz dziennie 42,5 45,2 Kilka razy w tygodniu 39,0 35,1 Rzadziej 2,7 2,1 nigdy 1,1 1,3 Wnioski 1. Zaobserwowano zbyt niskie spożycie produktów mlecznych, owoców, warzyw surowych w porównaniu do zalecanych norm 2. Najczęściej używanym tłuszczem do smarowania pieczywa jest masło 3. Zaobserwowane błędy żywieniowe mogą przyczynić się do występowania w diecie niedoborów min.: niezbędnych nienasyconych kwasów tłuszczowych (NNKT), witamin, składników mineralnych 4. Nie stwierdzono istotnego wpływu płci na spożycie określonych produktów spożywczych Literatura 1. Ilow R., Regulska-Ilow B., Strzała-Kruk D., Biernat J.,: Ocena zwyczajów żywieniowych licealistów z Oleśnicy. Bromat.Chem.Toksykol., 2008; 41, Keys A., AndersonJ., Grandem.,: Serum cholesterol response to changes in the diet. IV Particular saturated fatty acids in the diet. Metabolism, 1965; 14, Kunachowicz H., Nadolna I., Przygoda B., Iwanow K.:, Tabele wartości odżywczej produktów spożywczych. IŻŻ, Prace IŻŻ Nr 85, Warszawa, Nadolna I., Kunachowicz H., Iwanow K.:, Potrawy, skład i wartość odżywcza. IŻŻ, Nr 65, Warszawa, Szponar L., Wolnicka K., Rychlik E.:, Album fotografii produktów i potraw. IŻŻ. Prace IŻŻ Nr 96,Warszawa, Waszkiewicz L., Rogowska J., Racjonalne żywienie w aspekcie zarządzania własnym zdrowiem. (W) Rola i zadania medycyny społecznej u progu XXI wieku. Akademia Medyczna we Wrocławiu, Wrocław, Ziemlanski Ś., (red.) Normy żywienia człowieka. Fizjologiczne podstawy, PZWL, Warszawa, 2001 Assessment diets high school students from Chelm Summary The purpose of this study was to evaluate the dietary habits of school children Chelm. Were tested a group of 112 students including 69 girls and 43 boys. To assess the study habits of high school students in a group interview method was used nutritional. The results showed numerous abnormalities of young people study habits such as high consumption of butter, low consumption of milk and dairy products, and insufficient consumption of fruits, vegetables, especially raw. Key words: nutrition, secondary school students 41

42 OCENA SPOSOBU ŻYWIENIA OSÓB PO 50 ROKU ŻYCIA ZAMIESZKUJĄCYCH POWIAT CHEŁMSKI Autorzy: Małgorzata Stryjecka, Karina Bakun, Barbara Szpakowska, Joanna Wlizło Opiekun: dr inż. Małgorzata Stryjecka Studenckie Koło Naukowe Rolników Sekcja biologiczna Instytut Nauk Rolniczych Państwowa Wyższa Szkoła Zawodowa w Chełmie Ul. Nowy Świat 3, Chełm Słowa kluczowe: żywienie, osoby starsze Wstęp Racjonalne żywienie osób starszych ma istotne znaczenie, gdyż u osób po 50 roku życia wzrasta w sposób naturalny ryzyko chorób dietozależnych takich jak: cukrzyca typu II, nadciśnienie tętnicze, otyłość. Na sposób odżywiania się ludzi starszych wpływ mają min. ich problemy zdrowotne, nawyki z młodości, sytuacja ekonomiczna [1,2,3, 4,5]. W Polsce jednym z problemów żywieniowym jest nadmiernym spożycie energii z tłuszczu i węglowodanów, natomiast niskie spożycia witamin i składników mineralnych. Obserwuje się częste spożycia mięsa i jego przetworów, a mniejsze spożycie ryb, owoców, warzyw, przetworach mlecznych. Celem niniejszej pracy jest przedstawienie oraz ocena sposobu żywienia osób po 50 roku życia zamieszkujących powiat chełmski. Materiał i metody Grupę badawczą stanowiło 132 osób (w tym kobiet 87, oraz 45 mężczyzn) w wieku lat mieszkający w powiecie chełmskim. Badania przeprowadzone w okresie od stycznia do marca Badania były przeprowadzone przy pomocy autorskiej ankiety. Przeważająca liczba ankietowanych to osoby z średnim i wyższym wykształceniem (73%). Analizując występowanie chorób przewlekłych, ankietowani najczęściej cierpią na: otyłość (44,2%), cukrzycę typu 2 (41,7%), nadciśnienie tętnicze (37%), osteoporozę (21,7%). Wyniki Dane w tabeli 1 przedstawiają regularność spożywania posiłków w ciągu dnia przez osoby po 50 roku życia zamieszkujące powiat chełmski. Kobiety regularniej (79,2%) niż mężczyźni (71,0%) spożywają najważniejszy posiłek dnia, jakim jest pierwsze śniadanie. Niepokojące jest, że aż 20,8% kobiet i 25,8% mężczyzn nie jada pierwszego śniadania regularnie. 100 % kobiet codziennie jada obiad, mężczyźni niewiele mniej 97,1%. Niewielką popularnością cieszy się zarówno u kobiet jak i u mężczyzn obiadokolacja (odpowiednio 9,7%, 12%) oraz podwieczorek (odpowiednio 9,3%, 12,8%). 42

43 posiłkami. Wysoki odsetek, bo aż 53,2% badanych kobiet i 61% mężczyzn deklaruje pojadanie pomiędzy Tab. 1. Regularność spożywania posiłków [%] Płeć Posiłki Jadam codziennie Jadam nieregularnie W ogóle nie jadam Kobiety Pierwsze śniadanie 79,2 20,8 0,00 Drugie śniadanie 57,4 23,0 19,6 Obiad 100,0 0,00 0,00 Podwieczorek 9,3 71,3 19,4 Kolacja 27,1 59,7 13,2 Obiadokolacja 9,7 25,6 64,7 Pojadanie 53,2 42,1 4,7 Mężczyźni Pierwsze śniadanie 71,0 25,8 3,2 Drugie śniadanie 53,2 26,6 20,2 Obiad 97,1 2,9 0,00 Podwieczorek 12,8 57,3 29,9 Kolacja 29,4 52,7 17,9 Obiadokolacja 12,0 28,9 59,1 Pojadanie 61,0 49,00 0,00 Zarówno kobiety (82,4%) jak i mężczyźni (79,3%) spożywają głównie tłuszcze pochodzenia roślinnego. Respondenci smarują pieczywo przede wszystkim masłem niezależnie od płci (kobiety 59,4%, mężczyźni 60,2%). 2,1% kobiet deklaruje że w ogóle nie smaruje pieczywa żadnym tłuszczem. W przypadku pytania dotyczącego smażenia, niezależnie od płci najczęściej padała odpowiedź inne oleje. Wśród tzw. innych olej respondenci wymieniali: olej słonecznikowy i kukurydziany. Zadawalający jest niski odsetek osób używających do smażenia smalcu (kobiet 9,7% i 12,8% mężczyzn). Powyższe zależności przedstawia tab. 2. Niepokojące jest niskie spożycie mleka wśród ankietowanych. Codzienne spożycie mleka deklaruje 55,4% kobiet, oraz 58,9% mężczyzn. 41,4% ankietowanych kobiet oraz 39,6% mężczyzn pije mleko nieregularnie. 3,2% badanych kobiet oraz 1,5% mężczyzn nigdy nie pije mleka. Na pytanie dotyczące częstotliwości spożywania sera twarogowego najczęściej przez badanych padała odpowiedź: kilka razy w tygodniu, odpowiednio kobiety 38,7%, mężczyźni 34,2% W przypadku spożycia sera żółtego 33,7% kobiet oraz 30,8% mężczyzn deklaruje spożycie go kilka razy w tygodniu. Wysoki odsetek wśród ankietowanych to osoby, które nie spożywają sera żółtego (odpowiednio 17,8% kobiet, oraz 11,3% mężczyzn). Zależności przedstawione powyżej przedstawia tab

44 Tab. 2.Tłuszcze w żywieniu badanych osób [%] Oceniany parametr Płeć Kobiety Mężczyźni Tłuszcze Roślinne 82,4 79,3 dominujące Zwierzęce 17,6 20,7 Smarowanie Masło 59,4 60,2 pieczywa Margaryna 12,1 9,4 Masło+ 26,4 30,4 margaryna Nie smaruje 2,1 0,00 Smażenie Smalec 9,7 12,8 potraw Olej rzepakowy 21,4 21,3 Inne oleje 49,7 54,2 Różnie 19,2 11,7 Tab. 3. Częstotliwość spożywania mleka i jego przetworów [%] Przetwory mleczne Częstość spożycia Płeć Kobieta mężczyzna Mleko Codziennie 55,4 58,9 Kilka razy w tygodniu 19,4 20,2 Raz tygodniu 17,00 17,1 Rzadziej 5,0 2,3 nigdy 3,2 1,5 Sery twarogowe Codziennie 15,6 14,3 Kilka razy w tygodniu 38,7 34,2 Raz tygodniu 21,5 24,7 Rzadziej 18,8 20,9 nigdy 5,4 5,9 Sery żółte Codziennie 7,2 12,9 Kilka razy w tygodniu 33,7 30,8 Raz tygodniu 30,2 16,3 Rzadziej 11,1 28,7 nigdy 17,8 11,3 Pomimo okresu przeprowadzonych badań (styczeń-marzec), kiedy na rynku owoców i warzyw jest niewiele, respondenci, niezależnie od płci bardzo chętnie spożywają owoce i warzywa. Raz dziennie owoce spożywa 65,7% kobiet, oraz 66,9% mężczyzn. Wśród ankietowanych znajdują się osoby, które nigdy nie spożywają owoców (1,2% kobiet, oraz 1,5% mężczyzn). 7,9% kobiet i 11,1% mężczyzn spożywa owoce kilka razy w ciągu dnia. 44

45 Warzywa surowe są, niezależnie od płci, spożywane przez respondentów rzadziej niż owoce. Najczęściej ankietowani deklarują ze spożywają warzywa kilka razy w tygodniu (odpowiednio 55,8% kobiet i 39,7% mężczyzn). Raz dziennie warzywa są spożywane przez 18,1% kobiet, oraz 35,1% mężczyzn. Pośród ankietowanych są osoby, które w ogóle nie spożywają warzyw surowych (11,9% kobiet i 6,2% mężczyzn). Powyższe zależności prezentuje tab.4 Tab. 4. Częstość spożycia owoców i warzyw surowych. [%] Wyszczególnienie Częstość spożycia Płeć Kobieta Mężczyzna Owoce Kilka razy dziennie 7,9 11,1 Raz dziennie 65,7 66,9 Kilka razy w tygodniu 21,7 17,6 Rzadziej 3,5 2,9 Nigdy 1,2 1,5 Warzywa surowe Kilka razy dziennie 4,9 3,1 Raz dziennie 18,1 35,1 Kilka razy w tygodniu 55,8 39,7 Rzadziej 9,3 15,9 Nigdy 11,9 6,2 Tabelka 5 przedstawia częstotliwość spożycia ryb wśród badanych. Ryb w żywieniu osób starszych są bardzo istotne ze względu na źródło niezbędnych nienasyconych kwasów tłuszczowych. Ankietowanie niezależnie od płci deklarowali, że najczęściej spożywają ryby raz w tygodniu. Wśród respondentów znajdują się osoby, które spożywają ryby kilka razy w tygodniu (odpowiednio kobiety 4,1%, oraz mężczyźni 5,7%) Tab.5. Częstość spożycia ryb przez ankietowane osoby starsze [%] Płeć Kobieta Mężczyzna Kilka razy w tygodniu 4,1 5,7 Raz w tygodniu 73,5 73,6 Raz w miesiącu 19,7 18,5 Rzadziej 2,7 2,2 Nigdy 0,00 0,00 45

46 Literatura 1. Roszkowski W., Żywienie osób starszych. [w] Hasik J., Gawęcki J. (red) Żywienie człowieka. Podstawy nauki o żywieniu. PWN, Warszawa, Narojek L., Niektóre aspekty uwarunkowań zachowań żywieniowych. Instytut Żywności i Żywienia, Warszawa, Gabrowska E., Spodaryk M., Ocena sposobu żywienia ludzi starszych mieszkających w Krakowie, Żyw. Człow.Metab., 2002, 29, supl., Duda G., Różycka-Cała K., Przysławski J., Sposób żywienia a wybrane a wybrane wskaźniki stanu odżywiania osób w wieku podeszłym.now.med.2000, 12, Ziemlański Ś., (red). Normy żywienia człowieka. Podstawy fizjologiczne. PZWL, Warszawa, 2001 Assessment of feeding people over the age of 50 living in district Chelm Summary The purpose of this study was to evaluate the diets of elderly people after 50 years of age. Group studied consisted of 132 persons (including 87 women and 45 men) living in Chelm district. As a method of research used a dietary interview 9 constituting a menu 24 hours). The obtained results from the surveys show numerous errors nutrition among the respondents. To which we can count, low supply: essential fatty acids, dairy products, fruits and vegetables. Key words: nutrition, older people 46

47 PROCESS OF LIPID PEROXIDATION AND ACTIVITY OF ANTIOXIDANT SYSTEM IN THE CELLS OF WHITE RATS UNDER AFLATOXIN В1 INJECTION N.K. Koval 1,2, H.L. Antonyak 2,3 1 Drohobych Ivan Franko State Pedagogical University, Ivasyik Street 11, Truskavets, Ukraine, 2 Institute for Research in Animal Biology of NAAS of Ukraine, Stus Street 38, Lviv, Ukraine 3 Ivan Franko National University of Lviv, Ukraine halyna Influence of aflatoxin В1 (AFB1) on the processes of lipid peroxidation (LPO) and activities of antioxidant system enzymes in the cells of liver and brain of white rats was investigated. It was established that on 7th and 14th day after of AFB1 injection (0,5 mg/kg) intensification of LPO processes and suppression of antioxidant system enzymes activities (superoxide dismutase, glutathione reductase, glutathione peroxidase) took place in the animal cells. Keywords: aflatoxin B1, lipid peroxide oxidation, antioxidant system enzymes, brain, liver. Aflatoxin В1 (AFB1) is one of mycotoxins which can be found in forage and foodstuffs at the conditions of contamination with fungi of Aspergillus genus [1]. It is known that AFB1 shows mutagenic, carcinogenic, teratogenic and immunosuppressive properties. It is able to cause the severe effects in of animals and human organism during the short period of time [2,3]. In many countries maximum allowable concentrations of aflatoxins in foodstuffs and forage are minimized. In concentrations 3 5 mg/kg AFB1 shows carcinogenic effects in hepatocytes [3]. AFB1 and other aflatoxins is the object of constant attention of experts in food quality and safety because of their carcinogenic properties. However mechanisms of derangement of vital functions in human and animal organism caused by Aflatoxin В1 intake with food and forage were studied insufficiently. The objectives of this research was to study aflatoxin В1 influence on lipid peroxidation (LPO) process and activities of antioxidant system enzymes in the cells of liver and brain of white rats under single injection of AFB1 in a dose 0,5 mg/kg body weight (1/10 of LD 50 ). Materials and methods Experiments were conducted on adult white outbred male rats weighing g, kept on a standard ration in the vivarium conditions. Animals were divided into three groups: control and two studied groups (5 animals in each group). AFB1 was injected to the animals of studied groups in a dose 0,5 mg/kg body weight and the equivalent volume of physiologic saline was injected to the animals of control group. The rats of studied groups (the 1 st and the 2 nd ) were tested on the 7th and 14th day respectively after injection of the toxin. Euthanasia of animals was carried out under easy anesthesia by decapitation. 47

48 The homogenates of liver and brain were prepared using the standard methods. Concentrations of LPO products (TBA-reactive products) and activities of antioxidant system (superoxide dismutase, glutathione reductase, glutathione peroxidase) were determined in homogenates [4]. The results were handled statistically with the use of statistical methods. Results and discussion The researches results show that under influence of aflatoxin B1 the processes of ROS formation and lipid peroxidation enhance in the cells of experimental animals. Thus, in liver cells concentration of TBA-reactive products increased at the 7th and 14th day of experiment by 52% and 117% (р<0,05-0,001) respectively, in brain cells by 83% and 150% (р < 0,05-0,001). This suggests the development of oxidative stress in the both types of investigated cells under an influence of AFВ1. % of control levels * * * * Brain Liver 50 0 control 7 14 Days after AFB1 injection Fig. 1. Effects of aflatoxin В1 on TBA-reactive product concentrations in the organs of rats Note: in this and other figures * and ** is a probability of divergence between control and experimental groups of animals (* р<0,05; ** р<0,01) It was established that under acute toxication with aflatoxin В1 the significant decrease enzymes of antioxidant system (superoxide dismutase, glutathione reductase, glutathione peroxidase) activities was observed in the cells of liver and brain of animals. In particular, superoxide dismutase activity decreased at the 7th and 14th day of experiment in liver cells by 34,3% and 46,8% (р <0,05), in brain cells by 29% and 47% (р<0,05-0,01), respectively. The activitiy of other enzymes of antioxidant system, glutathione reductase, is also suppressed in rat cells during experimental period. In particular, in liver cells glutathione reductase activity diminished on 7th and 14th day after AFB1 treatment by 50% and 73% (р<0,01), in the brain cells by 59% and 66% (р<0,05-0,01). Glutathione peroxidase activity decreased on 7th and 14th days of 48

49 experiment in brain cells by 28,4% and 16,7% (р<0,05-0,01), in liver cells by 26,7% and 20,7% (р <0,05), respectively. The results of experiment show that AFB1 considerably influences metabolism in the cells of liver and brain by stimulating LPO processes and inhibiting the activities of antioxidant system enzymes. It is known that AFB1 promotes directly and indirectly the increase in reactive oxygen forms (ROS) generation in the cells [5]. Chemically active ROS induce lipid peroxidation and other processes that result in destructive changes in the cells. At such conditions the diminishing of antioxidant protection level in organism poisoned with aflatoxin В1 can enhance the harmful effects of AFB1 on functional activity of organs and systems. First of all, the detected changes will promote damage in the functional activity of liver cells. This can be a part of mechanisms of AFB1 toxic influence. It is known that liver is an organ where destructive effects of aflatoxin are most severe [3]. At the same time, high responsibility to the action of aflatoxin is evident for brain cells where activation of LPO processes and inhibition of antioxidant system activity may be accompanied with other harmful intracellular effects. The obtained results are the basis for further researches of mechanisms of AFB1 and other aflatoxins harmful action in the cells of organs and tissues, and for the researches directed on possibility of correction metabolism disorders in organism of animals. Conclusions 1. Under the influence of single injection of aflatoxin В1 (0,5 mg/kg) in the cells of liver and brain of white rats intensification of TBA-reactive products formation was observed at the 7th and 14th day of experiment. 2. Aflatoxin В1 inhibited the activities of antioxidant system enzymes (superoxid dismutase, glutathione reductase and glutathione peroxidase) in the cells of liver and brain of the rats. Literature 1. Antonyak H.L., Babych N.O., Stefanyshyn O.M., Koval' N.K., Fedyakov R.O., Aflatoxins: biological effects and mechanisms of influence on organisms animals and human. The Animal Biology 1-2, Eaton D.L., Groopman J.D., The Toxicology of Aflatoxins. New York Acad. Press, Ellis E.M., Protection against aflatoxin B1 in rat a new look at the link between toxicity, carcinogenicity, and metabolism. Toxicol Sci. 109(1), Prochorova M.I., Methods of biochemical analysis. Leningrad: Leningr. Univ. Press., 272 р. 5. Sies H., Oxidative stress: introduction. Oxidative Stress: Oxidants and Antioxidants,

50 STEPONE REAL-TIME PCR DETECTION OF SALMONELLA SPP., SALMONELLA ENTERICA SER. TYPHIMURIUM AND ENTERITIDIS IN CHICKEN MEAT Authors: Jaroslav Pochop, Miroslava Kačániová, Lukáš Hleba Supervisor: doc. Ing. Miroslava Kačániová, PhD. Department of Microbiology, Faculty of Biotechnology and Food Sciences, Slovak University of Agriculture in Nitra, Tr. A. Hlinku 2, Nitra, Slovak Republic Key words: real-time PCR, Salmonella spp., food, detection Introduction Meat, including poultry, is one of the major sources of human Salmonella infection [3-4], and therefore, efficient and rapid monitoring of Salmonella in the poultry production chain is necessary [2]. The generation of quantitative data is extremely laborious and time consuming. Currently all available data are based on cultural methods such as the most probable number (MPN) test or colony count techniques using agar plates. Consequently, only few quantitative data for Salmonella from food and the environment are available [6]. Faster, easier and cheaper enumeration methods could provide risk managers with large amounts of new data for improving the risk assessment studies. Additionally, the colony count technique on selective agar is only appropriate for higher levels of Salmonella (10 2 to 10 3 CFU/g or more) and is not feasible when high levels of background flora are present. For low numbers of Salmonella, and/ or when the amount of background flora is relatively high, the laborintensive MPN method is recommended, which provides confirmed results within 3 to 6 days. Currently, an ISO standard is elaborated based on a mini-mpn procedure to enumerate salmonellae, offering a miniaturized version of the standard MPN method with benefits regarding procedural handling and consumption of reagents and consequently reduction of costs, but without improvements in process time. Real-time PCR offers several advantages in terms of speed, detection limit, costs and high-throughput [6] and has been used to generate quantitative data on Salmonella in various matrices including food [11-12]. However, pre-pcr processing methods without culture enrichment, such as flotation [12], immunomagnetic separation [10], and filtration [11], have a limit of quantification (LOQ) of approximately CFU/mL or gram of sample due to the loss of target material during the sample preparation and the small volumes analysed. This LOQ is usually still too high, since most samples in the food production chain, including the surface of the pig carcasses, are contaminated with 10 2 salmonellae per gram [1]. A number of PCR based Salmonella diagnostic kits are now commercially available including the BAX Salmonella Kit (Oxoid), the LightCycler foodproof Salmonella Detection Kit (Biotecon Diagnostics) and the MicroSEQ Salmonella spp. Detection Kit (Applied Biosystems). Each of these methods comprise of a shortened culture enrichment followed by a real-time PCR detection assay. Additional real-time PCR based methods for the detection of 50

51 Salmonella in food have been reported [8-9]. Real-time PCR methods are often used for quantification of initial target DNA. Unfortunately, amplification efficiencies can be different from sample to sample due to the effects caused by inhibition of amplification, human failures or preparation errors. This implies that quantification, even with external controls, does not always represent a correct calculation of initial amount of target in each sample. To eliminate part of these drawbacks, different approaches of using an internal amplification control (IAC) in each real-time PCR have been described recently [5, 7]. Materials and Methods Food samples Total of eight food samples were used in this study. As the aim of investigation were observed animal meat. Samples were obtained by taking swabs from the body of chickens. Bacterial Strains and DNA Extraction As a pre-preparation step for the Step One real-time PCR, DNA extraction was performed using DNA extraction method: PrepSEQ Rapid Spin Sample Preparation Kit (Applied Biosystems, USA). General Sample Preparation Protocol Sample of 750 μl was loaded onto the spin column and microcentrifuged for 3 minutes at maximum speed. Supernatant was discarded and to the pellet was added 50 μl of Lysis Buffer. Samples were incubated for 10 minutes at 95 C. MicroSEQ Salmonella spp. Detection Kit Assay to amplify the polymerase chain reaction (PCR) a unique microorganism specific DNA target sequence and a TaqMan probe to detect the amplified sequence were used. 8-tube strips containing assay beads compatible with StepOne Systems were used. Samples of 30 μl to the lyophilized beads were loaded. MicroAmp 48-Well Base and the MicroAmp Cap Installing Tool to the tubes were used. MicroAmp Fast 48-Well Tray on the sample block of the StepOne System was used. Real-time PCR Thermal cycling conditions were as follows: 2 minutes of incubation at 95 C, followed by 40 cycles of 1 sec. denaturation at 95 C and 20 sec. annealing and elongation at 60 C. Data were collected during each elongation step. PCR products were detected by monitoring the increase in fluorescence of the reporter dye at each PCR cycle. Applied Biosystems software plots the normalized reporter signal, ΔRn, (reporter signal minus background) against the number of amplification cycles and also determines the threshold cycle (Ct) value i.e. the PCR cycle number at which fluorescence increases above a defined threshold level were used. 51

52 Results and Discussion In the investigated samples before incubation we could detect strain of Salmonella spp. in six out of eight samples, as well as internal positive control (IPC), which was positive in all samples as shown in Graph 1. The (Ct) value of positive salmonella samples was from to and IPC (Ct) value was from to In the samples after 16 hours incubation we could detect strain of Salmonella spp. in samples, as well as internal positive control (IPC), which was positive in all samples as shown in Graph 2. The (Ct) value of positive salmonella samples was from to and IPC (Ct) value was from to Graph 1 Process Real Time PCR without incubation Graph 2 Process Real Time PCR after incubation 52

53 Pre-enriched meats had CT values of or more, while post-enriched meats had CT values of to When 1.45 ± 0.21 log10 CFU/mL of S. Typhimurium and 1.65 ± 0.07 log10 CFU/mL of S. Enteritidis were spiked into meats, the multiplex real-time PCR assay detected bacteria in all conditions (beef, pork, pre-enriched, and postenriched) [7]. The multiplex real-time PCR developed in this study was the first to detect all Salmonella spp. possibly related with meats and to differentiate simultaneously S. Typhimurium from S. Enteritidis in meats. Previously, real-time PCR assays had been applied for Salmonella spp. and other food-borne pathogens [6]. Although there has been a fall in the number of human Salmonella infections in Europe over the past number of years [4], foodborne infection from Salmonella continues to pose a great risk to public health. It is widely believed that pathogen reduction in animals, efficient Quality Control Systems (e.g. HACCP principles and GHP) and Quality Assurance (QA) at all stages of the food chain from farm to fork is the most effective way to prevent the spread of infection via food [1]. Possible biological contaminants such as blood and fats present on animal carcasses which can cause PCR inhibition are also diluted. The bacterial cell pellet was washed in PBS prior to DNA isolation to reduce the concentration of enrichment medium which may also cause PCR inhibition [8]. Whereas most of the target genes used for PCR detection of foodborne pathogens encode proteins involved in virulence and were identified as the result of many years of work involving gene/protein structure function studies, the progress in computational genomics has led the way to more efficient and customized mining of genomes for species-specific nucleotide sequences. Several software packages for such data mining have been developed based upon sequence alignment [11]. Conclusion Conventional PCR methods need amplification product separation by gel electrophoresis followed by hybridization with a probe. These time-consuming protocols are now gradually being replaced by more convenient and rapid real-time PCR assays. This will not only prevent many people from becoming infected with Salmonella, it will also benefit food manufacturing companies by extending their product s shelf-life by several days and saving them the cost of warehousing their food products while awaiting pathogen testing results. Acknowledgments: This work was funded by Grant Agency VEGA 1/0372/09, KEGA SPU- 4/2010, APVV-VMSP-P References 1. Boughton, C., Egan, J., Kelly, G., Markey, B., Leonard, N Quantitative examination of Salmonella spp. in the lairage environment of a pig abattoir. Foodborne Pathogens and Disease, 4: Carrique-Mas, J.J., Davies, R.H Sampling and bacteriological detection of Salmonella in poultry and poultry premises: a review. Rev. Sci. Technol. 27: Denny, J., Boelaert, F., Borck, B., Heuer, O.E., Ammon, A., Makela, P Zoonotic infections in Europe: trends and figures-a summary of the EFSA-ECDC annual report. Eur. Surveill. 12:

54 4. Foley, S.L., Lynne, A.M., Nayak, R Salmonella challenges: prevalence in swine and poultry and potential pathogenicity of such isolates. J. Anim. Sci. 86: Hoorfar, J., Wolffs, P., Rådström, P Diagnostic PCR: validation and sample preparation are two sides of the same coin. Acta Pathologica, Microbiologica et Immunologica Scandinavica. 112: Malorny, B., Löfström, C., Wagner, M., Krämer, N., Hoorfar, J Enumeration of Salmonella in food and feed samples by real-time PCR for quantitative microbial risk assessments. Applied and Environmental Microbiology, 74: Mazurek, J., Salehi, E., Propes, D., Holt, J., Bannerman, T., Nicholson, L.M., Bundesen, M., Duffy, R., Moolenaar, R.L A multistate outbreak of Salmonella enterica serotype typhimurium infection linked to raw milk consumption-ohio. J. Food Prot. 67: McGuinness, S., McCabe, E., O'Regan, E., Dolan, A., Duffy, G., Burgess, C., et al Development and validation of a rapid real-time PCR based method for the specific detection of Salmonella on fresh meat. Meat Science, 83: O'Regan, E., McCabe, E., Burgess, C., McGuinness, S., Barry, T., Duffy, G., et al Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples. BMC Microbiology, 8: Warren, B.R., Yuk, H.G., Schneider, K.R Detection of Salmonella by flow-through immunocapture real-time PCR in selected foods within 8 hours. In Journal of Food Protection, 70: Wolffs, P.F., Glencross, K., Norling, B., Griffiths, M.W Simultaneous quantification of pathogenic Campylobacter and Salmonella in chicken rinse fluid by a flotation and real-time multiplex PCR procedure. International Journal of Food Microbiology, 117: Wolffs, P.F., Glencross, K., Thibaudeau, R., Griffiths, M.W Direct quantitation and detection of Salmonellae in biological samples without enrichment, using two-step filtration and real-time PCR. Applied and Environmental Microbiology, 72:

55 TAJEMNICE CZEKOLADY Autor: Hanna Tomala Opiekun: dr inż. Agnieszka Maj Koło Naukowe Inżynierów Żywności Państwowa Wyższa Szkoła Zawodowa w Sulechowie, Instytut Zarządzania i Inżynierii Rolnej ul. Armii Krajowej 51, Sulechów Słowa kluczowe: czekolada, produkcja czekolady, historia czekolady, składniki czekolady Dzieje czekolady Historia czekolady rozpoczęła się 3 tysiące lat temu, gdy obszary lasów tropikalnych na Wybrzeżu Zatoki Meksykańskiej zamieszkiwane były przez jedną z najstarszych cywilizacji - Olmeków. Oni pierwsi zaczęli uprawiać kakaowce, w czym pomagały im sprzyjające warunki klimatyczne, z tym że ich wyrób nie przypominał jeszcze niczym naszej współczesnej czekolady. Po Olmekach kult czekolady przejęli i rozwinęli Majowie, których cywilizacja powstała kilkaset lat po upadku Olmeków. To Majowie zaczęli jako pierwsi obróbkę ziarna kakaowego. Uprawiali oni kakaowce, których owoce poddawali fermentacji, prażyli i mielili, co można już nazwać pierwotnym schematem technologii obróbki ziarna kakaowego. Mieszając zmielone kakao z wodą, mąką kukurydzianą, miodem i chili sporządzali napój zwany xocolatl ( gorzka woda ). Napój ten przeznaczony był tylko dla wybranych, głównie dla królów, arystokracji i najważniejszych uczestników obrzędów religijnych. Czekolada, uważana za przysmak bogów, była otaczana szczególną czcią i pełniła kluczową rolę podczas odprawiania świętych rytuałów. Obyczaj picia gorzkiego napoju był również ważnym punktem uroczystości zaręczynowych, podobnie jak dzisiejsze picie szampana. Również Majowie jako pierwsi zaczęli pić czekoladę z pianką. Dokładne receptury na przyrządzanie i przyprawianie czekolady oraz opisy wszelkich rytuałów z nią związanych Majowie zostawili w swoich tak zwanych Kodeksach - zwojach, manuskryptach zapisanych starożytnym pismem hieroglificznym [1]. Kolejna cywilizacja - Aztekowie przejęli zwyczaj spożywania czekolady od Majów. Oni również cenili ziarna kakaowe, jednak zaczęli coraz bardziej je udostępniać. Już nie tylko królowie i arystokracja mogli wypić ten cudowny napój, ponieważ ziarno kakaowe stało się moneta obiegową. Mimo to picie czekolady było luksusem, rozrzutnością, na którą nie każdy mógł sobie pozwolić. Koszt 100 ziaren równał się dziennemu wynagrodzeniu tragarza lub też cenie jednego niewolnika. Królika zaś można było zakupić za 10 ziarenek kakaowca. W XVI w. kakaowiec był również towarem zamiennym w Meksyku, gdzie wartość 1120 orzechów wynosiła 1 peso meksykańskie [3]. Pierwszym Europejczykiem, który miał zaszczyt skosztować kakaowego napoju był Krzysztof Kolumb. Podczas ostatniej podróży do Nowego Świata żeglarz dotarł do wyspy Guanaja, położonej 50 km od Hondurasu, gdzie Indianie przygotowali mu napar nazywali go cacao. 55

56 Do Europy kakao dotarło najprawdopodobniej dzięki wyprawom konkwistadorów około 1519 r. Hiszpanie przyrządzili napar według nowej receptury: zamiast ostrych przypraw dodali esencję waniliową i cukier. Picie czekolady stało się zwyczajem całej Europy za sprawą Anny Austriaczki, która wprowadziła ten zwyczaj we Francji, a do Włoch czekoladę sprowadził Antonio Carletti, kupiec. John Cadbury, angielski sprzedawca herbaty i kawy, w 1824 roku wyprodukował napój śniadaniowy Cocoa Nibs a w 1866 roku dość potężna już firma Cadbury wyprodukowała pierwszą bombonierkę. Mleczna czekolada natomiast została wymyślona w 1875 roku w Vevey w Szwajcarii przez Daniela Petera [3]. Dyrektywa 2000 z dnia 23 czerwca 2000 roku, definiuje czekoladę jako produkt wytworzony z surowców kakaowych (śruty kakaowej, miazgi kakaowej, kakao w proszku i odtłuszczonego kakao w proszku) oraz sacharozy, z dodatkiem lub bez dodatku tłuszczu kakaowego (masła kakaowego) w ilości nie większej niż 5% i zawierający (z zastrzeżeniem dla czekolady w wiórkach, czekolady orzechowej giandula i kuwertury czekoladowej) dodatek kakao w ilości, co najmniej 35% suchej masy, suchego odtłuszczonego kakao, co najmniej 14% i tłuszczu kakaowego nie mniej niż 18%. Zawartości te oblicza się po odjęciu masy dodatków [2]. Od początku odkrycia ziaren kakaowca zachwycano się niezwykłymi właściwościami czekolady, natomiast obecnie została ona zniesławiona między innymi przez oskarżenie, że podnosi cholesterol, psuje zęby, tuczy i jest niezdrowa. Jednak dzięki różnym ciągle trwającym badaniom naukowców, znów przekonujemy się, że produkty kakaowe mają mnóstwo wspaniałych właściwości. Czekolada powraca do łask konsumentów i smakoszy, nie tylko w formie smakołyków, ale również jako wspaniały odmładzający specyfik stosowany np. w salonach SPA, oraz dodawany do różnych produktów. O czekoladzie mówi się - słodki narkotyk. Dlaczego czekolada uzależnia? Uzależnienie od czekolady można wyjaśnić kilkoma czynnikami związanymi zarówno z jej składem chemicznym, jak i reakcją ludzkiego organizmu na te składniki. Od niedawna wiemy, że w ziarnie kakaowym występują substancje przypominające związki chemiczne obecne w liściach marihuany. Działają one tak jak cząsteczki przenoszące sygnały w komórkach mózgu, a ich przyjmowanie prowadzi do uzależnienia. Są to alkaloidy, do których należą m.in. morfina, kofeina, kokaina, atropina i chinina, oddziałujące na komórki nerwowe. Te same związki chemiczne odkryto też w winie i piwie. Czekolada zawiera wiele składników, z których część może uzależniać, w tym: cukier, teobrominę (wcześniej wspomniany alkaloid), anandamid oraz fenyloetyloaminę (pochodną amfetaminy). Teobromina jest aktywną biologicznie pochodną ksantyny, główną substancją uzależniającą zawartą w czekoladzie. Gorzka czekolada zawiera jej ok. 1%, mleczna od 0,1% do 0,5%. 56

57 Za to, że nie możemy się oprzeć tabliczce czekolady odpowiada także aromat ziaren kakaowca i jej niezwykły smak oraz fakt, że podczas spożywania czekolady w naszym organizmie wytwarza się endorfina, hormon zwany hormonem szczęścia, dzięki któremu odczuwamy wewnętrzne szczęście i poczucie zadowolenia, błogości. Jeśli często spożywamy czekoladę, stężenie tego hormonu we krwi jest większe, nasz organizm przyzwyczaja się do jego obecności. W momencie przerwania jedzenia czekolady organizmowi brakuje endorfiny, do której się już przyzwyczaił i wysyła sygnały objawiające się chęcią zjedzenia czekolady. Kakaowiec Kakao i czekolada produkowane są z kakaowca. Theobroma cacao. Jest to drzewo wiecznie zielone, kwitnące i owocujące cały rok. Jego nazwa pochodzi od greckich słów "theos"- bóg i "broma"-napój, tworzących łącznie frazę: "napój bogów". Drzewo żyje lat, zaczyna owocować dopiero po 12 latach, zaś największe zbiory osiąga się po 25 latach % młodych owoców ginie, ziarna pozyskane z jednej jagody ważą g, natomiast średnia masa ziarna wynosi 1,3 2,3 g. Wewnątrz owocu znajduje się biały miąższ, który ukrywa ok ziaren kakaowca. Najczęściej uprawiane odmiany kakaowca to Criollo - odmiana szlachetna, najrzadsza i najcenniejsza, której jagody mają barwę czerwoną a zbiory stanowią zaledwie 10% światowej produkcji; Trinitario odmiana powstała w wyniku skrzyżowania Criollo i Forestero, której produkcja stanowi 20% światowych zbiorów a ziarna tej odmiany wykorzystywane są m.in. do produkcji słynnych londyńskich czekolad Rococo oraz odmiana Forastero, której uprawa stanowi aż 70% światowej produkcji, jest najwydajniejsza i najodporniejsza z wszystkich odmian [3]. Regiony uprawy kakaowca na świecie to Ameryka Południowa (Ekwador, Brazylia, Kolumbia, Peru, Boliwia), Afryka (Wybrzeże Kości Słoniowej, Ghana, Kamerun, Nigeria), Azja Południowo-Wschodnia (Indonezja, Wietnam, Filipiny, Malezja), Australia i Oceania (Papua-Nowa Gwinea) [5]. Produkcja czekolady Proces powstawania tabliczki czekolady, który rozpoczyna się od przygotowani ziarna kakaowca, można podzielić na 3 główne etapy (rys. 1). 1. Obróbka surowego ziarna: Ziarna kakaowe są to nasiona wydobyte z owoców drzewa kakaowego. Aby nadać właściwe cechy świeżemu ziarnu, poddaje się je jeszcze na plantacjach specjalnym zabiegom, polegającym głównie na fermentacji i suszeniu. Fermentacja ma na celu enzymatyczną przemianę cukrów zawartych w przylegającym do ziarna miąższu, początkowo w alkohol etylowy i dwutlenek węgla. Następnie część alkoholu przechodzi w kwas octowy, który przenika przez całe ziarno. Fermentacja trwa od 3 do 6 dni. Na skutek procesów biochemicznych temperatura ziarna wzrasta do 50ºC. Po fermentacji ziarna poddaje się suszeniu na słońcu lub w specjalnych suszarkach. Dzięki zabiegowi fermentacji i suszenia ziarno kakaowe nabiera brązowego zabarwienia, pachnie kwasem octowym, a na skutek zmniejszania 57

58 zawartości garbników maleje w znacznym stopniu jego naturalny cierpki smak. Wysuszone i przefermentowane ziarno kakaowe jest produktem handlowym, stanowiącym surowiec do produkcji miazgi i tłuszczu kakaowego [6]. 2. Produkcja miazgi kakaowej i tłuszczu kakaowego Ziarno kakaowe przefermentowane i wysuszone oczyszcza się, a następnie poddaje się prażeniu i śrutowaniu. Oddziela się łuskę i zarodki, otrzymując w ten sposób śrutę kakaową, która zostaje zmielona na miazgę kakaową. Część miazgi kakaowej poddaje się tłoczeniu w celu uzyskania tłuszczu kakaowego, zwanego tez masłem kakaowym. Tłuszcz ten ma specyficzne właściwości fizyczne, dzięki którym nadaje czekoladzie odpowiednią konsystencję i powoduje, że roztapia się ona w ustach. Produktem ubocznym procesu tłoczenia tłuszczu jest kuch kakaowy, z którego po zmieleniu otrzymuje się kakao. Rys. 1. Schemat produkcji miazgi i tłuszczu kakaowego [6] 3. Produkcja masy czekoladowej [6] I Rozdrobnienie i połączenie składników Miazga kakaowa i tłuszcz kakaowy stanowią podstawowe surowce do wyrobu masy czekoladowej. Pozostałymi surowcami, bez których czekolada nie mogłaby powstać są cukier i (w mlecznej czekoladzie) mleko w proszku oraz potrzebne emulgatory i aromaty. Wymienione surowce rozdrabnia się i miesza. II Konszowanie Następnie przeprowadza się proces zwany konszowaniem, w czasie, którego zachodzą przemiany chemiczne i fizyczne, decydujące o jakości masy czekoladowej i tak zwanej, rozpływalności gotowego wyrobu. Dobrze wykonany proces konszowania powinien doprowadzić do stanu, w którym każda cząsteczka masy zetknie się z powietrzem, aby wydobyć z niej delikatność i aromat. Podczas tego procesu poprawia się jednorodność składników, zmniejsza ilość garbników, 58

59 wody, niektórych kwasów. Dzięki konszowaniu, rozdrabnianiu i emulgowaniu surowiec staje się mniej lepki a bardziej jedwabisty. III Temperowanie Masa czekoladowa przed formowaniem czekolady poddawana jest procesowi temperowania, czyli obróbce cieplnej. Temperowanie, dostarczając ciepło, powoduje topnienie części tłuszczu, potem następuje ponowna jego krystalizacja. Gdy proces ten zachodzi w gotowej masie czekoladowej, to na jej powierzchni pojawiają się białe plamy tzw. kwiat tłuszczowy. Temperowanie ma zapobiec temu zjawisku. Od właściwego przebiegu zależy odpowiednia konsystencja i stabilność fizyczna wytworzonych produktów. IV Formowanie i pakowanie Po temperowaniu masa czekoladowa mieszana jest z dodatkami (orzechy, bakalie, kawałki karmelu itp.), a następnie rozlewana do form. Po schłodzeniu i skrzepnięciu czekoladę wyciąga się z form i pakuje. W przypadku produkcji czekolady nadziewanej najpierw wytwarza się skorupki z masy czekoladowej odmierzonej w odpowiedniej ilości, a następnie dozuje się nadzienie i zasklepia następną dawką masy czekoladowej. I tak powstała czekolada (rys. 2). Rys. 2. Schemat produkcji masy czekoladowej i czekolady [6] Tłuszcz kakaowy i kakaopodobny Najważniejszym i zarazem najdroższym składnikiem masy czekoladowej jest tłuszcz kakaowy, dlatego w celu obniżenia kosztów produkcji i ceny wyrobów często zastępowany jest tańszymi tłuszczami roślinnymi o zbliżonych właściwościach fizycznych, zwanymi tłuszczami kakaopodobnymi. Produkty sporządzane z użyciem takich tłuszczów noszą nazwę wyrobów czekoladopodobnych oraz wyrobów w polewie kakaowej. Surowce dozwolone do otrzymywania ekwiwalentów masła kakaowego (CBE- cocoa butter equivalents) to: olej palmowy, shea, illipe, sal, tłuszcz z pestek mango (Magnifera indica) oraz cocun gurgi. 59

60 Odmiany czekolady Kolor i smak czekolady zależą od tego, jakiego ziarna użyto do jej produkcji. Biała jest bardziej kaloryczna. Produkuje się ją bez dodatku miazgi kakaowej, która nadaje czekoladzie brązowy kolor. Dlatego wymaga większej ilości masła kakaowego - to właśnie ono stanowi o kaloryczności tego przysmaku. Istnieje wiele odmian czekolady pełnej, mlecznej, gorzkiej, nadziewanej czy białej, ale najkorzystniejsze jest spożywanie czekolady pełnej, twardej, ciemnej oraz gorzkiej. Najlepiej smakuje i najlżej strawna jest zaś gorąca czekolada w płynie, jednak ulubionym smakołykiem na świecie jest czekolada mleczna. Przeciętny konsument potrafi rozróżnić czekoladę mleczną, gorzką, białą i z dodatkami, jednak istnieje o wiele więcej aromatycznych i smakowych odcieni, na przykład czekolada kuchenna, topiona, czy kuwertura [4]. Najlepsi z najlepszych - producenci Aby docenić prawdziwą magię czekolady warto, choć raz spróbować produktów wytwarzanych przez prawdziwych mistrzów - są bardzo drogie, ale warte swojej ceny. Wśród najwyżej ocenianych na świecie wytwórni czekolad wymienić należy belgijskie Godiva i Leonidas, szwajcarskie Chocolats Roth i Lindt&Sprungli, francuską Valrhona, kalifornijską Scharffen Berger oraz brytyjską Cadbury. W Polsce od dość niedawna rozwija się i upowszechnia kultura picia czekolady. Coraz większą popularnością cieszą się pijalnie czekolady, w których można rozkoszować się smakiem filiżanki gorącego, aromatycznego napoju, ale też kupić ręcznie robione pralinki. Literatura 1. Coe S. D., Coe M. D Prawdziwa historia czekolady. PIW, Warszawa 2. Nitecka E Prawo Żywnościowe Unii Europejskiej. Wymagania jakościowe dotyczące wyrobów kakaowych i czekoladowych. Fundacja Programów Pomocy dla Rolnictwa (FAPA), Warszawa 3. Perrier-Robert A Czekolada- Poradnik smakosza. Wyd. Wiedza i Życie, Warszawa 4. Schroer J Smakołyki, które rozpływają się w ustach Czekolada. Warszawski Dom Wydawniczy, Warszawa 5. Dostatni B Na plantacji roślin tropikalnych. WSiP, Warszawa 6. Lisińska G., Leszczyński W Ćwiczenia z technologii przetwórstwa węglowodanów. Wyd. UP, Wrocław The Secrets of chocolates Summary: Chocolate was discovered by the ancient Indians. It was a magical drink, used in religious ceremonies. The ingredients of chocolate don't cause serious addiction and they improve mood. Chocolate production process consists of several stages. Cocoa seeds are used in first of them. There are many kinds of cocoa trees. They grow in warm regions. Many kinds of chocolate are produced all over the world, in many famous and respected chocolate factories. Key words: chocolate, process of chocolate production, history of chocolate, ingredients of chocolate 60

61 WARTOŚĆ ODŻYWCZA I PRZYDATNOŚĆ TECHNOLOGICZNA MLEKA KÓZ UTRZYMYWANYCH W GOSPODARSTWACH EKOLOGICZNYCH I KONWENCJONALNYCH Z REJONU PODKARPACIA Autorzy: mgr inż. Magdalena Szwajkowska Katedra Towaroznawstwa i Przetwórstwa Surowców Zwierzęcych, Uniwersytet Przyrodniczy w Lublinie ul. Akademicka 13, Lublin, Słowa kluczowe: mleko kozie, wartość odżywcza, przydatność technologiczna, gospodarstwa ekologiczne, gospodarstwa konwencjonalne Zarówno w Europie, jak i w Polsce obserwuje się wzrost zainteresowania produkcją i przetwarzaniem mleka koziego. Mleko kozie, poza właściwościami odżywczymi, ma również właściwości terapeutyczne. Unikalne i prozdrowotne właściwości mleka koziego w porównaniu z mlekiem krowim to m.in. niższa alergenność, większa strawność, pojemność buforowa, mniejsza średnica kuleczek tłuszczowych, wyższa zawartość krótkołańcuchowych kwasów tłuszczowych czy też korzystniejsze właściwości immunologiczne oraz antybakteryjne. Pomimo, że mleko kozie ma podobny podstawowy skład chemiczny do krowiego, to jednak wykazuje nieco inne właściwości technologiczne. Jest ono mniej wytrzymałe na obróbkę cieplną, a ze względu na dłuższy czas krzepnięcia, uzyskany skrzep jest słabszy i bardziej podatny na rozrywanie. Zdecydowana większość utrzymywanych w Polsce kóz to zwierzęta bezrasowe, wśród których stosuje się w celu poprawy wydajności i składu chemicznego mleka krzyżowanie z importowanymi rasami mlecznymi, takimi jak rasa saaneńska, alpejska czy anglo-nubijska. Celem pracy była ocena składu chemicznego i przydatności technologicznej mleka kóz utrzymywanych w dwóch typach gospodarstw, tzn. ekologicznych i konwencjonalnych. Badaniami objęto 262 próby mleka pozyskanego w sezonie letnim od kóz (pomiędzy 60 a 150 dniem laktacji) utrzymywanych w dwóch typach gospodarstw, tzn. ekologicznych i konwencjonalnych. W gospodarstwach konwencjonalnych utrzymywano kozy ras uszlachetnionych (białe i barwne), a w ekologicznych mieszańce bezrasowe. Wszystkie zwierzęta wypasane były na pastwisku. Paszę treściwą w gospodarstwach ekologicznych stanowiła śruta zbożowa pochodząca z własnego gospodarstwa, a w konwencjonalnych przemysłowe mieszanki paszowe. Oznaczano: zawartość białka, kazeiny, tłuszczu, laktozy, kwasowość (ph), gęstość, punkt zamarzania, termostabilność i czas enzymatycznego krzepnięcia mleka pod wpływem podpuszczki. Wyniki opracowano statystycznie za pomocą programu StatSoft Inc. STATISTICA ver. 7 z wykorzystaniem testu NIR Fishera. Stwierdzono, że kozy utrzymywane w gospodarstwach konwencjonalnych produkowały istotnie (p 0,01) więcej mleka (o 0,77 kg/dobę) niż kozy z gospodarstw ekologicznych. Mleko kóz bezrasowych z gospodarstw ekologicznych charakteryzowało się jednak zdecydowanie korzystniejszym składem chemicznym i wyższą wytrzymałością na obróbkę termiczną. Zawierało 61

62 ono, bowiem istotnie (p 0,01) więcej tłuszczu (o 0,19%), białka (o 0,45%), w tym kazeiny (o 0,40%), laktozy (o 0,11%) i suchej masy (o 0,88%), miało niższą kwasowość (o 0,20 ph), wyższą termostabilność (o 1:01 min) oraz krótszy czas krzepnięcia enzymatycznego (o 0:37 min) niż mleko kóz uszlachetnianych z gospodarstw konwencjonalnych. System utrzymania nie miał wpływu natomiast gęstość, punkt zamarzania i liczbę komórek somatycznych (LKS) w mleku. Na podstawie uzyskanych wyników można stwierdzić, że kozy bezrasowe utrzymywane w gospodarstwach ekologicznych pomimo niższej wydajności, produkowały mleko o korzystniejszym składzie i lepszych parametrach technologicznych. System utrzymania kóz nie miał wpływu na jakość cytologiczną mleka. 62

63 WARTOŚĆ ODŻYWCZA MIĘSA NAJPOPULARNIEJSZYCH GATUNKÓW RYB SPOŻYWANYCH W POLSCE Autorzy: Piotr Skałecki, Piotr Domaradzki, Tomasz Grodzicki Uniwersytet Przyrodniczy w Lublinie, Katedra Towaroznawstwa i Przetwórstwa Surowców Zwierzęcych, ul. Akademicka 13, Lublin Słowa kluczowe: ryby, mięso, kwasy tłuszczowe, wartość odżywcza Wstęp O wartości odżywczej mięsa ryb decyduje zawarty w nim tłuszcz, białko, węglowodany, składniki mineralne i witaminy. Mięso ryb składa się głównie z wody, której procentowy udział jest o wiele większy niż w mięsie zwierząt rzeźnych, bo od 57 do 83%. Głównymi zaś składnikami suchej masy są: białko (12-24%), tłuszcz (0,13-27,5%), niebiałkowe związki azotowe, lipidy oraz substancje mineralne [5,7,7]. Na skład chemiczny mięsa ryb wpływa wiele czynników, do najważniejszych należą pochodzenie i gatunek ryby. W ostatnim czasie wzrosło spożycie ryb słodkowodnych na rzecz importowanej z Azji pangi. Pod tą nazwą handlową występują na rynku ryby z gatunku Pangasius spp. [3,6]. Celem podjętych badań było porównanie wartości odżywczej mięsa rodzimych gatunków ryb z mięsem importowanej z Wietnamu ryby pangi. Materiał i metody Badaniami objęto dwa najpopularniejsze gatunki ryb spożywane w kraju tzn. karpia (n=10) i dorsza (n=10). Ocena wartości odżywczej mięsa ryb obejmowała określenie podstawowego składu chemicznego i profilu kwasów tłuszczowych. Uzyskane wyniki badań własnych porównano dodatkowo z danymi literaturowymi dotyczącymi wartości odżywczej mięsa pangi. W pobranych próbkach mięsa oznaczono metodami konwencjonalnymi podstawowy skład chemiczny tj. zawartość suchej masy metodą suszenia, popiołu metodą spalania, białka ogólnego metodą Kjeldahla przy użyciu aparatu Büchi B-324 i tłuszczu metodą Soxhleta przy użyciu aparatu Büchi B-811. Procentowy udział kwasów tłuszczowych oznaczano za pomocą chromatografu gazowego Varian CG 3900 z detektorem płomieniowo-jonizującym (FID) wykorzystując program Star GC Workstation, ver Rozdział przeprowadzono na kolumnie kapilarnej CP-Sil 88 o długości 50 m i średnicy wewnętrznej 0,25 mm. Analizę zawartości kwasów tłuszczowych przeprowadzono po uprzedniej ekstrakcji tłuszczu wg metodyki podanej przez Follch a i wsp. [4]. Dalsze postępowanie prowadzono w oparciu o normy: [PN-EN ISO 5509:2001. Oleje i tłuszcze zwierzęce. Przygotowanie 63

64 estrów metylowych kwasów tłuszczowych] oraz [PN-EN ISO 5508:1996. Oleje i tłuszcze roślinne oraz zwierzęce]. Analizę statystyczną wykonano za pomocą jednoczynnikowej analizy wariancji wykorzystując program StatSoft STATISTICA ver Istotność różnic pomiędzy średnimi w poszczególnych grupach zweryfikowano testem Tukey a. Wyniki Wykazano istotne różnice w udziale podstawowych składników chemicznych w mięsie ocenianych gatunków ryb. W mięsie karpi stwierdzono istotnie niższą zawartość wody (o 1,97%) i białka (o 0,82%) oraz jednocześnie wyższą zawartość tłuszczu (o 3,33%) w porównaniu do mięsa dorsza (tab. 1). Tab. 1. Skład chemiczny [w %] i udział kwasów tłuszczowych (% sumy kwasów tłuszczowych) mięsa najpopularniejszych trzech gatunków ryb spożywanych w Polsce. Wyszczególnienie Karp Dorsz Panga - dane źródłowe x SD x SD [2,9] Woda 78,48 A 2,0 80,45 B 0,75 82,8 Białko 16,84 0,88 17,66 1,23 14,6 Tłuszcz 4,28 B 1,55 0,95 A 0,26 1,3 Popiół 1,24 0,13 1,39 0,45 1,2 C12:0 0,14 0,08 0,17 0,12 - C14:0 2,49 1,19 2,98 0,94 2,85 C14:1 0,23 0,12 0,47 0,43 - C15:0 0,51 0,12 0,51 0,12 - C16:0 23,91 a 3,19 27,49 b 3,23 29,21 C16:1 9,03 0,91 7,37 3,19 - C17:0 0,45 0,41 0,55 0,22 - C17:1 0,42 0,37 0,40 0,13 - C18:0 9,17 B 0,80 6,58 A 2,48 10,20 C18:1 46,35 B 7,09 29,59 A 5,01 43,36 C18:2 1,68 a 1,20 2,77 b 0,68 9,86 C18:3 0,32 A 0,35 1,06 B 0,34 0,84 C20:1 0,68 A 0,27 1,15 B 0,33 0,36 C18:4 0,68 b 0,51 0,32 a 0,12 - C20:4 0,22 A 0,17 1,56 B 0,60 - C20:5 0,09 A 0,04 4,83 B 1,96 0,28 C22:5 1,65 B 0,94 0,15 A 0,10 - C22:6 0,18 A 0,13 13,73 B 5,52 - SFA 40,23 b 5,02 34,73 a 4,82 42,26 MUFA 56,95 B 5,36 38,74 A 8,14 43,72 PUFA 2,47 A 0,95 24,87 B 7,90 13,30 UFA 59,42 4,65 63,61 5,28 57,02 a,b średnie oznaczone różnymi literami w wierszach różnią się istotnie przy p 0,05 A,B średnie oznaczone różnymi literami w wierszach różnią się istotnie przy p 0,01 64

65 Uzyskane w badaniach własnych wyniki dotyczące podstawowego składu chemicznego mięsa nie odbiegają od wartości podawanych przez innych autorów. Usydus i wsp. [9] analizując skład chemiczny mięsa najpopularniejszych na polskim rynku ryb dla karpia i dorsza uzyskali odpowiednio: w przypadku wody 77,7% i 81,5%, białka 16,7% i 17,4%, tłuszczu 5,1% i 0,08% oraz popiołu 0,6% i 1,1%. Porównując skład chemiczny mięsa karpia i dorsza z danymi literaturowymi dla pangi, wykazano wyższy udział wody, a jednocześnie niższy popiołu i zdecydowanie niższy udział białka w mięsie pang (tab. 1). W mięsie karpi w porównaniu do mięsa dorszy wykazano istotnie (P<0,01) wyższy poziom nasyconych kwasów tłuszczowych - SFA (o 5,5 %), jak również większą zawartość kwasów jednonienasyconych - MUFA (o 18,21%). Mięso dorsza zawierało natomiast dziesięciokrotnie więcej kwasów wielonienasyconych PUFA (tab. 1). Podawany przez innych autorów profil kwasów tłuszczowych mięsa pangi [2,9], wskazuje na wyższą zawartość u tego gatunku kwasów nasyconych i niższą kwasów nienasyconych w porównaniu z mięsem obu gatunków krajowych. Pewne natomiast zróżnicowanie pomiędzy ocenianymi gatunkami ryb, zaobserwowano dla grupy kwasów jedno- i wielonienasyconych. Najwięcej kwasów MUFA zawierało mięso karpia (blisko 57%), mniej pangi (43,7%), a najmniej dorsza (38,7%). Odwrotną tendencję stwierdzono dla kwasów wielonienasyconych, których największy udział odnotowano w mięsie dorsza (24,9%), blisko o połowę niższy w mięsie pangi (13,3%), a u karpi udział ten wynosił tylko 2,5% (tab. 1). Zbliżone wyniki odnośnie profilu kwasów tłuszczowych uzyskali Bienkiewicz i wsp. [1], którzy analizując tkankę mięśniową dwudziestu dwóch ryb słodkowodnych stwierdzili najwyższą procentową zawartość SFA (42,99%) w mięsie pangi. Mięso karpia charakteryzowało się największym udziałem kwasów tłuszczowych jednonienasyconych - MUFA (68,62%). Natomiast dominujący udział PUFA stwierdzili w mięsie ryby typowo drapieżnych, tj. w okoniach (48,51%) i sandaczach (38,5%). Z kolei Usydus i wsp. [9] w przypadku mięsa analizowanych dwóch rodzimych gatunków ryb oznaczyli odmienny od uzyskanego w badaniach własnych profil kwasów tłuszczowych. Niemniej jednak mięso karpia charakteryzował się największym udziałem kwasów tłuszczowych jednonienasyconych (MUFA) - 51,2%, natomiast w mięsie dorsza stwierdzili, że dominującym był udział PUFA - 67,4%. Na uwagę zasługuje jednak bardzo niski poziom tłuszczu (poniżej 0,1%), oznaczony przez cytowanych autorów, w mięsie dorsza. Wnioski 1. Mięso karpi w porównaniu z mięsem dorszy i pang charakteryzowało się niższą zawartością wody, lecz wyższą tłuszczu. 2. Z żywieniowego punktu widzenia najwyższą wartością, spośród porównywanych gatunków ryb, charakteryzowało się mięso dorszy, ze względu na wysoką zawartość białka oraz wysoki 65

66 procentowy udział PUFA (w tym kwasów szczególnie cennych i istotnych tj. EPA - 20:5 i DHA- 22:6). 3. Należy stwierdzić, że wartość odżywcza ryb powinna być głównym kryterium wyboru uwzględnianym przy ich zakupie przez konsumentów. Literatura 1. Bienkiewicz G., Domiszewski Z., Kuszyński T Ryby słodkowodne jako źródło niezbędnych nienasyconych kwasów tłuszczowych NNKT. Mag. Przem. Ryb., 3(63): Bienkiewicz G., Domiszewski Z Zawartość długołańcuchowych nienasyconych kwasów tłuszczowych omega 3 (LC n-3-pufa) w wybranych gatunkach ryb. Mag. Przem. Ryb. 2(62): Cieśla M Czy jedząc ryby zawsze stajemy się zdrowsi?. Prz. Hod., 11: Follch J.M., Less M., Sloane-Stanley G.H A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem., 226: Gurgul E., Kielesińska A Technologia i organizacja przemysłu spożywczego. Częstochowa 6. Hryszko K Sektor rybny w Polsce tendencje rozwojowe. Przem. Spoż., 9: Kołakowska A., Kołakowski E Szczególne właściwości żywieniowe ryb. Przem. Spoż., 6: Pijanowski E., Dłużewski M Ogólna technologia żywności. Wydaw. Nauk.-Tech., Warszawa. 9. Polak-Juszczak L., Usydus Z Nowe na polskim rynku gatunki ryb - ocena chemiczna. Wiad. Ryb., 5-6(151): Usydus Z., Szlinder-Richert J., Adamczyk M., Szatkowska U Marine and farmed fish in the Polish market: Comparison of the nutritional value. Food Chem., 126: Nutritional value of meat from most popular fish species consumed in Poland Summary The aim of the undertaken research was to compare nutritional value of meat from native fish species with meat from Panga fish, imported from Vietnam. The research was performed on two popular fish consumed in our country, i.e. carp (n=10) and cod (n=10). Assessment of nutritional value of fish meat consisted of investigating the basic chemical composition and fatty acid profile. Obtained results were additionally compared with the literature data concerning nutritional value of panga meat. It was stated that carp meat compared with meat from cods and panga was characterized by lower content of water, while the content of fat was higher. From a nutritional point of view, meat from cods had the highest value among the compared fish species, due to its high content of protein and high percentage of PUFA (including especially valuable and considerable acids such as EPA 20:5 and DHA 22:6). It should be emphasized that consumers while purchasing fish should consider their nutritional value. Key words: fish, meat, fatty acids, nutritional value 66

67 WPŁYW PRZECHOWYWANIA NA JAKOŚĆ MIODÓW PODKARPACKICH Autorzy: Dominika Słotwińska Opiekun: dr inż. Małgorzata Dżugan SKN Technologów Żywności Ferment, Sekcja Toksykologii żywności Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy Ul. Ćwiklińskiej 2, Rzeszów Słowa kluczowe: miód, odmiany, cechy organoleptyczne, zawartość wody, kwasowość Wstęp Miód naturalny jest produktem wytwarzanym przez pszczoły z nektaru kwiatowego lub spadzi. Nektar, wydzielany przez specjalne narządy rośliny tj. nektarniki, jest zagęszczonym sokiem, którego głównymi składnikami są m.in. woda i cukry (ok. 20%): glukoza, fruktoza i sacharoza, śladowe ilości białek i aminokwasów, kwasy organiczne, witaminy, związki aromatyczne i barwniki. Zawartość cukrów oraz ilość nektaru wydzielanego przez roślinę zależy od wielu czynników: pory dnia, nasłonecznienia, temperatury, wilgotności powietrza itp. Drugi rodzaj pożytku pszczelego stanowi spadź. Jest to wydalina żerujących na roślinach owadów głównie mszyc i czerwców, pozbawiona białka, które zostało pobrane przez owady. Spadź zawiera cukry w ilości do 50%. Skład cukrowców jest zbliżony do nektaru, występuje jednak charakterystyczny trójcukier - melecytoza powstający w organizmie mszyc [1]. Podstawowa klasyfikacja miodów dotyczy surowca, z którego został wytworzony: nektarowy(n), spadziowy(s) i nektarowo-spadziowy(ns). Wyróżnia się też odmiany miodu w oparciu o typ pożytku, m.in.: rzepakowy(nr), akacjowy(na), lipowy(nl), gryczany(ng), wrzosowy(nw), wielokwiatowy(nk), nektarowo-spadziowy(ns), ze spadzi drzew liściastych(sl), ze spadzi drzew iglastych(si) [2]. Przetworzenie pożytków pszczelich w miód polega na odparowaniu wody do zawartości ok. 18% oraz obejmuje szereg procesów biochemicznych, głównie sacharoza jest rozkładana do glukozy i fruktozy pod wpływem β-fruktofuranozydazy. Podczas dojrzewania wzrasta kwasowość. Procesy enzymatyczne są katalizowane przez enzymy pochodzące z organizmu pszczoły i nektaru lub spadzi. Podczas przechowywania miodu następuje zestalenie patoki (ciekła postać). W trakcie tego procesu glukoza krystalizuje szybciej niż fruktoza, która pozostaje w otaczającym syropie (tzw. krupiec) [1]. Przebieg i szybkość krystalizacji zależy głównie od temperatury, typu miodów oraz zawartości wody. Miody nektarowe zazwyczaj krystalizują szybciej niż miody spadziowe. Miód to wodny roztwór różnych substancji organicznych i nieorganicznych. W dojrzałych miodach zawartość wody nie powinna przekraczać 20% (wyjątek miód wrzosowy, do 23%) [2]. Głównym składnikiem miodu są cukrowce, z których glukoza i fruktoza stanowią 70-80% a zawartość 67

68 sacharozy wynosi do 5%. W miodzie występują specyficzne oligosacharydy, m.in. trehaloza, melecytoza, teanderoza [1]. Proporcje omówionych cukrów w miodzie nie są jednakowe ani stałe. Miód, który jest głównie produktem cukrowym, zawiera śladowe ilości białek wynoszącą 0,05-1,6% [1], jest źródłem wolnych aminokwasów tj. kwas glutaminowy, kwas asparaginowy, metionina, glicyna, cystyna, walina. Aktywność antydrobnoustrojowa jest prawdopodobnie najszerzej badaną, biologiczną aktywnością miodu. Składa się na nią szereg czynników, zarówno fizykochemicznych, biologicznych oraz chemicznych, które wspólnie skutecznie hamują rozwój wielu patogennych mikroorganizmów [1]. Do czynników fizycznych zalicza się wysokie ciśnienie osmotyczne (duża zawartość cukrów) oraz niskie ph (obecność kwasów organicznych). Najwięcej w miodzie jest kwasu glukonowego, ale występuje również: jabłkowy, mlekowy, cytrynowy, winowy, szczawiowy, bursztynowy, malonowy. Miód wykazuje ph w granicach 3,3-4,9 [1]. Czynnikami biologicznymi są substancje, nazywane wspólnie inhibinami, są to m.in. oksydaza glukozy, katalaza, lizozym i apidycyna. Czynnikami chemicznymi są substancje pochodzące z nektaru i spadzi, a są to: terpeny, garbniki katechinowe, flawonoidy i kwasy organiczne. W miodzie znajdują się substancje przeciwutleniające, takie jak α- tokoferol, kwas askorbinowy, flawonoidy i inne fenole [3,4]. W miodzie występują śladowe ilości witamin A,B2, C, B6, PP. Na małą ilość witaminy C wpływa działanie enzymu oksydazy kwasu askorbinowego, który utlenia kwas askorbinowy [1]. Właściwości przeciwutleniające miodu wraz z jego antybiotycznym oraz regeneracyjnym w stosunku do tkanek działaniem, wykorzystywane są w leczeniu wielu ran i schorzeń w dzisiejszej medycynie, podobnie jak to miało miejsce tysiące lat temu. Materiał i metody Materiał badawczy stanowiły miody: gryczane (5), rzepakowe (2), nawłociowy (1), wrzosowe (2) oraz ze spadzi iglastej (2). Miody pochodziły od jednego producenta, z pasieki znajdującej się w województwie podkarpackim. Próbki do wykonania analiz przechowywano w temperaturze pokojowej w zaciemnionym miejscu. Badane miody pochodziły ze zbiorów z 5 kolejnych lat, przed pomiarem były przechowywane w warunkach standardowych. Miody poddano badaniom organoleptycznym obejmującym ocenę: barwy przez obserwację przeprowadza się przy świetle dziennym, oglądając pod światło próbkę miodu ogrzanego w temp C w probówce z bezbarwnego szkła, konsystencji - przez obserwację ściekania miodu z metalowego lub drewnianego mieszadła, a w przypadku miodu skrystalizowanego-ocenia się wygląd kryształków w rozmazie miodu na szkiełku przedmiotowym, smaku- przez degustację płynnego miodu o temperaturze pokojowej, zapachu przez wąchanie miodu lekko podgrzanego i roztartego na szkiełku przedmiotowym. 68

69 Zawartość wody w miodzie oznaczono metodą refraktometryczną wg PN-88/A [5]. Próbkę 5 g dobrze wymieszanego miodu, odważonego z dokładnością do 0,001 g w probówce, doprowadzano do stanu płynnego przez podgrzewanie w łaźni wodnej w temperaturze C. Badany miód umieszczano pomiędzy pryzmatami refraktometru i dokonywano pomiaru w temp. 20 C, odczytując wartość współczynnika załamania światła (refrakcji) z dokładnością do czwartego miejsca po przecinku oraz zawartość ekstraktu. Zawartość wody w procentach wagowych, odpowiadającą oznaczonemu współczynnikowi refrakcji, odczytywano z odpowiedniej tablicy. Oznaczenie wykonywano dwukrotnie, wynik obliczano jako średnią arytmetyczną dla dwóch równoległych oznaczeń nieróżniących się więcej niż o 0,2 %. Kwasowość miodu, określającą zawartość wszystkich wolnych kwasów, oznaczano metodą miareczkowania alkacymetrycznego za pomocą roztworu wodorotlenku sodu o stężeniu 0,1 M, z potencjometrycznym wyznaczeniem punktu końcowego (ph 8,30), wyznaczonego przy użyciu pehametru. Oznaczenie powtarzano dwukrotnie. Wyniki wyrażano w stopniach kwasowości (1 stopień odpowiada 1 ml 0,1 M NaOH zużytego do zmiareczkowania roztworu przygotowanego z 10g miodu i 25 ml wody destylowanej). Odczyn miodów (kwasowość czynna) ustalano w oparciu o pomiar ph 10% w/v roztworu miodu. Wyniki Badane miody wykazywały zróżnicowanie cech sensorycznych, związane z odmianą miodu (tab. 1). Wśród badanych miodów większą zdolność do krystalizacji w miarę przechowywania wykazywały miody ciemne (gryczany, spadziowy) niż jasne (rzepakowy). Dla miodu wrzosowego obserwowano, charakterystyczne dla tej odmiany, przechodzenie w stan żelu. Najniższą zawartość wody stwierdzono dla miodów spadziowych, średnio 17,55 %wag., najwyższą dla miodów gryczanych, średnio 19,88 % wag. Zawartość ekstraktu kształtowała się na poziomie 76,5-81,6 i spełniała wymagania normy [5]. Wody w miodzie powinno być 16-20% z wyjątkiem miodu wrzosowego do 23% [6]. Gdy jest jej więcej uważa się miód za niedojrzały, czyli mniej wartościowy. Podczas przechowywania miodu w otwartych naczyniach może następować podwyższenie lub obniżenie zawartości wody zależnie od wilgotności względnej otaczającego powietrza. Ilość wody w miodzie odebranym z ula jest zależna od wielu czynników, m.in. od warunków atmosferycznych w czasie kwitnienia roślin i zbierania nektarów, dojrzewania miodu itp.[1]. Badane miody spełniają wymagania normy, z wyjątkiem miodu gryczanego z 2008 oraz 2009 roku i rzepakowego z 2010 roku, które charakteryzowały się najwyższą zawartością wody. Może to być związane ze zbyt wczesnym pobraniem miodu, przed zakończeniem procesu dojrzewania w plastrze[1]. 69

70 Nawło -ciowy SPADŹ IGLASTA RZEPAKOWY WRZOSOWY GRYCZANY Tabela 1. Charakterystyka cech sensorycznych miodu oraz oznaczanie zawartości wody metodą refraktometryczną TYP Barwa Konsystencja Zapach Smak Zawartość wody [%] Ekstrakt [%] 2006 brązowa ciecz gęsta, silny, słodki, 18,3 80,2 gruboziarnista zapachu ostry kwiatów gryki 2007 brunatna ciecz gęsta łagodny słodki 18,9 79, brązowa ciecz gęsta, gruboziarnista, płynna warstwa na powierzchni Silny 2009 brązowa ciecz gęsta silny, zbliżony do zapachu kwiatów gryki 2010 brunatna ciecz gęsta, Silny gruboziarnista 2009 brązowa średnioziarnista silny, zbliżony do zapachu kwiatów wrzosu 2010 brunatna ciecz gęsta, galaretowata silny, zbliżony do zapachu kwiatów wrzosu 2007 kremowa ciecz gęsta mało intensywny słodki, ostry słodki, ostry słodki, ostry mało słodki mało słodki, ostry 22,1 76,5 20,8 77,8 19,3 79,3 19,9 78,7 17,7 80,8 słodki 19 79, słomkowa ciecz gęsta zbliżony do zapachu kwiatów rzepaku 2007 brązowa z odcieniem zielonkawym średnioziarnisty, kryształy tworzą zlepy lekko żywiczny 2009 ciemnobrunatna ciecz gęsta lekko żywiczny 2010 słomkowa Ciecz gęsta Silny mało słodki 20,6 78 łagodny, lekko żywiczny łagodny, lekko żywiczny słodki 16,6 81,9 18, ,2 79,4 Odczyn badanych miodów kształtował się na poziomie 3,2-3,7, przy czym najniższe ph wykazywały miody gryczane i nawłociowy, najwyższe- miody wrzosowe (Rys. 1). Próbki miodów 70

71 pochodzące z różnych zbiorów różniły się nieznacznie kwasowością ogólną i czynną. Długość okresu przechowywania miodów nie miała istotnego wpływu na ph miodu. Niskie ph badanych miodów wskazuje na wysoki stopień zdysocjowania występujących kwasów. Wyjątek stanowią miody gryczane, wykazujące najwyższą kwasowość miareczkową, związaną z wysoką zawartością substancji o charakterze słabych kwasów. Również ten parametr nie ulegał znaczącym zmianom podczas przechowywania i raczej był uzależniony od warunków, w jakich został wytworzony np. przy dokarmianiu pszczół cukrem. Rozpiętość wskaźników kwasowości oraz ph zależy od rodzaju surowca wyjściowego, od daty zbioru, stopnia dojrzałości i typu pszczoły [1]. Wraz z dojrzewaniem miodu wzrasta jego kwasowość [6]. Nadmierną kwasowością wykazują miody sfermentowane, co jest najczęściej wynikiem rozwoju na ich powierzchni różnych drobnoustrojów. Niższą kwasowością ogólną odznaczają się na ogół jasne miody wiosenne w przeciwieństwie do późniejszych miodów ciemnych [1,3]. Wnioski 1. Badane miody wykazywały cechy organoleptyczne charakterystyczne dla danej odmiany i spełniały wymagania normy PN-88/A Spośród badanych miodów największą zawartość mocnych kwasów wykazywał miód ze spadzi iglastej, a substancji o charakterze słabych kwasów stwierdzono najwięcej w miodzie gryczanym. 3. Okres przechowywania miodu nie wpływał w sposób istotny na poziom badanych parametrów tj. zawartość wody i ekstraktu, kwasowość czynna i miareczkowa, są one raczej wynikiem odmiany i dojrzałości miodu, warunków wytworzenia i zbioru surowca. GRYCZANY WRZOSOWY ,5 3 2,5 2 1,5 1 0, ph Kwasowość ph Kwasowość 71

72 SPADŹ IGLASTA RZEPAKOWY I NAWŁOCIOWY NAWŁOĆ 2010 ph Kwasowość ph kwasowość Rys. 1. Kwasowość miareczkowa i ph badanych miodów Literatura 1. Hołderna-Kędzia E., Kędzia B Miód i właściwości biologiczne. PW Rzeczpospolita. 2. Lempka A.[pod.red] Towaroznawstwo: produkty spożywcze Państ. Wydaw. Ekonomiczne. Warszawa, Majewska E., Trzanek J., Właściwości przeciwutleniające miodów wielokwiatowych i innych produktów pszczelich. Bromat. Chem. Toksykol.- XLII, 4, Wojtacki M Produkty pszczele i przetwory miodowe. Państwowe Wydawnictwo Rolnicze i Leśne. Warszawa 5. PN-88/A Miód pszczeli. 6. Majewska E., Kowalska J., Jeżewska A., Charakterystyka jakości miodów wielokwiatowych z różnych regionów Polski. Bromat. Chem. Toksykol. XLIII, 3, Effect of storage on the quality of honeys from Podkarpacie Summary The purpose of the study was to compare the organoleptic Characteristics and some chemical parameters in different varieties of honey produced in the Podkarpackie in Significant differences were found related to the variety of honey, but no against the time of storage. Key words: honey, variety, organoleptic characteristics, water content, acidity 72

73 ZWIĄZEK WARIANTÓW GENETYCZNYCH Κ-KAZEINY ZE WSKAŹNIKAMI PRZYDATNOŚCI TECHNOLOGICZNEJ MLEKA KRÓW RASY SIMENTAL Autor: mgr Anna Wolanciuk Katedra Towaroznawstwa i Przetwórstwa Surowców Zwierzęcych Uniwersytet Przyrodniczy, Wydział Biologii i Hodowli Zwierząt ul. Akademicka 13, Lublin Słowa kluczowe: kazeina, przydatność technologiczna, simental Wstęp O przydatności mleka do przetwórstwa decyduje jego jakość higieniczna, skład chemiczny i wskaźniki przydatności technologicznej. Pożądany jest surowiec o najwyższej jakości higienicznej i parametrach technologicznych warunkujących wysoką jakość wytwarzanych produktów. Do produkcji mleka spożywczego pasteryzowanego i UHT oraz koncentratów mlecznych wymagany jest surowiec wytrzymały na działanie wysokich temperatur. Z kolei do produkcji serów pożądany jest surowiec o wysokiej zawartości białka, w tym kazeiny i szybko koagulujący pod wpływem podpuszczki (1). Bardzo ważna jest dla serowarów również zwięzłość skrzepu (10). Mleko krowie zawiera cztery rodzaje kazein: αs 1 -kazeinę, (38% całkowitej ilości kazein), αs 2 -kazeinę (10%), β-kazeinę (36%) i κ- kazeinę (15%), których synteza uwarunkowana jest obecnością wariantów genetycznych tych białek (7). Warianty te mogą dodatkowo mieć związek z cechami użytkowości i parametrami określającymi jakość mleka, jednak jako markery cech ilościowych jednoznacznie uważane są formy polimorficzne kappa-kazeiny (3, 9). Gen κ-kazeiny (CASK) zaliczany jest do genów głównych o szczególnym znaczeniu dla wyników ekonomicznych hodowli bydła i jest szczególnie ważny z punktu widzenia technologii przetwórstwa mleka. Procesy, którym ulega κ-kazeina podczas obróbki mleka, są podstawą tworzenia się żelu i krzepnięcia mleka. Dowiedziono, że polimorfizm w obrębie genu CASK wpływa na przebieg procesów technologicznych w serowarstwie (4). Celem badań było ustalenie ewentualnych związków wariantów genetycznych κ-kazeiny z wybranymi wskaźnikami przydatności technologicznej mleka krów rasy simental. Materiał i metody Badaniami objęto 52 krowy rasy simental. Genotypy κ-kazeiny oznaczono metodą PCR-RFLP wg Medrano i Aquilar-Cordova (8). Od każdej krowy jednorazowo pobrano krew do probówek próżniowych zawierających jako antykoagulant K 3 EDTA. DNA zostało wyizolowane przy wykorzystaniu zestawu QIAamp DNA Blood Mini Kit firmy QIAGEN. Mieszanina reakcyjna na 25 μl obejmowała: 50 ng matrycy DNA, 1U termostabilnej polimerazy Taq (Fermentas), 2,5 pmol każdej 73

74 z sekwencji starterowych, 200 μm każdego z dntp, 2,5 mm jonów magnezu (MgCl 2 ), 1xPCR bufor oraz wodę dejonizowaną, wolną od nukleaz (Fermentas). Użyto następujących starterów: 5`ATCATTTATGGCCATTCCACCAAAG3`; 5 GCCCATTTCGCCTTCTCTGTAACAGA3`. Reakcje wykonano w termocyklerze TProfesional firmy Biometra w następujących warunkach: predenaturacja przez 3 min w 95 C a następnie 30 cykli- 94 C 30 s, 58 C- 30 s, 72 C- 30 s, 72 C- 10 min. Uzyskany produkt PCR wielkości 350 pz w ilości 10 μl trawiono enzymem restrykcyjnym Hinf I i rozdzielano w 3,5% żelu agarozowym barwionym bromkiem etydyny. Dodatkowo od każdej krowy będącej pomiędzy 120 a 200 dniem laktacji pobrano próbkę mleka pozyskanego z całego udoju. W każdej próbce mleka oznaczono: skład chemiczny, tj. zawartość tłuszczu, białka i laktozy (aparatem Infrared Milk Analyzer); procentowy udział kazeiny (2), kwasowość czynną (ph), kwasowość potencjalną ( o SH) (metodą miareczkową), stabilność cieplną w temp. 140 o C w łaźni olejowej firmy TEWES-BIS metodą Whitea i Daviesa (6) oraz czas krzepnięcia mleka pod wpływem podpuszczki metodą Scherna (5). Wyniki opracowano statystycznie za pomocą programu StatSoft Inc. STATISTICA ver. 6. Istotność różnic pomiędzy średnimi wartościami dla ocenianych grup wyznaczono testem NIR Fishera. Wyniki U ocenianej populacji krów stwierdzono występowanie trzech genotypów: AA, AB i BB, uwarunkowanych dwoma allelami κ-cn A i κ-cn B. Heterozygoty stanowiły 46,15% populacji, homozygoty AA 30,77%, a BB 23,08%. Frekwencja genu A wynosiła 0,54 i była nieznacznie wyższa w porównaniu z częstotliwością występowania genu B (0,46). Analizując związek wariantów genetycznych ze składem chemicznym i parametrami technologicznymi mleka stwierdzono, że najkorzystniejsze pod tym względem było mleko pozyskane od krów z genotypem BB κ-cn. Charakteryzowało się ono najwyższą (p 0,05) zawartością białka (3,72%), w tym kazeiny i najkrótszym (p 0,05) czasem krzepnięcia pod wpływem podpuszczki (201,67s). W przypadku wariantu AA κ-kazeiny mleko miało najniższą (p 0,05) zawartość białka (3,25%), suchej masy (12,13%) oraz wykazywało istotnie najdłuższy (p 0,05) czas krzepnięcia pod wpływem podpuszczki (415,94s). Wnioski Mleko krów rasy simentalskiej jest dobrym surowcem do produkcji serów ze względu na wysoką zawartość białka, w tym kazeiny i korzystny stosunek białkowo-tłuszczowy. Wykazano, że mleko krów z wariantem genetycznym B κ-kazeiny charakteryzowało się najkorzystniejszymi parametrami technologicznymi do produkcji serów. 74

75 Tab 1. Związek wariantów genetycznych κ-kazeiny z wybranymi wskaźnikami przydatności technologicznej mleka ocenianych krów Genotyp Cecha AA AB BB n=16 n=24 n=12 Białko ogólne (%) Kazeina (%) Tłuszcz (%) x 3,25 a 3,59 b 3,72 b SD 0,15 0,25 0,42 x 2,59 2,63 2,69 SD 0,27 0,33 0,18 x 3,81 4,32 4,34 SD 0,44 0,75 1,02 B/T * x 0,86 0,91 0,92 SD 0,10 0,12 0,21 Sucha masa (%) Czas krzepnięcia (s) Termostabilność (s) ph x 12,13 a 13,32 b 13,20 b SD 0,70 1,38 0,96 x 415,94 b 387,38 b 201,67 a SD 254,42 240,24 51,54 x 249,67 231,67 225,75 SD 123,27 117,10 61,02 x 6,72 6,71 6,74 SD 0,07 0,08 0,03 o SH x 7,02 6,72 6,67 SD 0,75 0,68 0,61 * - stosunek białkowo-tłuszczowy; a, b różnice istotne przy P 0,05; 75

76 Literatura 1. Barłowska J Wartość odżywcza i przydatność technologiczna mleka krów 7 ras użytkowanych w Polsce. Rozprawy Naukowe AR Lublin, Budsławski J Badanie mleka i jego przetworów. Wyd. PWRiL, Warszawa. 3. Farrell H.M., Jimenez-Flores R., Bleck G.T., Brown E.M., Butler J.E., Creamer L.K Nomenclature of the proteins of cows milk sixth revision. J of Dairy Sci., 87: Feleńczak A., Gil Z., Ormian M Kappa-kazeina jako wskaźnik przydatności technologicznej mleka. Rocz. Nauk. Zoot., Supl.,.8: Jurczak M. E Mleko. Produkcja, badania, przerób. Wydawnictwo SGGW, Warszawa, Kruk A., Kisza J., Palich P Porównanie i ocena metod określania stabilności termicznej mleka. Zesz. Nauk. ART. Olsztyn, Tech. Żywn., 15: Litwińczuk A., Litwińczuk Z., Barłowska J., Florek M Surowce zwierzęce ocena i wykorzystanie. PWRiL, Warszawa. 8. Medrano, J.F., Aquilar-Cordova E Genotyping of bovine kappa-casein loci following DNA sequence amplification. Bio/Technology, 8: Värv S., Belousova A., Sild E., Viinalass H Genetic diversity in milk proteins among estonian dairy cattle. Vet Med Zoot, 48, 70: Żuraw J., Chojnowski W., Jęsiak Z Technologia serów twardych i półtwardych. Biblioteczka Majstra Mleczarskiego. Oficyna Wydawnicza Hoża. Warszawa. Association of κ-casein genetic variants with technological usability indicators of Simmental cows milk Summary The aim of this study was to determine possible connections of κ-casein genetic variants with the indicators of technological usability of Simmental cows milk. The study included 52 cows. Blood samples were taken from each cow individually in order to determine the genetic variant of κ-casein. In addition, individual milk samples were collected from cows between 120 th and 200 th day of lactation. Examination of each milk sample included the following parameters: contents of fat, protein, casein and dry matter, protein to fat ratio, active (ph) and potential ( SH) acidity, heat resistance and rennet coagulation time. Three genotypes were found in the evaluated population of cows: AA, AB and BB determined by two alleles of κ-cn A and κ-cn B. Milk from cows with BB variant of κ-casein was characterized by significantly (p 0.05) higher protein content and the shortest (p 0.05) rennet coagulation time. Milk from cows with B variant of κ-casein was characterized by favorable technological parameters for cheese production. Key words: casein, technological usability, Simmental 76

77 СЕЗОННА АКТИВНІСТЬ ФОТОСИНТЕЗУЮЧИХ ПІГМЕНТІВ ХВОЇ ЯЛІВЦЮ ЗВИЧАЙНОГО JUNIPERUS COMMUNIS В УМОВАХ ПЕРЕДКАРПАТТЯ Автори: Мар яна Кравців, Світлана Волошанська Науковий керівник: канд. біол. наук Волошанська Світлана Ярославівна ДДПУ ім. І.Франка, біологічний факультет, кафедра біології. м. Трускавець, вул.. Івасюка 11, 82200, Україна Ключові слова: фотоситезуючі пігменти, хвоя, ялівець звичайний, Передкарпаття. Досліджуючи рослинність рідного краю, звертаючи увагу на заростання природніх біотопів, спостерігаємо зміну їх кількісного і якісного складу. Зокрема виявляємо, що зростає популяція ялівцю звичайного у природніх біотопах пасовищ Передкарпраття. Це надзвичайно цінна лікарська, харчова, ефіроолійна, фітонцидна, деревинна, смолоносна, декоративна і фітомеліоративна рослина. Шишки ялівцю мають високу ароматичність, містять різноманітні смакові речовини і широко застосовуються для технічної переробки. Плоди ялівцю містять флавоноїди, смоли, ефірну олію, органічні кислоти (яблучну, оцтову, мурашину, гліколеву), дубильні речовини, цукри, пектини, солі калію. Препарати ялівцю підвищують діурез, дезинфікуюче діють на сечовивідні шляхи, виявляють протизапальну і аналгезуючу дію, посилюють виділення шлункового соку та жовчі. Їх застосовують при циститах, гастритах, гепатитах, набряках, бронхітах, ревматизмі, подагрі, кашлі, пневмонії, злоякісних пухлинах, анемії. При цьому залишається актуальною проблема дослідження особливостей формування фотосинтезуючих пігментів у хвої ялівцю звичайного Juniperus communis Метою дослідження є вивчення особливостей формування фотосинтезучих пігментів у хвої ялівцю звичайного у різні пори року Методика досліджень. Серед найточніших методів визначення концентрації речовин, зокрема пігментів, є спектрофотометричні методи. Під спектрофотометрією розуміють визначення залежності величини поглинання світла від довжини хвилі. Залежно від характеру визначення інтенсивності світлового потоку методи спектрофотометрії поділяють на фотографічні, термоелектричні і фотоелектричні, В біологічних дослідженнях райширше використовують методи фотоелектричної спектрофотометрії. Завдяки спектрофотометрії можна визначити кількість речовини, не змінюючи її структури. Найбільш поширене кількісне визначення зелених і жовтих; пігментів у рослинах грунтується на вимірюванні ступеня поглинання світла розчинами цих пігментів. Характеристика хлорофілів і основних каротиноїдів включає кількісну оцінку вмісту в тканині хлорофілів а і b, \ їхні суми, відношення хлорофілів а/b, вмісту каротину, ксантофілів; суми всіх каротиноїдів, відношення зелених пігментів до жовтих тощо. Поряд з цим велике значення має і те, що визначення вмісту кількох пігментів у 77

78 одній наважці дає значну економію часу і матеріалів. Аналіз рослин на вміст каротину має велике практичне значення, оскільки він дає уявлення про якість продуктів харчування і кормів для тварин. Суть цього методу в тому, що із наважки свіжих зелених листків бензином вилучають каротин, а решту пігментів екстрагують етиловим спиртом. Після розбавлення до певного об'єму визначають суму хлорофілів (при нм). Потім.хлорофіл омилюють лугом і вилучають ксантофіли хлороформом, які визначають при 440 нм. Основні фактори, які впливають на формування фотосинтезуючих пігментів у хвої ялівцю звичайного: Сонячна енергія незамінний, обов'язковий екологічний фактор існування рослин і живих організмів. Світло основний фактор фотосинтезу в рослинах. Рослини вирощені при малому освітленні, містять небагато хлорофілу, характеризуються слабко розвинутою механічною тканиною, в них недостатній вміст цінних поживних речовин, особливо цукрів. При затіненні збільшується висота рослин, але ослаблюється кущіння, знижується маса надземних органів і розвиток кореневої систем. Ялівець звичайний може розвиватися при мінімумі 20,5% денного світла (Хемрі, 1996). УФ-випломінювання. При різкому підвищенні УФ-випромінювання протягом кількох тижнів ялівець накопичує вуглеводи, а в його клітинах спостерігається різке збільшення хлорофілу. Залежність від води. Ялівець як правило посухостійкий. Це пов язано з температурою та індексом сухості у місцях його поширення, одночасно такий фактор можна пов язати із адаптацією рослин до перепадів температур (особливо на високогір ї). При низькому рівні зустрічного опору у поєднанні з малою швидкістю вітру (< 30 см/сек) ялівець формує товстий аеродинамічний шар листя. Цього достатньо для підвищення ефективності використання води. Також в умовах високогір я спостерігається підвищений рівень концентрації СО 2 у листку і більшим доступом грунтових вод до рослини завдяки розгалуженій кореневій системі. Оскільки зростає утримання атмосферного вуглекислого газу, цілком ймовірно, що посилюється темп фотосинтезу, що спричиняє більше накопичення вуглеводів, а також синтез і накопичення інших активних речовин. Ці факти показують, що ялівець може розширити ареал росту в посушливих районах. Це сприятиме підтриманню продуктивності площ зростання ялівцю та їх і успішне відтворення. Температура. Ялівець звичайний витримує різноманітні температурні впливи. Він може розвиватися не менше 150 днів при пониженні температури. Вчені прийшли до висновку, що оптимальна температура для продукування пилку ялівцю становить 1,5 º С. Ці дані схожі на показники сосни звичайної (1,7 º С) [6]. Ялівець є стійким до морозів: тільки під час холодних зим можливі пошкодження хвої і незрілих стовбурів. В авсрійських Альпах ялівець активно виживав як морозостійка рослина упродовж вегетаційного сезону при температурі 9,9º С (Ташле, Нойнер, 2004 р.). 78

79 Територія досліджень Пробна площа місцезростань становила 0,25 га. Вона знаходиться на півдні від с. Сторона, близько 1000 метрів від жилої частини села, на околиці хвойного лісу. Особливості нагромадження фотосинтезуючих пігментів у хвої ялівцю звичайного. У вищих рослин існує два види хлорофілів: хлорофіл а (С 55 Н 72 О 5 N 4 Mg) та хлорофіл в (С 55 Н 70 О 6 N 4 Mg). За хімічною будовою хлорофіл це складний ефір двохосновної кислоти та двох спиртів метилового і високомолекулярного ненасиченого спирту фітолу (фітол похідна сполука ізопрену). Саме наявність залишків фітолу у хлорофілі надає останньому ліпідних властивостей. Поруч із хлорофілами іншим класом фотосинтезуючих пігментів у вищих рослин є каротиноїди, які теж беруть участь у фотосинтезі β-каротин і лютеїн. Вміст хлорофілу у рослинах складає в середньому 1% від сухої речовини. Він бере участь у фотохімічних окисно-відновних реакціях. Хлорофіл а поглинає світлові кванти при довжині хвилі понад 680нм; хлорофіл b має максимум поглинання квантів при 650нм, але вже при 680нм майже не поглинає. Одночасне підсилення інтенсивності фотосинтезу можливе при поглинанні світла хлорофілом а, і в доповнення хлорофіл в. Група каротиноїдів включає близько природних пігментів (α-,β-,γ- каротини, ліконін та ін.). Вони містяться у більшості рослин, але їх концентрація майже завжди досить низька. Вміст каротиноїдів у зелених листках складає 0,07 0,2% при підрахунку на суху масу листків. Отже, хлорофіл а акумулює світлову енергію, яку поглинає рослинна клітина, а потім використовує її у фотохімічних реакціях. Світлова енергія, яка поглинається хлорофілами у процесі фотосинтезу, використовується не лише на розщеплення (фотоліз) води і синтез NADPH (НАДФН). Частина світлової енергії що поглинається хлорофілом, перетворюється у хімічну енергію, «запасається» у вигляді високоенергетичних сполук АТФ і використовується у наступних реакціях для синтезу АТФ. У відповідності до поставлених завдань нами було проведено визначення рівня фотосинтезуючих пігментів у хвої ялівцю звичайного. Відбори проб хвої проведено з екземплярів рослин пробної площі у наступні терміни: влітку ( ), восени ( ) та взимку ( ; ). дані наведено в таблиці 1. 79

80 Таблиця 1 Вміст пігментів у хвої ялівцю звичайного. Ялівець, сухий. Вміст пігментів, мг/г абс. сух. маси Дата Хл. а Хл. B a+b a/b Карот. (a+b)/карот. 23,01,10 1,154±0,004 0,645±0,015 1,799±0,019 1,79±0,04 0,276±0,001 6,52±0,10 29,12,09 1,009±0,041 0,605±0,036 1,614±0,078 1,67±0,03 0,176±0,006 9,20±0,76 30,10,09 1,255±0,023 0,763±0,002 2,017±0,025 1,65±0,03 0,164±0,004 12,34±0,47 31,08,09 1,017±0,001 0,690±0,014 1,707±0,015 1,47±0,03 0,122±0,011 14,06±1,39 Встановлено, що у період з кінця літа до середини січня зростає у хвої ялівцю вміст хлорофілу а та істотно підвищується (у два рази) вміст каротиноїдів. Взимку у досліджуваних зразках дещо зменшується концентрація хлорофілу в. Це призводить до суттєвого підвищення відношення хлорофілу а до хлорофілу в (а/в). Проте, співвідношення суми хлорофілів до каротиноїдів (а+в/карот.) від літа до зими істотно зменшується: від 14,06±1,39 мг/г до 6,52±0,10 мг/г. Зростання кількості каротиноїдів одночасно можна пояснити їх участю в окисновідновних процесах, а також їх здатністю захищати хлорофіли від фото сенсибілізованого окиснення. Рисунок 1 Сезонні зміни вмісту пігментів (мг/г абс. сухої маси) А мг/г абс. сух. маси Рисунок 2 Співвідношення концентрації фотосинтезуючих пігментів у хвої ялівцю звичайного (мг/г абс. сух. маси) А мг/г абс. сух. маси 80

81 Отримані дані узгоджуються із літературними відомостями (Правдин А., 1964, Голомазова Г., 1987, Чемирис І., 2007). Дослідниками встановлено, що природні фактори призводять до зменшення вмісту хлорофілу, але в зимовий період більше руйнується хлорофіл в, зростає також кількість каротиноїдів. Отже, утворення і нагромадження хлорофілу в зелених листках відбувається виключно під дією сонячної енергії, кількість якої переважає, звичайно влітку, що і створює сприятливі умови для інтенсивного фотосинтезу та росту рослин. Висновки 1. Ялівець звичайний стійка рослина до впливу температур, високого рівня ультрафіолетового випромінювання. 2. Пробна площа досліджень хвої ялівцю звичайного знаходиться на території с. Сторона Дрогобицького району. 3. Природні фактори призводять до зменшення вмісту хлорофілу, але в зимовий період більше руйнується хлорофіл в, зростає також кількість каротиноїдів 4. Утворення і нагромадження хлорофілу в зелених листках відбувається виключно під дією сонячної енергії, кількість якої переважає, звичайно влітку, що і створює сприятливі умови для інтенсивного фотосинтезу та росту рослин 5 Вміст фотосинтезуючих пігментів у досліджуваних зразках хвої ялівця звичайного відрізняється посезонно. При цьому співвідношення хлорофілів а/в є найвищим у зимовий період (1,79±0,04мг/г), що підтверджує інтенсивність фотосинтезу та достатній рівень обміну речовин у клітинах рослин ялівцю. Література 1. Біленко В.А. Ялівець звичайний // Народний лікар України С Гавриленко В.Ф., Ладыгина М.Е., Хандобина Л.М. Большой практикум по физиологии растений. Фотосинтез. Дыхание. Учеб. Пособие М., «Высш. Школа», с. 3. Голомазова Г.М. Влияние внешних факторов на фотосинтез хвойных. Красноярск: Изд-во Краснояр. ун-та, с. 4. Иост Я.К. Физиология клетки. М.: Мир, С Казаков Є.О. Методологічні основи постановки експерименту з фізіології рослин. Київ: Фітосоціоцентр, с. 6. Козубов Г.М. Биология плодоношения хвойных на Севере. Л.: Наука, с. 7. Морозюк С.С., Протопопова В.В. Трав янисті рослини України,: Навчальний посібник. Тернопіль: Навчальна книга Богдан, с. 8. Мінарченко В.М. Флора лікарських рослин. Луцьк: Едельвіка, С

82 ŻUREK - TYPOWO POLSKIE DANIE. WPŁYW RÓŻNYCH CZYNNIKÓW NA JAKOŚĆ PRODUKTU Autorzy: Przemysław Rożek, Maciej Kurcz, Sylwia Czyjt-Kuryło, Barbara Chwaszcz,,Joanna Kosturek Opiekun: mgr Maciej Kluz SKN Technologów Żywności FERMENT, Sekcja Biotechnologii i Mikrobiologii Żywności Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy Ul. Ćwiklińskiej 2, Rzeszów Słowa kluczowe: żurek, zakwas, kwas mlekowy, mąka żytnia Wstęp Kiszenie (inaczej kwaszenie) jest procesem opartym na fermentacji mlekowej. Celem tego procesu jest przetwarzanie surowców roślinnych w artykuły smaczne i zdrowe, a jednocześnie zakonserwowanie tych produktów na stosunkowo długi okres. Czynnikiem konserwującym jest kwas mlekowy wytworzony w wyniku fermentacji bakterii mlekowych. Do grupy tej nakeżą: Lactobacillus, Pediococcus, Leuconostoc, Carnobacterium, Oenococcus, Weissella, Streptococcus, Lactococcus, Enterococcus, Tetragenoococcus i Vagococcus. Fermentacja mlekowa dzieli się na homo fermentację mlekową gdzie bakterie z glukozy produkują głównie kwas mlekowy (około 90%) oraz niewielkie ilości ubocznych metabolitów dwuwęglowych i dwutlenku węgla oraz hetero fermentacje mlekową, podczas której oprócz kwasu mlekowego powstaje szereg innych związków, takich jak diacetyl, aldehyd octowy, etanol, kwas octowy i dwutlenek węgla. Fermentacja mlekowa może zachodzić w sposób spontaniczny (tradycyjny), w której uczestniczy bardzo bogata mikroflora bakteryjna składająca się niejednokrotnie z kilkudziesięciu, a nawet powyżej stu szczepów bakterii fermentacji mlekowych, odpowiadających za charakterystyczny zapach i smak produktów. Fermentacja może być również ukierunkowana powszechnie stosowane są kultury starterowe czyli czyste kultury drobnoustrojów o zróżnicowanym składzie gatunkowym dobranym zarówno do surowca, jak i do produktu prowadzoną na skale przemysłową. Fermentację mlekową przeprowadza się z użyciem szczepionek bakterii mlekowych, która jest mieszaniną trzech gatunków bakterii mlekowych: Leuconostoc mesenteroides, Lactobacillus plantarum, Lactobacillus brevis. Powstający w procesie fermentacji kwas mlekowy wykazuje korzystny wpływ na funkcjonowanie przewodu pokarmowego. Reguluje ph treści jelitowej, dzięki czemu wpływa na optymalizację procesów trawienia i wydalania zapobiegając zaparciom. Obniża ph środowiska, a tym samym ogranicza rozwój niepożądanej mikroflory, w tym mikroorganizmów potencjalnie chorobotwórczych, sprzyja rozwojowi tzw. probiotyków. Bakterie probiotyczne wykazują szczególnie korzystny wpływ na organizm człowieka, gdyż zwiększają odporność organizmu i neutralizują związki o charakterze rakotwórczym. Ponadto syntetyzują witaminy i wytwarzają enzymy wpływające 82

83 na poziom wykorzystania składników żywności,przyczyniając się do utrzymania równowagi mikroflory jelitowej. W wyniku fermentacji maki żytniej i pszennej przez ich mikroflorę własną, powstaje tzw. zakwas z którego na bazie wywaru mięsnego lub mięsno-warzywnego przygotować można żurek. Żur to inaczej zakwaszona zupa mączna mająca charakterystyczny kwaśny posmak. Nazwa żur pochodzi od dawnego niemieckiego wyrazu sūr, dziś sauer - kwaśny[1], (s)kisły. Żur może mieć konsystencję gęstszą lub rzadszą w zależności od ilości dodanej wody oraz zakwasu. Podobnie jest z kwasowością. Do żuru można dodawać ser, grzyby, wędlinę, a także jajka w zależności upodobań. Cel pracy Celem pracy było wykonanie różnych zakwasów, ze względu na stosunek użytej mąki żytniej do mąki pszennej. Po procesie fermentacji mlekowej dokonano analizy mikrobiologicznej zakwasów żurkowych oraz oceny ich parametrów chemicznych takich jak zasolenie oraz kwasowość. Następnie z otrzymanych zakwasów sporządzono żurki (zupa) i poddano je ocenie organoleptycznej na reprezentatywnej grupie osób. Materiały i metody Do produkcji zakwasu żurkowego użyto mąkę żytnią razową typ 720 oraz mąkę pszenną typ 500 w odpowiednich stosunkach wagowych: Tabela 1. Skład ilościowy zakwasów Zakwas nr 1 Zakwas nr 2 Zakwas nr 3 Zakwas nr 4 50 g mąki żytniej 250 ml wody 40 g mąki żytniej 10 g mąki pszennej 250 ml wody 30 g mąki żytniej 20 g mąki pszennej 250 ml wody 25 g mąki żytniej 25 g mąki żytniej 250 ml wody Zakwasy wykonano wg. tradycyjnej receptury przez zmieszanie odmierzonych porcji mąki żytniej i pszennej, dodatek wody wodociągowej (po uprzednim przegotowaniu) oraz dodatek kromki chleba razowego spełniającego rolę startera. Tak sporządzoną mieszaninę poddano naturalnej fermentacji mlekowej w temperaturze 30 C przez 72 h. W celach porównawczych badaniu poddano również zakwas żurkowy Żurek rzeszowski otrzymany metodą przemysłową, znajdujący się w obrocie detalicznym. Analizę mikrobiologiczną badanych zakwasów wykonano na podstawie barwienia metoda Gramma. Wykonano następujące czynności: przygotowanie preparatu, umieszczono preparat w roztworze fioletu krystalicznego (barwiono 3 minuty), utrwalono w płynie Lugola (1,5-2 minut), zanurzono w alkoholu etylowym (30 sekund), 83

84 naniesiono roztwór fuksyny zasadowej (barwiono 20 sekund) Tak przygotowane preparaty oglądano pod imersją w mikroskopie świetlnym firmy Olympus oraz wykonano zdjęcia zintegrowaną kamerą cyfrową. W badanych zakwasach oceniono także kwasowość metodą miareczkowania alkacymetrycznego oraz zawartość soli metodą Mohra. Kwasowość oznaczono przez miareczkowanie roztworem 0,1M NaOH kwasów zawartych w zakwasie wobec 2% alkoholowego roztworu fenoloftaleiny jako wskaźnika. Zawartość soli kuchennej w zakwasie na żurek oznaczono metodą miareczkowania argentometrycznego (AgNO 3 ) wobec chromianu (VI) potasu jako wskaźnika. Wszystkie oznaczenia wykonano w trzech powtórzeniach. Z uzyskanych wyników wyciągnięto średnią arytmetyczną. Z przygotowanych zakwasów sporządzono żurki które poddano ocenie organoleptycznej na grupie 35 osób, oraz sporządzono ankietę, której wyniki zawarto w artykule. Wyniki i dyskusja Kwasowość oraz zawartość soli w żurku Zawartość kwasów w zakwasach wahała się w zależności od użytego stosunku mąki żytniej do mąki pszennej. Już na poziomie kwasowości poszczególnych mąk widać różnice w zawartości kwasów, co nie pozostaje bez wpływu na przygotowane zakwasy. Mąka żytnia ze względu na większy udział w jej składzie fragmentów okrywy owocowo nasiennej odznacza się wyższą kwasowością wynoszącą do 6 stopni kwasowości w stosunku do mąki pszennej, której zawartość popiołu jest niższa, a kwasowość wynosi do 3 stopni. Na końcową zawartość kwasów w żurkach miał także wpływ mąki żytniej, która odznacza się większą zdolnością do wytwarzania kwasu mlekowego na drodze fermentacji mlekowej. Tabela 2. Stopień kwasowości zakwasów żurkowych. Zakwas nr 1 Zakwas nr 2 Zakwas nr 3 Zakwas nr 4 Żurek rzeszowski Kwasowości 4,2 3,9 3,5 3,4 12,6 W badanych próbkach zawartość soli kształtowała się na nieznacznym poziomie, a niewielka jej ilość w zakwasach nr 1-4 była wynikiem dodatku w fazie przygotowania chleba razowego, który w swym składzie zawiera chlorek sodu. Ocena organoleptyczna Podczas oceny organoleptycznej pod uwagę brane były takie wyróżniki jak: smak, zapach, konsystencja, kwasowość. Zarówno pod względem smaku jak i pożądanej kwasowości najwyższe oceny otrzymał zakwas nr 2, a najniższe zakwas nr 4. Konsystencja i zapach wszystkich żurków zostały ocenione na podobnym, akceptowalnym poziomie. Jako zbyt kwaśny oceniony został Żurek rzeszowski. 84

85 Rysunek 1. Cechy badanych żurków wg. oceny konsumentów. 5 4,5 4 3,5 3 2,5 2 1,5 1 0,5 0 Zakwas nr 1 Zakwas nr 2 Zakwas nr 3 Zakwas nr 4 "Żurek rzeszowski" Smak Zapach Konsystencja Kwasowość Podsumowanie Żurek to jedno z typowych polskich dań, jadane jako potrawa świąteczna jak i na co dzień, powstająca przez dodanie do wywaru mięsno-warzywnego zakwasu, powstającego w wyniku fermentacji mąki żytniej i pszennej. Podczas przeprowadzonych badań udało nam się wyprodukować cztery partie zakwasu, określić ich cechy mikrobiologiczne, chemiczne oraz przeprowadzić ocenę organoleptyczną. Żurek zawiera znaczne ilości kwasu mlekowego, a zatem i bakterii go wytwarzających, które wykazują pozytywne działanie na układ pokarmowy konsumenta. Literatura 1. Mitek M., Słowiński M. (red) Wybrane zagadnienia z technologii żywności. Wyd. SGGW Warszawa. 2. Jakubczyk T. Haber T Analiza zbóż i przetworów zbożowych. Skrypt SGGW, Warszawa. 3. Małecka Maria (red.) Wybrane metody analizy żywności. Wyd. Akademii Ekonomicznej w Poznaniu, Poznań, 4. Kłossowska J., Stradecka A. (red) Obiady u Kowalskich. Wydawnictwo WATRA Warszawa. Żurek national polish dish. Influence of various factors on the product quality Zurek is a typical Polish dish, acidified soup, prepared on the basis of mealy starter with rye and wheat. The subject of our study was the impact of factors on the quality of the starter. With its production accepted four types of relations used by weight of rye flour to wheat: 5:0, 4:1, 3:2, 2.5:2.5. Assessing the quality took into account the following factors: acidity, salt content and composition of the bacterial intestinal flora, in particular lactic acid bacteria. Determine the amount of acid contained in the prepared starters study sample consisted of acid-base titration by 0.1 M NaOH in the presence of phenolphthalein. Salt content was determined by quantitative precipitation of chlorides by titration of neutralized extract test solution of nitrate (V) in the presence of silver chromate (VI) as an indicator of potassium, so-called Mohr's method. Prepared sourdoughs were used to prepare soup - zur, which then was subjected to organoleptic evaluation by a representative group of people. Key words: żur, starter, lactic acid, rye flour 85

86 Sekcja perspektywy rozwoju turystyki w Polsce 86

87 EKOTURYSTYKA NA ŚWIECIE NA WYBRANYCH PRZYKŁADACH Autorzy: Anna Chmielowiec, Anna Pilch, Michał Rak Opiekun: mgr Jarosław Herbert SKN Podróżników Uniwersytet Rzeszowski, Wydział Wychowania Fizycznego Ul. Towarnickiego 3, Rzeszów Słowa kluczowe: ekoturystyka, świat, wybrane przykłady Wstęp Podczas szczytu Quebeku zwrócono uwagę, że protest przeciwko ekspansywności turystyki masowej jest wyrażany coraz silniej i że w ślad za nim pojawia się więcej twórców i zwolenników, ekoturystyki, choć ta przynosi niecałe 5% finansowych zysków z turystyki. Czym tak właściwie jest ekoturystyka? Otóż, jest zjawiskiem interdyscyplinarnym korzystającym z dorobku różnych dziedzin nauki. Do prawidłowego rozwoju potrzebna jest wiedza z wielu czasem wydawałoby się skrajnych gałęzi nauki takich jak: zarządzanie i marketing, ekologia, biologia, geografia, socjologia, etnologia. Dzisiaj już nie można mówić o ochronie przyrody, pomijając wątki ekonomiczne i społeczne. Niemożliwe jest dyskutowanie o roli, ekoturystyki bez zbadania przez biologa czy antropologa jej potencjalnego wpływu na kulturę i środowisko. Według Dominiki Zaręby, autorki pierwszej w Polsce książki o ekoturystyce, stanowi ona rdzeń koncepcji turystyki zrównoważonej. Jest najczystszą formą podróżowania przyjaznego środowisku, ponieważ odbywa się zwykle na obszarach o najwyższych walorach przyrodniczych i krajobrazowych, bezpośrednio przyczynia się do ochrony środowiska naturalnego i kulturowego tych regionów, a jej uczestnikami są ludzie o dużej świadomości ekologicznej i wrażliwości przyrodniczej. Dominika Zaręba wyodrębnia trzy najważniejsze cechy ekoturystyki wyróżniające ją spośród innych form podróżowania: ekoturystyka jest formą aktywnego i dogłębnego zwiedzania obszarów o wybitnych walorach przyrodniczych i kulturowych; ekoturystyka strzeże harmonii ekosystemów przyrodniczych i odrębności kulturowej lokalnych społeczności; ekoturystyka dostarcza środków finansowych skutecznej ochronie wartości dziedzictwa przyrodniczego i kulturowego oraz przynosi realne korzyści ekonomiczno-społeczne ludności miejscowej [1]. Kluczem do sukcesu turystyki jest jej rozwój przy jednoczesnej ochronie środowiska, dlatego też ruch turystyczny powinien odbywać się w odpowiedni sposób. W wielu krajach stworzono specjalne projekty, ośrodki hotelowe wykorzystujące proekologiczne rozwiązania, które pozwolą na ochronę przyrody a także dziedzictwa kulturowego. Przykładowymi projektami wykorzystującymi proekologiczne rozwiązania są El Mundo Maya - obejmującą ziemie Majów, Projekt Annapurna w 87

88 Nepalu, Ekologiczne letnisko na Wyspach Dziewiczych, Park Narodowy Hortobagy na Węgrzech, Projekt Ekologiczna Elba, Ekologiczne miasto w Zjednoczonych Emiratach Arabskich - Masdar oraz obiekty hotelarskie tj.: Sieć hoteli Four Seasons na Bora Bora, Treehotel hotel na drzewach w Szwecji, Crowne Plaza Copenhagen Towers. Wszystkie te zostały poniżej szerzej przedstawione. Ameryka Środkowa - El Mundo Maya Ziemia Majów obejmuje 5 krajów Ameryki Środkowej Belize Gwatemali Hondurasu Salwadoru i Meksyku. Kraje te postanowiły połączyć swe siły i wspólnie promować Świat Majów jako przyjazny dla środowiska produkt turystyczny. Wyzwanie polega na połączeniu ochrony dziedzictwa kulturowego i przyrodniczego regionu z promocją i sprzedażą jego niezliczonych atrakcji turystycznych. Jego dziedzictwo kulturowe regionu stanowią przede wszystkim liczne zabytki architektoniczne ruiny starożytnych miast Majów ze świątyniami, piramidami, pałacami obserwatoriami astronomicznymi, z którego każde budowane z innego projektu miało być dziełem sztuki. Ostatnie badania potwierdzają jedną z hipotez, że przyczyna tajemniczego upadku cywilizacji prekolumbijskiej była katastrofa ekologiczna spowodowaną nieracjonalną gospodarką zasobami przyrody. Archeolodzy twierdzą, że masowe wycinanie lasów doprowadziło tu do zmian warunków klimatycznych i wyjałowienia gleby. Tajemnicze losy majów stanowią dodatkowa atrakcję turystyczna oraz w świetle najnowszych badań również bardzo istotny element kształtowania świadomości ekologicznej odwiedzających go turystów. W planie rozwoju zielonej turystyki wyszczególniono priorytetowe zadania dotyczące komunikacji, infrastruktury turystycznej, obszarów chronionych, oraz alternatywnych źródeł zarobkowania dla miejscowej ludności. Założenia strategiczne projektu dotyczące transportu turystycznego zakładają ograniczenie budowy nowych dróg ulepszenie istniejących tras. Transport lotniczy ma być jedną z ważniejszych form komunikacji, małe samoloty docierają do trudno dostępnych miejsc i tam, nie planuje się budowy dróg. Linie lotnicze podejmują przedsięwzięcia w ochronie środowiska takie jak: ograniczenie użycia energii i produkcji odpadów, zmniejszenie emisji hałasu, emisji dwutlenku węgla, tlenków azotu. W świecie Majów są również tworzone warunki do bardziej przyjaznych dla środowiska środków transportu łodzie konie, oraz infrastruktura w formie ścieżek do wędrówek pieszych, tras rowerowych, konnych i szlaków krekingowych przez dżungle i tereny górskie. Powstają także inne spektakularne pomysły jak sieć kolejek linowych zbudowanej z naturalnych materiałów do przewożenia turystów. Projekt Annapurna w Nepalu Wraz z utworzeniem obszaru chronionego Annapurny, równocześnie wszedł projekt Annapurna Conservation Area Project. Podstawowym celem projektu jest zapewnienie korzyści 88

89 ekonomiczno-społecznych ludności miejscowej, a jednocześnie zwiększenie jej świadomości ekologicznej, aby stała się ona strażnikami przyrody. Podniesienie wrażliwości przyrodniczej i szerzenie właściwych wzorców zachowań w górach miało też dotyczyć również turystów, których odpowiedzialności za środowisko naturalne Himalajów jest tak samo duża, jak i lokalnych społeczności. Główne osiągnięcia ACAP: Budowa domowych elektrowni wodnych, instalowanie baterii słonecznych, oraz stosowanie urządzeń energooszczędnych w domach prywatnych, schroniskach turystycznych. Budowa sieci noclegowej z ekologicznych materiałów. Zatrudnianie mieszkańców przy konserwacji szlaków turystycznych budowy mostów wiszących, w akcjach zalesiania. Zmiany systemów zagospodarowania odpadami recykling. Zwiększanie świadomości ekologicznej turystów oraz mieszkańców. Ekologiczne letnisko na Wyspach Dziewiczych Na Wyspach Dziewiczych, które w znacznej części są objęte ochroną prawną, stworzono proekologiczne letniska na wyspie Saint Jon. Estate Cocordia jest jedną ze słynnych wiszących stacji turystycznych. Posiadłość przylega do Parku Narodowego Wysp Dziewiczych i zajmuje obszar 10 ha. Niedaleko ośrodka znajduje się miejsce składania jaj kilku gatunków żółwi oraz niewielkie rafy koralowe. Sednem projektu jest pomysł budowy wiszących dróg w celu niedopuszczenia do zniszczenia rzadkich środowisk roślinnych i ochrony przed erozja, zadeptywaniem gruntu przez turystów. Małe domki szałasy (6x6m) są umieszczone nad ziemią pośród drzew połączonych systemem wiszących dróg i schodów. Każdy domek wyposażony jest w urządzenia energooszczędne, energia pochodzi głównie z siły wiatru, funkcję klimatyzacji pełnią gęste korony drzew, które ocieniają kwatery. Infrastrukturę turystyczną stanowi kilka niewielkich budynków: sklep ze zdrową żywnością, gdzie wszystko opakowane jest w przyjazne dla środowiska materiały, jest też tzw. Centrum Poczęstuj Się gdzie turyści przed odjazdem zostawiają produkty żywnościowe i inne zbędne przedmioty nie wykorzystywane na wyspie. Restauracja przygotowuje posiłki z miejscowych produktów, pracownicy kuchni korzystają z urządzeń oszczędzających wodę i energię oraz nietoksycznych środków owadobójczych. We wszystkich obiektach woda jest uzdatniana do picia. Powtórnie używa się ok. 1 mln. litrów wody rocznie. Park Narodowy Hortobagy na Węgrzech Park został utworzony w roku 1973 głównie ze względu na cenne obszary bagienne będące miejscem lęgowym wielu ptaków zagrożonych wyginięciem na kontynencie Europejskim takich jak: żuraw, warzęcha, drop, bocian czarny. Park ma status Rezerwatu Biosfery UNESCO. 89

90 Region szczyci się ciekawą historią, bogatym dziedzictwem kulturowym, prastarymi tradycjami hodowli owiec, koni i bydła. Prowadzi się hodowlę zwierząt zanikających w tej części Europy np. Węgierskiego Rębacza Szarego, owiec Racka, bawołów wodnych, koni rasy Nonius i świni Mangalica. Przedsięwzięcie PN Hortobagy System zarządzania stref wewnątrz parku wyróżnia: C buforową, przeznaczona do rozwijania wszystkich możliwych form turystyki zrównoważonej, B, w której możliwe jest prowadzenie ekoturystyki podlegającej ścisłej kontroli władz parku, A rdzeń, w całości przeznaczona do celów naukowych i badawczych. Projekt odnowy populacjo Konia Przewalskiego. Rozwój produktu ekoturystycznego infrastruktury przyjaznej dla środowiska Ścieżka rowerowa Egyek 30 kilometrowa obejmująca najatrakcyjniejsze miejsca widokowe Ornitologiczny projekt Kis Jusztus, stworzenie oferty wycieczek dla profesjonalnych obserwatorów ptaków jak i turystów o szczególnych zainteresowaniach. Projekt Ekologiczna Elba Głównym celem było zintegrowanie celów turystycznych z priorytetami ochrony środowiska, rozwój ekoturystyki miał przynieść zmianę przyzwyczajeń i kultury turystów odwiedzających wyspę i skłonić ich do większej troski o otaczające środowisko przyrodnicze. Elba uchroniła się przed rozwojem wielkiego przemysłu turystycznego i zachowała typową śródziemnomorska atmosferę, krajobraz i spokój. Zamiast samochodów i motorówek turyści i mieszkańcy korzystają głównie z rowerów i łodzi. Jedną z podstawowych form ekoturystyki są wędrówki piesze wzdłuż i w szerz wyspy (trekking all Elba). Przygotowano kilka szczególnych tras przyrodniczych, opracowano do nich mapy i przewodniki ze zdjęciami, rysunkami i komentarzami. W każdym materiale informacyjnym jest drukowany etyczny regulamin postępowania prawdziwego miłośnika przyrody oraz spis niezbędnych elementów ekwipunku: lornetka do obserwacji zwierząt, aparat fotograficzny. Własciciele hoteli oraz restauracji zobowiązali się do szerokiej ekologizacji działalności: do segregacji odpadów, oszczędnego gospodarowania wodą i energią, używania biodegradacyjnych i najmniej szkodliwych dla przyrody środków czystości, przygotowywania potraw ze zdrowej żywności pochodzącej z regionu. Turystów i mieszkańców wyspy uczula się na potrzebę oszczędzania wody i energii oraz używania biodegradacyjnych opakowań, dbałości o estetykę otoczenia - sprzątania po sobie. W ramach Projektu Ekologiczna Elba wyznaczono specjalne grupy ochotników głównie młodzieży, które pełnią rolę strażników mających zapobiegać pożarom lasów. 90

91 Ekologiczne miasto w Zjednoczonych Emiratach Arabskich - Masdar Priorytetem przy projektowaniu tego miasta było wyeliminowanie emisji dwutlenku węgla. Projekt oparto na teorii, że współczesne miasto może funkcjonować bez zatruwania atmosfery dwutlenkiem węgla, a potrzebna miastu energia jest uzyskiwana z takich odnawialnych źródeł jak słońce, wiatr, woda, biopaliwa. Sercem ekomiasta ma być Masdar Headquarters, czyli "Centrala" pierwszy na świecie budynek, który w pewnym sensie będzie budował sam siebie. Najpierw wykończony zostanie dach pokryty bateriami słonecznymi. Z pozyskanej energii słonecznej będą zasilane maszyny budowlane. Miasto ma być z założenia samowystarczalne energetycznie będzie czerpać energię potrzebną do funkcjonowania z odnawialnych źródeł energii. Najważniejszym z nich będzie słońce. Przewiduje się zastosowanie specjalnych paneli fotowoltaicznych i kolektorów parabolicznych. Będą one rozmieszczone na dachach wszystkich budynków, a także nad wąskimi alejami, gdzie jednocześnie spełnią rolę osłony przed promieniami słonecznymi. Będzie to miało na celu obniżenie temperatury i zmniejszenie zapotrzebowania na klimatyzatory. Odpady nieorganiczne z całego miasta będą podlegać recyklingowi, zaś organiczne trafią jako paliwo do elektrowni. Miasto nie będzie wywozić żadnych odpadów, ani emitować dwutlenku węgla. Nie przewiduje się używania żadnych silników spalinowych transport ma być oparty na wodorze, pojazdy będą wykorzystywać ogniwo paliwowe. Materiały budowlane w mieście będą pochodzić z recyklingu, drewno z racjonalnie zarządzanych lasów, z tzw. certyfikatem FSC. Żywność w sklepach z upraw ekologicznych. Słodka woda z pobliskiej Zatoki Perskiej, której wody będą w specjalny sposób oczyszczane i odsalane. Na obrzeżach miasta planuje się ustawienie farm wiatrowych o mocy powyżej 20 MW. Planuje się również wykorzystanie energii geotermalnej. Ukończenie budowy Masdar City planowane jest między 2016 a 2023 rokiem. Jeszcze nie wiadomo, ile tak naprawdę cała inwestycja będzie kosztować. Wymieniane są różne kwoty. Niektóre źródła podają astronomiczną kwotę 24 miliardów dolarów [2]. Sieć hoteli Four Seasons na Bora Bora Do budowy hoteli wykorzystano w większości naturalne materiały (m.in. liście i drzewo plecione, używane w tradycyjnych mieszkaniach wilgotnego klimatu tropikalnego). Każdy domek posiada port do nurkowania, stały dostępdo Internetu i sieci energetycznej, co więcej, każde pomieszczenie zostało wyposażone w czujniki, aby w pełni monitorować i optymalizować zużycie energii w tym nawet ciśnienie wody pod prysznicem. Dzięki nowoczesnym rozwiązaniom udało się opracować system ochładzający powietrze w hotelowych pomieszczeniach cyrkulacją zimnej wody z dna oceanu. Hotele na Bora Bora inwestują w odnawialne źródła energii już teraz opracowywany jest system odzyskiwania wody deszczowej i ścieków, a także melioracji ogrodów na wyspie. Aż 20% energii każdego hotelu pochodzi z energii słonecznej. Nie jest to jednak pierwsza ekologiczna innowacja w hotelach na tej mitycznej wyspie. Od dwóch lat, klimatyzacja w hotelu Intercontinental pochodzi z dna oceanu [3]. 91

92 Treehotel hotel na drzewach w Szwecji W Laponii powstał nietypowy hotel. Goście mogą spędzić tu noc w jednym z niezwykłych domków, zawieszonych w koronach drzew. Treehotel, znajduje się w pobliżu miejscowości Harads w szwedzkiej części Laponii. Właściciel poprosił kilku architektów o pomoc w zaprojektowaniu hotelowych "pokoi". Tak powstało kilka zaawansowanych technologicznie, przyjaznych naturze domków, w których goście mogą nieco zwolnić, wyciszyć się i wziąć głębszy oddech. Goście idąc do swoich pokoi na drzewach, zabierają ze sobą tylko niewielkie torby z rzeczami na noc. Prysznic i jadalnia są w pensjonacie, o 10 minut spacerem. Lustrzana Kostka najbardziej zadziwiający ze wszystkich domków. Wygląda jak ogromne szklane pudło zawieszone wysoko na pniu. Drzewa odbijające się w lustrzanych ścianach sprawiają, że sześcian staje się niemal niewidoczny. Zdradza go jedynie linowy most, prowadzący do ledwo dostrzegalnych drzwi. Wnętrze pachnie ciepłym drewnem. Pomieszczenie ma cztery metry długości, cztery szerokości i cztery wysokości. Jest jasne i przestronne. Łazienka ogranicza się do ekologicznego sedesu (w niektórych domkach nieczystości zamarzają, a w innych są palone) oraz umywalki.. Lustrzaną Kostkę pokrywa nawet specjalna taśma, widoczna tylko dla ptaków, która chroni je przed zderzeniem z budynkiem. Drugi z domków na drzewie, nazwany Kabina, przypomina kosmiczną kapsułę, która wylądowała w lesie. Ten dwuosobowy pokój doskonale nadaje się na platformę widokową. Zamiast jednej ze ścian posiada duże okno wychodzące na las i rzekę. Kolejny z domków został zbudowany na wzór Ptasiego Gniazda. Crowne Plaza Copenhagen Towers Pierwszy w Danii hotel o zerowym poziomie emisji dwutlenku węgla. Hotel jest neutralny pod względem emisji gazów cieplarnianych, gdyż cała zużywana w nim energia pochodzi ze źródeł odnawialnych. Przykładowo woda zużywana do chłodzenia i ogrzewania pozyskiwana jest z głębokości 100 metrów pod powierzchnią ziemi. Instalacja dostarczania wody jest pierwszym przypadkiem w Danii, w którym wykorzystuje się wody gruntowe - można w ten sposób zaoszczędzić do 90% energii zużywanej do chłodzenia i ogrzewania. Dodatkowo wszystkie fasady pokryte są najnowszej technologii ultra cienkimi panelami, które łącznie generują 170 MWh rocznie. Jest to ilość energii, którą zużywa 55 typowych polskich gospodarstw. Hotel, nie obniżając jakości oferowanych usług wyznacza nowe standardy dla hoteli, działających w oparciu o zasadę zrównoważonego rozwoju. Crowne Plaza Copenhagen Towers jest czterogwiazdkowym hotelem starającym się zapewniać komfort ekologicznego hotelu, pięciogwiazdkowego nie pobierając za to dodatkowych opłat. Władze hotelu wpadły ostatnimi czasy na niecodzienny pomysł: chcą oferować darmowy posiłek tym, którzy wsiądą na rowerek treningowy i w litrach potu wyprodukują, co najmniej 10 watogodzin prądu elektrycznego. Jest to pierwsza tego typu inicjatywa na świecie. Po wysiłku każdy ma otrzymać jedno z głównych dań hotelowego menu o 92

93 wartości 240 koron duńskich (około 120 zł). Będzie to dla gości zachęta nie tylko do aktywności fizycznej, ale też przyczyni się do zredukowania ich śladu węglowego oraz oszczędzenia energii elektrycznej i pieniędzy dodaje [4]. Podsumowanie Wiele na świecie jest takich regionów, które wyraźnie pretendują do uczynienia ekoturystyki jednym z podstawowych priorytetów ich rozwoju. Co więcej, wydaje się że, właśnie ekoturystyka wraz z pokrewnymi jej formami podróży i przedsiębiorczości może przyczynić się do tego że te obszary zachowają swoja tożsamość kulturową oraz różnorodność przyrodniczą jeżeli umiejętnie zaplanuje się ich zrównoważony rozwój. Chociaż wybudowanie nietypowego ośrodka turystycznego, w miejsce tradycyjnego kurortu, wymaga nieco więcej wysiłku i wyobraźni dla inwestorów, to jednak inwestycja okaże sięw dalszej perspektywie czasu o wiele bardziej opłacalna. Jeśli już teraz nie zaczniemy myśleć o przyjaznej środowisku turystyce, możemy niedługo pożegnać się z prawdziwą, dziką naturą. Dzisiaj, kiedy słońce zaświeci, zaczynamy myśleć o odpoczynku. Z tysiącami propozycji spędzenia wolnego czasu wychodzą nam naprzeciw m.in. agencje turystyczne, czy hotele. Jeśli wybierzemy się na wycieczkę wytyczonymi szlakami, po pewnym czasie zastanawiamy się, czy to, aby na pewno jest wypoczynek na łonie natury? Mijamy tłumy ludzi a hałas jest powszechny. Przenosząc w góry, do lasów, czy nad jezioro miejskie zwyczaje, niszczymy resztki prawdziwej natury, czego przykładem są wypłoszone zwierzęta i stosy pozostawionych odpadów. Dlatego właśnie ekoturystyka ma być przeciwstawieniem się turystyce masowej, która doprowadza często do niszczenia atrakcyjnych turystycznie obszarów, takich właśnie, jak lasy, góry, czy morza. Literatura 1. Zaręba D., Ekoturystyka, Wydawnictwo naukowe PWN, Warszawa, 2006, s Ecotourism in the world - selected examples Summary The aim of this article was to show ecoturism in the world. Presents to selected tourism projects and facilities using pro ecologikal solutions. Key words: ecotourism, world, selected examples 93

94 IMPREZY AGROTURYSTYCZNE OFEROWANE PRZEZ PODKARPACKIE GOSPODARSTWA W OPARCIU O DANE INTERNETOWE Autorzy: Aneta Romankiewicz, Łukasz Mucha, Marta Pisarek Opiekun: dr inż. Marta Pisarek SKN Rolników Włościanin Sekcja Agroekologii Fitofagusie Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy Ul. Ćwiklińskiej 2, Rzeszów , Słowa kluczowe: agroturystyka, oferta, turystyka Wstęp Rozwój agroturystyki w Polsce jest uwarunkowany występowaniem atrakcyjnych turystycznie obszarów wiejskich, różnorodnością krajobrazu związanego z rozdrobnioną strukturą agrarną, tradycyjnymi metodami produkcji rolniczej oraz zasobami dziedzictwa kulturowego wsi [3]. Wśród różnorodnych uwarunkowań rozwoju współczesnej turystyki kluczową rolę odgrywają atrakcje turystyczne; są one jednym z ważniejszych elementów składowych systemu turystyki [2]. Wizja spędzenia wakacji w atrakcyjnie położonych miejscowościach, o pięknych krajobrazach, ciekawej architekturze i czystym środowisku, w tradycyjnym gospodarstwie rolnym, to spora atrakcja, szczególnie dla spragnionych natury mieszkańców wielkich miast. Z tą formą spędzania wolnego czasu wiążą się również znaczne wyzwania turyście należy zaoferować dobrze przygotowany produkt. Nie może w nim zabraknąć takich elementów jak kontakt z przyrodą, zwierzętami czy uczestniczenie w pracach polowych. Biorąc pod uwagę wszystkie te uwarunkowania, na pewno nie zaskakuje fakt, że województwo podkarpackie zajmuje piąte pod względem liczby kwaterodawców agroturystycznych. W województwie tym zarejestrowanych jest też około 450 obiektów noclegowych, w tym schroniska młodzieżowe i turystyczne, hotele, motele i pensjonaty [6]. Najlepszą infrastrukturę turystyczną mają powiaty: bieszczadzki, leski, sanocki, krośnieński, jasielski oraz miasta Przemyśl i Rzeszów. Niewiele obiektów noclegowych jest w powiatach: brzozowskim, kolbuszowskim, przeworskim i strzyżowskim. Schroniska turystyczne znajdują się w powiatach: bieszczadzkim, leskim i sanockim. Jest to związane z ruchem turystycznym na terenie Bieszczadów i Beskidu Niskiego. Wymienione tereny są licznie i chętnie odwiedzane przez osoby uprawiające turystykę aktywną. Materiał i metody Artykuł przygotowany został w oparciu o dane zamieszczone na stronach internetowych gospodarstw agroturystycznych, podstawowe źródło informacji stanowiła strona internetowa wykresy obrazujące problematykę badawczą sporządzone zostały za pomocą programu Microsoft Excel. 94

95 Wyniki Przeglądając oferty gospodarstw agroturystycznych zdecydowana większość gospodarzy proponowała takie atrakcje jak: grill lub miejsce na ognisko 103 gospodarstwa (22%) oraz wędkowanie 48 (10%). Pozostałe atrakcje to: możliwość wypożyczenia rowerów 43 (9%), jazda konna 38 (8%), gospodarz jako przewodnik oraz plac zabaw dla dzieci 26 (6%), kuligi 23 (5%), boisko do siatkówki 22 (5%), potrawy regionalne 20 (4%), grzybobranie 20 (4%), warsztaty rękodzieła 14 (3%), stół do tenisa 14 (3%), zwierzęta gospodarskie 10 (2%), bryczka 8 (2%), boisko do koszykówki 8 (2%), sprzęt wodny 8 (2%), stół bilardowy 7 (1%), sprzęt narciarski 6 (1%), sauna 5 (1%), kort tenisowy 5 (1%), zbieranie ziół 4 (1%), samochód terenowy 4 (1%), udział w pracach polowych 3 (1%), basen 3 (1%), kąpielisko 1 (<1%). Analizując atrakcje bezpośrednio związane z gospodarstwem agroturystycznym to stanowią one ogółem 42%, zapewniające bierny wypoczynek na terenie gospodarstwa i w okolicy - 19%, aktywny wypoczynek na terenie gospodarstwa - 17%, natomiast turystyka konna 15% (rys. 1). Według Smoleńskiej [5] istotną kwestią jest uatrakcyjnianie pobytu gościom poprzez różnego rodzaju oferty dodatkowe, głównie nieodpłatne. Pośród atrakcji, które oferowano w innych rejonach Polski najczęściej wymienianymi były jazda konna (64% badanych) oraz uczestnictwo w pracach rolniczych (50% analizowanych gospodarstw agroturystycznych w powiatach wieruszowskim i ostrzeszowskim. Ponadto gospodarstwa w obrębie swoich domostw oferowały dostęp do kuchni czy aneksów kuchennych, zaplecza rekreacyjnego dla dzieci i dorosłych, place zabaw dla najmłodszych oraz różnego rodzaju usługi transportowe. Z punktu widzenia autorki, wydaje się jednak, że oferta jest zbyt mało zróżnicowana i brakuje w niej atrakcji, które mogłyby zaciekawić i przyciągnąć nieco ambitniejszego turystę. Za najciekawsze propozycje należy uznać jedynie: możliwość polowań, łowiectwo i wędkarstwo; poznanie ludowego rękodzieła oraz szerokie spektrum uprawiania turystyki aktywnej (rowerowej, kajakowej, pieszej, konnej etc), atrakcje zimowe (kuligi) [5]. Wymienione przez Smoleńską [5] propozycje są oferowane przez gospodarstwa agroturystyczne z Podkarpacia. 95

96 Ognisko / grill Gospodarz jako przewodnik Potrawy regionalne Sauna Zwierzęta gospodarskie Plac zabaw Udział w pracach polowych Wędkowanie Kąpielisko Grzybobranie Zbieranie ziół Warsztaty rękodzieła Jazda konna Kuligi Bryczka Stół do tenisa Rowery Basen Boisko do koszykówki Boisko do siatkówki Kort tenisowy Sprzęt wodny Sprzęt narciarski Stół bilardowy Samochód terenowy Tabela 2. Atrakcje oferowane przez podkarpackie gospodarstwa agroturystyczne Powiat Bieszczadzki Brzozowski Dębicki Jarosławski Jasielski Kolbuszowski Krośnieński Leski Lubaczowski Mielecki Niżański Przemyski Przeworski Ropczyckosędziszowski Rzeszowski Sanocki Stalowowolski Razem Źródło: Badania własne w oparciu o oferty agroturystyczne zamieszczone na stronie LEGENDA: atrakcje bezpośrednio związane z gospodarstwem agroturystycznym bierny wypoczynek na terenie gospodarstwa i w okolicy turystyka konna aktywny wypoczynek na terenie gospodarstwa 96

97 Rys 1. Procentowy udział ofert podkarpackich gospodarstw agroturystycznych Źródło: Badania własne w oparciu o oferty agroturystyczne zamieszczone na stronie Wśród atrakcji bezpośrednio związanych z gospodarstwem agroturystycznym najliczniej oferowane było ognisko/grill (54% z ogółu propozycji). Plac zabaw oraz gospodarz jako przewodnik polecało po 13% gospodarstw, a potrawy regionalne 10%. Natomiast obecność zwierząt gospodarskich wynosiła tylko 5%, sauna 3%, udział w pracach polowych 2% (rys. 2). 2% 5% 3% UDZIAŁ W PRACACH POLOWYCH 10% SAUNA OBECNOŚĆ ZWIERZĘT GOSPODARSKICH 53% 14% POTRAWY REGIONALNE GOSPODARZ JAKO PRZEWODNIK 13% PLAC ZABAW OGNISKO / GRILL Rys. 2. Procentowy udział atrakcji bezpośrednio związanych z gospodarstwem Źródło: Badania własne w oparciu o oferty agroturystyczne zamieszczone na stronie Przeglądając oferty biernego wypoczynku na terenie gospodarstwa zdecydowanie dominowało wędkowanie 55%, grzybobranie 23%, 16% stanowiły warsztaty rękodzieła, zbieranie ziół wynosiło 5%. Najmniej licznie były oferty kąpieliska - tylko 1% (rys. 3). 97

98 16% 5% 23% 55% wędkowanie kąpielisko grzybobranie zbieranie ziół warsztaty rękodzieła 1% Rys. 3. Procentowy udział stacjonarnego wypoczynku na terenie gospodarstwa Źródło: Badania własne w oparciu o oferty agroturystyczne zamieszczone na stronie Analizując możliwości aktywnego wypoczynku na terenie gospodarstwa i w jego okolicy 35% ofert stanowiły rowery górskie, 18% boisko do siatkówki, 12% stół do tenisa, sprzęt wodny oraz boisko do koszykówki 7%, stół bilardowy 6%, sprzęt narciarski 5%, kort tenisowy 4%, natomiast samochód terenowy i basen po 3% (rys. 4). Turystyka konna jest czwartym blokiem atrakcji turystycznych. Najliczniej stanowiły atrakcje jazdy na koniu 55%, następnie 33% kuligi oraz przejazdy bryczką 12% (rys. 5). 5% 7% 4% 18% 6% 3% 12% stół do tenisa rowery basen boisko do koszykówki boisko do siatkówki 35% kort tenisowy sprzęt wodny sprzęt narciarski 7% 3% stół bilardowy samochód terenowy Rys. 4. Procentowy udział aktywnego wypoczynku na terenie gospodarstwa i w jego okolicy Źródło: Badania własne w oparciu o oferty agroturystyczne zamieszczone na stronie 98

99 Rys. 5. Procentowy udział atrakcji turystyki konnej Źródło: Badania własne w oparciu o oferty agroturystyczne zamieszczone na stronie Wnioski Z przeprowadzonej analizy wynika, że w śród oferowanych przez podkarpackie gospodarstwa agroturystyczne atrakcji dominują metody biernego spędzania czasu w postaci grillowania i biesiadowania przy ognisku. Jednocześnie obserwowany jest wzrost zainteresowania gospodarstw turystyką konną i rowerową, czemu sprzyja gęsta sieć szlaków przeznaczonych do tego typu turystyki na terenie województwa, zwłaszcza w powiecie bieszczadzkim oraz w rejonie Beskidu Niskiego. Obserwowany jest również wzrost ofert związanych z możliwością uczestnictwa w grzybobraniu czy wędkowaniu. Podobne formy wypoczynku stanowią podstawę w gospodarstwach na terenie Podlasia Godlewskiego [1], w województwie zachodnio-pomorskim Krupińskiej [3], czy na Pogórzu Przemyskim [4]. Brak jest natomiast ofert związanych z turystyką winiarską. Żadne gospodarstwo nie oferuje degustacji i sprzedaży wina. Gospodarstwa w małym stopniu wykorzystują także możliwość organizacji warsztatów rękodzielniczych, co niewątpliwie wpłynęłoby na uatrakcyjnienie pobytu w danym gospodarstwie wzbogacając jednocześnie wiedzę na temat danego regionu i jego kultury. Odnieś można wrażenie że obecnie w agroturystyce dąży się jedynie do zapewnienia noclegu i wyżywienia, gdyż jest to najłatwiejsza metoda przynosząca szybki zysk, co znacznie wypacza idee towarzyszącą tworzeniu gospodarstw agroturystycznych. 99

100 Literatura 1. Godlewski G Społeczno-ekonomiczne aspekty działalności gospodarstw agroturystycznych na przykładzie południowego Podlasia. Zeszyty studiów doktoranckich. Zeszyt 19. Akademia Ekonomiczna w Poznaniu. 2. Kruczek Z Metody badań atrakcji turystycznych, [w:] Turystyka w badaniach naukowych. Red. R. Winiarski, W. Alejziak, AWF Kraków i WZIiZ w Rzeszowie, Kraków-Rzeszów, Krupińska W Uwarunkowania rozwoju agroturystyki w województwie zachodniopomorskim. Zesz. Nauk. AR im. H. Kołłątaja w Krakowie, Z. 402: Pisarek M., Lechowska J Perspektywy rozwoju agroturystyki w rejonie Pogórza Przemyskiego. Roczniki Naukowe SERiA, T. 11, Z. 4: Smoleńska O Turystyka wiejska w powiatach wieruszowskim i ostrzeszowskim formą aktywizacji obszarów rolniczych. Praca magisterska manuskrypt. AWF w Poznaniu. 6. Tokarczyk K., Perun J Stan agroturystyki w gminie Krempna, [w:] Stan i perspektywy rozwoju turystyki w regionach Polski. Red. Wojtyczek Ł. Prace Naukowo-Dydaktyczne PWSZ w Krośnie. Krosno,

101 PERSPEKTYWY ROZWOJU TURYSTYKI ROWEROWEJ W POLSCE NA PRZYKŁADZIE SZWAJCARII Autor: mgr Anna Kurkowska Uniwersytet Warszawski, Wydział Geografii i Studiów Regionalnych ul. Krakowskie Przedmieście 30, Warszawa Słowa kluczowe: turystyka rowerowa, turystyka zrównoważona, rozwój regionalny Wstęp Turystyka rowerowa, jako forma spędzania czasu wolnego jest jeszcze relatywnie młodym turystycznym fenomenem. W wielu krajach Europy Zachodniej, takich jak m. in. Niemcy, Austria Szwajcaria, Holandia, Dania, czy Wielka Brytania rozwinęła się na szerszą skalę dopiero od drugiej połowy lat 90-tych XX wieku, przy czym dynamiczny jej rozwój odnotowuje się w ciągu ostatnich 10- ciu lat XXI wieku. 3 Należy do ekspansywnie rozwijającego się segmentu na rynku turystycznym o wzrastającym gospodarczym znaczeniu i na wielu obszarach wiejskich jest istotnym czynnikiem stymulującym lokalny rozwój społeczno-gospodarczy. W Polsce, jak do tej pory, nie osiągnęła podobnej popularności, pomimo istniejących licznych turystycznych potencjałów, w szczególności bogatych walorów środowiska przyrodniczego i kulturowego. Zaczyna być, co prawda postrzegana przez lokalnych aktorów, jako istotne źródło materialnych korzyści i szansa dla rozwoju społeczno-gospodarczego na obszarach peryferyjnych, jednak, aby móc wykorzystać istniejące potencjały trzeba przede wszystkim przezwyciężyć liczne ograniczenia infrastrukturalne. Do najważniejszych zalicza się m. in. niewystarczającą gęstość sieci odpowiednio oznakowanych szlaków rowerowych, po których można atrakcyjnie i komfortowo prowadzić turystyczny ruch rowerowy oraz braki, zarówno ilościowe, jak i jakościowe w przyjaznej rowerzystom infrastrukturze turystycznej wzdłuż szlaków. Poza oczywiście stosownymi nakładami finansowymi, należałoby wypracować, zatem w Polsce nowe, elastyczne instrumenty i metody, które umożliwiłyby efektywną realizację działań, mogących przyczynić się do dalszego rozwoju tej formy turystyki. Materiał i metody Przedmiotem artykułu jest analiza modelowych rozwiązań szwajcarskich w zakresie planowania i koordynacji działań mających na celu dynamiczny rozwój turystyki rowerowej 4. Przykład Sywajcarii wskazuje, że aby osiągnąć sukces, oprócz właściwie wypracowanych koncepcji i projektów, potrzebne jest zaangażowanie i współpraca wielu lokalnych aktorów, m. in. polityków, instytucji i organizacji rządowych i pozarządowych, lokalnych przedsiębiorców. 3 Patrz sprawozdania m. in. Niemieckiego Związku Turystyki, Ogólnoniemieckiego Klubu Rowerowego (ADFC), Schweiz Mobil, European Cyclist Federation (ECF). 4 Należy w tym miejscu podkreślić, iż w Szwajcarii turystyka rowerowa już w krótkim czasie uplasowała się na czołowej pozycji, jeśli chodzi o letnią ofertę turystyczną. 101

102 Podstawowe metody badawcze wykorzystywane w pracy to analiza materiałów źródłowych, m. in. publikacji szwajcarskich instytucji i organizacji zajmujących się turystyką rowerową i ruchem rowerowym, a take analiza danych uzyskany podczas wywiadów eksperckich, przeprowadzonych przez autorkę w czasie pobytu na stypendium badawczym w marcu 2011 roku. Wyniki Dynamiczny w ostatnich latach rozwój turystyki rowerowej w Szwajcarii to nie tylko efekt realizacji właściwie wypracowanych koncepcji planistycznych, lecz przede wszystkim bardzo dobrej współpracy i zaangażowania wielu aktorów. Na szczególną uwagę zasługuje organizacja Schweiz Mobil (do 2004 roku pod nazwą Veloland Schweiz), pełniąca rolę koordynatora wszystkich inicjatyw i działań związanych z planowaniem, popularyzacją i rozwojem przyjaznych rodowisku form turystyki, w szczególności turystyki rowerowej. Jej liczne sukcesy docenione zostały zarówno w kraju, jak i poza jego granicami i również dla Polski mogą być przykładem godnym naśladowania. Idea stworzenia w Szwajcarii gęstej, zintegrowanej z komunikacją publiczną i bardzo dobrej jakościowo sieci szlaków rowerowych dla turystyki, a także czasu wolnego, narodziła się w roku Pomysł zyskał wsparcie Szwajcarskiego Związku Turystyki i do jego realizacji powołano organizację Veloland Schweiz, pełniącą rolę koordynatora planowanych działań. Realizację projektu (również pod nazwą Veloland Schweiz ) 5 rozpoczęto w roku 1995, zaś jego uroczyste otwarcie odbyło się w kwietniu 1998 i było przedmiotem zainteresowania krajowych i międzynarodowych mediów. W tym samym też roku organizacja (od 2004 pod nową nazwą SchweizMobil) rozszerzyła działalność, rozwijając ofertę przyjaznych środowisku form turystyki, określanych wspólnym pojęciem Langsamverkehr 6 do których zalicza się turystykę pieszą, rowerową, kolarstwo górskie, jazdę na rolkach oraz turystykę kajakową 7. Sukces organizacji to jednak nie tylko powstanie gęstej sieci krajowych, regionalnych i lokalnych szlaków dla Langsamverkehr. To przede wszystkim umiejętne ich wypromowanie dla celów turystycznych. Schweiz Mobil zrzesza szwajcarskie organizacje i instytucje, zajmujące się turystyką, sportem i transportem 8 oraz współpracuje z wieloma aktorami; przedsiębiorcami, politykami, licznymi instytucjami rządowymi i pozarządowymi, w tym również z księstwem Liechtensteinu 9. Partnerami Schweiz Mobil w ramach sektora prywatnego są przede wszystkim firmy świadczące usługi dla turystów rowerowych, w szczególności usługi zakwaterowania, wyżywienia, komunikacji publicznej, transportu bagażu oraz wypożyczania i serwisowania rowerów 10. Ok Projekt budowy 9-ciu krajowych szlaków rowerowych o długości ponad 3 000km. Ich przebieg ustalono we współpracy z instytucjami kantonalnymi zajmującymi się tzw. Langsamverkehr oraz organizacjami turystycznymi. Realizację oraz jednolite oznakowanie powierzono natomiast poszczególnym kantonom w ramach prowadzonej przez nich działalności inwestycyjnej W sumie w projekcie uczestniczyły 3 instytucje rządowe, 80 urzędów kantonalnych, 1800 gmin oraz 30 organizacji zajmujących się Langsamverkehr. 6 Tłum. z j. niem. - powolny transport, powolna komunikacja. Pojęcie rozwinięte w dalszej części artykułu. 7 W tym celu zrealizowano krajową sieć szlaków dla Langsamverkehr składającą się z 22 krajowych i 147 regionalnych szlaków o całkowitej długości km. 8 Ich listę zamieszczono na stronie internetowej: 9 Dostępne w Internecie pod adresem: 10 Ich wykaz wzdłuż każdego szlaku Schweiz Mobil, dostępny jest na stronie internetowej Veloland.ch. 102

103 spośród nich (hotele, kwatery prywatne, miejsca kempingowe, schroniska młodzieżowe, gospodarstwa agroturystyczne) wyróżnionych zostało też, jako przedsiębiorstwa przyjazne rowerzystom, odznaką jakości Schweiz Mobil 11. W zakresie marketingu krajowego i międzynarodowego organizacja współpracuje ze Schweiz Tourismus, IG Schweiz Mobil oraz z około 35 firmami zajmującymi się sprzedażą w sumie około 150 ofert turystycznych. 12 Są to m. in. firma Swiss Trails oraz Rent-a-Bike. Pierwsza z nich przygotowała ofertę aktywnych wakacji w Szwajcarii, przyciągając tysiące turystów z całego świata. 13 Druga z kolei uruchomiła na terenie kraju sieć ok. 100 punktów wypożyczania rowerów, zlokalizowanych najczęściej w pobliżu stacji kolejowych. Zaletą świadczonych usług jest m. in. to, iż sprzęt wypożyczony w jednym z punktów, może być oddany w dowolnym innym. Obecnie sieć szlaków rowerowych Schweiz Mobil 14 liczy km długości, z czego 3300 km stanowią szlaki krajowe, uzupełnione między rokiem 2003, a 2008 siecią ok. 50 szlaków regionalnych o długości ok km. Ponadto ok km to szlaki przygotowane specjalnie dla kolarstwa górskiego (1800 km udostępniono w roku 2004, pozostale 3300 w 2008). Wszystkie inwestycje realizowane były przez odpowiednie jednostki i instytucje zrzeszone w SchweizMobil w ramach projektów partnerstwa publiczno-prywatnego 15. Szacuje się, iż rocznie na szlakach tych przejeżdżanych jest ok. 150 mln kilometrów 16, co odpowiada odległości pomiędzy Ziemią, a Słońcem. Tab 1. Wycieczki i wyprawy rowerowe w Szwajcarii w roku 2009 Wyszczególnienie Wycieczki jednodniowe (bez noclegu) Krótkie wyprawy rowerowe (1-2 noclegów) Liczba wycieczek rowerowych Liczba przejechanych kilometrow (w mln km) Żródło: Veloland Schweiz 2009 Wyprawy rowerowe (powyżej 2 noclegów) Ogółem 4,8 mln mln Przedsiębiorstwa mogą uzyskać odznakę Schweiz Mobil jeśli spełniają wszystkie wymagane kryteria. Są to m. in. dostępność zadaszonych i zamykanych pomieszczeń na przechowywanie rowerów, dostęp do narzędzi do drobnych napraw rowerów, możliwość prania i suszenia odzieży oraz dostępność informacji na temat oferty SchweizMobil i prospektów dotyczących lokalnej oferty turystycznej. 12 Wszelkie niezbędne informacje przy planowaniu wycieczki rowerowej znajdują się w specjalnych przewodnikach rowerowych oraz na interaktywnej platformie internetowej (strona w języku angielskim, niemieckim, francuskim oraz włoskim). Zakres dostępnych na platformie informacji, to m. in. interaktywne mapy, które można załadować do skali 1:50 000, w tym mapy z punktami przystankowymi komunikacji publicznej wzdłuż szlaków, gdzie po kliknięciu na poszczególne przystanki zostaje się automatycznie przekierowanym do linku z rozkładem jazdy z danego miejsca. Ponadto profile terenu, opis atrakcji turystycznych, wykaz usługodawców i wiele innych. 13 Oprócz wielu propozycji wycieczek zorganizowanych, firma wprowadzila tzw. SwissTrails Voucher (ważny od do 31.10). Daje on możliwość indywidualnego dopasowania czasu trwania podróży, wyboru szlaków oraz długości poszczególnych etapów. Honorowany jest w ponad 150 obiektach hotelowych zlokalizowanych wzdłuż krajowych szlaków rowerowych SchweizMobil. Wykorzystać go można również na transport bagażu realizowany przez firmę. Dodatkowo SwissTrails świadczy usługi wypożyczania rowerów, profesjonalne doradztwo w języku angielskim, niemieckim i francuskim oraz prowadzi tzw. HelpLine infolinię dostępną 7 dni w tygodniu w godz Oprócz szlaków Schweiz Mobil istnieją w Szwajcarii jeszcze inne szlaki rowerowe o zasięgu lokalnym. 15 W partnerstwie publiczno-prywatnym SchweizMobil uczestniczyły urzędy krajowe (45%), kantony (45%) oraz prywatne organizacje i sponsorzy (10%) (dane na podstawie informacji uzyskanych w siedzibie Schweiz Mobil). Partnerstwo Publiczno-Prywatne (PPP) to forma współpracy przedsiębiorczości prywatnej (wspartej prywatnym kapitałem) z sektorem publicznym na wszystkich szczeblach. Jako instrument rozwoju infrastruktury i świadczenia z jej pomocą usług powszechnego pożytku gospodarczego, stanowi rozwiniętą formę inwestowania w sektor publiczny w większości krajów świata. W Polsce dopiero zaczyna nabierać znaczenia (patrz 16 Informacje na podstawie wyników badań przeprowadzonych w 2008 przez Schweiz Mobil (dane otrzymane z 16 punktów pomiarowych zlokalizowanych wzdłuż najważniejszych szlaków rowerowych oraz przy pomocy danych ankietowych, przeprowadzonych wśród turystów rowerowych). 103

104 Liczbę jednodniowych wycieczek rowerowych szacuje się na ok. 4,8 mln, z kolei wycieczek kilkudniowych na ok (patrz tab. 1). Biorąc, zatem pod uwagę średnie wydatki turystów rowerowych (patrz tab. 2.) oraz liczbę świadczonych noclegów (ok ), to całkowity roczny obrót z turystyki rowerowej szacować można na około 150 mln franków (turyści kilkudniowi wydają średnio ok. 100 franków dziennie, natomiast jednodniowi około 13 franków dziennie). Tab. 2. Średnie wydatki turystów rowerowych w Szwajcarii w roku 2009 (w mln franków). wycieczki krótkie wyprawy wyprawy rowerowe ogółem jednodniowe (bez noclegu) rowerowe (1-2 noclegów) (powyżej 2 noclegów) wyżywienie transport noclegi pozostałe ogółem Żródło: Veloland Schweiz 2009 Liczba noclegów udzielona turystom rowerowym w 2008 roku w podziale na poszczególne kategorie obiektów noclegowych przedstawiona została w poniższej tabeli. Tab 3. Liczba noclegów świadczonych w 2008 roku dla turystów rowerowych w Szwajcarii wg kategorii obiektów noclegowych hotel kemping schronisko gospodarstwo obiekty noclegi u pozostałe ogółem młodzieżowe agroturystyczne typu Bed & Breakfast znajomych/rodziny kategorie Żródło: Veloland Schweiz 2008 Inicjatywą SchweizMobil są również tzw. Dni slowup (der autofreie Erlebnistag, tłum. z niem. wolny od samochodu dzień przygody), zapoczątkowane w latach w ramach tzw. «Human Powered Mobility» w celu rozpropagowania idei Langsamverkehr wśród mieszkańców. Pierwsza tego typu impreza odbyła się w roku 2000 nad jeziorem Murten i do dnia dzisiejszego Dni Slow Up przyciągają w sezonie wiosenno letnim (od kwietnia do września) we wszystkich regionach Szwajcarii w sumie około pół miliona uczestników. Pełna sukcesów działalność organizacji została doceniona i wyróżniona m. in nagrodą Milstone Szwajcarskiego Związku Turystyki (rok 2008). Ponadto projekt Veloland Schweiz otrzymał dofinansowanie w ramach programu InnoTour 17 (innowacyjna turystyka). Inno Tour skierowany jest w szczególności do regionów, w których nie ma możliwości rozwoju innych dziedzin gospodarki poza turystyką i w przeciwieństwie do wielu innych instrumentów wspierających rozwój regionalny, z programu dofinansowywane mogą być tylko takie projekty, których wymierne korzyści ekonomiczne są możliwe do osiągnięcia już w krótkim okresie czasu. Do takich należał właśnie 17 InnoTour to jeden z instrumentów polepszenia struktury i jakości oferty szwajcarskiej turystyki. Jest to inicjatywa jednostki państwowej ds. gospodarki SECO (Staatssekretariat für Wirtschaft), do której zadań należy m. in. dalszy rozwój krajowej turystyki, poprzez m. in. wspieranie innowacji i współpracy (w tym współpracy międzynarodowej), działań marketingowych w turystyce, a także udzielanie kredytów małym i średnim przedsiębiorcom świadczącym usługi z zakresu turystyki. 104

105 Veloland Schweiz, który obejmował następujące projekty: 1. szwajcarskie szlaki rowerowe (lata ), Mountainbikeland (lata ), Schweiz Mobil Lokal ( ) i już w pierwszym roku po realizacji przyniósł wymierny efekt w postaci udzielonych noclegów i ok. 137 milionów franków obrotu 18. Co warte podkreślenia - w projekcie współpracowali ze sobą przedsiębiorcy na co dzień konkurenci, którzy w celu zrealizowania założeń, zostali partnerami. Podsumowanie W Polsce turystyka rowerowa wykazuje znaczne potencjały rozwojowe, choć do tej pory niestety jeszcze niewykorzystane. Podobnie jak w Szwajcarii może pełnić rolę istotnego stymulatora rozwoju lokalnego na obszarach słabiej rozwiniętych gospodarczo i przyczyniać się do wzrostu dochodu społeczności lokalnych oraz tworzenia nowych miejsc pracy. Jednak jak pokazuje modelowy przykład szwajcarski, aby osiągnąć sukces, poza oczywiście atrakcyjnym turystycznie środowiskiem przyrodniczym i kulturowym oraz niezbędną wysokiej jakości infrastrukturą, obiektami zagospodarowania turystycznego wzdłuż szlaków rowerowych i usługami świadczonymi dla turystów rowerowych, sprawą priorytetową jest zaangażowanie i kooperacja lokalnych aktorów oraz jednostka pełniąca rolę koordynatora wszelkich działań. Dla Polski dodatkowo szansą dla rozwoju turystyki rowerowej są środki z funduszy Unii Europejskiej, przy pomocy których sfinansować można niektóre niezbędne inwestycje infrastrukturalne. Możliwość ubiegania się o nie jest jednak tylko do roku Tym bardziej, zatem doświadczenia zachodnie, w szczególności z zakresu planowania i koordynacji niezbędnych działań, mogą stanowić istotne korzyści poznawcze. Literatura Meier R., Projekte für einen nachhaltigen Freizeitverkehr. Nachhaltiger Freizeitverkehr. Verlag Rüegger. Chur, Schnell P., Fahrradtourismus. Geographie der Freizeit und des Tourismus: Bilanz und Ausblick: 3. Auflage. Oldenbourg Wissenschaftsverlag, SchweizMobil, Das Netzwerk zum Langsamverkehr für Freizeit und Tourismus, Stiftung SchweizMobil, Bern 6. SchweizMobil, Schlussbericht, Planungs- und Realisierungsphase , Stiftung SchweizMobil, Bern 7. www. Swisstrails.ch Veloland Schweiz należy do najbardziej udanych projektów finansowanych w ramach InnoTour. W wielu regionach zapoczątkował on liczne dodatkowe projekty. 105

106 Perspectives of development of bicycle tourism in Poland for example of Switzerland Summary Bicycle tourism plays a very important role in the highly developed countries and it is an expanding section of the tourist market with increasing economic importance. In Poland, the potential of this tourism form is still not realized. The most important reasons for this state of affairs are: qualitative and quantitative shortages in bike infrastructure, tourism infrastructure along bike trails and their surroundings, and an inadequate density of bike trail networks. Coherent bicycle networks that can attractively and comfortably lead a bicycle movement do not yet exist in most regions of Poland. The subject of the article is an analysis of swiss solution in the field of planning, realization and coordination of the activities, which have as an aim, a long-lived development of bicycle tourism. Unquestioned the collection of swiss experiences,will contribute to progress in the field of planning and development of this tourism form in Poland, and will result in additional cognitive benefits. Key words: bicycle tourism, sustainable tourism, regional development 106

107 PERSPEKTYWY ROZWOJU TURYSTYKI NA OBSZARACH WIEJSKICH NA PRZYKŁADZIE GMINY BRZYSKA Autorzy: Marta Tabaczyńska Opiekun: mgr Beata Dec, mgr Łukasz Stokłosa Studenckie Koła Naukowe Ekologiczno - Przyrodnicze Wyższa Szkoła Informatyki i Zarządzania Ul. Sucharskiego 2, Rzeszów Słowa kluczowe: turystyka, walory, rozwój, gmina Wstęp Turystyka wg Światowej Organizacji Turystyki (UNWTO) to: ogół czynności osób, które podróżują i przebywają w celach wypoczynkowych, służbowych lub innych nie dłużej niż rok bez przerwy poza swoim codziennym otoczeniem, z wyłączeniem wyjazdów, w których głównym celem jest aktywność zarobkowa wynagradzana w odwiedzanej miejscowości [2]. Na przełomie XX i XXI wieku nastąpiło wyraźne zróżnicowanie i wzbogacenie sposobów spędzania czasu wolnego, powstało szczególnie dużo tak zwanych form turystyki specjalnych zainteresowań. Nowe formy spędzania czasu wolnego coraz częściej przenikają się wzajemnie, co sprawia, że turysta uczestnicząc w ruchu turystycznym jest jednocześnie uczestnikiem wielu form turystyki [7]. Takie zjawisko możemy zaobserwować nie tylko w dużych aglomeracjach miejskich, będących centrami kulturalnymi, które tworzą coraz to nowe możliwości spędzania czasu wolnego dla coraz bardziej świadomych turystów, ale również w mniejszych ośrodkach miejskich oraz na obszarach wiejskich. Celem artykułu jest przedstawienie kierunków rozwoju turystyki na terenie gminy Brzyska z uwzględnieniem barier, na które napotyka potencjalny turysta odwiedzający ten obszar. Podczas pisania niniejszego opracowania dokonano porównania danych zawartych w literaturze, ze stanem aktualnym oraz przeprowadzono badania terenowe. Gmina Brzyska- perspektywy rozwoju turystyki Według systemu regionalizacji fizycznogeograficznej Jerzego Kondrackiego gmina Brzyska leży w obrębie: obszaru Alpejskiego; prowincji Karpaty Zachodnie; podprowincji Zewnętrzne Karpaty Zachodnie; makroregionu Pogórze Środkowo-Beskidzkie; mezoregionu Pogórze Ciężkowickie [4]. Położona jest ona w zachodniej części województwa podkarpackiego, w powiecie jasielskim. Gmina leży przy trasie nr 73 Tarnów Jasło Krosno. Od południa gmina sąsiaduje z gminą Jasło i Skołyszyn, od zachodu z gminą Szerzyny, od północnego zachodu z gminą Jodłowa, od północnego wschodu z gminą Brzostek, a od wschodu z gminą Kołaczyce. Zajmuje ona obszar o powierzchni 4513 ha, który zamieszkiwany jest przez około 6300 osób [5]. 107

108 W skład gminy wchodzi 7 sołectw: Brzyska, Błażkowa, Dąbrówka, Kłodawa, Lipnica Dolna, Ujazd oraz Wróblowa. Zachodnia granica gminy jest jednocześnie granicą województwa podkarpackiego z województwem małopolskim, natomiast wschodnią granicę wyznacza przepływająca przez gminę rzeka Wisłoka [6]. Lasy najistotniejszy element krajobrazotwórczy zajmują 23,3% ogólnej powierzchni gminy, natomiast grunty orne 68,6%. Pozostałe tereny, w tym mieszkaniowe i komunikacyjne 8,1%, co stanowi wielkość porównywalną z innymi gminami powiatu jasielskiego. Gmina jest malowniczo położona na wzgórzach Pogórza Ciężkowickiego łagodnie opadających w dolinę Wisłoki, co w połączeniu ze wspaniałym klimatem, nieskażoną przyrodą oraz ciekawymi pamiątkami przeszłości stanowi dużą atrakcję turystyczną [1]. Fot. 1. Krajobraz gminy Brzyska- widok na Masyw Liwocza oraz górę Krzemyk Źródło: zbiory własne Gmina Brzyska to gmina o typowo rolniczym charakterze. Praca w rolnictwie jest podstawą utrzymania ponad połowy mieszkańców. Na jej terenie nie ma zakładów przemysłowych oraz szeroko rozwiniętej działalności gospodarczej, co sprawia, że gmina należy do obszarów o niskim poziomie zanieczyszczenia środowiska oraz o wysokim poziomie bezrobocia. Szansą dla zmiany obecnej sytuacji ekonomicznej mieszkańców gminy jest zrównoważony rozwój i adaptacja jej, jako miejsca destynacji turystycznej. Obecnie obszary te nie są jednak w pełni wykorzystywane ze względu na brak zaplecza gastronomiczno-noclegowego, obiektów i urządzeń rekreacyjnych oraz odpowiedniej bazy informacyjnej. Gmina Brzyska nie posiadając odpowiedniego zagospodarowania turystycznego jest obecnie dopiero na początku drogi, aby stać się atrakcyjną miejscowością turystyczną. Okres ten jest jednak 108

109 jednym z najważniejszych, bo to właśnie od działań podejmowanych na tym etapie, będzie zależał przyszły profil turystyczny omawianego obszaru. Priorytetem powinno być zadbanie o stworzenie odpowiedniego produktu turystycznego. Jak wiemy produkt turystyczny może być rozpatrywany w dwóch zakresach węższym oraz szerszym. Ja w swoim rozważaniu zajmę się jedynie produktem w ujęciu szerszym, czyli dotyczącym ogółu zasobów turystycznych danego obszaru, zagospodarowania turystycznego, jak również ogółu doświadczeń turysty w całym okresie jego pobytu w danej miejscowości, czy też regionie. Podstawową cechą każdego produktu turystycznego jest jego dostępność oraz wizerunek, dlatego też uważam, że na omawianym obszarze pracę należy rozpocząć od działań mających na celu poprawę stanu technicznego dróg. Na sieć drogową gminy Brzyska, składają się drogi powiatowe oraz gminne. Droga powiatowa nr 1313 relacji Błażkowa Jasło, przebiega przez obszar gminy osiowo i jest trasą najbardziej uczęszczaną. Posiada powierzchnię utwardzoną, wynoszącą łącznie 24,38 km. Uzupełnienie sieci dróg powiatowych, stanowią drogi gminne o długości 38 km. W lokalnej komunikacji sieć dróg gminnych uzupełniana jest przez drogi rolnicze i dojazdowe, w większości jedynie utwardzone, pozbawione nawierzchni. Obecnie cała sieć drogowa wymaga gruntownej modernizacji nawierzchni, gdyż jej stan techniczny można ocenić, jako średni. Udział ruchu ciężkiego w strukturze rodzajowej jest stosunkowo niewielki i nie stanowi szczególnego zagrożenia w aspekcie wpływu na środowisko oraz warunki i bezpieczeństwo ruchu drogowego. Niekorzystną cechą istniejącego układu komunikacyjnego w gminie jest brak rozdzielenia przestrzeni ruchowej dla różnych rodzajów ruchu. Szczególnie dotkliwie dotyka to rowerzystów i pieszych, którzy przy braku wydzielonych ścieżek, czy chodników korzystają z jezdni dróg [5]. Szansą na dodatkowe zwiększenie ruchu turystycznego w gminie jest zakończenie inwestycji mającej na celu wybudowanie mostu drogowego na rzece Wisłoka (most został oddany do użytku z dniem 1 stycznia br.). Inwestycja ta została sfinansowana przez budżet gmin: Brzyska i Kołaczyce oraz dzięki wsparciu finansowemu ze strony władz Powiatu Jasielskiego. Inwestycja ta pozwoli na ożywienie gospodarcze i turystyczne poprzez bezpośrednie połączenie drogi gminnej Brzyska Kłodawa z drogą krajową nr 73 Tarnów Pilzno Jasło. Wizerunek miejsca docelowego to kolejny czynnik wpływający na fakt, czy dany walor turystyczny w wyniku odpowiedniego zagospodarowania stanie się atrakcją turystyczną. Dlatego kolejną ważną sprawą jest stworzenie odpowiedniego zaplecza informacyjno organizacyjnego. Obecnie obszar gminy przecinają jedynie 3 szlaki turystyczne: 2 szlaki żółte (Gilowa Góra- Liwocz; oraz Kołaczyce Liwocz) oraz jeden szlak zielony (Jabłonica Liwocz) o łącznej długości około 25 km. Uważam jednak, że istniejąca sieć szlaków nie jest wystarczająca, jak na tak dużą gminę, dlatego warto było by wytoczyć kolejne prowadzące do niezwykle ciekawych zakątków, których nie brakuje na terenie całej gminy. 109

110 Pełnowartościowy produkt turystyczny może powstać jedynie w oparciu o odpowiednią bazę noclegowo-żywieniową. Ubytki w jej strukturze mogą spowodować zmniejszenie albo nawet całkowity brak zainteresowania danym terenem przez potencjalnego turystę. Usługi noclegowe, nazywane często hotelarskimi należą do świadczeń podstawowych, gdyż turysta będąc poza miejscem swojego stałego zamieszkania odczuwa chęć zaspokojenia potrzeb bytowych. Baza noclegowa nierozerwalnie łączy się z usługami żywieniowymi. Gmina posiada obecnie bardzo słabo rozwiniętą bazę turystyczno-wypoczynkową, brak jest miejsc noclegowych, campingów, działa jedynie kilka prywatnych punktów gastronomicznych, dlatego stanowi to główną barierę dla rozwoju turystyki na tym terenie [6]. W celu zmiany obecnej sytuacji należy wytyczyć miejsca na pola biwakowe oraz campingi ze względu na stosunkowo niewielki nakład kosztów oraz szybki czas realizacji. W kolejnym etapie władze gminy powinny postawić na kampanię reklamową, której celem byłoby uświadomienie lokalnej ludności, że ich jedyną szansą rozwoju jest turystyka. Dopiero wówczas w wyniku tych działań miejscowa ludność uwierzy na nowo w swoją małą ojczyznę, która dzięki pięknym krajobrazom, różnorodności rzeźby terenu oraz licznym zbiornikom wodnym jest idealnym miejscem do uprawiania wielu form turystyki ze szczególnym nastawieniem na turystykę wiejską, agroturystykę, ekoturystykę, turystykę krajoznawczą, kwalifikowaną, leczniczą, kulinarną, turystykę etniczną oraz religijno-pielgrzymkową. Gmina Brzyska posiada intensywnie rozwiniętą sieć rzeczną. Położona jest ona w dorzeczu Wisły, a główną rzeką gminy jest Wisłoka. Obszar ten jest zasobny w wodę powierzchniową, jednak możliwości jej wykorzystania są ograniczone ze względu na duże wahania poziomu wody w ciągu roku. Mimo to, rzeka ta idealnie nadaje się do organizowania m.in. spływów kajakowych. Bogate w zwierzynę Lasy Liwockie są idealnym miejscem dla rozwoju łowiectwa, natomiast amatorzy zbierania runa leśnego znajdą dla siebie wiele doskonałych miejsc obfitujących w jagody i grzyby. Sam masyw Liwocza już od roku 1995 objęty został ochroną prawną w ramach Parku Krajobrazowego Pasma Brzanki, natomiast od roku 2004 dodatkowo w ramach rezerwatu przyrody Liwocz, stanowiącego otulinę dla tego parku. Obszar gminy, a szczególnie wschodnie stoki góry Liwocz, które opadają w kierunku Brzysk są w sposób naturalny przystosowane do rozwoju sportów zimowych, głównie tras zjazdowych. Dzięki takiej inwestycji w okresie letnim można by zapoczątkować na tych terenach rozwój również innej z form turystyki kwalifikowanej Zorbingu. Kolejną formą cieszącą się coraz większym zainteresowaniem wśród turystów są Quady, czyli połączenie motocykla z miniaturowym samochodem. Turyści, zmagając się z dziką przyrodą, czterokołowym pojazdem pokonują bezdroża, przeszkody terenowe, strome zjazdy i podjazdy, przeprawiają się przez brody, rzeki, bagna, poruszając się także nocą w trudnym terenie. Rozwój tej formy na omawianym obszarze uwarunkowany jest krajobrazem pogórzy tworzonym przez wzniesienia fałdu liwockiego zajmującego środkową cześć gminy. Poprzecinany jest on przez liczne 110

111 zadrzewienia towarzyszące potokom oraz pojedynczą wiejską zabudowę, co dodatkowo wpływa na uatrakcyjnienie oferty turystycznej. Na terenie gminy Brzyska występują również liczne źródła wody zmineralizowanej, znajdujących się u podnóża góry Liwocz, do których można zaliczyć wody siarczane oraz solanki. Wody te według przeprowadzonych badań nadają się do zabiegów leczniczych, głównie balneologicznych, czyli leczenie kąpielami oraz wodami pitnymi [5]. W XXI wieku coraz więcej ludzi zwraca uwagę na to, co je, skąd to jedzenie pochodzi oraz w jakich warunkach zostało ono wyprodukowane. Związanie jest to z coraz większą świadomością na temat zdrowego stylu życia, jak i hasłami lansowanymi przez media, które w głównej mierze kształtują ludzkie zachowania. Ludzie coraz częściej wyjeżdżają poza miasto, po to, aby znaleźć się w innym, przede wszystkim czystym, nieskażonym środowisku, które stanowi dla nich pewnego rodzaju odskocznie od codziennego stylu życia. W związku z przytoczonymi argumentami gmina Brzyska ze względu na swój typowo rolniczy charakter powinna postawić na rozwój agro- oraz ekoturystyki [7]. Gmina Brzyska oprócz wspaniałych krajobrazów i czystego środowiska posiada wiele zabytków, które tworzą niezwykły klimat tego miejsca. Wykaz zabytków architektury zamyka się liczbą 27 obiektów, z czego 3 ze względu na szczególne wartości historyczne i poznawcze zostały ujęte w Rejestrze Zabytków. Jest to neogotycki kościół parafialny w Brzyskach p.w. św. Marii Magdaleny z XIX w i dwór w Brzyskach oraz dwór rodziny Rylskich w Lipnicy Dolnej. Największą uwagę z wymienionych obiektów przyciąga zespół pałacowo dworski pochodzący z końca XVIII znajdujący się na terenie wsi Brzyska. Obiekt położony jest w centralnym miejscu parku wypełnionym starodrzewem [6]. Od kilku lat ze względu na brak funduszy na terenie wspomnianego założenia parkowo-dworskiego nie są przeprowadzane żadne prace konserwatorskie, co powoduje ciągłe niszczenie tego obiektu. Do innych obiektów zabytkowych należą liczne malownicze kapliczki przydrożne oraz figury nagrobne pochodzące z XIX i XX wieku. Gmina posiada również na swoim obszarze cztery zabytkowe nekropolie ujęte w aktualnym wykazie zabytków. Dwa cmentarze znajdują się w Brzyskach oraz dwa w miejscowości Błażkowa. Cmentarze z terenu Błażkowej pochodzą z okresu I wojny światowej [3]. Na terenie gminy Brzyska w ostatniej dekadzie postawiono dwa monumentalne krzyże przypominające miejscowej ludności o przełomie tysiącleci. Jeden z nich osiemnastometrowy stanowi zwieńczenie platformy widokowej na Liwoczu. Drugi, zaś czterdziestometrowy jest najwyższym krzyżem na terenie całej Polski i usytuowany jest na wzgórzu górującym nad drogą powiatową Błażkowa Jasło w miejscowości Ujazd. Gmina Brzyska to nie tylko zabytki i unikalny krajobraz, ale to również liczne legendy, wierzenia ludowe oraz tradycje i obyczaje przekazywane od lat z ust do ust. Wierzenia te mogłyby posłużyć jako motyw przewodni podczas organizacji licznych zlotów i rajdów młodzieżowych. Lokalny folklor wpłynęłaby niewątpliwie na uatrakcyjnienie miejscowej oferty turystycznej. 111

112 Miejscowe tradycje kulinarne kultywowane są przez Stowarzyszenie Kobiet Gminy Brzyska Liwoczanka. Stowarzyszenie to, od kilku lat organizuje cyklicznie imprezy o charakterze folklorystycznym, m.in. Święto chleba, na terenie miejscowości Dąbrówka. Podejmując problematykę rozwoju turystyki na terenach wiejskich należy wspomnieć również o poważnym jej ograniczeniu, a mianowicie o problemie sezonowości. Uważam jednak, że zaproponowane przeze mnie kierunki rozwoju turystyki po odpowiednim przygotowaniu pozwolą początkowo ograniczyć, a następnie w pełni zniwelować wspomniany problem. Wówczas gmina Brzyska stanie są idealnym miejscem rozwoju dla turystyki całorocznej. Wnioski Podsumowując, gmina Brzyska leżąca 15 km od Jasła ma olbrzymie szanse, aby stać się głównym ośrodkiem wypoczynku dla mieszkańców powiatu i nie tylko. Zawdzięczać to będzie wysokim walorom przyrodniczo-krajobrazowym, czystemu środowisku naturalnemu, bliskości rzeki Wisłoki, korzystnym cechom glebowo-klimatycznym oraz warunkom dla rozwoju różnorodnych form turystyki. Szansę dla gminy Brzyska stanowić będzie wzrost zainteresowania wypoczynkiem na wsi, możliwość promowania gminy, jako miejsca czystego ekologicznie, co w połączeniu z możliwością dofinansowania inwestycji z zagranicznych środków pomocowych doprowadzi do tego, że gmina ta już w niedługiej przyszłości zdobędzie taką samą renomę miejscowości wypoczynkowej, jak pobliski Folusz czy Krempna. Literatura 1. Dacyl A., Ropa W Powiat jasielski gminy, zabytki, przyroda. Starostwo Powiatowe w Jaśle, Jasło. 2. Ďuriček M., Obodyński K Syntetyczne podstawy rekreacji i turystyki. Wyd. UR, Rzeszów. 3. Hap W Ziemia jasielska nasza małą ojczyzną. Stowarzyszenie Jasielska Federacja Regionalnych Towarzystw Kultury, Jasło. 4. Kondracki J Geografia regionalna Polski. Wyd. PWN, Warszawa. 5. Matejek R., Mikoś G W gminie Brzyska. Wyd. PUW Roksana, Krosno. 6. Podkarpacka Regionalna Organizacja Turystyczna Plan Rozwoju Lokalnego Gminy Brzyska. Rzeszów. 7. Różycki P., Zarys wiedzy o turystyce, Proksenia, Kraków Żaba I Słownik pojęć z geografii społeczno ekonomicznej. Wyd. Videograf Edukacja, Katowice. Prospects for development of tourism in rural areas for example of Brzyska Summary This diploma thesis includes information about the community of Brzyska and its tourist potential. The main aim of a following thesis is to reveal the tourists and landscapes merits of the borough as well as the possibilities of exploiting them. Key words: tourism, merits, development, community 112

113 PROJEKT GOSPODARSTWA AGROTURYSTYCZNEGO O PROFILU TURYSTYKI KAJAKOWEJ W POWIECIE BIŁGORAJSKIM Autorzy: inż. Magdalena Senczyna, inż. Jan Hułas, inż. Łukasz Rybak Opiekun: dr inż. Marta Pisarek SKN Rolników Włościanin Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy ul. Ćwiklińskiej 2, Rzeszów Słowa kluczowe: agroturystyka, produkt agroturystyczny, turystyka kwalifikowana Wstęp Jednym z głównych kierunków charakteryzujących współczesną gospodarkę na terytorium wiejskim jest rozwój turystyki oraz związanych z nią podmiotów gospodarczych. Ten mechanizm jest z każdej strony zalecanym sposobem wchodzenia terenów wiejskich na drogę rozwoju oraz jednym ze sposobów wielofunkcyjnego rozwoju kraju. Polska wieś jest miejscem szczególnym, gdzie zachowane zostały bogate walory przyrodnicze, krajobrazowe i kulturowe, jednak jest także miejscem, gdzie, pod względem ekonomicznym, można mówić o głębokim niedoinwestowaniu i upośledzeniu. Organizowana na obszarach wiejskich przez społeczność lokalną, działalność gospodarcza jest, więc zjawiskiem niezwykle pozytywnym. Właściciele gospodarstw agroturystycznych prześcigają się w pomysłach urozmaicających pobyt turystom. Dla miłośników turystyki aktywnej w zależności od pory roku i specyfiki regionu czekają rowery, narty, łodzie i kajaki. Oferta gospodarstw agroturystycznych musi być atrakcyjna dla turystów, aby mogła wyróżnić się wśród innych propozycji turystycznych [1]. Celem niniejszej pracy jest stworzenie modelowego gospodarstwa agroturystycznego o profilu turystyki kajakowej w powiecie biłgorajskim. Przez powiat biłgorajski przepływa jedna z najpiękniejszych rzek w Polsce - Tanew, a rozległe lasy są miejscem do uprawiania również innych form rekreacji. Niestety walory te są słabo wykorzystywane i na terenie powiatu brak jest ciekawych ofert agroturystycznych. Założono hipotezy badawcze: - powiat biłgorajski spełnia warunki przyrodnicze do rozwoju turystyki kajakowej, - brak ośrodków turystycznych zapewniających kompleksowe usługi (nocleg, wyżywienie, turystyka wodna) stwarza szansę na powodzenie opracowanego projektu. Badania własne Zasięg terytorialny projektu Powiat biłgorajski położony jest w południowej części województwa lubelskiego, na pograniczu Wyżyny Lubelskiej, Roztocza i Kotliny Sandomierskiej. Granica oddzielająca Kotlinę 113

114 Sandomierska i Roztocze biegnie wzdłuż linii Józefów Tereszpol - Frampol i jest dobrze widoczna w terenie. Z jednej strony bezkresna, puszczańska równina, z drugiej pasma niewysokich wzgórz. Powiat biłgorajski zajmuje obszar 1678 km 2 i liczy około mieszkańców, średnia gęstość zaludnienia wynosi 61 osoby na 1 km 2. W jego skład wchodzą: miasto Biłgoraj, trzy gminy miejsko-wiejskie (Frampol, Józefów, Tarnogród), 10 gmin wiejskich (Biłgoraj, Aleksandrów, Biszcza, Goraj, Księżpol, Łukowa, Obsza, Potok Górny, Tereszpol i Turobin). Powiat jest słabo zurbanizowany (32% mieszkańców żyje w miastach). Poza Biłgorajem, liczącym około 27 tys. mieszkańców, pozostałe trzy miasta maja niewielka liczbę ludności (Tarnogród 3,5 tys., Józefów 2,5 tys., Frampol 1,5 tys.). Powiat ma charakter rolniczy, 43% powierzchni zajmują użytki rolne, a 80% mieszkańców gmin wiejskich utrzymuje się z rolnictwa. Dobre warunki do produkcji rolnej znajdują się w północnej części powiatu, gdzie występują urodzajne gleby lessowe. Około 38 % powierzchni powiatu stanowią lasy najwięcej w gminach Biłgoraj, Tereszpol i Józefów. Dość zróżnicowana jest infrastruktura techniczna i komunalna powiatu. Około 75% gospodarstw korzysta z wodociągów, słabo rozwinięta jest natomiast sieć kanalizacyjna. Walory przyrodnicze, krajobrazowe, zabytki sprzyjają rozwojowi turystyki, tworzeniu gospodarstw agroturystycznych. Jest ich jednak w powiecie niewiele [2, 3]. Baza noclegowa powiatu biłgorajskiego to 41 obiektów noclegowych w hotelach, motelach, pensjonatach, schroniskach młodzieżowych w tym 26 to kwatery agroturystyczne z 243 miejscami noclegowymi [4]. Zasoby turystyczne powiatu biłgorajskiego jako baza projektu (budowa geologiczna, klimat, warunki hydrologiczne, dziedzictwo kulturowe i kulinarne) Warunki geologiczne i klimatyczne Powiat biłgorajski należy do obszarów o stosunkowo mało zdegradowanej działalnością człowieka przyrodzie. Zdecydowały o tym różne czynniki. Do najważniejszych zaliczyć należy utrudniony dostęp do bogatych zasobów drewna, spowodowany brakiem rozwiniętej sieci dróg, warunkami naturalnymi (tereny bagniste, trzęsawiska). Istotne znaczenie miało też słabe zaludnienie tego regionu, a w nowszych czasach wolniejsza niż w innych regionach Polski industrializacja. Wpływ na zachowanie walorów naturalnych mają przedsięwzięcia w zakresie ochrony przyrody, które doprowadziły do objęcia ochroną prawną niemal wszystkich, najcenniejszych pod względem przyrodniczym obszarów i miejsc. W Kotlinie Sandomierskiej, będącej częścią Zapadliska Przedkarpackiego, a wiec również na obszarze powiatu biłgorajskiego dominują iły krakowieckie, na nich zaś występują piaski, gliny i pyły czwartorzędowe. W iłach trzeciorzędowych znajdują się złoża gazu ziemnego (Wola Rożaniecka, Tarnogród), a także źródła wód mineralnych (rejon Biszczy). Górna część iłów to surowiec do produkcji wyrobów ceramicznych. Wody z utworów czwartorzędowych wykorzystywane są do zaopatrzenia ludności i przemysłu. 114

115 Roztocze zbudowane jest z wapieni kredowych. Na nich zalegają wapienie trzeciorzędowe, wyżej zaś piaski i lessy czwartorzędowe. W szczelinach wapieni występuje woda pitna. Wapienie są eksploatowane do celów budowlanych, m.in. w kamieniołomie w Józefowie. Są one bogate w szczątki organizmów żywych, występujących pod postacią skamielin. W wyniku procesów eolitycznych powstały w dolinach liczne wydmy piaskowe i zagłębienia deflacyjne, w których gromadziła się woda tworząc z czasem zabagnione jeziorka, mokradła i torfowiska. Czwartorzędowa erozja doprowadziła do osadzania się w niżej położonych obszarach, lekkich mułów i piasków. W warstwach geologicznych występują również lupki, kwarcyty, niewielkie skupiska pirytu, piaskowce i mułowce. Północna część powiatu należy do makroregionu Wyżyny Lubelskiej (Wyniosłość Giełczewska, Padół Zamojski). Występują tu margle z okresu kredowego, pokryte płatami lessu [5]. Powiat biłgorajski znajduje się w strefie klimatu Nizin Podgórskich i Kotliny Sandomierskiej. Średnia temperatura lipca wynosi 18 o C, średnia stycznia -2,8 o C, średni opad roczny 600 mm. Pokrywa śnieżna utrzymuje się około dni. Okres wegetacyjny trwa od 200 do 215 dni. Na warunki klimatyczne duży wpływ wywiera powietrze kontynentalne ze wschodu. Jego chłodne masy zalegają przez dłuższe okresy północno-wschodnie obniżenie Kotliny Sandomierskiej, powodują niższe, niż w sąsiednich regionach, temperatury. Czynnikiem klimatotwórczym są rozlegle masywy leśne i gruba warstwa piasków. Zima powoduje ich wychłodzenie i spadek temperatury, latem natomiast jest tu o 2-3 o C cieplej niż w południowej części Kotliny. Lasy stanowię też zaporę dla zimnych, wschodnich wiatrów, co sprawia ze temperatury odczuwalne są wyższe od rzeczywistych. Wysoki jest stopień nasłonecznienia 50% dni w roku (najwięcej w miesiącach letnich). Cechy klimatu sprzyjają rozwojowi turystyki i rekreacji, zwłaszcza w okresie letnim i wczesną jesienią, kiedy średnie dobowe wahania temperatur są najniższe (cieple, niekiedy upalne dni i równie ciepłe noce). Stosunkowo ostre zimy to z kolei szansa na uprawianie narciarstwa biegowego, dotychczas słabo rozpowszechnionego [6]. Warunki hydrologiczne Rzeki wypływające z Roztocza wykazują cechy rzek górskich z licznymi progami, zaś rzeki Równiny Biłgorajskiej płyną leniwie w rozległych zabagnionych dolinach. Bogactwu sieci rzek powiatu biłgorajskiego, a szczególnie Równiny Biłgorajskiej sprzyja położenie mezoregionu u stop Wyżyny Lubelskiej i Roztocza. Wzdłuż krawędzi tych wyżynnych krain ciągnie się linia źródeł dających początek licznym rzekom i potokom. Niektóre rzeki biorą też początek z licznych puszczańskich bagien i torfowisk. Większość rzek puszczańskich płynie z północnego-wschodu na południowy-zachód, co jest zgodne z konfiguracja terenu. Powiat biłgorajski leży w zlewni rzek Sanu i Wieprza. Rzeką najodpowiedniejszą do uprawiania turystyki kajakowej jest Tanew. Jest główną rzeką powiatu biłgorajskiego, płynie równoleżnikowo ze wschodu na zachód. Stanowi ona prawy dopływ Sanu. Liczy 113 km długości. Jej źródła objęte ochroną rezerwatową znajdują się na wysokości 308 m.n.p.m., na południe od wsi Huta Złomy, na Roztoczu Wschodnim. Na pograniczu Roztocza Południowego i Kotliny Sandomierskiej 115

116 rzeka tworzy liczne wodospady zwane szumami. Teren ten w okolicy miejscowości Rebizanty zajmuje rezerwat leśno-krajobrazowy Nad Tanwią. W korycie Tanwi znajduje się 47 progów skalnych. Tanew wpływa w granice powiatu biłgorajskiego w Borowych Młynach. Następnie rzeka przepływa przez Osuchy, Szostaki, Pisklaki, Księżpol, Zynie, Wólkę Biską, Łazory, Harasiuki, Kurzynę i Ulanów. W Ulanowie Tanew uchodzi do Sanu na wysokości 163 m n.p.m. Średni przepływ Tanwi w dolnym biegu wynosi 13,3 m/s. Górny odcinek Tanwi przepływa przez Południoworoztoczański Park Krajobrazowy Puszczy Solskiej. Znajdują się tu najwyższe wzniesienia polskiej części Roztocza: Wielki Dział, Krągły Goraj, Długi Goraj. Rozlegle dorzecze Tanwi stanowi jeden z najbardziej interesujących, najpiękniejszych pod względem krajobrazowym terenów województwa lubelskiego. Prawobrzeżne dopływy Tanwi to: Potok Łosiniecki, Jeleń, Sopot, Niepryszka ze swoim dopływem Szumem, Spisznica, Łada z połączenia Białej i Czarnej Łady oraz Kurzynka. Lewobrzeżne dopływy Tanwi to: Wirowa ze swoim dopływem Lubienią, Złota Nitka, Łazobna, Borowina. Całkowita powierzchnia dorzecza Tanwi wynosi 2339 ha [7]. Powiat biłgorajski jest ubogi w zbiorniki wód stojących. Są one zlokalizowane w następujących gminach powiatu: Aleksandrów, Biszcza, Frampol, Goraj, Józefów, Łukowa i miasto Biłgoraj. W zbiornikach rekreacyjnych istnieje możliwość kąpieli i pływania z wykorzystaniem kajaków i pontonów. W zbiornikach wodnych i stawach jest możliwość łowienia ryb. Poprawa czystości rzek obserwowana z każdym rokiem wpływa pozytywnie na stan ryb. W wodach Ziemi Biłgorajskiej zaczynają pojawiać się gatunki ryb wymagające czystej wody, jak np. pstrąg. Nie dziwi, więc fakt, że coraz większa liczba amatorów wędkowania spędza czas na połowie ryb. Duże nasłonecznienie, jakie cechuje powiat biłgorajski sprzyja możliwości kąpieli w rzekach i zbiornikach wodnych. Zalewy w Biłgoraju, Biszczy i Józefowie zatrudniają w sezonie ratowników wodnych. Przy zalewach funkcjonują wypożyczalnie sprzętu turystycznego, jak: kajaki, rowerki wodne, deski do windsurfing'u [8]. Dziedzictwo kulturowe i kulinarne Na obszarze powiatu przenikały się ze sobą kultury i religie: rzymskokatolicka, żydowska, greckokatolicka, prawosławna. Spotyka się też ślady osadnictwa wołoskiego, niemieckiego, holenderskiego. Można na tym obszarze spotkać murowane synagogi, dawne cerkwie greko-katolickie i prawosławne, kościoły katolickie, a także kirkuty. Na terenie powiatu znajdują się Izby Pamięci w Józefowie i Biszczy [9]. Jak podaje Ministerstwo Rolnictwa i Rozwoju Wsi na listę produktów tradycyjnych w województwie lubelskim zarejestrowanych jest 77 produktów z różnych kategorii (stan na maj 2011). W powiecie biłgorajskim najbardziej znanymi i lubianymi produktami są: Pieróg (Piróg) biłgorajski dawniej zwany krupniakiem i olej lniany. Obydwa produkty zostały wpisane na listę produktów tradycyjnych dnia 4 października 2005 roku [10]. 116

117 Projekt modelowego gospodarstwa agroturystycznego specjalizującego się w turystyce kajakowej w powiecie biłgorajskim Uzasadnienie projektu Stworzenie zbiornika wodnego Biszcza-Żary oraz usytuowanie rzeki Tanew przyczyniło się do utworzenia ruchu turystycznego w gminie Biszcza. Niestety brak jest w okolicy dostatecznej liczby miejsc noclegowych oraz zaplecza do prowadzenia turystyki kajakowej. Zauważono również trend na wypoczynek w miejscach swojskich i z dala od wielkich kurortów. Dlatego postanowiono stworzyć miejsce, które będzie zapewniać atrakcyjny wypoczynek poprzez wykorzystywanie aktywnej turystyki kajakowej z wszystkimi dodatkowymi atrakcjami, jakie zapewnia agroturystyka tj. obcowanie z fauną i florą, wyciszenie, zbiory runa leśnego, a także spędzania czasu z rodziną wiejską, czyli wpasowanie się w wiejski styl życia. Cele projektu: poprawa własnej sytuacji materialnej, stworzenie miejsca pracy dla właścicielki i jej rodziny, poprawa oferty turystycznej gminy Biszcza, stworzenie atrakcyjnej oferty dla turystów wypoczywających nad wodą, promocja zdrowego stylu życia, zapobieganie marginalizacji ludności wiejskiej, zwiększenie aktywności innych mieszkańców poprzez dawanie dobrego przykładu. Planowane usługi: 4. usługi noclegowe gospodarstwo agroturystyczne będzie dysponowało docelowo 7 miejscami noclegowymi, usług gastronomiczne planuje się w wariancie śniadanie + obiadokolacja, spływy kajakowe po rzece Tanew jedno- i dwudniowe, wypożyczanie sprzętu wodnego i plażowego do korzystania na zalewem Biszcza-Żary, wypożyczanie rowerów, organizowanie wycieczek po okolicy, zajęcia z nordic walking'u, gry terenowe (paintball) w lesie, warsztaty kulinarne, warsztaty artystyczne z rękodzieła z zaproszonymi lokalnymi artystami, ogniska, grille itp., zimą narciarstwo biegowe i kuligi. 117

118 Tabela 1. Analiza SWOT Podsumowanie analiza SWOT projektu Słabe strony Mocne strony brak dostatecznej informacji o ofercie doskonałe warunki do uprawiania sportów turystycznej gminy, wodnych (rzeka Tanew, zalew), nie wystarczający poziom rozwoju brak uciążliwego przemysłu, infrastruktury turystycznej w gminie i obszar słabo zurbanizowany, powiecie, duża powierzchnia obszarów leśnych, brak zagospodarowania terenów nad rzeką, rosnące zainteresowanie turystów rekreacją nad brak otwartych imprez kulturalnych i wodą turystycznych, piękny, krajobraz i dużo zieleni oraz ciekawe brak bazy gastronomicznej w pobliżu zalewu, miejsca do zwiedzania, obfite opady deszczu uniemożliwiając elastyczność dostosowania się do wymogów rekreację na powietrzu oraz przyczyniające klienta się do powstania wysokiego poziomu wody w rzece, długotrwała susza powodująca niski poziom wody w rzece, możliwość pojawienia się nowych konkurentów Zagrożenia degradacja środowiska naturalnego przez turystów, zwiększenie poziomu przestępczości, nagłe pojawienie się zanieczyszczenia zbiornika wodnego. Szanse stworzenie nowych miejsc pracy, zwiększenie się dochodów miejscowej ludności, aktywizacja społeczności wiejskiej, poprawa wizerunku wsi, powstrzymanie migracji ludności wiejskiej, poprawa infrastruktury rekreacyjnej, szanse zbytu żywności wyprodukowanej w gospodarstwach rolnych, wejście na lokalny rynek nowych standardów usług turystycznych Literatura 1. Wojciechowska J Agroturystyka w kreowaniu przestrzeni turystycznej. [w:] Palicha P. (red.) Marka wiejskiego produktu turystycznego. Wyd. Akademii Morskiej w Gdyni, Gdynia, s Lawera H., Bata A Na szlakach turystycznych powiatu biłgorajskiego. 3. Główny Urząd Statystyczny Buraczyński J Roztocze budowa- rzeźba- krajobraz. Wyd. UMCS, Lublin, s Wojewódzki Fundusz Ochrony Środowiska i Gospodarki Wodnej. Raport o stanie środowiska województwa lubelskiego. Biblioteka Monitoringu Środowiska Lublin Kurzyna M Pejzaże powiatu biłgorajskiego- uroki rzek. Agencja Promocyjno- Wydawnicza UNIGRAF, s Strategia Rozwoju Powiatu Biłgorajskiego na lata Strategia Rozwoju Gminy Biszcza na lata Keywords: agrotourism, agritourism product, adventure tourism 118

119 PROJEKT TURYZM DLA REGIONU A ROZWÓJ TURYSTYKI W WOJEWÓDZTWIE ŁÓDZKIM Autorzy: Katarzyna Leśniewska, Marcin Żek Uniwersytet Łódzki, Wydział Nauk Geograficznych Ul. Kopcińskiego 31, Łódź Słowa kluczowe: rozwój turystyki, województwo łódzkie, planowanie strategiczne, produkt turystyczny Wstęp Projekt Turyzm dla Regionu jest Zintegrowanym Programem Rozwoju Doktorantów realizowanym przez Stowarzyszenie Doradców Gospodarczych Pro-Akademia w Łodzi. SDG Pro- Akademia zostało założone w 1996 roku i było pierwszą w Polsce organizacją zrzeszającą zarówno przedsiębiorców jak i wykładowców. Głównym celem Stowarzyszenia jest przede wszystkim działalność na rzecz współpracy podmiotów gospodarczych z instytucjami otoczenia biznesu i organizacjami badawczymi. Projekt Turyzm dla Regionu skierowany jest do doktorantów zamieszkujących województwo łódzkie, którzy chcieliby prowadzić badania na rzecz gospodarki w obszarze turyzmu uwzględniające m.in. aspekty geograficzne, ekonomiczne, prawne etc. 19. Na drodze rekrutacji zostało wybranych 22 doktorantów reprezentujących trzy wydziały Uniwersytetu Łódzkiego, tj. Wydział Nauk Geograficznych, Wydział Zarządzania oraz Wydział Ekonomiczno-Socjologiczny 20. Obowiązkiem doktorantów zakwalifikowanych do projektu jest sformułowanie oraz zrealizowanie badania na rzecz branży turystycznej i usług powiązanych, w których uzyskaną zostaną rezultaty o charakterze: aplikacyjnym (możliwość ich zastosowania przez podmioty gospodarcze), innowacyjnym (brak ich obecnie w regionie), wspierającym rozwój regionu łódzkiego (zgodne z Regionalną Strategią Innowacji oraz strategicznymi dokumentami dla branży turystycznej) oraz benchmarkingowym (odwołujący się do dobrych praktyk) [8]. Każdy doktorant uczestniczący w projekcie posiada Indywidualny Program Rozwoju Doktorant (IPRD) funkcjonujący zarówno w formie papierowej jak i elektronicznej. IPRD spełnia cztery podstawowe zadania, tj. monitoruje i ewaluuje postępy, stanowi podstawę dokumentacyjną sukcesu doktoranta, archiwizuje indywidualną dokumentację doktoranta oraz jest udokumentowaniem kwalifikowalności wypłaty stypendium [8]. Doktoranci biorący udział w projekcie zostali zobowiązani do opracowania: wstępnego raportu metodologicznego, raportu metodologicznego oraz raportu końcowego z badania. Realizacja badań prowadzonych przez doktorantów odbywa się w oparciu o konsultacje z ekspertami z dziedziny nauki oraz praktyki (po 2 godziny pracy każdego z ekspertów w miesiącu). Ponadto doktoranci zobowiązali data dostępu data dostępu

120 się do odbycia praktyki badawczej, czyli nawiązanie współpracy z podmiotami gospodarczymi wskazanymi jako grupa docelowa badania [8]. Oprócz sesji doradczych każdemu uczestnikowi przysługują po dwie godziny coachingu projektowego oraz motywacyjnego. Głównymi celami coachingu projektowego są: wsparcie doktoranta w realizacji celów projektu, monitorowanie realizacji IPRD, wsparcie podczas nawiązywania kontaktu z podmiotami gospodarczymi oraz nadzór przebiegu praktyki badawczej, a także wsparcie doktoranta w osiągnięciu tzw. sukcesu doktoranta. Celami coachingu motywacyjnego są: ukierunkowanie uczestników projektu na realizację zadań, praca nad zmianą ograniczeń w dostępie do zasobów własnych, wsparcie rozwoju potrzebnych kompetencji osobistych i biznesowych [8]. Doktoranci biorący udział w projekcie Turyzm dla Regionu zobowiązali się do opracowania publikacji prezentującej wyniki ich badań oraz kwartalnych publikacji zamieszczanych na stronie internetowej projektu. Celami publikacji kwartalnych jest przede wszystkim dzielenie się wiedzą z innymi doktorantami biorącymi udział w projekcie, upowszechnianie innowacyjnej wiedzy z zakresu rozwoju branży turystycznej oraz promowanie współpracy nauki i gospodarki 21. Dodatkowo wszyscy uczestniczy projektu zobowiązali się do udziału i wystąpienia na konferencji, sympozjum lub forum oraz przygotowania planu komercjalizacji badania i biznes planu firmy typu spin out/ spin off [8]. Realizowane projekty w świetle założeń Programu rozwoju turystyki w województwie łódzkim na lata Województwo łódzkie uchodzi za nieatrakcyjne turystycznie takie opinie powstały na przestrzeni lat w społeczeństwie i funkcjonują po dziś dzień. Władze wojewódzkie, chcąc zmienić ten obraz postanowiły zbudować strategię dla rozwoju turystyki, a działania realizowane w ramach opracowanego planu miałyby zmienić m.in. ten niekorzystny wizerunek łódzkiego. Dokument strategiczny został opracowany w grudniu 2007 roku, przez zespół ekspertów Polskiej Agencji Rozwoju Turystyki, na zlecenie Departamentu Kultury Fizycznej, Sportu i Turystyki Urzędu Marszałkowskiego w Łodzi. Po trzech latach od powstania Programu rozwoju turystyki w województwie łódzkim na lata SDG Pro-Akademia w ramach funduszy strukturalnych uruchomiła Zintegrowany Program Rozwoju Doktorantów Turyzm dla Regionu. Dalsze rozważania autorów, mają na celu udzielenie odpowiedzi na pytanie czy realizowane projekty wpisują się w założenia Programu rozwoju turystyki w województwie łódzkim na lata Opracowanie strategiczne rozwoju turystyki w województwie łódzkim zawiera cztery obszary priorytetowe [24], których wdrożenie i realizacja ma przyczynić się do poprawy pozycji województwa data dostępu

121 łódzkiego na turystycznej mapie Polski, jak również Europy. Strategia, jako rozbudowany dokument, zakładający działania długofalowe zawiera szereg celów głównych i celów uzupełniających, które w sposób przejrzysty i precyzyjny wskazują zakres podejmowanych działań. Na każdy z czterech obszarów priorytetowych składa się jeden cel strategiczny oraz trzy bądź cztery (Priorytet III) cele operacyjne. Taka konstrukcja dokumentu pozwala na uszczegółowienie podejmowanych działań oraz na dokładną kontrolę realizowanych prac. Poniżej przedstawiono strukturę czterech obszarów priorytetowych Programu rozwoju turystyki w województwie łódzkim na lata [23]: Priorytet I Rozwój produktów turystycznych Cel strategiczny 1 Rozwój produktów turystycznych wpływających na kształtowanie turystycznego wizerunku województwa łódzkiego. Cele operacyjne: 1. Rozwój nowych markowych produktów turystycznych o wyraźnej zdolności kreowania wizerunku województwa; 2. Zagospodarowanie atrakcji, rozbudowa istniejących produktów turystycznych oraz podnoszenie ich jakości; 3. Rozwój lokalnych produktów turystycznych wspierających budowę wizerunku turystycznego województwa Priorytet II Kształtowanie atrakcyjnego turystycznie wizerunku województwa łódzkiego Cel strategiczny Wzrost rozpoznawalności turystycznej województwa. Wypracowanie zasad spójnego i skutecznego marketingu turystycznego. Integracja działań informacyjno-promocyjnych. Cele operacyjne: 1. Wykreowanie marki turystycznej województwa; 2. Wdrożenie Wojewódzkiego Systemu Informacji Turystycznej; 3. Wdrożenie systemu monitorowania rynku turystycznego Priorytet III Rozwój zasobów ludzkich oraz współpraca w obszarze turystyki Cel strategiczny Przygotowanie społecznych podstaw do rozwoju turystyki w województwie łódzkim, w tym przygotowanie kadr dla turystyki, kształtowanie świadomych postaw społecznych oraz tworzenie podstaw współpracy i wsparcia dla turystyki. Cele operacyjne 1. Przygotowanie kadr turystycznych zgodnie z potrzebami lokalnego rynku pracy; 2. Podnoszenie poziomu świadomości lokalnej tożsamości kreowanie pozytywnych postaw wśród mieszkańców regionu, w tym również służb publicznych oraz pracowników obsługi turystów; 3. Stworzenie warunków współpracy dla grup interesu z obszaru turystyki; 4. Wzrost rangi turystyki jako dziedziny gospodarki regionu oraz stymulowanie rozwoju inicjatyw społeczno samorządowych na rzecz rozwoju turystyki 121

122 Priorytet IV Zagospodarowanie przestrzeni turystycznej Cel strategiczny Kształtowanie przestrzeni turystycznej województwa do pełnienia funkcji turystycznej oraz rozwój infrastruktury turystycznej Cele operacyjne: 1. Rozwój podstawowej infrastruktury turystycznej zgodnie z oczekiwaniami rynku odbiorców; 2. Kształtowanie i rozwój mikroprzestrzeni turystycznych rozwój infrastruktury wspierającej budowę produktów turystycznych; 3. Podniesienie dostępności komunikacyjnej województwa łódzkiego, w tym ułatwienie dostępu do atrakcji turystycznych. Jak zostało wspomniane we wstępie, w programie Turyzm dla Regionu uczestniczy dwudziestu dwóch doktorantów. Tematyka podjętych badań jest bardzo zróżnicowana i dotyczy wielu sfer szeroko rozumianego turyzmu. Na potrzeby programu, realizowane projekty zostały podzielone na następujące grupy tematyczne [26]: 1. Agroturystyka, obejmująca trzy projekty, których tematyka związana jest rozwojem lokalnym i promocją poprzez działalność agroturystyczną [1, 3, 10]; 2. Geoturystyka, na którą składają się dwa projekty realizowane w obszarze geoturystyki jako produktu turystycznego [15, 22]; 3. Innowacje produktowe w turystyce, na którą to grupę składają się trzy projekty podejmujące badania w zakresie innowacyjnych dla województwa produktów turystycznych [5, 13, 20]; 4. Turystyka biznesowa dwa projekty o charakterze analitycznym dotyczące potencjału województwa łódzkiego w obszarze turystyki biznesowej [2, 4]; 5. Turystyka historyczna, w ramach której realizowane projekty związane są z zasobami dziedzictwa historycznego Łodzi i województwa [12, 17, 18]; 6. Turystyka medyczna, dotycząca wykorzystania zasobów województwa dla turystyki medycznej [7, 11]; 7. Turystyka w rozwoju regionalnym, obejmująca pięć projektów, których cele skupiają się na wsparciu władz lokalnych oraz podmiotów gospodarczych w procesie zarządzania turystyką [6, 9, 14, 19, 23]; 8. Zarządzanie ryzykiem w turystyce dwa projekty związane z szeroko rozumianym bezpieczeństwem turystów odwiedzających województwo łódzkie [16, 21]. Zróżnicowana tematyka podjętych badań powoduje, że zaproponowany podział może budzić pewne wątpliwości, na co wskazuje fakt, iż niektóre z projektów zaszeregowani do danej grupy tematycznej zawdzięczają jedynie tytułowi badania, bądź jego fragmentowi (patrz. np. 4, 7, 12]. Zestawienie zakresu tematycznego realizowanych projektów 22 z wyznaczonymi obszarami priorytetowymi oraz celami strategicznymi i operacyjnymi pozwala wskazać, w jakim zakresie prace 22 Zakres tematyczny projektów realizowanych w ramach programu Turyzm dla Regionu znajduje się w artykułach otwarcia (pozycje w literaturze od 1 do 23 z wyłączeniem poz. 8). 122

123 podjęte przez doktorantów Uniwersytetu Łódzkiego wpisują się z założenia strategiczne Programu rozwoju turystyki w województwie łódzkim na lata (rys. 1) 23. Rys. 1 Projekty realizowane w ramach programu Turyzm dla Regionu w świetle Priorytetów Programu rozwoju turystyki w województwie łódzkim na lata ; źródło: opracowanie własne Zaprezentowane na rysunku 1 zależności pomiędzy tematyką projektów a obszarami priorytetowymi Programu rozwoju turystyki w województwie łódzkim na lata wyraźnie wskazują, że większość podjętych prac wpisuje się w założenia Priorytetów I i II. Należy w tym miejscu podkreślić, iż wszelkie działania podejmowane w sektorze turystyki, mające na celu poprawę funkcjonowania tej gałęzi gospodarki wpływają pozytywnie na wizerunek obszaru (priorytet II) i powodują wzrost jego atrakcyjności turystycznej. Jednak z uwagi na różny zakres prac podejmowanych przez doktorantów, autorzy zdecydowali się wskazać dominujący kierunek ciążenia projektu do jednego bądź dwóch wybranych Priorytetów. Pojawienie się w macierzy wszystkich projektów, oznacza iż w mniejszym bądź większym stopniu wpisują się one w założenia działań strategicznych w zakresie rozwoju turystyki w województwie łódzkim. 23 Numery na rysunku symbolizujące poszczególne projekty badawcze realizowane w ramach programu Turyzm dla Regionu odpowiadają pozycjom literatury, w których zawarta jest tematyka podjętych badań 123

124 Literatura 1. Bogołębska J Agroturystyka jako czynnik rozwoju obszarów wiejskich. data dostępu Bogołębski M Perspektywy rozwoju turystyki biznesowej w województwie łódzkim. data dostępu Dąbkowska M Dolina rzeki Grabi. data dostępu Drożdżyk M Przedstawienie projektu badania pt. Analiza porównawcza tematyki i oferty imprez targowych w kontekście rozwoju branży turystycznej w Łodzi i w wybranych miastach Polski, uzupełniona o zbiór dobrych praktyk z Wielkiej Brytanii.. data dostępu Dziuba J Ruch turystyczny w branży turystyczno - hotelarskiej regionu łódzkiego. Ekologiczny hotel jako element innowacyjnej strategii. data dostępu Gotwald B E-marketing w kreowaniu wizerunku turystycznego regionu łódzkiego. data dostępu Guz M Modele wypoczynku urlopowego łódzkiego środowiska lekarskiego koncepcja badania. data dostępu Stowarzyszenie Doradców Gospodarczych Pro-Akademia Zintegrowany Program Rozwoju Doktorantów Turyzm dla Regionu 10. Indywidualny plan rozwoju doktoranta (IPRD), 2011, Materiały Pro-Akademii. 11. Janusz A Turystyka i zarządzanie projektami w ponowoczesnym świecie. data dostępu Jasiński A Skuteczność promocji z wykorzystaniem Internetowych portali agroturystycznych w świetle opinii ich użytkowników koncepcja badania. data dostępu Kirillis K Określenie potencjału Łodzi w zakresie rozwoju turystyki medycznej. data dostępu Leśniewska K Zarys koncepcji badania pt. Analiza rynku turystycznego podróży Żydów do Łodzi w kontekście rozwoju turystyki w mieście. data dostępu Ludwiczak B Turystyka konna w regionie łódzkim. data dostępu Łaszkiewicz E Przestrzenno-czasowa analiza zróżnicowania liczby turystów i turystycznych obiektów zbiorowego zakwaterowania w powiatach podregionu łódzkiego. data dostępu Majecka A Ślady przeszłości geologicznej regionu łódzkiego podstawą geoturystyki w Parku Krajobrazowym Wzniesień Łódzkich. data dostępu Michalak D Derywaty pogodowe jako instrument efektywnego zarządzania ryzykiem pogodowym, data dostępu Moterski F Region łódzki i jego bogactwo kulturowe a procesy rewitalizacji. data dostępu Musiaka Ł Dostępność zamków i pałaców województwa łódzkiego dla osób niepełnosprawnych. Koncepcja badania. data dostępu Muszyńska A Idea opracowania gry miejskiej dla Głowna. data dostępu Program rozwoju turystyki w województwie łódzkim na lata , Część II strategiczna, Wykonano na zlecenie Urzędu Marszałkowskiego w Łodzi, Departamentu Kultury Fizycznej, Sportu i Turystyki, Warszawa Łódź, Sołtuniak J Bilans otwarcia dla tematyki badawczej dedykowanej perspektywom rozwoju turystyki w wybranych obiektach hydroenegetycznych województwa łódzkiego. data dostępu Sztybel M Poczucie bezpieczeństwa mieszkańców i turystów w przestrzeni Łodzi. Koncepcja badania. data dostępu Wiśniewska M Geostanowiska jako perspektywiczna szansa zrównoważonego rozwoju turystycznego regionu. data dostępu Żek M Planowanie strategiczne w turystyce na poziomie lokalnym koncepcja projektu badawczego, data dostępu

125 Tourism for the Region project in development of tourism in lodzkie voivodeship Summary Authors of this article would like to present a project Tourism for the Region which is an integrated development program of PhD students realizing by The Association Of Economic Consultants Pro-Akademia (AEC PA) in Lodz. The project is directed to the PhD students who live in lodzkie voivodeship and would like to start researches in interdisciplinary tourism (economical, marketing, spatial economy, geographical, environment, cultural, law, sociological and psychological aspects). Studies which are realized by students in the project Tourism for the Region should be applied and caused development of tourism sector and sectors of the relating services in the region. Program began in January and is realizing during 12 months. Special experts have chosen 22 students from 3 departments: Faculty of Geographical Science, Faculty of Management and Faculty of Economics and Sociology in University of Lodz. Researches are realizing with help of experts and coaches. Kay words: development of tourism, lodzkie voivodeship, strategic plan 125

126 PRZEGLĄD GOSPODARSTW AGROTURYSTYCZNYCH PODKARPACIA POSIADAJĄCYCH OFERTĘ ZDROWOTNĄ BAZUJACĄ NA PRODUKTACH EKOLOGICZNYCH Autor: Łukasz Rybak, Magdalena Senczyna, Aneta Środoń Opiekun: dr inż. Marta Pisarek SKN Rolników Włościanin Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy Ul. Ćwiklińskiej 2, Rzeszów Słowa kluczowe: turystyka, agroturystyka, rolnictwo ekologiczne Wstęp Produkt turystyczny, czyli przedmiot transakcji miedzy turystą a przedstawicielem przemysłu turystycznego to, w większości przypadków, zestaw kilku usług tworzących tzw. pakiet, a także dobra materialne. Produktem turystycznym może być lot samolotem, zwiedzanie parku krajobrazowego lub parki rozrywki, bądź miejsce w hotelu, zaś w skład pakietu może wchodzić przelot i nocleg oraz zwiedzanie miasta z przewodnikiem, lub przejazd i pobyt w ośrodku wypoczynkowym połączony z pełnym wyżywieniem i korzystaniem z różnych usług rekreacyjnych. Do dóbr materialnych, wchodzących w skład produktu turystycznego, należą: prospekty, atlasy, przewodniki bądź drobne upominki oferowane przez biura podróży. Cechą charakterystyczną produktu turystycznego jest jego usługowość oraz wynikające z tego złożoność, komplementarność, jedność procesu wytwarzania, wymiany i konsumpcji. Istotą właściwością jest niemożność wytwarzania na zapas, pewnego rodzaju nieuchwytność, swoisty brak właściciela i sezonowość. Wymienione cechy czynią produkt turystyczny i, w efekcie, przemysł turystyczny zjawiskiem unikalnym i złożonym [5, 8]. Dzisiaj jednym z panujących trendów współczesnej turystyki jest dynamiczny wzrost znaczenia turystyki przyjaznej środowisku, bazującej na naturalnych walorach środowiska przyrodniczego, jak i zasoby dziedzictwa kulturowego regionu. Pojęciem obejmującym całokształt gospodarki turystycznej na obszarach wiejskich jest turystyka wiejska. Definiowana jest między innymi jako każda forma turystyki odbywająca się w środowisku wiejskim i wykorzystująca jego walory. Agroturystyka na Podkarpaciu Obecnie w ramach harmonijnego i trwałego rozwoju wsi oraz form turystyki zrównoważonej dużo uwagi poświęca się agroturystyce. Najważniejsze cechy, które ją charakteryzują, są następujące: ochrona środowiska przyrodniczego przez promocję form aktywności turystyczno-rekreacyjnych, które są ekonomicznie produktywne, społecznie odpowiedzialne i przyjazne środowisku; 126

127 podejmowanie działalności turystycznej i rolniczej, co powinno być dostosowane do środowiska i krajobrazu; rozwój produkcji żywności o podwyższonych parametrach ekologicznych; rozwój infrastruktury wspierającej ekologiczne wzory aktywności turystycznej; utrzymanie integralności krajobrazu, wartości kulturowych oraz atrakcyjności wsi i okolicy [8]. Agroturystykę upodobały sobie rodziny z dziećmi. I nic dziwnego, bo gdzie jak nie w gospodarstwie agroturystycznym, miejskie dziecko może zaprzyjaźnić się z krową, pokarmić kury czy króliki, poskakać na sianie, pojeździć na kucykach, czy pomóc gospodarzom uprawiać ogródek. Z racji lokalizacji na wsi, gospodarstwa agroturystyczne najczęściej są otoczone polami, łąkami czy lasami, w których można zbierać grzyby albo jagody. Jeśli gospodarze oferują możliwość wypożyczenia rowerów, jest to idealna okazja do poznania okolicy w bardzo przyjemny sposób [1]. Gospodarstwa agroturystyczne często specjalizują się w jakiejś dziedzinie. Miłośnicy koni znajdą dla siebie wiele miejsc umożliwiających przejażdżki lub naukę jazdy konnej. W gospodarstwach zajmujących się hodowlą koni, możliwe są także przejażdżki bryczką, co stanowi nie lada atrakcję dla dzieci lub może uświetnić jakieś szczególne okazje. W ofercie gospodarstw można znaleźć i takie, które szczególnie ciepło witają wędkarzy, miłośników historii, czy ornitologów. Jest także oferta skierowana do miłośników lalkarstwa, prac plastycznych, garncarstwa. Niektóre gospodarstwa zapraszają na weekendowe warsztaty artystyczne bez telefonów komórkowych, z dala od cywilizacji. Są także gospodarstwa nastawione na edukację najmłodszych. W takich miejscach organizowane są zielone szkoły, czy jednodniowe pobyty grup szkolnych lub przedszkolnych. Oferta jest naprawdę niezwykle szeroka, a pomysłowość i zapał niektórych gospodarzy są imponujące. Jeśli do wszystkich tych atrakcji dodamy jeszcze niezapomniane ogniska, może okazać się, że dzieci mając do wyboru wyjazd na zagraniczne wakacje lub pobyt na wsi w przyjaznym gospodarstwie, wybiorą to drugie [2, 3]. Warto podkreślić, że agroturystyka pozwal na spędzania czasu na wsi przez cały rok.. Coraz więcej turystów korzysta również z wypoczynku w sezonie zimowym, a w szczególności w okresie świątecznym i ferii. Uzależnione jest to oczywiście od pogody oraz od faktu, że coraz więcej osób uprawia sporty zimowe. Wyzwaniem dla właścicieli jest pomysł jak wzbogacić ofertę swojego gospodarstwa, aby zachęcała gości do odwiedzenia ich w sezonie zarówno letnim jak i zimowym. Pierwszą i niekwestionowaną atrakcją spędzania wolnego czasu jest oczywiście oferta związana z narciarstwem. Coraz bardziej popularne stają się narty biegowe. Od dawna na rynku usług turystyki wiejskiej pojawia się niezwykle popularna oferta jazdy konnej. Turyści chętnie pokonują zaśnieżone tereny konno. Największą jednak zimową atrakcją jest kulig z płonącymi pochodniami i kapelą oraz ognisko w mroźnej scenerii. W ofercie gospodarstwa agroturystycznego zimą mogą być również rodzinne spacery. Saneczkarstwo zajmuje również wysoką na liście ulubionych zajęć, dlatego niektóre obiekty posiadają własne tory saneczkowe. Gospodarstwo wiejskie jest prawdziwym zimowym rajem dla dzieci. Po intensywnej zabawie na śniegu, lepieniu bałwana, rozpoznawaniu 127

128 śladów zwierząt na śniegu, szaleństwie na sankach i zjeżdżaniu na workach z sianem lub słomą, dzieci mogą się przyglądnąć dojeniu krów oraz głaskać zwierzęta [7]. Hitem ostatnich sezonów zimowych jest sauna. Na Podkarpaciu można znaleźć coraz więcej takich propozycji, a to za sprawą dostępności środków unijnych na prowadzenie usług agroturystycznych. Wiele gospodarstw poczyniło tego typu inwestycje, wykorzystując wolne zasoby gospodarstwa typu parter, piwnica lub nawet dobudowa dodatkowych pomieszczeń. Zwolennicy podkreślają jej wspaniałe właściwości zdrowotne i relaksacyjne. Właściciele gospodarstw twierdzą, że sauna jest bardzo dobrą inwestycją, która stanowi dodatkową atrakcję oraz podnosi wartość oferty dla gości [4]. Przeglądając oferty gospodarstw agroturystycznych z Podkarpacia zamieszczone na stronie [6] można zauważyć, że atrakcje bezpośrednio związane z gospodarstwem agroturystycznym stanowią ogółem 42%, co piąte gospodarstwo zapewniało bierny wypoczynek na terenie gospodarstwa i w okolicy, aktywny wypoczynek na terenie gospodarstwa - 17%, natomiast turystykę konną 15% (rys. 1). 26% 15% 40% atrakcje bezpośrednio związane z gospodarstwem agroturystycznym bierny wypoczynek na terenie gospodarstwa i w okolicy aktywny wypoczynek na terenie gospodarstwa turystyka konna 19% Rys 1. Procentowy udział ofert podkarpackich gospodarstw agroturystycznych Źródło: opracowanie własne na podstawie [6] Przegląd ofert gospodarstw agroturystycznych Siedlisko Janczar w Pstrągowej To idealne miejsce dla organizacji rodzinnych uroczystości, wypoczynku, krótkich weekendowych pobytów, Zielonych Szkół, Wakacji w siodle, nauki jazdy konnej, a także spotkań biznesowych, szkoleń, konferencji, imprez integracyjnych i wyjazdów służbowych. Ośrodek dysponuje nowoczesną i komfortową bazą noclegowo-gastronomiczną i konferencyjną oraz stadniną koni. Usytuowany jest w malowniczym regionie Polski Południowo-Wschodniej, w województwie podkarpackim, w odległości 20 km od Rzeszowa, w miejscowości Pstrągowa. Poprzez 128

129 różnorodność oferty w gospodarstwie spełniane są oczekiwania najbardziej wymagających Gości organizując m.in.: spacer bryczkami po okolicy np. wycieczkę bryczkami do rezerwatu Wielki Las na ścieżkę dydaktyczno-przyrodniczą, indywidualne przejażdżki konne na maneżu, korzystanie z zaplecza rekreacyjno-sportowego (w tym boiska do siatkówki, placu zabaw dla dzieci, latem basen, quday, skutery śnieżne), zajęcia nording walking pod okiem instruktora sportu, warsztaty taneczne, ceramiczne, bibułkarskie, degustację regionalnych potraw. Gospodarstwo agroturystyczne Leśna Stajnia w Krzywej Gospodarstwo Agroturystyczne LEŚNA STAJNIA położone jest nieopodal Sędziszowa Małopolskiego w miejscowości Krzywa, przysiółek Poręby. Na miejscu do dyspozycji gości są trzy konie: śląska klacz Kinga, sympatyczny hucuł o imieniu Ptyś oraz kucyk Diablo. Istnieje możliwość wstawienia własnego konia do pensjonatu. Jazda wierzchem na ujeżdżalni, nauka jazdy konnej pod okiem instruktora, przejażdżki po lesie, do którego przylega gospodarstwo, antyczna bryczka lub sanie zimą - to przyjemności, z jakich korzystać można przez okrągły rok. Dom freniszówka w Pstrągowej Miłośników kontaktu z naturą zapraszamy do komfortowego domu, w pełni wyposażonego. Wokół strefa ciszy, rzeka, las, pola. Atrakcje, jakie mamy do dyspozycji Państwa to: koncerty świerszczy, rowery/narty biegowe/sanki/pontony/hamak, nauka jazdy konnej pod okiem licencjonowanego instruktora, przejażdżki bryczką, kuligi po malowniczych miejscach wspaniałe warunki do uprawiania narciarstwa biegowego, grill/ognisko/altana, boisko do piłki siatkowej, grzyby, jagody w sezonie, możliwość obserwacji bogatej fauny i flory, poranna kawa w altanie gratis. Gospodarstwo agroturystyczne Złota Przystań w Ożannej Gospodarstwo ekologiczne prowadzone. Gospodarze do dyspozycji Gości przeznaczają dom wolnostojący nad rzeką Złotą. Leży on w otoczeniu lasów a obok domu znajduje się dużo wolnej przestrzeni. Niedaleko domu zalew w Ożannie. Okolica jest mocno zalesiona bogata w grzyby i jagody. Przy domu znajduje się altana, grill ogrodowy, boisko do siatkówki oraz plac zabaw dla dzieci. Wspaniałe warunki środowiskowe zapewniają doskonały wypoczynek osobom zmęczonym cywilizacją i codziennym pośpiechem. Państwo Pędziwiatrowie prowadzą czynne gospodarstwo rolne z produkcją roślinną i zwierzęcą zgodnie z zasadami ekologii. Dla swoich Gości przygotowują posiłki ze zdrowej żywności pochodzącej z ich gospodarstwa. Atrakcje gospodarstwa to: degustacja nalewek, możliwość skosztowania lub zakupu chleba z własnego wypieku, w pobliżu (około 50m) znajduje się kąpielisko, boisko do gier sportowych, plac zabaw dla dzieci, stół do ping-ponga, grill ogrodowy, miejsce na ognisko, możliwość imprez przy kapeli ludowej. Gospodarstwo agroturystyczne Andrzejówka w Bóbrce Proponujemy Państwu spędzenie wolnego czasu z dala od zgiełku wielkiego miasta zapewniając komfortowe warunki w naszym domu umiejscowionym w malowniczych Bieszczadach. To miejsce, za którym się tęskni i do którego się wraca. Na trenie posesji znajduje się plac zabaw dla dzieci, zadaszone palenisko grillowe i miejsce na ognisko. Nasze gospodarstwo jest doskonałą bazą 129

130 wypadową na górskie bieszczadzkie szlaki turystyczne, ścieżki rowerowe i spacerowe. Dysponujemy rowerami. Na życzenie gości organizujemy we współpracy z pobliską stadniną koni, jazdę wierzchem, przejażdżkę bryczką a śnieżną zimą saniami. Wieczorową porą oferujemy miłe chwile spędzone przy ognisku i grillu. Dla lubiących wędkować w okolicy znajduje się wiele czystych i zasobnych w ryby łowisk [4]. Ekoagroturystyka na Podkarpaciu Kolejna formą wypoczynku, która wiąże się z obszarami wiejskimi jest ekoturystyka. Głównym jej celem jest odkrywanie dzikiej przyrody i lokalnej kultury. Stosunkowo nowym pojęciem jest ekoagroturystyka, którym nazywa się wypoczynek u rolników prowadzących gospodarstwa ekologiczne (uprawiających Ziemię i produkujących żywność metodami ekologicznymi) oraz świadczących usługi agroturystyczne. Ta forma wypoczynku zyskuje coraz szersze grono użytkowników, ponieważ rośnie świadomość ekologiczna turystów, a przede wszystkim świadomość żywieniowa szczególnie wśród mieszkańców miast. Poszukują oni już nie tylko ciszy i spokoju podczas wypoczynku, ale także możliwości konsumpcji żywności smacznej, zdrowej i nieskażonej. Odpowiedzią na tego typu potrzeby jest rosnąca z roku na rok liczba gospodarstw ekoagroturystycznych w Polsce. Rosnące zainteresowanie wypoczynkiem na wsi wynika z faktu, iż traktowany jest on jako ucieczka od życia w pośpiechu, hałasie i niesprzyjającym środowisku. Podczas wypoczynku turyści pragną ciszy, spokoju, czystego powietrza i zdrowej żywności. Pobyt w gospodarstwie ekoagrotyrystycznym dla turystów to także lekcja edukacji ekologicznej, która wykształca świadomość proekologiczną oraz przyczynia się do wzrostu szacunku dla pracy rolnika. Obecnie w zakresie rosnącego popytu na usługi turystyczne w Polsce, Podkarpacie ma szansę stać się ekologicznym regionem turystycznym, gdyż może on zaoferować produkt turystyczny (ekoprodukt), który: bazuje na lokalnych zasobach przyrodniczych, materialnych i ludzkich, jego wytwarzanie jest zlokalizowane w nieskażonym środowisku, obejmuje szeroki wachlarz usług, zajęć i urządzeń zaspokajających potrzeby rekreacyjne i odpowiedniego spędzania wolnego czasu, służy zdrowiu i jest przyjazny środowisku. Turystyka jest dobrym narzędziem promocji rolnictwa ekologicznego i zdrowego stylu życia. Połączenie tych dwóch kierunków - wytwarzania produktów ekologicznych i świadczenie usług agroturystycznych jest bardzo pożądane. Według ECEAT - Poland, organizacji promującej gospodarstwa ekologiczne świadczące usługi agroturystyczne, w Polsce istnieje kilkadziesiąt gospodarstw zrzeszonych w tej jedynej tego rodzaju organizacji w Polsce. Ta grupa gospodarstw będzie mogła wyodrębnić swoją ofertę agroturystyczną i wzmocnić ją o możliwość oferowania swoim 130

131 gościom żywności ekologicznej. Połączenie rolnictwa ekologicznego i agroturystyki zaowocuje wzrostem ich dochodowości i konkurencyjności na rynku usług turystycznych [1]. Z badań przeprowadzonych przez Knap w Polsce do 2010 roku działało 116 gospodarstw ekoagroturystycznych. Ich średnia wielkość wynosiła 21 ha. Gospodarstwa o najmniejszej średniej powierzchni znajdowały się w województwie śląskim, małopolskim, podkarpackim, natomiast gospodarstwa ekoagroturystyczne o największej średniej powierzchni zajmowały tereny województw zachodnio-pomorskiego, kujawsko-pomorskiego, dolnośląskiego wielkopolskiego. Podsumowanie Na terenach Podkarpacia widać wyraźny wzrost zainteresowanie rolnictwem ekologicznym. Ten sposób gospodarowania rolnicy podejmują coraz częściej inspirowani wzrastająca liczba konsumentów, którzy poszukują płodów oraz produktów o wysokiej wartości odżywczej, dobrym smaku i o znanym pochodzeniu. Ponadto sprzyja temu fakt wypłacania dotacji do powierzchni upraw ekologicznych. Rolnicy ekologiczni szukając dróg rozwoju często łączą produkcję rolną z agroturystyką. Dzięki temu rodzi się nowy interesujący rodzaj produktu - turystyka zdrowotna. Jak się okazuje coraz więcej ludzi zaczyna rozumieć, że wizyta w gospodarstwie agroekoturystycznym jest gwarancją korzystania z rekreacji biernej i czynnej w nieskażonym środowisku oraz spożywania posiłków z produktów o podwyższonej wartości biologicznej. Literatura 1. Figórska E Biuletyn Polskiego klubu ekologicznego, Wyd. Zarząd Główny Polskiego Klubu Ekologicznego, Kraków, nr Gąsiorowski M O produktach tradycyjnych i regionalnych. Możliwości a polskie realia, Fundacja Fundusz Współpracy, Warszawa. 3. Kulczycki Z Zarys historii turystyki w Polsce. Wyd. Sport i turystyka, Warszawa. 4. Województwo Podkarpackie, Na mapie Europy, Wyd. Urząd Marszałkowski Województwa Podkarpackiego. 5. Wojtasik L., Tauber R Nowoczesna turystyka i rekreacja. Wydawca Wyższa Szkoła Gastronomii i Hotelarstwa, Poznań Zima w agroturystyce Biuletyn informacyjno-handlowy Podkarpackiego Ośrodka Doradztwa Rolniczego, nr 2, s Żemła M Produkt turystyczny - ujęcie przedmiotowe. Problemy turystyki, nr 1-2, s Summary In the province of Podkarpackie very clearly a growing interest in organic farming. This way of farming, farmers take more and more inspired by the growing number of consumers who want crops and products of high nutritional value, good taste and of known origin. Moreover, they are encouraged by the introduction of subsidies for organic area. Organic farmers looking for ways to develop agricultural production is often linked to rural tourism. Thanks to this interesting product may be formed in health tourism. As demonstrated in the work of the farm visit agroekoturystycznym guarantees the use of active and passive recreation in the unpolluted environment, and eating the products of higher biological value. 131

132 ROZWÓJ OŚRODKÓW TURYSTYKI KONNEJ W REJONIE BIESZCZADÓW Karol Sołek, Anna Góra Opiekun: dr inż. Jadwiga Topczewska Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy, Zakład Produkcji Zwierzęcej i Oceny Produktów Drobiarskich Adres ul. Zelwerowicza 4, Rzeszów Koło Naukowe AnimalEquus Słowa kluczowe: turystyka konna, Bieszczady, rozwój Wstęp Bieszczady stanowią rozległy obszar górski, będący częścią łańcucha Karpat. Położone w północno wschodniej części Polski, ich obszar rozciąga się od Przełęczy Łupkowskiej na zachodzie, aż do Przełęczy Użockiej na wschodzie. W obrębie bieszczadzkiego pasma górskiego położony jest powiat bieszczadzki, który stanowią trzy gminy: Czarna, Lutowiska oraz Ustrzyki Dolne. Jest to jeden z najpiękniejszych regionów Podkarpacia. Liczne szlaki spacerowe oraz rozbudowana infrastruktura turystyczna, dobrze rozwinięta oferta pobytowo rekreacyjna, niewielka odległość od innych ważnych ośrodków regionu pozytywnie wpływają na ruch turystyczny oraz rozbudowę ośrodków przystosowanych do wypoczynku. Powiat bieszczadzki zajmuje powierzchnię 1138,17km 2, należy do najrzadziej zaludnionego powiatu w Polsce, oferując czystą, nieskażoną przyrodę. Na jego terenie znajduje się wiele cennych zabytków architektury drewnianej. Region ten obfituje także w liczne atrakcje turystyczne, m.in. wyciągi narciarskie, korty tenisowe, kąpieliska, boiska sportowe, stadniny koni, ośrodki jeździeckie oraz gospodarstwa agroturystyczne proponujące turystykę konną. Bieszczady ze swoimi wielkimi przestrzeniami są doskonałym miejscem do realizacji tej formy wypoczynku. Obecność koni i jazda konna stanowi sztandarowy produkt agroturystyki (nauka jazdy konnej, jazdy rekreacyjne i terenowe). Należy podkreślić, iż turystyka konna jest jedną z najbardziej przyjaznych środowisku form turystyki. Turystyka i rekreacja jest bardzo rozległym zjawiskiem, jakim jest wypoczynek, podejmowany w czasie wolnym w celu regeneracji sił fizycznych, umysłowych i psychicznych. Najczęściej jako zaplecze wykorzystuje się zasoby przyrodnicze regionu [2, 5]. Celem pracy była analiza rozwoju obiektów turystyki konnej na terenie powiatu bieszczadzkiego. Materiał i metody Materiał badawczy stanowiła dokumentacja Polskiego Związku Hodowców Koni. W zestawieniu uwzględniono ośrodki posiadające minimum 5 koni. Wykorzystano również dane GUS. Wyniki zestawiono na wykresach. 132

133 Wyniki Liczebność pogłowia koni w Polsce w latach przedstawiono na rys. 1. Największy spadek liczby koni w Polsce zanotowano do 1995 roku. Jak wskazują szacunki GUS, w kolejnych latach tendencja ta utrzymywała się nadal, chociaż jej tempo było wyraźnie mniejsze. Szacowane pogłowie koni w Polsce w 2010 roku wynosiło 297,9 tys. szt. Prognozy wskazują, że od roku 2010 populacja koni będzie ulegać stopniowemu zwiększeniu [3, 7]. Maleje ogólna liczba koni, bo zmniejsza się liczba koni roboczych. Rośnie natomiast populacja koni wierzchowych [2, 8]. Rys. 1. Pogłowie koni w Polsce w latach (tys. szt.) (wg danych GUS) Liczbę obiektów utrzymujących konie (co najmniej 5 sztuk), z przeznaczeniem do wykorzystania w rekreacji i turystyce przedstawiono na rys. 2. Jak wykazała analiza, w 1990 roku było tylko 3 stadniny koni. Największy wzrost liczby obiektów utrzymujących konie zanotowano w okresie między 1990 a 1995 rokiem. Hodowla koni jest w Unii Europejskiej w uprzywilejowanej sytuacji, nie podlega limitom sektorowym. Ponadto jest zgodna z polityką UE promowania wielofunkcyjnego charakteru obszarów wiejskich. Koń jest produktem rolnictwa użytkowanym w głównej mierze w strefach miejskich i podmiejskich. Jest przede wszystkim partnerem człowieka w sporcie i rekreacji [1, 3]. Ponieważ koń nie niesie ze sobą żadnego zagrożenia ekologicznego może być wykorzystywany na terenach cennych przyrodniczo (Parki Narodowe, rezerwaty, tereny chronione). 133

134 Rys. 2. Liczba obiektów utrzymujących konie w powiecie bieszczadzkim Rys. 3. Liczba koni wykorzystywanych w turystyce i rekreacji na terenie powiatu bieszczadzkiego Szacowaną liczbę koni przeznaczonych do użytkowania w turystyce i rekreacji na terenie powiatu bieszczadzkiego przedstawiono na rys. 3. Wyniki wskazują na duży wzrost w okresie między 1990 a 1995 oraz 2005 i 2010 rokiem. Szczegółowa analiza wykazała, iż w latach powstawały głównie stadniny koni utrzymujące liczne pogłowie. Natomiast w okresie od 2005 roku zwiększeniu ulegała liczba gospodarstw agroturystycznych, utrzymujących nieliczną stawkę koni, często 3-4 sztuki, których nie uwzględniano w zestawieniu. Należy zaznaczyć, iż liczba zwierząt ulega stałym nieznacznym wahaniom (sprzedaż, powiększanie oferty ośrodka lub ich likwidacja). Rozwijającej się bazie turystycznej sprzyjają walory przyrodnicze regionu a przede wszystkim zainteresowanie części społeczeństwa ideą powrotu do natury, ekologii i zdrowego stylu życia. Obecność konia do jazdy rekreacyjnej w gospodarstwie agroturystycznym stanowi dodatkową atrakcję, podnoszącą wartość oferty. Jazda konna posiada walor terapeutyczny i rehabilitacyjny [6]. 134

135 Rejon Bieszczadów jest zasobny w trwałe użytki zielone, będące podstawą w żywieniu i utrzymaniu tego gatunku. Ponadto posiada wiele atrakcyjnych terenów, z bogatą ofertą górskiej turystyki konnej. Rajdy jedno i wielodniowe znajdują się w ofercie wielu ośrodków. Przyrodę Bieszczadzkiego Parku Narodowego można podziwiać również z końskiego grzbietu. Doświadczenia krajów Europy Zachodniej pozwalają przypuszczać, iż jeździectwo i rekreacja stanie się w Polsce masowe, obejmując tys. osób. Poprawie sytuacji ekonomicznej społeczeństw towarzyszy wzrost wymagań odnośnie czynnego wypoczynku [4, 8, 9]. Obecna struktura krajobrazu na obszarach wiejskich z dominacją ekstensywnych gospodarstw o małej powierzchni sprzyja zachowaniu bioróżnorodności. Jednocześnie obszary wiejskie są znacznie zróżnicowane pod względem ekonomicznym, społecznym i strukturalnym. Specyfice prowadzenia działalności rekreacyjnej lub usługowej związanej z branżą końską sprzyja bliskość zwierząt. W przypadku ruchu turystycznego oferta wzbogacana jest zgodnie z możliwościami regionu i oczekiwaniami turysty. Koń uznawany jest za,,istotę ekologiczną, przyjazną środowisku. Nie produkuje uciążliwych dla środowiska zanieczyszczeń. Może być zatem bez przeszkód użytkowany na terenach chronionych. Wnioski Turystyka konna od kilkunastu lat przeżywa renesans i staje się nie tylko sposobem na aktywny wypoczynek. Jest też pomysłem na dochodową działalność gospodarczą. Obserwowany dynamiczny wzrost ośrodków rekreacyjnych na terenie Bieszczadów jest odpowiedzią na potrzeby rynku a zainteresowanie aktywnymi formami wypoczynku z wykorzystaniem zwierząt wpisuje się w specyfikę regionu. Badania pokazują, iż w ofercie wypoczynkowej tworzonej pod oczekiwania współczesnego turysty nie może zabraknąć jazdy konnej. Szczególnie korzystne warunki do uprawiania turystyki konnej znajdują się w Bieszczadach i Beskidzie Niskim, choć i pozostałe części województwa Podkarpackiego mają dobre warunki do jej uprawiania. Rozwój hodowli koni oraz propagowanie jeździectwa jest zgodne z polityką UE promowania wielofunkcyjnego charakteru gospodarstw wiejskich, zapewnia szeroki wachlarz możliwości dla ekonomiki terenów wiejskich. Przyczynia się do zachowania dziedzictwa kulturowego regionu, m.in. poprzez kultywowanie imprez z wykorzystaniem regionalnych ras koni. Na terenach zasobnych w trwałe użytki zielone umożliwia ich racjonale wykorzystanie. Wpływa na rozwój przedsiębiorczości, zapewnia miejsca generując jednocześnie wiele unikatowych i zamierających zawodów. Literatura 1. Hadberg A., Helgesson A Implications of introducing equine services onto farms A European perpective.52 EAAP Annual Meeting. Budapest. 2. Legienis H Rynek jeździecki podaż. Instytut Turystyki, Warszawa. 3. Łojek J Ekonomiczne i społeczne znaczenie przemysłu końskiego oraz warunki jego rozwoju. Koń zwierzę z przyszłością. PZHK, PZJ, Warszawa. 4. Łojek J Miejsca pracy w krajowym przemyśle końskim. Międzynarodowa konferencja Konie dają pracę. Warszawa. 5. Przezbórska L., Sznajder M Agroturystyka. Polskie Wydawnictwo Ekonomiczne. Warszawa. 135

136 6. Topczewska J Ośrodki Jeździeckie jako czynnik rozwoju obszarów wiejskich na Podkarpaciu. Roczniki Naukowe Stowarzyszenia Ekonomistów Rolnictwa i Agrobiznesu, tom XI, z. 5, s Ministerstwo Rolnictwa i Rozwoju Wsi Zarys kierunków rozwoju obszarów wiejskich. [www.bip.min-rol.gov.pl]. 8. Narodowy Program Rozwoju Hodowli Koni i Jeździectwa. Hippica Pro Partia [www.pzhk.pl] 9. The Horse Industry In the European Union. Working Report prepared for EU Equss June Skara and Solvalla, Sweden. The Development of Riding Tourism Resorts in the Area of Bieszczady Mountains Summary The aim of this MA Thesis was to analyse the developmnent of resorts offering equestrian tourism and recreation in the Bieszczady county area. This region is extremely attractive for doing active tourism. Reasearch has shown a steady growth of number of places keeping horses since The most dynamic increase was observable between 1990 and 1995 (number of resorts and maintained horses), as well as between 2005 and The Bieszczady county has abundant tourist attractions and the possibility of doing equestrian tourism in mountains is indubitably a great advantage of this region. Key words: equestrian tourism, Bieszczady Mountains, development 136

137 TURYSTYKA W GMINIE KLIMONTÓW Katarzyna Kiliańska SKN Procent,Opiekun: Dr M. Leszczyński Uniwersytet Humanistyczno- Przyrodniczy Jana Kochanowskiego w Kielcach, Ul. Świętokrzyska 21, Kielce e- mail: Słowa kluczowe: turystyka, strategia rozwoju turystyki, Klimontów. Wstęp Jednostki samorządu terytorialnego tak samo jak podmioty gospodarcze podlegają walce konkurencyjnej. Gminy powadzą swego rodzaju walkę o zasoby finansowe, rzeczowe, starają się być lepsze w przyciąganiu inwestorów, a także turystów. Na przestrzeni ostatnich lat, turystyka stała się ważnym obszarem, który umożliwia kreowanie gminom swojej pozycji konkurencyjnej. Wykorzystanie istniejącego potencjału turystycznego powoduje poprawę jakości życia mieszkańców wspólnoty gminnej, przyczynia się również do poprawy wizerunku całej gminy. Rozwój turystyki w gminie Rozwój turystyki w gminie jest to dynamicznie ujmowany proces przemian istniejących form turystycznych na jej terenie, który prowadzi do korzystnych zmian ilościowych i jakościowych w turystyce. Proces ten musi przebiegać według przyjętych zasad, by nie stał się chaotyczny. Zarówno ogólne, jak i te bardziej szczegółowe wytyczne zazwyczaj są zbierane i ujmowane w formie jednego dokumentu- strategii. Strategia rozwoju turystyki w gminie to długookresowy plan działania, określający strategiczne cele rozwoju turystyki oraz przyjmujący takie kierunki i priorytety działania, a także alokację środków finansowych, które są niezbędne dla realizacji przyjętych celów i zadań [5]. Strategia powinna zawierać tylko takie zadania, które dana jednostka jest w stanie zrealizować. Przy formułowaniu zadań trzeba brać pod uwagę sytuację, w jakiej znajduje się gmina, sprawdzić czy dysponuje ona wystarczającą ilością środków finansowych do realizacji zamierzeń. Samorządy terytorialne powinny być zainteresowane rozwojem turystyki, gdyż może ona stać się motorem napędowym aktywizacji społeczno- gospodarczej gminy i w efekcie przynosić jej wymierne korzyści w postaci zwiększonych wpływów budżetowych, napływu siły nabywczej, przyciągania kapitału z zewnątrz i w rezultacie stworzenia nowych miejsc pracy. Turystykę powszechnie uważa się za skuteczną receptę na problemy społeczno-ekonomiczne nękające obszary wiejskie. Dlatego na szczeblu zarówno regionalnym jak i krajowym dużą wagę przywiązuje się do polityki wspierania rozwoju turystyki wiejskiej [8]. Szczególna rola administracji terenowej polega na stymulowaniu oraz wspieraniu pożądanych kierunków rozwoju turystyki poprzez prowadzenie odpowiedniej polityki turystycznej. Celem gminy powinno być udostępnienie posiadanych dóbr lub walorów i świadczenie usług z nimi związanych: naturalnych, kulturowych i komplementarnych oraz 137

138 innych usług (noclegowych, gastronomicznych, transportowych, informacyjnych, łączności, organizacji wypoczynku, przewodnictwa, handlowych, rzemieślniczych). Samorząd lokalny może między innymi zaznaczyć swój wkład w rozwój agroturystyki na swoim terenie, może popierać takie inicjatywy jak wytyczanie tras spacerowych, budowę kortów tenisowych, basenów kąpielowych itp.[3]. Ważną rolę w rozwoju turystyki lokalnej odgrywają dobra komplementarne, czyli infrastruktura techniczna (drogi, szlaki turystyczne, parkingi, przystanie, sieć noclegowa i gastronomiczna) oraz infrastruktura społeczna, tj. biura i agencje turystyczne, informacja turystyczna, obiekty sportowe i wypoczynkowe [7]. Turystyka, a konkurencyjność Niewątpliwie turystyka może być sferą, w ramach, której gminy ze sobą konkurują. Rozwój turystyki dynamizuje wielokierunkowy rozwój całej gminy [5]. Walory wypoczynkowe, zdrowotne, poznawcze, występujące w danym regionie decydują o jej atrakcyjności dla turystów. O atrakcyjności decyduje także jakość oferowanych dóbr i usług, program imprez kulturalnych, sportowych, artystycznych, czy innych form spędzania czasu. Innymi słowy zabytki, tradycje, placówki gastronomiczne, komunikacja, imprezy, rajdy muszą łącznie zainteresować podróżujących. Dlatego działania podnoszące konkurencyjność gminy nie mogą ograniczać się jedynie do dbania o bazę noclegową, czy architekturę, należy także przygotować i realizować strategię budowania konkurencyjności, budować wizerunek gminy, i wspomagać powstawanie i rozwój podmiotów zajmujących się ruchem turystycznym. Aby maksymalnie wykorzystać potencjał turystyczny regionu należy zorganizować i stosować różne formy i środki działań informacyjno- promocyjnych, żeby dotrzeć do jak najszerszego grona potencjalnych klientów- turystów. Walory gminy muszą zostać podane do ogólnej wiedzy klientów. Służy temu promocja, która aby mogła dać pożądane efekty musi zostać uprzednio przygotowana zarówno pod względem treści, jak i formy. Dobrze opracowana i przeprowadzona akcja promocyjna dostarczy wielu informacji turystom, które pozwolą na ukształtowanie w ich oczach pozytywnego wizerunku regionu. W celu podjęcia działań promocyjnych można wykorzystać różnorodne metody, jak reklama prasowa, tablice ogłoszeniowe, reklama wydawnicza (foldery, ulotki), wystawiennicza (wystrój stoiska), upominkowa (kalendarze, długopisy), internetowa. Najlepsze rezultaty osiąga się zwykle stosując nie jeden, a kilka sposobów dotarcia do turystów jednocześnie. Nieodłącznym składnikiem promocji turystycznej jest informacja. Informacja turystyczna uznawana jest jako jedna z potrzeb turystów, przejawiająca się w zapotrzebowaniu na odpłatne bądź nieodpłatne udzielanie informacji na temat danego miejsca lub obiektu. Jest to zespół działań zapewniających turystom lepszą orientację w danym miejscu, umożliwiając pełniejsze poznanie walorów turystycznych [4]. W gminach, w których intensywnie rozwija się turystyka, można wymienić główne korzyści z rozwoju tego działu: agroturystyka jako jedna z form turystyki, łączy się z powstawaniem więzi 138

139 społeczno- ekonomicznych między turystami a rolnikami, społecznością wiejską podczas czasowego przebywania osób przyjezdnych w gospodarstwach rolnych, zwiększenie roli i prestiżu rolnika, wzajemne przenikanie kultur [3],rozwój turystyki może stymulować rozwój gospodarstw rolnych, tworząc dodatkowe rynki zbytu na produkty żywnościowe i usługi, pozytywny wpływ na zwalczanie bezrobocia ukrytego, powszechnego w wielu gminach, a także dostarczanie dodatkowych dochodów gospodarstwom domowym. Jednak ukazywanie tylko dodatnich stron rozwoju turystyki nie jest słuszne, bowiem w konfrontacji z rzeczywistością ujawnią się negatywne aspekty tego zjawiska. Turystyka niesie ze sobą również pewne niebezpieczeństwa. Jednym z istotnych jest zmniejszenie poczucia bezpieczeństwa wśród mieszkańców przyjmujących turystów i nierzadko wśród samych turystów w miejscowościach, w których występuje duże natężenie ruchu turystycznego. Problem ten jest jednym z wielu pilnych zadań do rozwiązania przez samorząd lokalny [2]. Innymi skutkami są wzrost przestępczości i degradacja środowiska naturalnego. Gmina Klimontów- przegląd zabytków Gmina Klimontów jest jedną z gmin województwa świętokrzyskiego i jest położona jest we wschodniej jego części. Klimontów to stara i malowniczo położona w dolinie Koprzywianki osada. Gmina charakteryzuje się najwyższym w województwie pod względem ilościowym nasyceniem nieruchomymi dobrami kultury. Z obszaru gminy do ewidencji wpisano 896 obiektów nieruchomych, spośród których 34 posiada wyższą rangę ochronną. Nasycenie zabytkami ruchomymi w gminie jest średnie 276 obiektów. Najważniejszymi obiektami zabytkowymi i elementami oferty turystycznej w gminie są [6]: Kościół św. Jacka z lat , wzniesiony w tradycji gotyckiej, o ścienno-filarowej konstrukcji wnętrza ze współczesnymi elementami m. in. z wczesnobarokowymi szczytami, elementami kamieniarki architektonicznej i sztukatorską dekoracją sklepień. Barokowa Kolegiata z lat , p.w.św. Józefa- wzniesiona na planie elipsy według projektu architekta włoskiego Wawrzyńca Senesa), będąca jedną z najoryginalniejszych budowli XVII wieku w Polsce, usytuowana jest na niewielkim pagórku. Klasztor z lat , jest budowlą piętrową, wzniesioną na rzucie zbliżonym do kwadratu, z prostokątnym wirydarzem pośrodku. Plebania wystawiona przed 1758r., dawny dworek infułatów. Plebania jest murowana z kamienia na rzucie prostokąta. Bramka - prowadząca na cmentarz kościelny. Murowana ok r., z dwoma bocznymi furtkami i kamiennymi późnobarokowymi posągami Wiary i Nadziei. Pomnik Powstańców 1863r.- tuż przy głównym wejściu na cmentarz. Wystawiony został w 1924 r., na cześć powstańców poległych w bitwach w pobliżu Klimontowa. 139

140 Synagoga z 1851 roku, powstała we wschodniej części Klimontowa, tworzącej dzielnicę żydowską, przy niewielkim placu obok rynku. To budynek prostokątny, z czterokolumnowym portykiem jońskim. Za świątynią znajdują się pozostałości cmentarza żydowskiego. Goźlice -stary kościół z XIII wieku, wybudowany za czasów panowania Bolesława Krzywoustego. Godne obejrzenia w kościele są: renesansowy nagrobek Hieronima Ossolińskiego wykonany przez warsztat Santi Gucciego, wczesnobarokowy ołtarz drewniany w bocznej kaplicy i obraz pędzla Wojciecha Gersona w ołtarzu głównym. Pozostałości zamku Ossolińskich z lat , z zachowanymi resztkami fundamentów oraz potężną arkadą mostu łączącego niegdyś pałac z przeciwległym wzgórzem. Kaplica podziemna zwana Betlejemską z 1640 roku, zbudowana na rzucie zbliżonym do trójkąta, nakryta nadziemnym kopcem, na który sprowadzano ziemię z miejsca narodzin Chrystusa Betlejem. Obok wartościowych i interesujących obiektów architektonicznych, władze gminy starają się zapewnić różnego rodzaju imprezy kulturalno- rozrywkowe zarówno mieszkańcom, jak i osobom przyjeżdżającym w celach turystycznych. Do ważniejszych imprez, które na stałe wpisały się w kalendarz wydarzeń kulturalnych zaliczają się: Gminny Piknik Rodzinny Klimontowska Majówka, Obchody Bitwy pod Konarami, Międzyzakładowy Puchar w Piłce Nożnej o Puchar Dziecka pod hasłem Ofiaruj Dzieciom Wakacje (zasięg powiaty), cykl imprez w czasie wakacji, Jarmark na Św. Jacka, Brunonalia, integracyjny Bieg Klimontowski oraz 11 listopada uroczystości patriotyczne przy cmentarzu legionistów w Górach Pęchowskich. Turystyka w Gminie Klimontów - analiza Gmina Klimontów dysponuje dużym zasobem atutów, jeśli chodzi o warunki turystyczne. Ma duże możliwości rozwoju tego działu, jednak obecne władze nie wykorzystują ich maksymalnie. Uważam, że to duży błąd, gdyż trzeba wyłapywać i wykorzystywać wszelkie nadarzające się ku temu okazje, zanim wykorzystają je inne gminy. Obecnie większość przebywających na obszarze gminy Klimontów turystów nie korzysta z pełnego pakietu usług, jakie mogłyby ich tu czekać. Powodem jest szczupłość istniejącej bazy usługowej i noclegowej-brak najbardziej popularnych rodzajów obiektów noclegowych. Słabo rozwinięta jest również agroturystyka mimo, że większość miejscowości należących do gminy Klimontów posiada duży potencjał do rozwoju tej formy noclegów. A przecież wciąż rosnące zapotrzebowanie na wczasy blisko natury stwarza dla gminy realną szansę rozwoju. Powodem tego iż eko- i agroturystyka nie rozwijają się na terenie gminy Klimontów mogą być sami mieszkańcy. Ze strony mieszkańców wsi przeszkodą rozwoju tego działu jest obawa przez wpuszczeniem obcych do domu i niechęć do dokonywania jakichkolwiek zmian w swoim dotychczasowym trybie życia. Prowadzenie gospodarstwa agroturystycznego, 140

141 podobnie jak każdego innego przedsięwzięcia wymaga od rolników zmiany zachowań, mentalności. Z gospodarza należy się przekształcić w managera, który dba nie tylko o siebie i własny interes, ale przede wszystkim o dobro gości [3]. Następnym problemem jest nieobecność odpowiedniego zaplecza gastronomicznego. Te które, obecnie znajdują się na terenie gminy, w większości mają charakter sezonowy i nie są w stanie zapewnić pełnej gamy usług w zakresie żywienia. Władze gminy Klimontów powinny odstąpić od sztywnych reguł postępowania, funkcjonowania podległego mu organu, by było ono bardziej elastyczne. Wójt powinien starać się poznać ludzi-mieszkańców gminy, a także zalety mini-regionu, jakim zarządza, by móc je następnie odpowiednio wypromować. Ważne jest by został stworzony informator o atrakcjach i ofertach dla turystów i osób szukających miejsca dla wypoczynku na wsi. Dziś nowoczesnemu turyście nie wystarczają tylko piękne widoki, rozciągające się krajobrazy, ani cudowne zabytki architektoniczne, jeśli musi ich szukać na własna rękę. Brak dokładnych informatorów, tablic informacyjnych, oznakowania tras dojazdowych powoduje, że wiele niepowtarzalnych zakątków, budynków i pomników przyrody zostaje niezauważonych. Wydanie przewodnika w formie książki jest kosztowne, lecz zazwyczaj owocuje napływem turystów, a więc i zysków. Przy odpowiedniej reklamie nastąpi znaczący wzrost liczby odwiedzających, którzy mając do dyspozycji tak bogatą ofertę na pewno skorzystają z możliwości dłuższego pobytu. Do przekazania szerszej rzeszy osób stworzonej oferty turystycznej i rekreacyjnej, gmina wykorzystuje internet. Na swojej stronie www zamieszczane są podstawowe informacje dla turystów. W Gminie Klimontów działają już gospodarstwa agroturystyczne, które nieźle prosperują. Jednak, aby prosperowały jeszcze lepiej, należy zadbać o to, by było ich więcej. Prawdą jest, że tylko grupa gospodarstw agroturystycznych ma szansę stać się poważną ofertą dla przyjezdnych. Ponadto będą mogły osiągać lepsze rezultaty współpracując ze sobą, np. wspólnie promować miejscowość, w której są zlokalizowane. Wnioski Władze samorządowe powinny zrozumieć doniosłą rolę, jaką odgrywa turystyka w rozwoju regionu. Turystyka może, a nawet powinna być podstawową drogą rozwoju gospodarczego wielu gmin, miast, regionów[1]. Rozwój turystyki niesie ze sobą zarówno korzyści, jak i zagrożenia. Jednak dobrze wykorzystany potencjał turystyczny może stanowić źródło przewagi konkurencyjnej wobec innych jednostek samorządu terytorialnego. Literatura 1. Barański M., Samorząd- Rozwój- Integracja, Wydawnictwo Uniwersytetu Śląskiego 2003, Katowice, s Boruszczak M., Polityka samorządu terytorialnego w dziedzinie turystyki, Międzynarodowa konferencja naukowa, Ostrzyce kwietnia 2000, s

142 3. Bosicki S., Grell J., Sikora J., Samorządowa koncepcja rozwoju turystycznego gminy, Akademia Wychowania Fizycznego Wydział Turystyki i Rekreacji 1996, Poznań, s Kruczek Z., Walas B., Promocja i informacja turystyczna, PROKSENIA 2004, Kraków, s Michałowski K., Podstawy zarządzania turystyką, Białystok, Wydawnictwo Wyższej Szkoły Ekonomicznej w Białymstoku 2008, s Niebielski E., W dobrach Ossolińskich- Klimontów i okolice, Urząd Gminy Klimontów 1999, Klimontów, s Nowak E., Regionalne oraz lokalne czynniki i bariery rozwoju turystyki, Wszechnica Świętokrzyska Instytut Geografii Akademii Świętokrzyskiej Kielecki Oddział Polskiego Towarzystwa Geograficznego 2003, Kielce, s Pender L., Sharpley R., Zarządzanie turystyką, Warszawa, Polskie Wydawnictwo Ekonomiczne 2008, s.225. Development of tourism in commune Klimontów Summary Local authorities should understand the important role played by tourism in the region's development. Tourism can and should be the principal form of economic development of many municipalities, cities, regions. Tourism development brings both benefits and risks. However, a well-used tourist potential can be a source of competitive advantage against other units of local government. Keywords: tourism, tourism development strategy, Klimontów 142

143 ZAGOSPODAROWANIE TURYSTYCZNE TATRZAŃSKIEGO PARKU NARODOWEGO I PARKU NARODOWEGO BERCHTESGADEN ZE SZCZEGÓLNYM UWZGLĘDNIENIEM BAZY NOCLEGOWEJ Autor: Marzena Prus Uniwersytet Jagielloński, Instytut Geografii i Gospodarki Przestrzennej Ul. Gronostajowa 7, Kraków Słowa kluczowe: zagospodarowanie turystyczne, parki narodowe, Tatrzański Park Narodowy, Park Narodowy Berchtesgaden Wstęp Parki narodowe tworzone są dla ochrony najcenniejszych przyrodniczo obszarów. Obecnie w Polsce funkcjonują 23 parki narodowe (około 1% powierzchni kraju) [6,7], a w Niemczech 14 (0,55 % powierzchni kraju) [2]. Zarówno Tatrzański Park Narodowy (TPN) jak i Park Narodowy Berchtesgaden (PNB) są jedynymi parkami narodowymi utworzonymi na obszarach o charakterze wysokogórskim na terytorium tych dwóch krajów. Tatrzański Park Narodowy położony jest w południowej Polsce, w województwie małopolskim, natomiast Park Narodowy Berchtesgaden na południu Niemiec, w Bawarii. Oba parki narodowe posiadają zbliżoną powierzchnię (TPN ha, PNB ha). Najwyższym szczytem w TPN są Rysy (2499 m n.p.m), natomiast PNB - Watzmann (2713 m n.p.m). Celem artykułu jest porównanie wybranych elementów zagospodarowania turystycznego parków: Tatrzańskiego i Berchtesgaden, w szczególności zaś bazy noclegowej. Materiał i metody Opracowanie obejmuje obszar dwóch górskich parków narodowych: Tatrzańskiego i Berchtesgaden, a opiera się na informacjach udostępnionych przez poszczególne obiekty noclegowe, Bundesamt für Naturschutz, organizacje turystyczne m.in. PTTK, DAV, PZA, a przede wszystkim wspomniane parki narodowe. Brak jest literatury polskiej, która obejmuje tematykę zagospodarowania turystycznego PNB. Zagospodarowanie turystyczne TPN omawia, jednak w innym zakresie, m.in. A. Śliwinski [9]. Wykorzystane zostały również mapy turystyczne TPN (1:25000) oraz Berchtesgadener Land (1:50000) oraz Plan ochrony PNB (Nationalparkplan z dn ). Baza noclegowa Tatrzańskiego Parku Narodowego i Parku Narodowego Berchtesgaden Podstawowym ogniwem zagospodarowania turystycznego jest baza noclegowa, na którą składają się wszelkie obiekty i urządzenia, które umożliwiają turyście nocleg poza miejscem jego stałego zamieszkania [10]. Baza noclegowa turystyki może być analizowana ze względu na: charakter użytkowania (stała, sezonowa), dostępność (ogólnodostępna, środowiskowa), stan i warunki materialno-techniczne (trwała, lekka) [3]. W parkach narodowych w Niemczech infrastruktura turystyczna tworzona z uwzględnieniem zasady zrównoważonego rozwoju, ma służyć celom ochrony przyrody oraz ma być atrakcją uwzględniającą oczekiwania odwiedzających [11]. W polskiej 143

144 literaturze również zwracana jest uwaga na konieczność zarządzania TPN zgodnie z ideą zrównoważonego rozwoju, aby minimalizować wpływ infrastruktury turystycznej na środowisko [1]. Baza noclegowa na terenie TPN liczy osiem schronisk [6,7] lub według innego źródła kilkadziesiąt obiektów świadczących usługi noclegowe, w tym schroniska i inne obiekty noclegowe, m.in. kwatery prywatne, które łącznie oferują 1937 miejsc noclegowych [9]. W bieżącym opracowaniu wzięto pod uwagę osiem ogólnodostępnych schronisk górskich w TPN (7 w Tatrach, 1 na Pogórzu Spisko- Gubałowskim) oraz jeden hotel górski. Według literatury [4] w PNB znajdują się 24 schroniska górskie. Obecnie jednak na terenie Parku Narodowego Berchtesgaden znajduje się dziewięć ogólnodostępnych schronisk górskich, pełniących usługi noclegowe. Na rysunku 1 przedstawiono położenie ogólnodostępnych schronisk górskich w TPN (A) oraz PNB (B). A B Rys. 1. Schroniska ogólnodostępne w granicach parków narodowych: Tatrzańskiego (A) i Berchtesgaden (B) Źródło: opracowanie własne Schroniska w TPN najczęściej położone są w dolinach, natomiast w PNB na grzbietach górskich. Schroniska w PNB (biorąc pod uwagę 9 schronisk, w których udzielane są noclegi tab. 2) położone są średnio na wysokości 1612 m n.p.m, natomiast w TPN (biorąc pod uwagę 8 schronisk oraz Hotel Górski na Kalatówkach - tab. 1) na wysokości 1281 m n.p.m. Liczba dostępnych miejsc noclegowych wynosi odpowiednio 997 i 703, zaś średnia liczba miejsc noclegowych przypadająca na 1 obiekt to 78 w przypadku TPN i 111 w przypadku PNB. Tym, co wyróżnia schroniska w TPN jest ich całoroczny charakter użytkowania, w przeciwieństwie do schronisk w PNB, które w większości przypadków są obiektami sezonowymi, otwieranymi w okresie zimowym jedynie dla grup, po wcześniejszym uzgodnieniu. Spośród dziewięciu schronisk w parku narodowym Berchtesgaden, trzy mają pomieszczenia dostępne w zimie. W tabelach 1 i 2, odpowiednio dla TPN i PNB, podano charakterystykę schronisk pod względem liczby i miejsc noclegowych, wysokości m n.p.m, oraz dostępności w ciągu roku. 144

145 Tabela 1. Schroniska górskie ogólnodostępne oraz hotel górski w Tatrzańskim Parku Narodowym Nazwa schroniska Właściciel/ Liczba miejsc Wysokość n.p.m użytkownik noclegowych (m) Morskie Oko PTTK Karpaty m W Dolinie Roztoki PTTK Karpaty m Pięć Stawów PTTK Karpaty m Murowaniec PTTK Karpaty m Hala Kondratowa PTTK Karpaty m Na Hali Ornak PTTK Karpaty m Na Polanie Chochołowskiej PTTK Karpaty m Głodówka GK ZHP m Hotel Górski Kalatówki PTTK Karpaty m Łącznie 703 Średnia 78,1 1280,7 Źródło: opracowanie własne Tabela 22. Schroniska górskie ogólnodostępne w Parku Narodowym Berchtesgaden Nazwa schroniska Właściciel/użytkownik Liczba miejsc noclegowych Wysokość n.p.m (m) Charakter użytkowania obiekt całoroczny Charakter użytkowania Blaueishütten DAV Berchtesgaden sezonowy (V X) Gotzenalm Prywatny sezonowy (V X) Kärlingerhaus DAV Berchtesgaden sezonowy (V X) Wimbachgrieshütte NaturFreunde Deutschlands sezonowy (V X) Schneibsteinhaus Prywatny sezonowy (IV X) Watzmannhaus DAV Monachium 259, zimą sezonowy (V X) Wasseralm DAV Berchtesgaden 60, zimą 1 pokój 1423 sezonowy (VI X) Kührointhutte Prywatny sezonowy (V X) Carl-von-Stahl- ÖAV Salzburg całoroczny Haus Łącznie 997 Średnio 110,8 Źródło: opracowanie własne 1612 Na rysunku 2 zobrazowano wysokość (m n.p.m) w poszczególnych schroniskach w TPN (wraz z Hotelem Górskim na Kalatówkach) i PNB. Rys. 2. Położenie ( m n.p.m) schronisk w Tatrzańskim Parku Narodowym i Parku Narodowym Berchtesgaden Źródło: opracowanie własne 145

146 Najwyżej położone schronisko ogólnodostępne w TPN to Pięć Stawów (1670 m n.p.m), natomiast w BPN Watzmanhaus (1930 m n.p.m). W TPN jedynie dwa schroniska położone są na wysokości 1500 m n.p.m i powyżej, natomiast w BNP jedynie dwa schroniska leżą poniżej 1500 m n.p.m. Na rys. 3 przedstawiono liczbę miejsc noclegowych w schroniskach ogólnodostępnych TPN i BNP, uszeregowanych zgodnie z wysokością n.p.m (od najniżej do najwyżej położonych). Rys. 3. Liczba miejsc noclegowych w schroniskach TPN i BNP Źródło: opracowanie własne Na rys. 4-6 przedstawiono analizę cen noclegów w ogólnodostępnych schroniskach TPN i PNB. Przy analizie tej wzięte zostały pod uwagę ceny dla osoby dorosłej, bez uwzględnienia zniżek, które przysługiwać mogą min. za przynależność do organizacji turystycznej prowadzącej dane schronisko, np. w TPN - PTTK, a w BNP - DAV. Ceny z BNP zostały przeliczone na złotówki w stosunku 1:4. Rys. 4. Zakres cen noclegów w schroniskach parków narodowych Tatrzańskiego i Berchtesgaden Źródło: opracowanie własne Rys. 5 przedstawia zależność cen noclegów w schroniskach TPN i BNP od ilości miejsc noclegowych, natomiast rys. 6 rozkład cen w zależności od położenia schroniska (m n.p.m). Liczba schronisk w obydwu parkach jest taka sama (dziewięć), natomiast sumarycznie liczba miejsc noclegowych jest w BNP jest o ponad 40% większa. Jednakże, jeśli wziąć pod uwagę, że większość schronisk jest czynna sezonowo, to całorocznie dostępna jest podobna liczba noclegów. Średnia cena noclegu w TPN wynosi 40 zł i poza hotelem na Kalatówkach nie ma praktycznie zróżnicowania 146

147 cenowego ani w zależności od wielkości schroniska (rys. 5), ani od wysokości n.p.m. W BNP ceny są wyższe i mocno zróżnicowane. W przeliczeniu na PLN średnia cena noclegu wynosi 91, zaś głównym czynnikiem wpływającym na cenę jest rodzaj własności w schroniskach prywatnych średnia cena noclegu wynosi 117 PLN, czyli o 60% wyższą od pozostałych - średnio 73 PLN (zawiera bowiem wliczone w cenę wyżywienie). Wśród tych ostatnich cena nie zależy od wielkości schroniska, natomiast nieco rośnie z wysokością n.p.m. o ok. 3,4 PLN na 100 m. Rys. 5. Zależność ceny noclegu od ilości miejsc noclegowych w schroniskach TPN i BNP Źródło: opracowanie własne Rys. 6. Zależność cen noclegów w stosunku do ilości miejsc noclegowych w schroniskach TPN i PNB Źródło:opracowanie własne Oprócz obiektów ogólnodostępnych, na obszarach obu Parków, znajdują się obiekty noclegowe środowiskowe (zamknięte) dostępne dla wspinaczy i grotołazów (w TPN przede wszystkim dla zrzeszonych w PZA tj. Polskim Związku Alpinizmu). Tabela 3. Obiekty noclegowe użytkowane przez PZA w Tatrzańskim Parku Narodowym Tatrzański Park Narodowy Użytkowanie Rodzaj obiektu Szałasiska (dolina Rybiego Potoku) VI (2 poł.) - VIII Obozowisko namiotowe Betlejemska 1510 m n.p.m (Hala Gąsienicowa) całoroczna Schronisko (20 miejsc) Polana Rogoźniczańska (Kiry) VI (2 poł.) - VIII Obozowisko namiotowe Źródło: opracowanie własne na podstawie 147

148 Tab. 4. Obiekty noclegowe użytkowane przez DAV w Parku Narodowym Berchtesgaden Park Narodowy Berchtesgaden Użytkowanie Rodzaj obiektu St.Bartholomä Watzmann-Ostwand-Hütte IV-XI Schronisko (40 miejsc) 618 m n.p.m Watzmann-Ostwand-Biwak 2380 m n.p.m całoroczny Schron biwakowy (10 miejsca), dojście tylko drogą wspinaczkową Hocheck-Unterstandshütte 2653 m n.p.m całoroczny Schron biwakowy Źródło: opracowanie własne na podstawie W TPN obiektami użytkowanymi przez PZA są obozowiska Szałasiska i Polana Rogoźniczańska oraz budynek Betlejemka, mieszczący Centralny Ośrodek Szkolenia PZA. W BNP są to obiekty należące do DAV (Deutscher Alpenverein): schronisko w St.Bartholomä oraz dwa schrony biwakowe w masywie Watzmann. A B Rys. 7. Obiekty noclegowe użytkowane przez PZA w TPN (A) oraz DAV w PNB (B) Źródło: opracowanie własne Baza gastronomiczna i towarzysząca w TPN i PNB (wybrane zagadnienia) Baza gastronomiczna jest elementem zagospodarowania turystycznego, który ma na celu zapewnienie turystom możliwości wyżywienia, zarówno na szlaku turystycznym jak i miejscowościach [8]. Zarówno w TPN, jak i PNB, wyróżnić można bazę gastronomiczną otwartą i bazę gastronomiczną w obiektach noclegowych oraz całoroczną i sezonową. Baza gastronomiczna otwarta jest znacznie bardziej rozwinięta w PNB. W TPN wszystkie schroniska górskie oraz hotel górski oferują usługi gastronomiczne. Dodatkowo w okresie letnim funkcjonują sezonowe obiekty gastronomiczne m.in. w dolinie Strążyskiej, na Włosienicy oraz bacówki. BNP oferuje usługi żywieniowe w schroniskach oraz samodzielnych obiektach gastronomicznych, np. Wimbachschloss, Saletalm, St.Bartholomä. Na terenie PNB funkcjonują liczne bacówki, różniące się jednak od tych spotykanych w TPN. Park Narodowy Berchtesgaden oferuje odwiedzającym 230 km szlaków turystycznych, natomiast TPN

149 A B Rys. 8. Punkty Informacji Turystycznej parków narodowych Tatrzańskiego (A) i Berchtesgaden (B) Źródło: opracowanie własne Punkty informacyjne Parku Narodowego Berchtesgaden znajdują się w sześciu miejscach: Berchtesgaden, Hintersee, Kühroint, Wimbachbrücke, Engert, St. Bartholomä [12], a Tatrzańskiego zlokalizowane są: w Zakopanem (ul. Chałubińskiego 44) oraz w Dolinie Kościeliskiej [13]. Wnioski Zarówno na terenie TPN i PNB występują obiekty noclegowe ogólnodostępne i środowiskowe oraz całoroczne i sezonowe. Schroniska w TPN są całoroczne, w przeciwieństwie do schronisk w PNB, które w większości przypadków są obiektami sezonowymi. Schroniska w PNB położone są średnio na wysokości ponad 300 m wyżej niż w TPN oraz dysponują większą ilością miejsc noclegowych. Analiza ceny noclegów w schroniskach obu parków narodowych wykazała, iż wszystkie schroniska w TPN mają średnią cenę noclegów na podobnym poziomie (zdecydowanie wyższą hotel górski na Kalatówkach), natomiast w BNP ceny te są bardzo zróżnicowane. Najwyższe ceny obserwowane są w schroniskach prywatnych. W TPN nie ma praktycznie zróżnicowania cenowego ani w zależności od wielkości schroniska, ani od wysokości n.p.m., natomiast w PNB cena również nie zależy od wielkości schroniska, natomiast nieco rośnie z wysokością n.p.m. (ok. 3,4 PLN na 100 m). Zarówno w TPN, jak i PNB, wyróżnić można bazę gastronomiczną otwartą oraz bazę gastronomiczną w obiektach noclegowych. Baza gastronomiczna otwarta jest znacznie bardziej rozwinięta w Parku Narodowym Berchtesgaden. Obiekty bazy żywieniowej podzielić można ponadto na całoroczne i sezonowe. Obiekty gastronomiczne w obu parkach są znacznie zróżnicowane pod względem tak jakościowym, jak i ilościowym. Istotnym elementem zagospodarowania turystycznego parków narodowych są szlaki turystyczne, których długość w obu Parkach jest zbliżona. Sieć punktów informacji turystycznej jest znacznie bardziej rozbudowana w Parku Narodowym Berchtesgaden. Literatura 1. Bundesamt für Naturschutz Großschutzgebiete in Deutschland Ziele und Handlungserfordernisse, Wyd. Bundesamt für Naturschutz, Bonn 2. Czochański J Ruch turystyczny w Tatrzańskim Parku Narodowym (w) J. Partyka (red.) Użytkowanie turystyczne parków narodowych. Wyd. OPN, Ojców: Europarc Deutschland Quality criteria and standards for German national parks 149

150 4. Kowalczyk A., Derek M Zagospodarowanie turystyczne. Wyd. PWN, Warszawa 5. Kurek W Turystyka na obszarach górskich Europy. Wyd. IGiGP UJ, Kraków 6. Nationalpark Berchtesgaden - Nationalparkplan z dn data dostępu Partyka J Turystyka w polskich parkach narodowych (w) J. Partyka (red.) Użytkowanie turystyczne parków narodowych. Wyd. OPN, Ojców: Ptaszcka-Jackowska D Turystyka na przyrodniczych obszarach chronionych (w) W. Kurek (red.) Turystyka. Wyd. PWN, Warszawa: Rogalewski O Zagospodarowanie turystyczne. Wyd. WSIP, Warszawa 10. Śliwiński A Stan i perspektywy rozwoju zagospodarowania turystycznego w Tatrzańskim Parku Narodowym, Praca magisterska, IGiGP UJ, Kraków 11. Warszyńska J., Jackowski A Podstawy geografii turyzmu. Wyd. PWN, Warszawa Selected elements of the tourist infrastructure of the Tatrzański National Park and the Berchtesgaden National Park mainly accommodation conditions Summary The most environmentally valuable areas in Poland and Germany became national parks. Nowadays there are twenty three national parks in Poland which cover about 1% of the total area of the country, while Germany has fourteen, which cover about 0.55% of the area of the country. Both, the Tatrzański National Park (TNP) and the Berchtesgaden National Park (BNP) are the only parks in these two countries, which are set in the alpestrine areas. Present paper demonstrates the state of tourist infrastructure in the two national parks mentioned above, with the emphasise on accommodation. The present work considers also catering facilities, tourist trails and tourist information offices. TNP and BNP have mountain huts which are either freely available or with limited access. The latters are dedicated to climbers and speleologists. The mountain huts in TNP are year-round opened while those in BNP work seasonally only. The mountain huts in BNP, compared to those in TNP, lie 300 meters higher on average and offer more places to sleep in. The accommodation has wide range of prices so this variable has also been analised. Besides gastronomical points accompanying mountain huts in both parks, there are many without accommodation possibilities in BNP. Gastronomical facilities are quantitatively and qualitatively divers in TNP and BNP. A network of trails is a crucial element of tourist infrastructure. Although their overall length is similar in both parks, tourist information centres are more populated in BNP than in TNP. Despite the similarities in landscape, attractiveness of the areas and tourist potential, the two national parks present series of differences in reference to tourist infrastructure. Key words: national parks, tourist infrastructure, Tatrzański National Park, Berchtesgaden National Park 150

151 ŻYWIENIE W TURYSTYCE GÓRSKIEJ Autorzy: Dorian Kapiszewski, Arkadiusz Mach Opiekun: mgr Jarosław Herbert KN Podróżników, Sekcja Miłośników Podróży Globtroter AZS Uniwersytet Rzeszowski, Wydział Wychowania Fizycznego Ul. Towarnickiego 13, Rzeszów Słowa kluczowe: żywienie, turystyka, alpninizm Wstęp Turystyka to bardzo szerokie pojęcie. Mieści się w nim turystyka piesza, nizinna i wysokogórska, wycieczki rowerowe, samochodowe, narciarskie, wycieczki kajakowe, żaglowe i wiele innych. Jeśli wysiłek odbywa się w warunkach nizinnych i w umiarkowanym klimacie, do których organizm jest zaadoptowany, to ogólne, zasady żywienia w turystyce są wystarczające. Jednakże w zmienionych warunkach, chcąc zachować wydolność fizyczną na odpowiednim poziomie, należy dostosować żywienie do ich specyfiki [2]. Bilans energetyczny organizmu przy różnych typach wysiłku turystycznego Organizm pracuje sprawnie i ekonomicznie, gdy wydatkowana na pracę energia równoważy energię dostarczaną z pożywieniem. Zapotrzebowanie energetyczne w turystyce zależy od jej rodzaju, intensywności, czasu trwania, ciężaru ciała, płci i wieku turysty. Jeśli pójdziemy śladem podanego przykładu, przeciętne zapotrzebowanie energetyczne wzorcowego turysty o ciężarze ciała 65 kg wyniesie 3600 kcal. Przyjęliśmy, bowiem, że jego zapotrzebowanie na białko wynosi 124 g/dzień, na tłuszcze też 124 g, a na węglowodany 496 g na dobę. Wartość kaloryczna 1 g białka wynosi 4 kcal, 1 g węglowodanów 4 kcal, a l g tłuszczów - 9 kcal netto. Po przemnożeniu ilości białka i węglowodanów przez 4, a tłuszczów przez 9 otrzymujemy 3604 kcal. W ten sposób każdy turysta może obliczyć swoje zapotrzebowanie kaloryczne i dostosować doń planowane nabycie produktów spożywczych. Zapotrzebowanie energetyczne można obliczyć w inny sposób, zapisując czas trwania poszczególnych czynności w ciągu doby (w minutach), czyli sporządzając chronometraż. Potem można dobrać z literatury koszty energetyczne danej czynności na 1 kg ciężaru ciała na minutę, przemnożyć przez własną masę ciała, a potem koszty kaloryczne czynności na 1 minutę na własną masę ciała przemnożyć przez czas trwania czynności. Otrzymane wydatki energetyczne w kaloriach sumujemy i otrzymujemy dobowy wydatek energetyczny. Jest to sposób dokładny, gdyż uwzględniający wielkość planowanego obciążenia. Do tak obliczonego dobowego wydatku energetycznego należy dodać 10% i w ten sposób otrzymujemy wartość kaloryczną pożywienia, którym to zapotrzebowanie pokryjemy. Tyle, bowiem trzeba dodać na straty spowodowane przy przyrządzaniu potraw (obierki, odpadki talerzowe). W naszym przypadku zapotrzebowanie kaloryczne wynosić, więc będzie 4000 kcal [2]. 151

152 Tabela 1. Przykładowe wydatki energetyczne podczas wykonywania różnych czynności w turystyce [2] Czynność Wydatek energetyczny (kcal/min/kg) Leżenie 1,47-1,62 Siedzenie 1,46-1,67 Marsz z prędkością 3 km/h 2,4 Marsz z prędkością 5 km/h 4,0 Marsz pod górę, kąt nachylenia stoku 15 stopni, prędkość 5 km/h 7,8 Marsz po twardym śniegu z prędkością 6km/h 11,9 Jazda na nartach z prędkością 6km/h 11,2 Pływanie, styl klasyczny 11,0 Pływanie kraulem 11,5 Jazda na rowerze z prędkością 9km/h 4,5 Wiosłowanie z prędkością 50m/min 0,029 Jazda konna, stęp 3,0 Jazda motocyklem 2,8 Prowadzenie samochodu 3,4 Zależność odżywiania od różnych typów wysiłków w turystyce Turyści o dużej praktyce doskonale wiedzą, jak bardzo dobre samopoczucie zależy od należycie dobranych posiłków. Turysta jest od rana do wieczora w ciągłym ruchu i wszystkie procesy przemiany materii muszą u niego przebiegać bez przeszkód, z jak najlepszym efektem dla ekonomiki pracy i zdrowia. Generalną zasadą przy układaniu posiłków na wycieczkach jest dobór potraw lekkostrawnych, lecz pełnowartościowych pod względem odżywczym i przy tym mało objętościowych. Podczas turystyki nizinnej należy spożywać węglowodany złożone w postaci pieczywa, kasz i makaronów. Można zabrać ze sobą pieczywo w postaci chrupkiego chleba, sucharków, na krótkie odległości świeże pieczywo. Najbardziej skoncentrowaną formą węglowodanów jest cukier l słodycze. Przyjmujemy, że w słodyczach (cukierki, czekolada, dżem, miód) znajduje się około 50% cukru. Łącznie z cukrem dodanym do potraw i napojów można spożywać około 50g cukru na dzień. Z tłuszczów najbardziej wskazane jest masło, miękka margaryna i oleje roślinne, zabierane w specjalnych, lekkich pojemnikach z tworzyw sztucznych. Z produktów białkowych, oprócz mleka świeżego lub sproszkowanego i skondensowanego, można zabierać łatwe do transportu żółte sery lub sery topione, suche wędliny, konserwy mięsne i rybne. Z napojów najlepsze są soki owocowe i warzywne, np. sok pitny z czarnej porzeczki, napój z Rosavitu, sok pomarańczowy, pomidorowy. W lecie staramy się pić napoje chłodne, ale o temperaturze pokojowej. Aby uzupełnić straty wody na skutek pocenia się, należy pić wolno, drobnymi łykami, nigdy łapczywie - duszkiem. Napój wypity raptownie i w dużej ilości działa hamująco na wydzielanie przez przysadkę mózgową hormonu antydiuretycznego, który hamując diurezę sprzyja wchłanianiu pobranego płynu do tkanek. Toteż po gwałtownym wypiciu dużej ilości napoju po minutach odczuwamy parcie na pęcherz i woda zostaje wydalona. Jeśli pijemy wolno i stopniowo, hormon jest bez przerwy 152

153 wydzielany do krwi, i hamując wydzielanie moczu, pozwala uzupełnić straty wody powstałe podczas pracy na skutek pocenia się. Absolutnie niedopuszczalne w turystyce są napoje alkoholowe. Nawet wino i piwo. Szczególnie dotyczy to turystyki zmotoryzowanej i wysokogórskiej. Alkohol, bowiem już w ustach przenika do krwi i układu nerwowego, burząc koordynację ruchów i zdolność należytego oceniania odległości. Niewskazane są również napoje wpływające podniecająco na akcję serca i układ nerwowy, a więc zbyt mocna kawa i herbata. Spożywanie podczas wycieczek smacznych i zdrowych posiłków to nie tylko zaspokajanie potrzeb fizjologicznych. Wspólnie przyrządzony posiłek, podany nawet w warunkach polowych estetycznie i higienicznie spożyty w nastroju przyjaźni na łonie natury, stanowi ważny element wychowawczy o dużych wartościach psychicznych i społecznych. Kto raz zakosztował jak smakuje pieczony w ognisku ziemniak, ten będzie przenosił polową kuchnie nad stół restauracyjny [2]. Wzorcowe żywienie na różnych typach imprez w turystyce popularnej i kwalifikowanej Nauka o żywieniu człowieka zaleca, aby nie przystępować do pracy na czczo. Badania naukowe, bowiem dowiodły niezbicie, że wydajność pracy jest większa, gdy po nocnym śnie przystępuje się do pracy fizycznej lub umysłowej po śniadaniu. Jest to zrozumiałe, gdyż w nocy energia jest zużytkowana na procesy życiowe (oddychanie, krążenie krwi, trawienie), a rezerwy nie są uzupełniane, bo w nocy nic spożywa się jedzenia, co więcej - nie należy tego robić. Odnosi się to, zatem także do turystyki. Względny jest tylko charakter, treść i objętość posiłku. Pełnowartościowe śniadanie, tj. o odpowiedniej objętości, wartości kalorycznej, białkowej, węglowodanowej, witaminowej, zawartości soli mineralnych itp., powinno być spożyte nie później, niż na l godzinę przed ruszeniem na trasę, Chodzi o to, by pożywienie opuściło żołądek i nie zalegało w nim w momencie wyruszenia w drogę. Wówczas, bowiem dobrze zaopatrywane w krew muszą być wszystkie narządy pracujące, przede wszystkim układ mięśniowy. Na skutek neuro - hormonalnej regulacji, podczas pracy następuje przemieszczenie krwi do obwodu, ze szkodą dla ukrwienia przewodu pokarmowego. A należyte ukrwienie jest warunkiem prawidłowego przebiegu procesu trawienia. Jeśli nie dbamy o to i wyruszamy tuż po posiłku na trasę, to zalegający w żołądku pokarm, wobec zakłóceń w procesie trawienia, wywiera ucisk i może wywołać niekorzystne zjawiska patologiczne, kolki, mdłości, wymioty itp. Jest to zasada także ważna w turystyce motorowej, ponieważ wymaga ona należytej sprawności układu nerwowego (refleks), upośledzonej przy pełnym żołądku. Wiadomo, że po spożyciu posiłku, zwłaszcza zbyt obfitego, ogarnia nas senność. Na trasie-należy przyjmować posiłki w odpowiednich przerwach wypoczynkowych, przy czym posiłki te powinny być lekkie, o charakterze białkowo - węglowodanowo - witaminowym, w celu doraźnego uzupełnienia zapasów energetycznych i pobudzenia sprawności działania mechanizmów glikolitycznych. A więc napoje owocowo - warzywne, herbatniki, miód, dżem, chleb, masło, sery, chuda szynka, polędwica itp. 153

154 Posiłek główny - obiad można spożyć w plenerze, w schronisku lub restauracji, zależnie od warunków. Przed tym, już obfitym i ciężej strawnym posiłkiem należy odpocząć i zasiąść doń nie wcześniej, niż w minut po pracy. Po prostu przedtem należy umyć się, przebrać, słowem "odsapnąć" i dopiero jeść. Chodzi tu o zabezpieczenie dopływu większej ilości krwi do przewodu pokarmowego, co następuje również na drodze regulacji neuro - hormonalnej, gwarantując należyte trawienie pobieranego pożywienia. Dlatego należy tak dobierać produkty, aby były lekkostrawne, albo tak planować marszrutę, aby wysiłek nie był zbyt intensywny. Często z tych względów wytrawni turyści planują kilka lekkich posiłków na biwaku w czasie wędrówki, a główny, obfitszy i ciężej strawny, dopiero wieczorem po jej zakończeniu. Sen nocny jest niezwykle ważnym elementem w turystyce. Musi, bowiem zapewnić organizmowi należyty wypoczynek, odnowę sił do dalszego wysiłku. Dlatego aby sen był mocny i pokrzepiający należy spożywać ostatni posiłek na dwie godziny przedtem, tak, by procesy trawienia nic powodowały niespokojnego snu. Tuż przed snem można wypić szklankę mleka lub pół szklanki alkalicznej wody mineralnej, co ułatwia organizmowi przywrócenie równowagi kwasowo - zasadowej, wzbogacając rezerwy alkaliczne ustroju. Liczba posiłków w ciągu dnia powinna być większa, niż trzy. Najlepiej jest spożywać 4-6 posiłków. Wówczas, jak wykazały badania, następuje korzystne w przemianie materii zjawisko, tj. odkładanie się białka tkankowego, a nie tłuszczu, przy czym wydolność fizyczna utrzymuje się na dobrym poziomie. Przerwa między jednym, a drugim posiłkiem nie powinna wynosić więcej, niż cztery godziny. [2] Żywienie na dużych wysokościach Turystyka wysokogórska w postaci taternictwa i alpinizmu bardzo znacznie różni się od pozostałych jej postaci i od sportu wyczynowego. Zwłaszcza alpinizm cechuje wysiłki, które łączą w sobie wybitne elementy siły, zręczności i kolosalnej wytrzymałości. Do tego dochodzą jeszcze bardzo zmienne warunki atmosferyczne, typowe dla klimatu wysokogórskiego, jak nadzwyczaj silne nasłonecznienie we dnie i upał, zaś w nocy znaczny spadek temperatury powietrza, oraz wiatry i śnieżyce. Wszystko to odbywa się przy rozrzedzonym powietrzu, o proporcjonalnie do wysokości nad poziomem morza niższym ciśnieniem barometrycznymi mniejszej zawartości tlenu w powietrzu. Skutkiem tego przebieg przemiany materii w organizmie ulega znacznemu zaburzeniu. Procesy utleniania ulegają zahamowaniu, przemiana tłuszczów i częściowo białek przebiega w tych warunkach inaczej niż na nizinach. Wzrasta zapotrzebowanie na witaminę C. Niepełne spalanie tłuszczów w warunkach wysokogórskich pozostawia w organizmie produkty ich spalania w postaci tzw. ciał acetonowych. Ciała te zwiększają jeszcze bardziej istniejący już na skutek wysiłków związanych ze wspinaczką, stan zakwaszenia organizmu. Prowadzi to oczywiście do znacznego obniżenia wydolności ustroju. 154

155 Węglowodany natomiast w warunkach wysokogórskich są znacznie lepiej przyswajalne niż w dolinach. Wydatkowanie energii podczas wspinaczek ogromnie wzrasta i może przekraczać ogólnie przyjęte normy. Każdy alpinista dźwiga na sobie całość niezbędnego sprzętu, jak liny, haki, czekan, śpiwór, paliwo i żywność. Obciążenie alpinisty przekracza 30 kg, co w warunkach górskich stanowi bardzo duży ciężar. Nic dziwnego, że przy dłuższej wspinaczce, gdy nie można porzucić czekanu ani haków, czy też liny, ponieważ posiadanie ich decyduje o powodzeniu, a nieraz i o życiu, można tylko ograniczyć rację pokarmową. Powstaje więc dość paradoksalna sytuacja, że przy największym wysiłku fizycznym, przy krańcowym wydatkowaniu energii, jakie cechuje zazwyczaj końcowy szturm na wybrany szczyt, racje żywnościowe bywają po prostu głodowe. Zagadnienie żywienia wysokogórskiego rozwiązano przez wprowadzenie do sprzedaży mało ważących koncentratów, które zawierają wszystkie niezbędne, a wysokokaloryczne składniki. Następną przyczyną, która stanowi przeszkodę w pokryciu strat energetycznych u alpinistów w warunkach wspinaczek, są zmiany przyswajalności produktów spożywczych. Doświadczenie alpinistów wykazuje, że na wysokości m kaloryczność pożywienia w ilości kcal na dobę zaspokaja całkowicie chwilową potrzebę organizmu. Wyższe normy pożywienia wywierają raczej wpływ niekorzystny. Ze względu jednak na bardzo duże wydatkowanie energii podczas wspinaczek, należy przed wspinaczką, więc w warunkach obozu przygotowawczego, który zazwyczaj jest położony na wysokości 3000 m, zwiększyć kaloryczność dziennej racji żywnościowej. Także po powrocie ze wspinaczki należy uzupełnić nadmierny wydatek energii. Najlepsze dla alpinistów są środki w postaci skoncentrowanej. Powinny one odznaczać się różnorodnością, być pożywne i smaczne. Należy pamiętać, że na dużych wysokościach występuje zmiana smaku i powonienia i dlatego wiele środków żywnościowych może wydawać się bez smaku. Z uwagi na obniżone ciśnienie barometryczne na dużych wysokościach temperatura wrzenia wody ulega obniżeniu, co zmienia warunki przygotowywania potraw. Dlatego też należy zaopatrywać się jedynie w produkty łatwo dające się ugotować, jak grysik, owsianka, makaron, względnie gotowe zupy. Jako typowe produkty żywnościowe dla alpinistów wymienimy: suchary, biszkopty, cukier, czekoladę, marmoladę, masło, miękkie margaryny, sery, konserwy mięsne i rybne, suchą kiełbasę, syropy witaminizowane. Przemysł żywnościowy produkuje bardzo dobre produkty żywnościowe dla celów alpinistycznych, lecz niestety są one dość drogie. W warunkach wspinaczki wysokogórskiej ważne jest zaopatrzenie się w pewną ilość czekolady, cukierków, rodzynek, aby w każdej chwili móc zaspokoić uczucie głodu. Występuje ono nieraz, jako wyraz hipoglikemii - niedocukrzenia organizmu. Kawałek czekolady lub cukierek bardzo skutecznie zapobiega tym przykrym objawom, które stanowią poważną przeszkodę we wspinaczce. Doskonałym środkiem są tabletki glukozy z witaminą C (glukowit). W warunkach wysokogórskich węglowodany (glukoza) są doskonale przyswajane przez organizm i dlatego korzystanie z nich, zwłaszcza w połączeniu z witaminą C, jest bardzo korzystne. Witamina C poza tym, że działa 155

156 dodatnio na przebieg procesów utlenienia, przyczynia się do sprawniejszej aklimatyzacji w warunkach wysokogórskich. [2] Na dużych wysokościach, gdzie obniżone jest ciśnienie parcjalne tlenu, organizm jest narażony na niedotlenienie (hipoksję). Wówczas uruchamia mechanizmy adaptacyjne, pozwalające zwiększyć potencjał aerobowy ustroju. Jako wyraz dostosowania się organizmu do niedoboru tlenu w powietrzu, następuje najpierw przyspieszenie oddechu i wzrost wentylacji płuc, po pewnym czasie wzrasta ilość erytrocytów we krwi obwodowej i ilośćhemoglobiny. Zachodzą także inne zmiany przystosowawcze, jak wzrost ilości kapilarów, mioglobiny i aktywności enzymatyczne. Mimo to, przy dużym wysiłku zużycie tlenu na dużych wysokościach obniża się o 5-30% w porównaniu do warunków nizinnych. Dlatego podczas wspinaczki wysokogórskiej należy ograniczać spożycie tłuszczów, które wymagają do prawidłowego spalania dostatecznej ilości tlenu. Na dużych wysokościach stosunek białek, tłuszczów i węglowodanów powinien wynosić 1:0,7:4. Tłuszczów nie powinno być więcej niż g (23% wartości kalorycznej dziennej racji pokarmowej). Na dużych wysokościach następuje utrata wody i rozpuszczonych w niej związków mineralnych, ponieważ powietrze jest suche i chłodne. Dlatego należy spożywać napoje owocowe i warzywne lub odpowiednie mieszanki, aby uzupełniać na bieżąco straty wody. Utrata wody i zawartych w niej cennych składników obniża wydolność fizyczną i sprawność. Stwierdzono, że procesy aklimatyzacji na dużych wysokościach można przyśpieszać przez zwiększenie ilości witamin. Na niedotlenienie ma wpływ kwas pangarnowy. czyli witamina B, podnosi ona odporność na hipoksję. Na zmniejszenie długu tlenowego wpływa też witamina E. Stosuje się specjalne preparaty na przyśpieszenie aklimatyzacji i wzrostu potencjału energetycznego oraz regenerację w okresie odpoczynku. Preparaty te zawierają: witaminy grupy B, kwas pantatenowy, kwas foliowy, kwas askorbinowy (witamina C), anabolizatory: adeninę, guaniny, matacyl. - przyśpieszające syntezę białka, ponadto sole żelaza i hydrolizat kazeiny (białka mleka) [2]. Gospodarka wodna organizmu Życie bez wody nie jest możliwe. Człowiek bez pożywienia, pijąc wodę, może żyć nawet ponad 70 dni, ale bez wody najwyżej 7-10 dni. W organizmie człowieka jest >70% wody w płynach wewnątrzkomórkowych i pozakomórkowych (osocze i limfa). W środowisku wodnym odbywają się wszystkie procesy życiowe, woda jest składnikiem budulcowym wszystkich tkanek. Toteż utrata wody z organizmu bez uzupełnienia natychmiast odbija się na sprawności fizycznej. Już utrata wody w wysokości 2% w stosunku do masy ciała zmniejsza wydolność fizyczną, a przy stracie wody do 10% masy ciała człowiek jest niezdolny do wykonywania jakiegokolwiek wysiłku fizycznego. W wypadku spadku masy ciała o ok. 15%, co oznacza utratę 20-22% ogólnej ilości wody w organizmie, następuje śmierć. Warunkiem normalnego funkcjonowania ustroju człowieka jest zrównoważony bilans wodny [1]. 156

157 Tabela 2. Bilans wodny człowieka [1] Dowóz wody[ml] Wydalanie wody[ml] W pożywieniu 1000 Przez płuca 550 W postaci napojów 1500 Przez skórę 600 Ze spalania wewnątrz ustroju 300 W moczu 1500 W kale 150 Razem 2800 Razem 2800 Żywienie podczas wyjazdów zagranicznych Nagła zmiana sposobu żywienia i trybu życia może być przyczyną zachorowań, dlatego aby ich uniknąć, należy przestrzegać higienicznych zasad postępowania. W niektórych krajach jest zakaz picia nieprzegotowanej wody, która zawiera liczną mikroflorę, zwłaszcza ameby. Mogą one wywołać ciężkie i długotrwałe schorzenia. Zawsze należy pamiętać (w kraju i za granicą) o starannym myciu przegotowaną wodą owoców przed spożyciem oraz o starannym myciu rąk przed każdym posiłkiem. Bardzo przydatne za granicą są produkty spożywcze zabrane z kraju, ale tylko takie, które nie ulegają po pewnym czasie zepsuciu. Może to być szynka konserwowa, polędwica, suche kiełbasy, twarde żółte sery, kakao, konserwy mięsne i rybne, koncentraty zup, kompoty, dżemy, miód, suszone owoce, chleb chrupki, herbatniki, twarda czekolada, cukierki, odżywki [1]. Ostrożnie z konserwami Konserwy są nieodzowną częścią jadłospisu współczesnego człowieka. Sięga się po nie najczęściej wtedy, gdy istnieją trudności z nabyciem świeżego produktu. Dotyczy to również odżywiania sportowców, zwłaszcza turystów. Trzeba jednak wiedzieć, że konserwy mięsne, rybne i warzywne z reguły mają mniejszą wartość niż potrawy przyrządzone ze świeżych produktów. Oprócz tego konserwy są zazwyczaj bardzo tłuste. Dlatego należy w okresie treningów korzystać z nich tylko wtedy, gdy jest to konieczne. Trzeba przy tym zwracać uwagę na datę produkcji i termin przydatności do spożycia, na czystość opakowania i jego szczelność, a zwłaszcza na to, czy nie wytworzył się tzw. bombaż. Polega on na wybrzuszeniu się denka, co świadczy o zbieraniu się gazów w wyniku przemiany materii rozmnażających się bakterii. Przed spożyciem konserwy należy ocenić jej wygląd, konsystencję, smak i zapach (tzw. badanie organoleptyczne). Mimo to zdarza się, że po spożyciu konserwy dochodzi do zatrucia pokarmowego, dlatego przed ważnymi zawodami i w czasie zawodów lepiej zrezygnować ze spożywania takiej żywności. [1] Literatura 1. Celejowa I., Żywienie w sporcie, Wydawnictwo lekarskie PZWL, Warszawa 2. Tauber R. D., Hasik J, Skrzypczak K., Żywienie w turystyce i sporcie, Wyd. WSHiG,.Poznań 157

158 Nutrition in high mountaintourism Summary This article treats about recommended nutrition in high mountain tourism. It shows the amount and types of food to eat on different altitudes. Authors also pointed some nutrition mistakes and good advices on when and with whatto feed organism in tourism. Key words: Tourism, nutrition, alpinism 158

159 Sekcja wielofunkcyjność obszarów wiejskich 159

160 ALTERNATYWNE METODY ZWALCZANIA ŚLIMAKÓW NAGICH NA PRZYKŁADZIE ARION LUSITANICUS Autorzy: Kinga Stawarczyk Michał Stawarczyk, Bartosz Piechowicz SKN Rolników Włościanin Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy ul. Ćwiklińskiej 2, Rzeszów. Uniwersytet Rzeszowski, Zamiejscowy Wydział Biotechnologii Werynia 502, Kolbuszowa. Słowa kluczowe: Arion lusitanicus, Ślinik luzytański, zwalczanie Arion lusitanicus. Ślinik luzytański jest jednym z najbardziej inwazyjnych gatunków ślimaków, który z roku na rok rozprzestrzenia się na coraz większą część Europy niszcząc kolejne uprawy i przyczyniając się do powstania istotnych strat ekonomicznych [1]. Pierwotny zasięg występowania Arion lusitanicus obejmował Hiszpanię, Portugalię i Azory [3]. Obecnie spotyka się go na obszarze prawie całej Europy [2]. W Polsce gatunek ten pojawił się w 1993 roku [1], choć zakłada się, że mógł występować na obszarze naszego kraju już wcześniej [3]. Pojawienie się Arion lusitanicus wymusiło podjęcie działań mających na celu wypracowanie skutecznych metod ograniczenia jego dalszego rozprzestrzeniania - m.in. w roku 2008 w Polsce gatunek ten został wpisany na Listę roślin zwierząt i grzybów gatunków obcych, które w przypadku uwolnienia do środowiska przyrodniczego mogą zagrozić gatunkom rodzimym (Dz. U r., Nr 201, poz. 1237). Rys.1. Ślinik luzytański (autor Michał Stawarczyk) Pojawienie się ślinika luzytańskiego powinno być dla każdego rolnika, ogrodnika czy właściciela ogródka działkowego sygnałem, aby zastosować środki redukujące jego liczebność i utrudniające rozmnażanie. Niestety nie ma obecnie technik umożliwiających całkowite wytępienie populacji tego intruza. 160

161 Aby ograniczyć występowanie Arion lusitanicus po przekroczeniu progów szkodliwości stosuje się obecnie powszechnie dostępne i dopuszczone do obrotu moluskocydy. Wiadomo jednakże, że syntetyczne środki chemiczne nie są w pełni bezpieczne dla środowiska, dlatego też coraz pilniej poszukuje się alternatywnych metod zwalczania szkodników upraw [4]. Zgodnie z maksymą lepiej zapobiegać niż leczyć dużą rolę w ograniczaniu występowania A. lusitanicus ma właściwa pielęgnacja i profilaktyka upraw: odpowiednia melioracja gruntów, likwidowanie resztek pożniwnych, chwastów, kamieni, desek i miejsc nadmiernego gromadzenia się materiału biologicznego, w którym chętnie bytują ślimaki [6]. Znaczenie w ograniczaniu występowania ślinika luzytańskiego odgrywa także prawidłowy dobór i konsekwentne stosowanie zabiegów agrotechnicznych: grabienie, plewienie, motykowanie, podorywka i bronowanie mogą w znaczący sposób zredukować ilość m.in. wyklutych jaj [5]. Bardzo istotną rolę w ograniczaniu populacji Arion lusitanicus w uprawach polowych może odegrać prawidłowe wykorzystanie wiedzy z techniki upraw, np. wprowadzanie do upraw zmianowania, dobór odmian, które szybko kiełkują czy też wczesny i głęboki siew ozimych roślin [5]. Często stosowaną alternatywną metodą walki z Arion lusitanicus jest tworzenie różnego typu fizycznych i chemicznych zapór pomiędzy zwierzęciem a jego potencjalnym posiłkiem - rowów z wodą, opasek miedzianych [7], barier z ziemi okrzemkowej [10], piasku [5], pokruszonych skorupek jajek, tłuczki szklanej, sieczki trzcinowej [7], igieł jodłowych [6], popiołu, plew jęczmiennych [5] czy smoły brzozowej [9]. Sporadycznie spotyka się również stosowanie przeciw ślimakom ogrodzeń w formie opasek elektrycznych [6]. W sprzedaży znajdują się różnorakie formy pułapek do odłowu ślimaków, aczkolwiek samodzielnie wykonane mogą również stanowić doskonały sposób walki z tymi szkodnikami [8]. Ślinik luzytański jest wszystkożercą [5] - atraktantami wabiącymi go do pułapki mogą być więc zarówno całe lub pofragmentowane owoce, warzywa, resztki kuchenne [12], pokarm (sucha karma) dla kota [11], zwykła woda z cukrem czy też bardzo lubiane przez te zwierzęta piwo bądź glikol [8]. A. B. Rys. 2. Pułapki na ślimaki nagie A - domowej produkcji, B - komercyjna wersja pułapki (autor Michał Stawarczyk) 161

162 Przełomem w ograniczaniu występowania Arion lusitanicus może okazać się coraz powszechniejsze stosowanie różnorodnych metod ich biologicznej kontroli. Zastosowanie alternatywnego pokarmu może sprawić, że ślimaki nagie nad smak roślin uprawnych przedłożą walory naturalnych atraktantów występujących tak w formie nasadzeń odpowiednio dobranych gatunków roślin wewnątrz i na obrzeżach upraw, jak i fragmentów tych roślin rozmieszczonych np. w formie kopców w miejscach, w których najskuteczniej odciągną szkodniki. Do atraktantów pokarmowych dla ślinika luzytańskiego należą m.in. takie rośliny, jak: Coriandrum sativum, Rudbeckia laciniata i Archangelica officinalis [5,13]. Pożądane jest także sianie lub sadzenie w uprawach współrzędnych roślin odstraszających ślimaki. Do naturalnych repelentów A. lusitanicus należą m.in. Thymus vulgaris, Aquilegia vulgaris i Allium cepa [6,13]. Podobnie repelentne dla ślimaków działanie mają, stosowane zwykle w formie oprysków, wyciągi i wywary z takich roślin, jak Artemisia absinthium, Allium sp. czy Pteridium aquilinum [14,15,16,17]. Redukując ilość wprowadzanych do środowiska pestycydów mamy większą szansę, że w naszych uprawach i ogrodach zwiększy się bioróżnorodność drapieżników żywiących się A. lusitanicus takich jak owady Carabidae, Staphylinidae i Silphidae [18], płazy, jak np. Bufo bufo, gady, jak Anguis fragilis, ptaki Corvus frugilegus, Turdus merula i Sturnus vulgaris [23] czy ssaki Erinaceus roumanicus i E. europaeus [5, 22]. Również bliżej spokrewniony z Arion lusitanicus ślimak winniczek (Helix pomatia) może przyczyniać się do redukcji liczebności szkodnika poprzez zjadanie jego jaj [6]. W zaleceniach dla gospodarstw ekologicznych zawarte są informacje propagujące ochronę naturalnych siedlisk powyższych zwierząt i wspomaganie ich rozwoju np. poprzez wieszanie budek lęgowych czy tworzenie oczek wodnych. Niektórych z wrogów ślimaków, jak np. kaczki biegusy (Anatinae sp.) i gęsi (Anserinae sp.) można również hodować [6]. Wymaga to jednakże dodatkowych zabiegów związanych z zabezpieczenie upraw przed dostępem tych ptaków, gdyż nie gardzą one również pokarmem roślinnym. Także pasożyty wewnętrzne znalazły zastosowanie w zwalczaniu ślinków luzytańskich. Preparat biologiczny zawierający wyselekcjonowaną odmianę nicienia Phasmarhabditis hermaphrodita z powodzeniem niszczy różnorodne gatunki szkodliwych ślimaków nagich [5]. Moraxella osloensis - bakteria wprowadzona przez nicienia do ciała A. lusitanicus powoduje prowadzące do śmierci zahamowanie żerowania zakażonych ślimaków, przy czym ważne jest tu, że nicienie będące wektorami bakterii wydajnie rozmnażają się również w naszych warunkach klimatycznych [20]. Jak wskazują badania nie tylko dojrzałe osobniki zainfekowane Tetrahymena limacis lub Colopoda steinii, ale również znajdujące się w ich ciałach jaja mają mniejsze szanse na prawidłowy rozwój [19]. Prócz powyższych sposobów istnieje również wiele innych, mniej wydajnych metod zwalczania ślinika luzytańskiego - od zbierania poszczególnych osobników bądź też fizycznej ich likwidacji 162

163 (np. przez ich zadeptanie), przez stosowanie odwarów z martwych osobników A. lusitanicus, którymi następnie traktuje się chronione uprawy [6], oprysków z wody z octem (50:50) lub kawy [24], aż po sypanie soli lub wapna gaszonego, które z jednej strony zabijają ślimaki, ale z drugiej przyczyniają się znacząco do degradacji gleb [5]. Przez ostatnie 70 lat, od momentu wprowadzenia do powszechnego użytku cudownego DDT, na całym świecie obserwowało się niekontrolowaną fascynację syntetycznymi środkami ochrony roślin. Skutkiem tego jest dziś z jednej strony wysoka produkcja rolna, a z drugiej znaczna degradacja środowiska i utrata wiedzy o tym, jak przez tysiące lat człowiek chronił swoje uprawy. Z tego też powodu obecnie, gdy coraz większa ilość szkodliwych gatunków cechuje się znaczna opornością na stosowane przeciw nim biocydy, trzeba od nowa uczyć się jak uprawiać rośliny, by doczekały one momentu zbioru. Artykuł ten powstała w celu przybliżenia czytelnikom różnorodnych tak komercyjnych, jak i domowych sposobów walki z Arion lusitanicus - bardzo inwazyjnym szkodnikiem upraw w Polsce. Mamy nadzieję, że dzięki wiedzy w niej zawartej uda się ocalić jakąś część upraw przed tym ślimakiem i uchronić choćby niewielką część środowiska przed dalszą degradacją wywołaną stosowaniem chemicznych środków ochrony roślin. Literatura 1. Kozłowski J., Kałuski T., Kozłowski R.J., Rozmieszczenie i ekspansja populacji Ślinika luzytańskiego (Arion Lusitanicus Mabille) na terenie Polski. Progress in Plant Protection, 48 (3): Kozłowski J., The distribution, biology, population dynamics and harmfulness of Arion lusitanicus Mabille 1868 (Gastropoda:Pulmonata:Arionidae) in Poland. Journal of Plant Protection Research 47 (3): Kałuski T., Kozłowski J., Soroka M., Genetyczne badania nad rozprzestrzenianiem inwazyjnego gatunku ślimaka Arion lusitanicus w Polsce. Progress in Plant Protection, 49 (3): Kozłowski J., Kałuski T., Jaskulska M., Kozłowska M., Wybrane związki chemiczne w ograniczaniu żerowania slinika luzytańskiego (Arion lusitanicus Mabille). Progress in Plant Protection. 49 (4): Kozłowski J., Ślimaki nagie w uprawach, klucz do identyfikacji, metody zwalczania. Poznań Instytut Ochrony Roślin: Tyburski J., Żakowska-Biemas S., Wprowadzenie do rolnictwa ekologicznego. Wydawnictwo SGGW. 7. Schuder I., Port G., Bennison J., Barriers, repellents and antifeedants for slug and snail control. Crop Protection 22: Hagnell J., Schander Ch., Nilsson M., Ragnarsson J., Valstar H., Wollkopf A. M., von Proschwitz T., How to trap a slug: Commercial versus homemade slug traps. Crop Protection 25: Lindqvist I., Lindqvist B., Tiilikkala K., Hagner M., Penttinen O., Pasanen T., Setälä T., 2010, Birch tar oil is an effective mollusc repellent: field and laboratory experiments Rusing Arianta arbustorum (Gastropoda: Helicidae)and Arion lusitanicus (Gastropoda: Arionidae). Agricultural and Food Science. 19: Macdonald T., Slug Stoppers, Organic Gardening. 54 (3): Jankowska B., Wilk E., Porównanie przydatności niektórych przynęt do odłowu ślimaków nagich w ogrodach i gospodarstwach ekologicznych. Progress in Plant Protection. 49 (2): Kozłowki J., Sionek R., Kozłowska M., Ocena przydatności różnych przynęt do odłowu ślimaków "nagich" (Gastropoda: Stylommatophora). Journal of Plant Protection. 2 (36): Briner T., Frank T., The palatability of 78 wildflower strip plants to the slug Arion lusitanicus. Annals of Applied Biology. 133 (1): Frahm J. P., Kirchhoff K., Antifeeding effects of bryophyte extracts from Neckera crispa and Porella obtusata against the slug Arion lusitanicus. Cryptogamie Bryologie. 23 (3):

164 15. Barone M., Frank T., Effects of plant extracts on the feeding behaviour of the slug Arion lusitanicus. Annals of Applied Biology. 134: Kozłowski J., Waligóra D Reakcja Arion lisitanicus Mabille, 1868 na wyciągi roślinne. Postępy w ochronie roślin. 47 (4): Pisarek M., Laboratoryjna ocena przydatności czosnku do zwalczania ślimaków nagich z rodzaju Arion. Postępy w ochronie roślin. 45 (2): Hatteland B. A., Predation by carabid beetles (Coleoptera, Carabidae) on the invasive Iberian slug Arion lusitanicus. Dissertation for the Degree Philosophiae Doctor. 19. Shoaib M., Cagan L., Natural enemies of slug and snail recorded in Slovakia. Acta fytotechnica et zootechnic. 7: Grimm B., Effect of the nematode Phasmarhabditis hermaphrodita on young stages of the pest slug Arion lusitanicus. Journal of Molluscan Studies. 68 (1): Speiser B., Glen D., Piggot S., Ester A., Davies K., Castillejo J., Coupland J., Slug damage and control of slugs in horticultural crops Barker G. B., Natural Enemies of Terrestrial Molluscs. CABI Publishing/ Biddles LTD. King s Lynn, UK 23. Cross J. V., Easterbrook M. A., Crook A. M., Crook D., Fitzgerald J. D., Innocenzi P. J., Jay C. N., Solomon M. G., Natural Enemies and Biocontrol of Pests of Strawberry in Northern and Central Europe. Biocontrol Science and Technology. 11: Hollingsworth R.G., Armstrong J.W., Campbell E., Caffeine as a novel toxicant for slugs and snails. Annals of Applied Biology. 142: Alternative methods of slug control (e.g. Arion lusitanicus) Summary: Arion lusitanicus is invasive species of slug, which causes very serious destruction of crops and financial losses. Controling this species is extremely difficult. Pesticide (molluscicides) treatments are not effective enough. The presented method to control this pest can be a serious alternative to chemical pesticides. Key word: Arion lusitanicus, slug, Spanish slug, slug control 164

165 ANALIZA PORÓWNAWCZA PRODUCENTÓW FASOLI PIĘKNY JAŚ Z DOLINY DUNAJCA Autorzy: Krzysztof Pikul, Anna Szeląg-Sikora, Mateusz Malinowski Opiekun: dr inż. Jakub Sikora Koło Naukowe Techniki Rolniczej, Sekcja Zarządzania Produkcją Uniwersytet Rolniczy w Krakowie, Wydział Inżynierii Produkcji i Energetyki Ul. Balicka 116B, Kraków Słowa kluczowe: fasola, Piękny Jaś, Chroniona nazwa pochodzenia, analiza SWOT Wstęp Phaseolus multiflorus czyli fasola wielokwiatowa jest rośliną strączkową, jednoroczną. Należy do rodziny bobowatych, posiada wiotką łodygę, duże trójlistkowe liście, kwiaty barwy białej lub czerwonej. Owocem jest strąk, w którym znajduje się kilka dużych nerkowatych nasion barwy białej bądź czarnej nakrapianej. Fasola została sprowadzona do Europy przez Krzysztofa Kolumba w XVI w., do Polski natomiast trafiła za sprawą wielkiej orędowniczki dobrej kuchni- królowej Bony. Piękny Jaś należy do grupy odmian tycznych, czyli wymagających do wzrostu specjalnych podpór. Cechą charakterystyczną Jaśka są piękne białe kwiaty, oraz duże pełne nerkowate nasiona również barwy białej. W Polsce roślina ta jest popularna, lecz głównie uprawiana na małych areałach. Szczególnym obszarem uprawy fasoli Piękny Jaś jest teren 11 gmin leżących w dolinie Dunajca. Dolina Dunajca charakteryzuje się specyficznym mikroklimatem, który ułatwia wzrost rośliny, jej wegetacje oraz nadaje nasionom specjalne walory smakowe i odżywcze. W celu ochrony producentów i samego produktu, jakim jest Piękny Jaś spółdzielnia Dolina Dunajca złożyła wniosek do Ministerstwa Rolnictwa i Rozwoju Wsi o rejestracje nazwy Fasola Piękny Jaś z Doliny Dunajca" lub "Fasola z Doliny Dunajca. W niniejszej pracy scharakteryzowano uwarunkowania produkcyjne fasoli, a także wykonano analizę porównawczą jej producentów z obszaru doliny Dunajca z rozróżnieniem na gospodarstwa działające indywidualnie oraz zrzeszone w grupie producenckiej. Narzędziem badawczym był kwestionariusz wywiadu. Część wyników została opracowana z wykorzystaniem analizy SWOT, która potwierdziła znaczenie przynależności producentów do grup producenckich. Producenci zrzeszeni wskazywali na większe korzyści z produkcji fasoli w stosunku do producentów indywidualnych. 165

166 Charakterystyka i uprawa fasoli Fasola była chlebem powszednim starożytnych Inków, Majów i Azteków. Od wieków znali są również mieszkańcy Indii i Chin. Fasolę uprawiano już wiele tysięcy lat przed naszą erą w Meksyku i Peru. W jednym z peruwiańskich wykopalisk odnaleziono nawet mumię, której w usta włożono owinięte w płótno ziarno kukurydzy i nasiona fasoli. Uprawa fasoli stała się popularna w Europie dopiero w XVI w., kiedy Kolumb przywiózł do Hiszpanii nasiona z Ameryki. Do Polski przywiozła ją królowa Bona. Dziś uprawia się ją na całym świecie. Znanych jest ponad 200 gatunków fasoli, a około 20 uprawia się na cela spożywcze. W Polsce najlepsze warunki do uprawy na suche ziarno znajdują się na południowej Lubelszczyźnie, w okolicach Rzeszowa, Przemyśla i Jarosławia, a także w rejonie poznańskopomorsko-łódzkim oraz rejonie krakowskim [Janisz 2006]. Dolina Dunajca to jedyny region w Polsce, w którym uprawia się fasolę tyczną na dużą skalę. Główny Urząd Statystyczny [2010] podaje, że powierzchnia zasiewów jadalnych roślin strączkowych w podregionie krakowsko-tarnowskim to 1512 ha. Plantacje fasoli w tym rejonie położone są stosunkowo nisko, często w niewielkiej odległości od rzeki, dzięki czemu pola są osłonięte od wiatru, a poranne mgły wiosną i jesienią ograniczają gwałtowne zmiany temperatury. Fasola Piękny Jaś to roślina jednoroczna, pnąca, tyczna, średnio plenna, dość późna. Strąki dojrzewają do później jesieni. Nasiona fasoli "Piękny Jaś" z Doliny Dunajca należą do największych w obrębie gatunku fasola wielokwiatowa, są gładkie, dobrze wypełnione, jednolite w kształcie. Ziarna są bocznie spłaszczone o nerkowatym kształcie [Kmak i in. 2007]. Na przełomie 2 i 3 dekady kwietnia następuje wysiew Pięknego Jasia. Fasola ta nie ma specjalnych wymagań glebowych, choć najodpowiedniejsze są gleby ciepłe nawożone próchnicznie, dlatego też często przedplonem jest pszenica bądź jęczmień z rozdrobnioną i przyoraną słomą. Po wiosennym kultywatorowaniu następuje wysadzenie fasoli w podwójne rzędy oddalone od siebie o 180cm. Inna metodą stosowaną szczególnie przy mniejszych plantacjach jest ręczne wysadzanie nasion punktowo po 2-3 sztuki do bruzdek wykonanych najczęściej obsypnikiem, a następnie przykrycie nasion broną chwastownik. Kolejną czynnością przy uprawie jest spulchnienie powierzchni pola lekka broną co ułatwia równomierne wschody rośliny. Na początku czerwca roślina jest na tyle duża ze konieczne jest zastosowanie podpór w postaci drewnianych tyczek bądź też uprawa na tak zwanych sznurkach czyli uprawa szpalerowa. Na chwilę obecną tyczki wierzbowe stały się bardzo popularne. Spowodowane jest to szybkim wzrostem wierzby (odrostu średnio, co 3 lata). Wadą takiego rozwiązania jest mała trwałość takich tyczek średnio 2 do 4 sezony. Za pomocą tak zwanej sztangli wykonanej z ciężkiego prostego kawałka rurki z ostrą końcówka najczęściej dociążonego betonem wykonuje się w ziemi w odległości co ok cm od rośliny otwór na głębokość ok. 25 cm w który kolejna osoba wbija tykę. Innym sposobem uprawy jest uprawa szpalerowa, w takim przypadku ręcznie bądź za po pomocą świdra zamontowanego na ciągniku rolniczym wykonuje się otwory w ziemi o średnicy ok cm na głębokość do 80cm, w które wstawia się drewniane słupki 166

167 o wysokości do 3m. Odległość zależna jest od średnicy słupków i osłonięcia od wiatru. Na słupkach rozciąga się stalowy drut, który naciągany jest na końcach rzędów. W zależności od pogody i tempa wegetacji w granicach połowy września wykonuje się podcinanie roślin za pomocą sierpów bądź krótkich kos z obciętą częścią szpicową. Przez dwa do trzech tygodni fasola swobodnie dosycha na tyczkach czy też na drutach. Po tym czasie konieczne jest ściągniecie jej z podpór, wykonanie z nich wiązeczek i zwiezienie pod zadaszenie. W miejscu suchym i przewiewnym wiązki fasoli leżakują aż do listopada [Konieczny 2009]. Częstym określeniem wielkości produkcji funkcjonującym wśród producentów jest podanie ilości roślin, a dokładniej tyczek potrzebnych do wzrostu. Nie wykorzystuje się systemu dziesiętnego, lecz podaje się to w ilości kop (kopa=60 sztuk). Jeden hektar uprawy fasoli przy standardowym dla fasoli rozstawie rzędów to około 200 kop (12000 tyczek). Materiał i metoda W celu ochrony producentów i samego produktu, jakim jest Piękny Jaś spółdzielnia Dolina Dunajca złożyła wniosek do ministerstwa rolnictwa i rozwoju wsi o rejestracje nazwy Fasola Piękny Jaś z Doliny Dunajca" lub "Fasola z Doliny Dunajca. W 2008 roku wniosek został pozytywnie rozpatrzony i wysłany do Komisji Europejskiej w celu nadania certyfikatu Chroniona nazwa pochodzenia. 18 listopada ubiegłego roku wniosek został opublikowany w dzienniku urzędowym unii. Chroniona nazwa pochodzenia (ang. protected designation of origin PDO) jest znakiem, który określa jakość produktu poprzez geograficzną nazwę jego miejsca pochodzenia i który ściśle wiąże charakterystyczne cechy produktu z uwarunkowaniami glebowymi, mikroklimatycznymi oraz historyczno - społecznymi miejsca, z którego dany produkt pochodzi. Począwszy od surowców, a skończywszy na sposobie wytwarzania produktu. Produkt posiadający PDO (Ch.n.p) powinien spełniać trzy następujące warunki: pochodzić z terenu, z którym związana jest jego nazwa (region, określone miejsce); jakość lub właściwości charakterystyczne produktu winny zależeć głównie bądź wyłącznie od środowiska geograficznego przy określonych warunkach środowiska naturalnego i oddziaływania człowieka; produkcja, przetwarzanie oraz przygotowanie winny odbywać się na terenie objętym delimitacją. Obszar, na którym uprawiana jest fasola Piękny Jaś leży na terenie 11 gmin leżących w dolinie Dunajca (Gródek nad Dunajcem powiat nowosądecki, Zakliczyn, Wojnicz, Wierzchosławice, Radłów, Wietrzychowice, Tarnów, Pleśna, Żabno powiat tarnowski, Czchów powiat brzeski i Gręboszów powiat dąbrowski), wszystkie w województwie małopolskim. Podstawowym narzędziem pracy był kwestionariusz wywiadu kierowanego przygotowany specjalnie dla producentów fasoli. W okresie sierpnia i września 2010 roku na terenie 2 gmin: Wojnicz i Zakliczyn zostały przeprowadzone ankiety na grupie 20 celowo wybranych producentów fasoli Piękny Jaś 10, którzy należą do grupy producenckiej i 10 nie zrzeszonych. Kwestionariusz zawierał pytania z zakresu danych na temat osoby respondenta: wieku wykształcenia, kwalifikacji zawodowych; gospodarstwa rolnego: jego powierzchni, struktury upraw; uprawy fasoli, wiedzy na 167

168 temat grupy producenckiej oraz subiektywnej oceny produkcji Pięknego Jasia. Podstawowym narzędziem służącym do analizy porównawczej obu grup producentów była analiza SWOT. Analizę SWOT różnicującą dla poszczególnych grup producentów wykonano w oparciu o następujące czynniki konkurencyjne, którym nadano odpowiednie wagi: cena za produkt (1,0), rynek zbytu (0,2), możliwości sprzedaży (0,2), marketing (0,1), system dystrybucji (0,1), warunki uprawy (0,5), kwalifikacje zawodowe (0,2), specjalizacja produkcji (0,1), zdolność produkcyjna (0,4), koszty (0,4), możliwości z ChNP (0,1). gospodarstw. Wyniki W tabeli 1 i 2 zestawiono podstawowe charakterystyki respondentów i analizowanych Tabela 1. Zestawienie charakterystyki respondentów L.p. Cecha Producenci Producenci indywidualni Zrzeszeni 1. Średni wiek producenta 58,5 lat 52,6lat 2. Poziom wykształcenia podstawowe 3 3 zawodowe 5 4 średnie Kwalifikacje rolnicze szkoła rolnicza kurs rolniczy 4. Doświadczenie w uprawie <10lat 10-30lat >30lat 5 Główne źródła dochodu gospodarstwo stała praca zarobkowa zarobki dorywcze emerytura renta Źródło: Opracowanie własne Producenci obu grup odznaczali się podobnym wiekiem, niestety był to wiek zbliżony do wieku emerytalnego, poziom wykształcenia był niski jedynie 5 osób miało wykształcenie średnie, kierunkowe rolnicze jedynie dwóch. Bardzo wysoko można ocenić doświadczenie w uprawie fasoli, które średnio w gospodarstwach przekracza 30 lat. Średnia powierzchnia gospodarstw - 3,27 ha - nieznacznie odbiega od średniej regionu wynoszącej: 3,83 ha, powierzchnia uprawy fasoli stanowi około 25 % powierzchni uprawianych gruntów. Według producentów uprawa ta stanowi jednak główne źródło dochodów z gospodarstwa rolnego. Tabela 3 przedstawia porównanie obu grup producentów pod względem czynników siły konkurencyjnej. Poszczególne wartości wynikają z oceny producentów, którzy odpowiadali na pytania w ankiecie. Obie grupy producentów dysponują zbliżoną zdolnością produkcyjną, warunkami glebowymi i uzyskiwaną ceną ze sprzedaży. Największe rozbieżności wynikają z braku możliwości 168

169 sprzedaży większych partii materiału oraz spójnego marketingu w przypadku producentów indywidualnych. Producenci zrzeszeni w grupie produkcyjnej wskazywali na większe korzyści z produkcji fasoli w stosunku do producentów indywidualnych. Tabela 2. Zestawienie charakterystyki gospodarstw L.p. Producenci Cecha indywidualni 1. Powierzchnia użytków rolnych [ha] 3,75 2,8 2. Zmiany powierzchni uprawy fasoli wzrost powierzchni spadek powierzchni brak zmian 3. Perspektywa uprawy na następne lata: tak nie nie wiem Producenci Zrzeszeni Powierzchnia uprawy fasoli [ha] 0,64 0,79 5 Procentowy udział powierzchni uprawy fasoli w stosunku do całej powierzchni gospodarstwa Źródło: Opracowanie własne % 28% Tabela 3. Zestawienie siły konkurencyjnej Źródło: Opracowanie własne 169

Organizmy modyfikowane genetycznie

Organizmy modyfikowane genetycznie Organizmy modyfikowane genetycznie C o to jest G M O? Organizmy Modyfikowane Genetycznie GMO (z ang. Genetically Modified Organism) - Organizmy Transgeniczne - są to organizmy, które zawierają w swoim

Bardziej szczegółowo

Co warto wiedzieć o zagrożeniach związanych z paleniem tytoniu?

Co warto wiedzieć o zagrożeniach związanych z paleniem tytoniu? Co warto wiedzieć o zagrożeniach związanych z paleniem tytoniu? HISTORIA NIKOTYNY Kiedy Krzysztof Kolumb wylądował ze swymi marynarzami na nieznanym lądzie, dnia 11 października Roku Pańskiego 1492, został

Bardziej szczegółowo

Biotechnologia jest dyscypliną nauk technicznych, która wykorzystuje procesy biologiczne na skalę przemysłową. Inaczej są to wszelkie działania na

Biotechnologia jest dyscypliną nauk technicznych, która wykorzystuje procesy biologiczne na skalę przemysłową. Inaczej są to wszelkie działania na Biotechnologia jest dyscypliną nauk technicznych, która wykorzystuje procesy biologiczne na skalę przemysłową. Inaczej są to wszelkie działania na żywych organizmach prowadzące do uzyskania konkretnych

Bardziej szczegółowo

Rośliny modyfikowane genetycznie (GMO)

Rośliny modyfikowane genetycznie (GMO) Rośliny modyfikowane genetycznie (GMO) Organizmy modyfikowane genetycznie Organizm zmodyfikowany genetycznie (międzynarodowy skrót: GMO Genetically Modified Organizm) to organizm o zmienionych cechach,

Bardziej szczegółowo

Jakie są dotychczasowe efekty prac Komisji Kodeksu Żywnościowego FAO/WHO w zakresie Genetycznie Modyfikowanych Organizmów (GMO)?

Jakie są dotychczasowe efekty prac Komisji Kodeksu Żywnościowego FAO/WHO w zakresie Genetycznie Modyfikowanych Organizmów (GMO)? Jakie są dotychczasowe efekty prac Komisji Kodeksu Żywnościowego FAO/WHO w zakresie Genetycznie Modyfikowanych Organizmów (GMO)? W latach 2000-2007 kwestie związane z GMO omawiane były na forum, powołanej

Bardziej szczegółowo

Warsztaty dla Rodziców. Wiosenne śniadanie. Warszawa 26.05.2015 r.

Warsztaty dla Rodziców. Wiosenne śniadanie. Warszawa 26.05.2015 r. Warsztaty dla Rodziców Wiosenne śniadanie Warszawa 26.05.2015 r. Urozmaicenie Uregulowanie Umiarkowanie Umiejętności Unikanie Prawidłowe żywienie 7 zasad wg prof. Bergera + Uprawianie sportu + Uśmiech

Bardziej szczegółowo

WYBRANE SKŁADNIKI POKARMOWE A GENY

WYBRANE SKŁADNIKI POKARMOWE A GENY WYBRANE SKŁADNIKI POKARMOWE A GENY d r i n ż. Magdalena Górnicka Zakład Oceny Żywienia Katedra Żywienia Człowieka WitaminyA, E i C oraz karotenoidy Selen Flawonoidy AKRYLOAMID Powstaje podczas przetwarzania

Bardziej szczegółowo

Uzależnienia. Nabyta silna potrzeba zażywania jakiejś substancji.

Uzależnienia. Nabyta silna potrzeba zażywania jakiejś substancji. Uzależnienia Nabyta silna potrzeba zażywania jakiejś substancji. Termin uzależnienie jest stosowany głównie dla osób, które nadużywają narkotyków, alkoholu i papierosów. Używki Wszystkie używki stanowią

Bardziej szczegółowo

CIAŁO I ZDROWIE WSZECHŚWIAT KOMÓREK

CIAŁO I ZDROWIE WSZECHŚWIAT KOMÓREK CIAŁ I ZDRWIE WSZECHŚWIAT KMÓREK RGANIZM RGANY TKANKA SKŁADNIKI DŻYWCZE x x KMÓRKA x FUNDAMENT ZDRWEG ŻYCIA x PRZEMIANA MATERII WSZECHŚWIAT KMÓREK Komórki są budulcem wszystkich żywych istot, również nasze

Bardziej szczegółowo

Europejski Tydzień Walki z Rakiem

Europejski Tydzień Walki z Rakiem 1 Europejski Tydzień Walki z Rakiem 25-31 maj 2014 (http://www.kodekswalkizrakiem.pl/kodeks/) Od 25 do 31 maja obchodzimy Europejski Tydzień Walki z Rakiem. Jego celem jest edukacja społeczeństwa w zakresie

Bardziej szczegółowo

BIOLOGICZNIE AKTYWNY SUPLEMENT DIETY. www.calivita.com.pl

BIOLOGICZNIE AKTYWNY SUPLEMENT DIETY. www.calivita.com.pl BIOLOGICZNIE AKTYWNY SUPLEMENT DIETY WOLNE RODNIKI TO AKTYWNE ATOMY LUB CZĄSTECZKI, KTÓRE ZGUBIŁY JEDEN ELEKTRON. PRÓBUJĄC GO ODZYSKAĆ, SZYBKO WCHODZĄ W REAKCJE Z RÓŻNYMI ELEMENTAMI KOMÓREK, USZKADZAJĄC

Bardziej szczegółowo

Wpływ alkoholu na ryzyko rozwoju nowotworów złośliwych

Wpływ alkoholu na ryzyko rozwoju nowotworów złośliwych Wpływ alkoholu na ryzyko rozwoju nowotworów złośliwych Badania epidemiologiczne i eksperymentalne nie budzą wątpliwości spożywanie alkoholu zwiększa ryzyko rozwoju wielu nowotworów złośliwych, zwłaszcza

Bardziej szczegółowo

Warzywa i owoce powinny wchodzić w skład codziennej diety, gdyż są źródłem cennych witamin, zwłaszcza witaminy C oraz B - karotenu.

Warzywa i owoce powinny wchodzić w skład codziennej diety, gdyż są źródłem cennych witamin, zwłaszcza witaminy C oraz B - karotenu. Warzywa i owoce powinny wchodzić w skład codziennej diety, gdyż są źródłem cennych witamin, zwłaszcza witaminy C oraz B - karotenu. Dostarczają także kwasu foliowego. Zawierają znaczne ilości składników

Bardziej szczegółowo

4 JUNIOR PHARMA PREZENTUJE. suplementy stworzone z myślą o najmłodszych sportowcach

4 JUNIOR PHARMA PREZENTUJE. suplementy stworzone z myślą o najmłodszych sportowcach 4 JUNIOR PHARMA PREZENTUJE suplementy stworzone z myślą o najmłodszych sportowcach JESTEŚ RODZICEM MŁODEGO SPORTOWCA? Czy Twoje dziecko uczęszcza na treningi minimum 2 razy w tygodniu? Zdarzyło się, że

Bardziej szczegółowo

Mikroorganizmy Zmodyfikowane Genetycznie

Mikroorganizmy Zmodyfikowane Genetycznie Mikroorganizmy Zmodyfikowane Genetycznie DEFINICJA Mikroorganizm (drobnoustrój) to organizm niewidoczny gołym okiem. Pojęcie to nie jest zbyt precyzyjne lecz z pewnością mikroorganizmami są: bakterie,

Bardziej szczegółowo

1. Biotechnologia i inżynieria genetyczna zagadnienia wstępne 13

1. Biotechnologia i inżynieria genetyczna zagadnienia wstępne 13 Spis treści Przedmowa 11 1. Biotechnologia i inżynieria genetyczna zagadnienia wstępne 13 1.1. Wprowadzenie 13 1.2. Biotechnologia żywności znaczenie gospodarcze i społeczne 13 1.3. Produkty modyfikowane

Bardziej szczegółowo

Znaczenie zdrowego odżywiania w profilaktyce nowotworowej

Znaczenie zdrowego odżywiania w profilaktyce nowotworowej Znaczenie zdrowego odżywiania w profilaktyce nowotworowej Nasza dieta oraz sposób odżywiania jest drugą (po paleniu) najważniejszą przyczyną powstawania chorób nowotworowych. Pożywienie stanowi czynnik

Bardziej szczegółowo

www.california-fitness.pl www.calivita.com

www.california-fitness.pl www.calivita.com DRIVERADE branica.pl SKONCENTROWANA OCHRONA AKTYWNEGO CZŁOWIEKA Unikalny zestaw składników uwzględniający potrzeby współczesnego człowieka Ekstrakt z guarany Witamina C Lecytyna Witamina E Cholina Selen

Bardziej szczegółowo

Metody przechowywania i utrwalania bioproduktów KOLEKCJE SZCZEPÓW

Metody przechowywania i utrwalania bioproduktów KOLEKCJE SZCZEPÓW Metody przechowywania i utrwalania bioproduktów KOLEKCJE SZCZEPÓW Opracował: dr S. Wierzba Katedra Biotechnologii i Biologii Molekularnej Uniwersytetu Opolskiego Kolekcje szczepów Metody przechowywania

Bardziej szczegółowo

Prezentacja antynikotynowa PAPIEROSOM POWIEDZ STOP

Prezentacja antynikotynowa PAPIEROSOM POWIEDZ STOP Prezentacja antynikotynowa PAPIEROSOM POWIEDZ STOP Co to jest nałóg? Często zadajemy sobie to pytanie? Nałóg, to zakorzeniona dysfunkcja sprawności woli przejawiająca się w chronicznym podejmowaniu szkodliwych

Bardziej szczegółowo

Podstawy biotechnologii. SYLABUS A. Informacje ogólne

Podstawy biotechnologii. SYLABUS A. Informacje ogólne Podstawy biotechnologii SYLABUS A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod przedmiotu Język przedmiotu

Bardziej szczegółowo

SPOŁECZEŃSTWO OD KUCHNI Integracja międzypokoleniowa mieszkańców Śliwkowego Szlaku

SPOŁECZEŃSTWO OD KUCHNI Integracja międzypokoleniowa mieszkańców Śliwkowego Szlaku SPOŁECZEŃSTWO OD KUCHNI Integracja międzypokoleniowa mieszkańców Śliwkowego Szlaku NASZE KULINARNE TRADYCJE NASZE KULINARNE TRADYCJE Co składa się na nie? Bez jakich produktów i potraw nie wyobrażamy sobie

Bardziej szczegółowo

Instrukcja do ćwiczeń laboratoryjnych

Instrukcja do ćwiczeń laboratoryjnych UNIWERSYTET GDAŃSKI WYDZIAŁ CHEMII Pracownia studencka Katedra Analizy Środowiska Instrukcja do ćwiczeń laboratoryjnych Ćwiczenie nr 4 i 5 OCENA EKOTOKSYCZNOŚCI TEORIA Chemia zanieczyszczeń środowiska

Bardziej szczegółowo

KARTA KURSU. Biotechnology in Environmental Protection. Kod Punktacja ECTS* 1

KARTA KURSU. Biotechnology in Environmental Protection. Kod Punktacja ECTS* 1 KARTA KURSU Nazwa Nazwa w j. ang. Biotechnologia w ochronie środowiska Biotechnology in Environmental Protection Kod Punktacja ECTS* 1 Koordynator Prof. dr hab. Maria Wędzony Zespół dydaktyczny: Prof.

Bardziej szczegółowo

Zdobycze biotechnologii w medycynie i ochronie środowiska

Zdobycze biotechnologii w medycynie i ochronie środowiska Zdobycze biotechnologii w medycynie i ochronie środowiska InŜynieria genetyczna - badania biomedyczne Jednym z najbardziej obiecujących zastosowań nowych technologii opartych na przenoszeniu genów z jednego

Bardziej szczegółowo

10 ZASAD ZDROWEGO ŻYWIENIA

10 ZASAD ZDROWEGO ŻYWIENIA 10 ZASAD ZDROWEGO ŻYWIENIA 10 ZASAD ZDROWEGO ŻYWIENIA: 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. Należy spożywać produkty z różnych grup żywności (dbać o urozmaicenie posiłków) Kontroluj masę ciała (dbaj o zachowanie

Bardziej szczegółowo

Organizmy Modyfikowane Genetycznie Rośliny transgeniczne

Organizmy Modyfikowane Genetycznie Rośliny transgeniczne Organizmy Modyfikowane Genetycznie Rośliny transgeniczne Co to GMO? GMO to organizmy, których genom został zmieniony metodami inżynierii genetycznej w celu uzyskania nowych cech fizjologicznych (lub zmiany

Bardziej szczegółowo

Podczas gotowania część składników przedostaje się do wody. Część składników ulatnia się wraz z parą (głównie witamina C).

Podczas gotowania część składników przedostaje się do wody. Część składników ulatnia się wraz z parą (głównie witamina C). Podczas gotowania część składników przedostaje się do wody. Część składników ulatnia się wraz z parą (głównie witamina C). Wzrost temperatury redukuje poziom większości składników odżywczych. Surowy por

Bardziej szczegółowo

nt. WYBIERZ ŻYCIE BEZ TYTONIU

nt. WYBIERZ ŻYCIE BEZ TYTONIU Grażyna Matysek nauczyciell wychowania fizycznego Publiczna Szkoła Podstawowa w Skarszewach Referat z Profilaktyki Uzależnień nt. WYBIERZ ŻYCIE BEZ TYTONIU przygotowany dla nauczycieli na lekcję wychowania

Bardziej szczegółowo

Żywność. zapewnia prawidłowe funkcjonowanie. poprawia samopoczucie

Żywność. zapewnia prawidłowe funkcjonowanie. poprawia samopoczucie Warsztaty żywieniowe Żywność buduje i regeneruje dostarcza energii zapewnia prawidłowe funkcjonowanie poprawia samopoczucie Żaden pojedynczy produkt nie dostarczy Ci wszystkiego, czego potrzebujesz dlatego

Bardziej szczegółowo

OCZYSZCZANIE ŚCIEKÓW PRZEMYSŁOWYCH O DUŻEJ ZAWARTOŚCI OLEJÓW NA ZŁOŻU BIOLOGICZNYM

OCZYSZCZANIE ŚCIEKÓW PRZEMYSŁOWYCH O DUŻEJ ZAWARTOŚCI OLEJÓW NA ZŁOŻU BIOLOGICZNYM ścieki przemysłowe, złoże biologiczne Katarzyna RUCKA, Małgorzata BALBIERZ* OCZYSZCZANIE ŚCIEKÓW PRZEMYSŁOWYCH O DUŻEJ ZAWARTOŚCI OLEJÓW NA ZŁOŻU BIOLOGICZNYM Przedstawiono wyniki laboratoryjnych badań

Bardziej szczegółowo

Oznaczanie mocznika w płynach ustrojowych metodą hydrolizy enzymatycznej

Oznaczanie mocznika w płynach ustrojowych metodą hydrolizy enzymatycznej Oznaczanie mocznika w płynach ustrojowych metodą hydrolizy enzymatycznej Wprowadzenie: Większość lądowych organizmów kręgowych część jonów amonowych NH + 4, produktu rozpadu białek, wykorzystuje w biosyntezie

Bardziej szczegółowo

Zanieczyszczenia naftowe w gruncie. pod redakcją Jana Surygały

Zanieczyszczenia naftowe w gruncie. pod redakcją Jana Surygały Zanieczyszczenia naftowe w gruncie pod redakcją Jana Surygały Oficyna Wydawnicza Politechniki Wrocławskiej Wrocław 2000 Zanieczyszczenia naftowe w gruncie pod redakcją Jana Surygały Oficyna Wydawnicza

Bardziej szczegółowo

INFORMACJE O ZASTOSOWANYCH PREPARATACH NOURIVIT I NOURIVIT PLUS

INFORMACJE O ZASTOSOWANYCH PREPARATACH NOURIVIT I NOURIVIT PLUS 1 INFORMACJE O ZASTOSOWANYCH PREPARATACH NOURIVIT I NOURIVIT PLUS Nourivit jest produkowany w kilku etapach z naturalnych składników mineralnych w kontrolowanym procesie kruszenia i sortowania bez użycia

Bardziej szczegółowo

Paweł Połanecki. Organizmy Genetycznie Modyfikowane w rolnictwie Zagadnienia prawne

Paweł Połanecki. Organizmy Genetycznie Modyfikowane w rolnictwie Zagadnienia prawne Paweł Połanecki Organizmy Genetycznie Modyfikowane w rolnictwie Zagadnienia prawne 1 Konflikt interesów wokół zastosowania technologii transgenicznych w rolnictwie naukowcy oraz instytucje eksperymentalno-przemysłowe

Bardziej szczegółowo

POWTÓRZENIE TREŚCI NAUCZANIA Z BIOLOGII KLASY III ROZPISKA POWTÓRZEŃ ROK 2007/2008 Klasa I Treści programowe Dział powtórzeniowy Przewidziana data

POWTÓRZENIE TREŚCI NAUCZANIA Z BIOLOGII KLASY III ROZPISKA POWTÓRZEŃ ROK 2007/2008 Klasa I Treści programowe Dział powtórzeniowy Przewidziana data POWTÓRZENIE TREŚCI NAUCZANIA Z BIOLOGII KLASY III ROZPISKA POWTÓRZEŃ ROK 2007/2008 Klasa I Treści programowe Dział powtórzeniowy Przewidziana data 1. Struktura organizmu i funkcje, jakim ona służy ( komórki,

Bardziej szczegółowo

Uniwersytet Łódzki, Instytut Biochemii

Uniwersytet Łódzki, Instytut Biochemii Życie jest procesem chemicznym. Jego podstawą są dwa rodzaje cząsteczek kwasy nukleinowe, jako nośniki informacji oraz białka, które tę informację wyrażają w postaci struktury i funkcji komórek. http://www.nobelprize.org/nobel_prizes/medicine/laureates/1959/press.html?print=1

Bardziej szczegółowo

BADANIA PODATNOŚCI ŚCIEKÓW Z ZAKŁADU CUKIERNICZEGO NA OCZYSZCZANIE METODĄ OSADU CZYNNEGO

BADANIA PODATNOŚCI ŚCIEKÓW Z ZAKŁADU CUKIERNICZEGO NA OCZYSZCZANIE METODĄ OSADU CZYNNEGO oczyszczanie, ścieki przemysłowe, przemysł cukierniczy Katarzyna RUCKA, Piotr BALBIERZ, Michał MAŃCZAK** BADANIA PODATNOŚCI ŚCIEKÓW Z ZAKŁADU CUKIERNICZEGO NA OCZYSZCZANIE METODĄ OSADU CZYNNEGO Przedstawiono

Bardziej szczegółowo

Jakie produkty warto ze sobą łączyć a jakich połączeń produktów powinniśmy unikać?

Jakie produkty warto ze sobą łączyć a jakich połączeń produktów powinniśmy unikać? Jakie produkty warto ze sobą łączyć a jakich połączeń produktów powinniśmy unikać? Komponując codzienne posiłki z ulubionych produktów spożywczych zwykle nie zastanawiamy się nad ich wpływem na nasz organizm

Bardziej szczegółowo

Zadbaj o swoje zdrowie już dziś

Zadbaj o swoje zdrowie już dziś Zadbaj o swoje zdrowie już dziś Jurata Jurkun Specjalista ds. odżywiania i kontroli wagi Centrum Zdrowego Odżywiania i Kontroli Wagi w Suwałkach Zmiany cywilizacyjne Zmiany cywilizacyjne Transport Zbiory

Bardziej szczegółowo

SPIS TREŚCI. 1. Znaczenie nauki o żywieniu. 2. Gospodarka energetyczna organizmu człowieka. 3. Podstawowe składniki pokarmowe i ich rola

SPIS TREŚCI. 1. Znaczenie nauki o żywieniu. 2. Gospodarka energetyczna organizmu człowieka. 3. Podstawowe składniki pokarmowe i ich rola 3 SPIS TREŚCI 1. Znaczenie nauki o żywieniu 1.1. Cele i zadania nauki o żywieniu................................................8 1.2. Rozwój nauki o żywieniu człowieka.............................................9

Bardziej szczegółowo

Rola poszczególnych składników pokarmowych

Rola poszczególnych składników pokarmowych Zdrowy styl życia Rola poszczególnych składników pokarmowych 1. Białka Pełnią w organizmie funkcję budulcową. Są składnikiem wszystkich tkanek oraz kości. 2. Tłuszcze Pełnią w organizmie funkcję energetyczną.

Bardziej szczegółowo

Europejski kodeks walki z rakiem

Europejski kodeks walki z rakiem Europejski kodeks walki z rakiem Dlaczego walczymy z rakiem? Nowotwory są drugą przyczyną zgonów w Polsce zaraz po zawałach i wylewach. Liczba zachorowao na nowotwory złośliwe w Polsce to ponad 140,5 tys.

Bardziej szczegółowo

Rozkład materiału z biologii do klasy III.

Rozkład materiału z biologii do klasy III. Rozkład materiału z biologii do klasy III. L.p. Temat lekcji Treści programowe Uwagi 1. Nauka o funkcjonowaniu przyrody. 2. Genetyka nauka o dziedziczności i zmienności. -poziomy różnorodności biologicznej:

Bardziej szczegółowo

Inżynieria Środowiska II stopnia (I stopień / II stopień) ogólnoakademicki (ogólno akademicki / praktyczny) dr hab. Lidia Dąbek, prof. PŚk.

Inżynieria Środowiska II stopnia (I stopień / II stopień) ogólnoakademicki (ogólno akademicki / praktyczny) dr hab. Lidia Dąbek, prof. PŚk. Załącznik nr 7 do Zarządzenia Rektora nr 10/12 z dnia 21 lutego 2012r. KARTA MODUŁU / KARTA PRZEDMIOTU Kod modułu Nazwa modułu Nazwa modułu w języku angielskim Obowiązuje od roku akademickiego 2012/2013

Bardziej szczegółowo

Płodowy zespół ponikotynowy PSSE Ostrołęka 21.05.2010 r. W Polsce na bierne wdychanie dymu papierosowego naraŝonych jest około 60% dzieci. 2 Fakty dotyczące biernego palenia bierne wdychanie dymu tytoniowego

Bardziej szczegółowo

Materiał i metody. Wyniki

Materiał i metody. Wyniki Abstract in Polish Wprowadzenie Selen jest pierwiastkiem śladowym niezbędnym do prawidłowego funkcjonowania organizmu. Selen jest wbudowywany do białek w postaci selenocysteiny tworząc selenobiałka (selenoproteiny).

Bardziej szczegółowo

Ekstrakt z Chińskich Daktyli TIENS. Doskonałe odżywienie krwi i ukojenie nerwów

Ekstrakt z Chińskich Daktyli TIENS. Doskonałe odżywienie krwi i ukojenie nerwów Ekstrakt z Chińskich Daktyli TIENS Doskonałe odżywienie krwi i ukojenie nerwów Lekarze z Chin uważają, że owoce głożyny znane jako chińskie daktyle pomagają zachować sprawność, poprawiają odporność, wspomagają

Bardziej szczegółowo

Efekty kształcenia dla kierunku studiów Dietetyka studia pierwszego stopnia profil praktyczny

Efekty kształcenia dla kierunku studiów Dietetyka studia pierwszego stopnia profil praktyczny Symbol kierunkowych efektów kształcenia l K_W01 K_W02 K_W03 K_W04 K_W05 K_W06 K_W07 K_W08 Efekty kształcenia dla kierunku studiów Dietetyka studia pierwszego stopnia profil praktyczny WIEDZA Zna budowę,

Bardziej szczegółowo

PRZEDMIOTY PODSTAWOWE

PRZEDMIOTY PODSTAWOWE PRZEDMIOTY PODSTAWOWE Anatomia człowieka 1. Które z białek występujących w organizmie człowieka odpowiedzialne są za kurczliwość mięśni? 2. Co to są neurony i w jaki sposób stykają się między sobą i efektorami?

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

17 LISTOPADA 2005 ROKU ŚWIATOWY DZIEŃ RZUĆ PALENIE RAZEM Z NAMI

17 LISTOPADA 2005 ROKU ŚWIATOWY DZIEŃ RZUĆ PALENIE RAZEM Z NAMI 17 LISTOPADA 2005 ROKU ŚWIATOWY DZIEŃ RZUĆ PALENIE RAZEM Z NAMI Pomysłodawca akcji: nauczycielka biologii mgr Jolanta Kujawska-Tomasik Organizatorzy akcji: nauczycielka biologii mgr Jolanta Kujawska-Tomasik

Bardziej szczegółowo

Europejski Kodeks Walki z Rakiem

Europejski Kodeks Walki z Rakiem Europejski Kodeks Walki z Rakiem Europejski kodeks walki z rakiem powstał z inicjatywy Unii Europejskiej, która już w latach 80 uznała zmagania z rakiem w społeczeństwie Europejczyków za jeden z najważniejszych

Bardziej szczegółowo

ĆWICZENIE NR 3 BADANIE MIKROBIOLOGICZNEGO UTLENIENIA AMONIAKU DO AZOTYNÓW ZA POMOCĄ BAKTERII NITROSOMONAS sp.

ĆWICZENIE NR 3 BADANIE MIKROBIOLOGICZNEGO UTLENIENIA AMONIAKU DO AZOTYNÓW ZA POMOCĄ BAKTERII NITROSOMONAS sp. ĆWICZENIE NR 3 BADANIE MIKROBIOLOGICZNEGO UTLENIENIA AMONIAKU DO AZOTYNÓW ZA POMOCĄ BAKTERII NITROSOMONAS sp. Uwaga: Ze względu na laboratoryjny charakter zajęć oraz kontakt z materiałem biologicznym,

Bardziej szczegółowo

System integrowanej produkcji roślinnej (IP) a integrowana ochrona roślin

System integrowanej produkcji roślinnej (IP) a integrowana ochrona roślin System integrowanej produkcji roślinnej (IP) a integrowana ochrona roślin Grzegorz Gorzała Główny Inspektorat Ochrony Roślin i Nasiennictwa Al. Jana Pawła II 11, 00-828 Warszawa Podstawa prawna USTAWA

Bardziej szczegółowo

I edycja Konkursu Chemicznego im. Ignacego Łukasiewicza dla uczniów szkół gimnazjalnych. rok szkolny 2014/2015 ZADANIA.

I edycja Konkursu Chemicznego im. Ignacego Łukasiewicza dla uczniów szkół gimnazjalnych. rok szkolny 2014/2015 ZADANIA. I edycja Konkursu Chemicznego im. Ignacego Łukasiewicza dla uczniów szkół gimnazjalnych rok szkolny 2014/2015 ZADANIA ETAP I (szkolny) Zadanie 1 Wapień znajduje szerokie zastosowanie jako surowiec budowlany.

Bardziej szczegółowo

Ruch zwiększa recykling komórkowy Natura i wychowanie

Ruch zwiększa recykling komórkowy Natura i wychowanie Wiadomości naukowe o chorobie Huntingtona. Prostym językiem. Napisane przez naukowców. Dla globalnej społeczności HD. Ruch zwiększa recykling komórkowy Ćwiczenia potęgują recykling komórkowy u myszy. Czy

Bardziej szczegółowo

Projekty realizowane w ramach Programu Operacyjnego Rozwój j Polski Wschodniej

Projekty realizowane w ramach Programu Operacyjnego Rozwój j Polski Wschodniej Projekty realizowane w ramach Programu Operacyjnego Rozwój j Polski Wschodniej dr inż. Cezary Możeński prof. nadzw. Projekty PO RPW Wyposażenie Laboratorium Wysokich Ciśnień w nowoczesną infrastrukturę

Bardziej szczegółowo

Soki 100% naturalne MALINA ARONIA

Soki 100% naturalne MALINA ARONIA Soki 100% naturalne MALINA Sok z malin 100 % jest doskonałym uzupełnieniem codziennej diety. Zawiera bogactwo witamin: C, E, B1, B2, B6, PP oraz minerały: magnez, potas, wapń i żelazo. W jego składzie

Bardziej szczegółowo

ph roztworu (prawie) się nie zmieniło. Zawiesina soi ma ph obojętne (lekko kwaśne). Zapach nie zmienił się.

ph roztworu (prawie) się nie zmieniło. Zawiesina soi ma ph obojętne (lekko kwaśne). Zapach nie zmienił się. Ureaza - dodatek krajowy 1. Odniesienie do podstawy programowej (starej) Kształcenie w zakresie podstawowym Odżywianie się człowieka - budowa i funkcja układu pokarmowego, główne składniki pokarmowe i

Bardziej szczegółowo

Zachowania zdrowotne kobiet w ciąży w 2009 i 2012 roku Przedstawione poniżej wyniki badań opracowano na podstawie: Zachowania zdrowotne kobiet w ciąży. Ekspertyza oparta na wynikach ogólnopolskich badań

Bardziej szczegółowo

Zachowania zdrowotne kobiet w ciąży w 2009 i 2012 roku

Zachowania zdrowotne kobiet w ciąży w 2009 i 2012 roku Zachowania zdrowotne kobiet w ciąży w 2009 i 2012 roku Przedstawione poniżej wyniki badań opracowano na podstawie: Zachowania zdrowotne kobiet w ciąży. Ekspertyza oparta na wynikach ogólnopolskich badań

Bardziej szczegółowo

EKOLOGICZNE I PROZDROWOTNE METODY PRZETWARZANIA OWOCÓW I WARZYW Z PRODUKCJI EKOLOGICZNEJ

EKOLOGICZNE I PROZDROWOTNE METODY PRZETWARZANIA OWOCÓW I WARZYW Z PRODUKCJI EKOLOGICZNEJ EKOLOGICZNE I PROZDROWOTNE METODY PRZETWARZANIA OWOCÓW I WARZYW Z PRODUKCJI EKOLOGICZNEJ Wprowadzenie Liczne badania przeprowadzone w Europie i w Polsce wskazują, że warzywa z produkcji ekologicznej są

Bardziej szczegółowo

PRAWIDŁOWE ODŻYWIANIE NASTOLATKÓW

PRAWIDŁOWE ODŻYWIANIE NASTOLATKÓW PRAWIDŁOWE ODŻYWIANIE NASTOLATKÓW Młody organizm, aby mógł prawidłowo się rozwijać potrzebuje wielu różnorodnych składników odżywczych, które powinny być nieodłączną częścią diety każdego dojrzewającego

Bardziej szczegółowo

Drobnoustroje w ochronie środowiska SYLABUS A. Informacje ogólne

Drobnoustroje w ochronie środowiska SYLABUS A. Informacje ogólne Drobnoustroje w ochronie środowiska A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod Rodzaj Rok studiów

Bardziej szczegółowo

Styl życia a nowotwory złośliwe w świetle Europejskiego Kodeksu Walki z Rakiem. Jadwiga Zapała

Styl życia a nowotwory złośliwe w świetle Europejskiego Kodeksu Walki z Rakiem. Jadwiga Zapała Styl życia a nowotwory złośliwe w świetle Europejskiego Kodeksu Walki z Rakiem Jadwiga Zapała CHOROBY CYWILIZACYJNE Nowotwory Choroby układu krążenia Choroby metaboliczne Schorzenia układu nerwowego EUROPEJSKI

Bardziej szczegółowo

BIOTECHNOLOGIA W KOSMETOLOGII SŁAWOMIR WIERZBA

BIOTECHNOLOGIA W KOSMETOLOGII SŁAWOMIR WIERZBA BIOTECHNOLOGIA W KOSMETOLOGII SŁAWOMIR WIERZBA TREŚĆ WYKŁADÓW Budowa i biologia skóry. Typy skóry. Funkcje skóry. Układ odpornościowy skóry. Starzenie się skóry. Przenikanie przez skórę. Absorpcja skórna.

Bardziej szczegółowo

10. Scenariusz lekcji dla gimnazjów i szkół ponadgimnazjalnych

10. Scenariusz lekcji dla gimnazjów i szkół ponadgimnazjalnych 10. Scenariusz lekcji dla gimnazjów i szkół ponadgimnazjalnych Temat: Potrawy typu fast food a żywność przygotowywana w domu. Cele: uświadomienie różnic pomiędzy daniami typu fast food a żywnością przygotowywaną

Bardziej szczegółowo

KARTA KURSU. Kod Punktacja ECTS* 2. Dr Małgorzata Kłyś

KARTA KURSU. Kod Punktacja ECTS* 2. Dr Małgorzata Kłyś KARTA KURSU Nazwa Nazwa w j. ang. Ochrona Środowiska I Protection of Environment Kod Punktacja ECTS* 2 Koordynator Dr Małgorzata Kłyś Zespół dydaktyczny dr Anna Chrzan, dr Małgorzata Kłyś Opis kursu (cele

Bardziej szczegółowo

ANKIETA. Pytania/pola zaznaczone (*) są obowiązkowe. Prosimy wpisać N/A w przypadku gdy pole nie dotyczy twojego przedsiębiorstwa.

ANKIETA. Pytania/pola zaznaczone (*) są obowiązkowe. Prosimy wpisać N/A w przypadku gdy pole nie dotyczy twojego przedsiębiorstwa. ANKIETA Informacje podane w niniejszej ankiecie mają charakter poufny i zostaną wykorzystane wyłącznie na potrzeby realizacji projektu TRAFOON. Analiza zawartych treści będzie pomocna w określeniu najistotniejszych

Bardziej szczegółowo

Pięć minut dla Twojego zdrowia! Copyright profit Sp. z o.o.

Pięć minut dla Twojego zdrowia! Copyright profit Sp. z o.o. Pięć minut dla Twojego zdrowia! Piramida zdrowia i witalności Trzy filary zdrowia to Aktywność fizyczna Racjonalne odżywianie Zarządzanie stresem (relaks) Szlachetne zdrowie Nikt się nie dowie Jako smakujesz,

Bardziej szczegółowo

ZDROWO AKTYWNI SZKOŁA PODSTAWOWA NR 8 W TARNOWIE

ZDROWO AKTYWNI SZKOŁA PODSTAWOWA NR 8 W TARNOWIE ZDROWO AKTYWNI SZKOŁA PODSTAWOWA NR 8 W TARNOWIE PIRAMIDY EGIPSKIE Piramidy to budowle, które przetrwały tysiące lat. Najbardziej trwała była ich podstawa, czyli część zbudowana na ziemi. PIRAMIDA ZDROWEGO

Bardziej szczegółowo

BIOTECHNOLOGIA, podstawy mikrobiologiczne i biochemiczne Aleksander Chmiel, PWN 1998

BIOTECHNOLOGIA, podstawy mikrobiologiczne i biochemiczne Aleksander Chmiel, PWN 1998 Wykłady - tematy Biotechnologia farmaceutyczna definicja i znaczenie. Typy procesów biotechnologicznych, biokatalizatory. Fermentacja tlenowa - przykład najczęściej stosowanego procesu biotechnologicznego.

Bardziej szczegółowo

Wpływ zanieczyszczenia powietrza benzenem na występowanie niektórych nowotworów złośliwych w powiecie kędzierzyńsko-kozielskim

Wpływ zanieczyszczenia powietrza benzenem na występowanie niektórych nowotworów złośliwych w powiecie kędzierzyńsko-kozielskim Wpływ zanieczyszczenia powietrza benzenem na występowanie niektórych nowotworów złośliwych w powiecie kędzierzyńsko-kozielskim Kędzierzyn-Koźle, 20 września 2012 Wojciech Redelbach C6H6 + KK = CA? Benzen

Bardziej szczegółowo

Nauczycielski plan dydaktyczny z chemii klasa: 1 LO, I ZS, 2 TA, 2 TŻ1, 2 TŻ2, 2 TŻR, 2 TI,2 TE1, 2 TE2, zakres podstawowy

Nauczycielski plan dydaktyczny z chemii klasa: 1 LO, I ZS, 2 TA, 2 TŻ1, 2 TŻ2, 2 TŻR, 2 TI,2 TE1, 2 TE2, zakres podstawowy Nauczycielski plan dydaktyczny z chemii klasa: 1 LO, I ZS, 2 TA, 2 TŻ1, 2 TŻ2, 2 TŻR, 2 TI,2 TE1, 2 TE2, zakres podstawowy Temat lekcji Treści nauczania 1. Zapoznanie z przedmiotowym systemem oceniania

Bardziej szczegółowo

Wioletta Buczak-Zeuschner. Wojewódzka Stacja Sanitarno-Epidemiologiczna w Lublinie

Wioletta Buczak-Zeuschner. Wojewódzka Stacja Sanitarno-Epidemiologiczna w Lublinie Choroby zawodowe powstałe w następstwie działania czynników występujących w środowisku pracy uznanych za rakotwórcze u ludzi w aspekcie zmian wykazów substancji, mieszanin, czynników i procesów technologicznych

Bardziej szczegółowo

NIKOTYNA LEGALNY NARKOTYK. Slajd nr 1

NIKOTYNA LEGALNY NARKOTYK. Slajd nr 1 NIKOTYNA LEGALNY NARKOTYK Slajd nr 1 PODSTAWOWE INFORMACJE NA TEMAT NIKOTYNIZMU NIKOTYNIZM (fr. nicotinisme) med. społ. nałóg palenia lub żucia tytoniu albo zażywania tabaki, powodujący przewlekłe (rzadziej

Bardziej szczegółowo

OCENA STANU WIEDZY UCZNIÓW SZKÓŁ POLICEALNYCH NA TEMAT DODATKÓW DO ŻYWNOŚCI

OCENA STANU WIEDZY UCZNIÓW SZKÓŁ POLICEALNYCH NA TEMAT DODATKÓW DO ŻYWNOŚCI BROMAT. CHEM. TOKSYKOL. XLV, 2012, 3, str. 1055 1059 Aneta Kościołek 1, Magdalena Hartman 2, Katarzyna Spiołek 1, Justyna Kania 1, Katarzyna Pawłowska-Góral 1 OCENA STANU WIEDZY UCZNIÓW SZKÓŁ POLICEALNYCH

Bardziej szczegółowo

Kierunek: ochrona środowiska

Kierunek: ochrona środowiska rok studiów: I studia stacjonarne pierwszego stopnia rok akademicki 2014/2015 w ćw kon lab EC zal egz w ćw kon lab EC zal egz 1 Bezpieczeństwo pracy i ergonomia 2 Ochrona własności intelektualnej 3 Przedsiębiorczość

Bardziej szczegółowo

1492 Krzysztof Kolumb w czasie swej podróży do Indian został poczęstowany wysuszonymi liśćmi tytoniowymi

1492 Krzysztof Kolumb w czasie swej podróży do Indian został poczęstowany wysuszonymi liśćmi tytoniowymi Palenie tytoniu jest jednym z czynników zagrażających zdrowiu, a nawet życiu. Obecnie znanych jest około 5000 składników, które występują w dymie tytoniowym. Najbardziej szkodliwe to: nikotyna, tlenek

Bardziej szczegółowo

SWOICH ŻYWICIELI. = wirusy = priony = bakterie pasoŝytnicze = grzyby. = robaki = kleszcze = owady

SWOICH ŻYWICIELI. = wirusy = priony = bakterie pasoŝytnicze = grzyby. = robaki = kleszcze = owady Wszystkie prawa zastrzeżone CALIVITA INTERNATIONAL INTERNATIONAL--POLSKA 2006 ParaProteX OSOBISTY OCHRONIARZ www.calivita.com.pl PASOŻYTY ORGANIZMY ŻYJĄCE KOSZTEM SWOICH ŻYWICIELI Mikroparazyty = wirusy

Bardziej szczegółowo

z rolnictwem konwencjonalnym, intensywnym

z rolnictwem konwencjonalnym, intensywnym ROLNICTWO EKOLOGICZNE Analiza porównawcza ekologicznych metod produkcji z rolnictwem konwencjonalnym, intensywnym Rolnictwo intensywne Rolnictwo ekologiczne Dominacja chemii i techniki Dominacja środków

Bardziej szczegółowo

MIĘSO, WĘDLINY, RYBY, JAJKA I NASIONA ROŚLIN STRĄCZKOWYCH W DIECIE DZIECKA

MIĘSO, WĘDLINY, RYBY, JAJKA I NASIONA ROŚLIN STRĄCZKOWYCH W DIECIE DZIECKA MIĘSO, WĘDLINY, RYBY, JAJKA I NASIONA ROŚLIN STRĄCZKOWYCH W DIECIE DZIECKA Wartość odżywcza Żywność z tej grupy należy do grupy produktów białkowych. Białko mięsa, ryb i jaj charakteryzuje sie dużą wartością

Bardziej szczegółowo

Szkodliwość E-Papierosów

Szkodliwość E-Papierosów Szkodliwość E-Papierosów Kilka słów wstępu... E-papieros jest produktem stosunkowo nowym. Jego produkcja podlega ciągłym zmianom technologicznym, a zakres jego stosowania i wpływ na zdrowie są cały czas

Bardziej szczegółowo

Nie pal, nie truj się...

Nie pal, nie truj się... Nie pal, nie truj się... Palenie papierosów Tytoń to produkt z liści rośliny tej samej nazwy. Zawiera dużo niebezpiecznych związków, takich jak nikotyna oraz substancje smoliste, które zakłócają prawidłowe

Bardziej szczegółowo

POLACY WOBEC GMO RAPORT Z BADANIA. Plan badania i kwestionariusz - Julia Nowicka, raport - Artur Kalinowski, realizacja badania - TNS Pentor

POLACY WOBEC GMO RAPORT Z BADANIA. Plan badania i kwestionariusz - Julia Nowicka, raport - Artur Kalinowski, realizacja badania - TNS Pentor POLACY WOBEC GMO RAPORT Z BADANIA styczeń 2012 Plan badania i kwestionariusz - Julia Nowicka, raport - Artur Kalinowski, realizacja badania - TNS Pentor Spis treści 2 Nr slajdu Informacje o badaniu 3 Główne

Bardziej szczegółowo

Interwencje żywieniowe u dzieci otyłych aktualne spojrzenie

Interwencje żywieniowe u dzieci otyłych aktualne spojrzenie Interwencje żywieniowe u dzieci otyłych aktualne spojrzenie H. Dyląg, 1 H. Weker 1, M. Barańska 2 1 Zakład Żywienia 2 Zakład Wczesnej Interwencji Psychologicznej karmienie na żądanie 7-5 posiłków 3 posiłki

Bardziej szczegółowo

WNIOSKI WYNIKAJĄCE Z KONFERENCJI NAUKOWEJ. Pasze GMO a produkcyjność i zdrowotność zwierząt. Instytut Zootechniki PIB, Balice 26 czerwca 2012 r.

WNIOSKI WYNIKAJĄCE Z KONFERENCJI NAUKOWEJ. Pasze GMO a produkcyjność i zdrowotność zwierząt. Instytut Zootechniki PIB, Balice 26 czerwca 2012 r. WNIOSKI WYNIKAJĄCE Z KONFERENCJI NAUKOWEJ Pasze GMO a produkcyjność i zdrowotność zwierząt Instytut Zootechniki PIB, Balice 26 czerwca 2012 r. I. Wobec braku na rynku krajowych pasz wysokobiałkowych, w

Bardziej szczegółowo

Targi POL-EKO-SYSTEM. Strefa RIPOK NANOODPADY JAKO NOWY RODZAJ ODPADÓW ZAGRAŻAJĄCYCH ŚRODOWISKU

Targi POL-EKO-SYSTEM. Strefa RIPOK NANOODPADY JAKO NOWY RODZAJ ODPADÓW ZAGRAŻAJĄCYCH ŚRODOWISKU NANOODPADY JAKO NOWY RODZAJ ODPADÓW ZAGRAŻAJĄCYCH ŚRODOWISKU Beata B. Kłopotek Departament Gospodarki Odpadami Poznań, dnia 28 października 2015 r. Zakres prezentacji 1. Nanomateriały definicja, zastosowania,

Bardziej szczegółowo

KIERUNKOWE EFEKTY KSZTAŁCENIA

KIERUNKOWE EFEKTY KSZTAŁCENIA KIERUNKOWE EFEKTY KSZTAŁCENIA Wydział: INŻYNIERIA ŚRODOWISKA Kierunek: OCHRONA ŚRODOWISKA (OS) Stopień studiów: I Efekty kształcenia na I stopniu dla kierunku OS K1OS_W01 K1OS_W02 K1OS_W03 OPIS KIERUNKOWYCH

Bardziej szczegółowo

Badanie stanu fizycznego zanieczyszczenia wód w gminie Raba Wyżna.

Badanie stanu fizycznego zanieczyszczenia wód w gminie Raba Wyżna. Badanie stanu fizycznego zanieczyszczenia wód w gminie Raba Wyżna. Zanieczyszczenie wód - niekorzystne zmiany właściwości fizycznych, chemicznych i bakteriologicznych wody spowodowane wprowadzaniem w nadmiarze

Bardziej szczegółowo

Biotechnologia i inżynieria genetyczna

Biotechnologia i inżynieria genetyczna Wersja A Test podsumowujący rozdział II i inżynieria genetyczna..................................... Imię i nazwisko.............................. Data Klasa oniższy test składa się z 16 zadań. rzy każdym

Bardziej szczegółowo

Badanie GATS w Polsce Rezultaty i wnioski dla polityki zdrowotnej

Badanie GATS w Polsce Rezultaty i wnioski dla polityki zdrowotnej Badanie GATS w Polsce Rezultaty i wnioski dla polityki zdrowotnej XIV Konferencja Naukowa im. F. Venuleta Tytoń albo Zdrowie TWP Wszechnica Polska Warszawa, 09.12.2011 Ostatnia aktualizacja: 09.08.2011

Bardziej szczegółowo

Substancje o Znaczeniu Biologicznym

Substancje o Znaczeniu Biologicznym Substancje o Znaczeniu Biologicznym Tłuszcze Jadalne są to tłuszcze, które może spożywać człowiek. Stanowią ważny, wysokoenergetyczny składnik diety. Z chemicznego punktu widzenia głównym składnikiem tłuszczów

Bardziej szczegółowo

RZUĆ PALENIE RAZEM Z NAMI! Wdychasz, wydychasz, nic nie masz a zdychasz!

RZUĆ PALENIE RAZEM Z NAMI! Wdychasz, wydychasz, nic nie masz a zdychasz! RZUĆ PALENIE RAZEM Z NAMI! Wdychasz, wydychasz, nic nie masz a zdychasz! Dlaczego palenie papierosów jest szkodliwe? Koncerny tytoniowe dodają do tytoniu wiele substancji konserwujących, aromatów o nie

Bardziej szczegółowo

Palenie tytoniu a zdrowie dziecka. mgr Justyna Szczęsna Sekcja Promocji Zdrowia i Oświaty Zdrowotnej PSSE w Krapkowicach Krapkowice 25.10.

Palenie tytoniu a zdrowie dziecka. mgr Justyna Szczęsna Sekcja Promocji Zdrowia i Oświaty Zdrowotnej PSSE w Krapkowicach Krapkowice 25.10. Palenie tytoniu a zdrowie dziecka mgr Justyna Szczęsna Sekcja Promocji Zdrowia i Oświaty Zdrowotnej PSSE w Krapkowicach Krapkowice 25.10.2011 roku Bierne palenie Bierne palenie to wdychanie dymu tytoniowego

Bardziej szczegółowo

SZYBKOŚĆ REAKCJI CHEMICZNYCH. RÓWNOWAGA CHEMICZNA

SZYBKOŚĆ REAKCJI CHEMICZNYCH. RÓWNOWAGA CHEMICZNA SZYBKOŚĆ REAKCJI CHEMICZNYCH. RÓWNOWAGA CHEMICZNA Zadania dla studentów ze skryptu,,obliczenia z chemii ogólnej Wydawnictwa Uniwersytetu Gdańskiego 1. Reakcja między substancjami A i B zachodzi według

Bardziej szczegółowo

Piramida przedstawia zasady prawidłowego odżywiania. Informuje o tym, ile porcji różnych grup produktów powinno znaleźć się w posiłkach, które

Piramida przedstawia zasady prawidłowego odżywiania. Informuje o tym, ile porcji różnych grup produktów powinno znaleźć się w posiłkach, które DROGI RODZICU Piramida przedstawia zasady prawidłowego odżywiania. Informuje o tym, ile porcji różnych grup produktów powinno znaleźć się w posiłkach, które zjadamy w ciągu dnia. Przy czym obowiązuje zasada,

Bardziej szczegółowo