A multiplex PCR assay for identification of the ogura male sterile cytoplasm and the Rfo restorer gene among oilseed rape breeding forms

Transkrypt

1 TOM XXXI ROŚLINY OLEISTE OILSEED CROPS 2010 Katarzyna Mikołajczyk, Agnieszka Dobrzycka, Jan Podkowiński*, Wiesława Popławska, Stanisław Spasibionek, Iwona Bartkowiak-Broda Plant Breeding and Acclimatization Institute, National Research Institute, Poznań, Poland * Institute of Bioorganic Chemistry Polish Academy of Sciences, Poznań, Poland A multiplex PCR assay for identification of the ogura male sterile cytoplasm and the Rfo restorer gene among oilseed rape breeding forms Zastosowanie analizy multiplex PCR do identyfikacji męsko-sterylnej cytoplazmy typu ogura oraz genu restorera Rfo w materiałach hodowlanych rzepaku Key words: winter oilseed rape (Brassica napus L.), hybrid breeding, ogura CMS, Rfo restorer gene, multiplex PCR Due to the fact that cross-pollination controlling male sterility systems have been developed for oilseed rape, breeders interest in hybrid varieties of this oil crop permanently increases. In Poland, a total of 111 oilseed rape cultivars are currently registered in the National Register of the Research Centre for Cultivar Testing, including 87 winter varieties 35 of which are hybrid ones. The F 1 restored hybrids and the restorer lines are phenotypically identical with the canola-type (double-low, 00) varieties, hence in order to monitor the presence of the ogura male-sterile cytoplasm (ogura CMS) and the Rfo restorer gene, two genetic markers were applied independently one of them specific for the ogura CMS (a SCAR marker of about 500 base pairs) and another one for the Rfo restorer gene (the C02 SCAR of about bp). In order to upgrade the effectiveness of the performed analyses and to reduce the costs, the multiplex PCR method was adapted based on a simultaneous analysis of both SCAR markers in one PCR amplification. In addition, an internal control comprising PCR amplification of a conservative region of an actin cdna (a structural protein present in all eukaryotic cells), a 600 bp SCAR marker, was included. As a result, false negatives due to the matrix DNA degradation, bad quality of reagents and solutions or possible manual mistakes were eliminated. Two hundred and eight of DNA samples obtained from oilseed rape F 1 hybrids, restorer lines and recombinant breeding forms were genotyped with the use of the multiplex PCR method. Simultaneous analysis by PCR with a single primer set for the two SCAR markers was performed thus confirming the reliability of the multiplex PCR method. It will be further applied for routine analysis in hybrid and recombinant breeding. Słowa kluczowe: rzepak ozimy (Brassica napus L.), hodowla mieszańcowa, CMS ogura, gen restorer Rfo, multiplex PCR Ze względu na opracowanie dla rzepaku systemów męskiej sterylności pozwalających na kontrolę zapylenia krzyżowego wzrasta zainteresowanie hodowców odmianami mieszańcowymi tej rośliny. W Krajowym Rejestrze COBORU wpisanych jest 111 odmian rzepaku, w tym 87 odmian ozimych, z których 35 stanowią odmiany mieszańcowe. Mieszańce zrestorowane F 1 oraz linie restorerów nie

2 202 Katarzyna Mikołajczyk... różnią się fenotypowo od odmian podwójnie ulepszonych, dlatego w celu monitorowania obecności męsko-sterylnej cytoplazmy (CMS) typu ogura oraz genu restorera Rfo stosowano niezależnie dwa markery genetyczne, specyficzne dla CMS ogura (marker SCAR, około 500 par zasad) i genu Rfo (marker SCAR, pz). W celu zwiększenia efektywności i obniżenia kosztów prowadzonych analiz zaadaptowano podejście w oparciu o metodę multiplex PCR, polegającą na jednoczesnej analizie obu markerów SCAR zamplifikowanych w jednej PCR. Dodatkowo, włączono kontrolę wewnętrzną polegającą na amplifikacji metodą PCR zachowawczego fragmentu cdna aktyny (marker SCAR, 600 pz), stanowiącej białko powszechnie występujące w strukturach komórkowych. Dzięki temu wyeliminowano fałszywe wyniki negatywne, spowodowane degradacją analizowanego DNA, złą jakością odczynników lub błędem podczas wykonywania reakcji. Przy użyciu metody multiplex PCR przeanalizowano 208 prób DNA uzyskanych z mieszańców F 1, linii restorerów oraz form hodowlanych rekombinantów. Równolegle prowadzono badania z zastosowaniem dwóch markerów w niezależnych reakcjach, co potwierdziło skuteczność metody. Znajdzie ona szerokie zastosowanie do rutynowych analiz w hodowli mieszańcowej i rekombinacyjnej. Introduction Male sterility is of special interest as a mechanism allowing hybrid production and also control of cross-pollination, especially in such important crop as rapeseed (Engelke et al. 2010). In major growing areas, an increasing proportion of the registered varieties represent single-cross hybrids (Wittkop et al. 2009). A total of 111 oilseed rape cultivars are currently registered in Poland including 87 winter varieties 35 of which are hybrid ones (National Register of the Research Centre for Cultivar Testing, COBORU, The current F 1 hybrids in oilseed rape are based mainly on the ogura cytoplasmic male sterility (CMS) system comprising the Rfo restorer gene, introduced from radish into rapeseed. The ogura CMS system totally prevents self-pollination (Schnable and Wise 1998). The F 1 restored hybrids as well as the restorer lines are phenotypically identical with the 00 breeding forms and in order to monitor them, genetic markers were applied. The ogura CMS cytoplasm was identified by a SCAR marker specific for the orf 138, a mitochondrial open reading frame of about 500 base pairs (bp) encoding a protein inhibitor of pollen development (Sigareva and Earle 1997, Mikołajczyk et al. 1998). The presence of the Rfo restorer gene was determined with the use of the SCAR C02 marker obtained as a result of PCR amplification with the primers specific for the 1150 bp genomic DNA fragment tightly linked to the Rfo restorer gene (Delourme et al. 1994, Mikolajczyk et al. 2008). Multiplex PCR is an efficient and cost-effective variant of conventional PCR including two or more pairs of primers in a single reaction for simultaneous amplification of target DNA sequences (Randhawa et al. 2008). The method is applicable for detecting infectious organisms, whole-genome sequencing, forensic analysis and enabling low-cost genotyping (Rachlin et al. 2005). A large-scale multiplex PCR assay was designed in an automated high-throughput environment,

3 A multiplex PCR assay for identification of the ogura MuPlex, where high coverage of potentially thousands of single nucleotide polymorphisms was required (Rachlin et al. 2005). Given a set of DNA sequences and SNP location at each, the system aimed at designing a set of pair forward and reverse primers for each sequence, as well as a placement of these primers into maximal size tubes such that coverage included in PCR was maximized (Rachlin et al. 2005). A multiplex real-time PCR assay was applied for detection of Xanthomonas campestris from brassicas (Berg et al. 2006). The assay amplified a 78-bp segment of the X. campestris hrpf gene and a 100-bp segment of the Brassica ssp. 18S-25S internal transcribed spacer region. The last one was an internal control for the amplification process to prevent false negatives arisen from inhibitors often present in extracts from plant material. The multiplex real-time PCR assay enabled the rapid detection of pathogenic strains of X. campestris from bacterial colonies, Brassica seed and plants (Berg et al. 2006). The method was applied for quantitative assay to detect two DNA sequences targeting transgenes in Bt cauliflower and an internal control gene for the family Brassicaceae (the S-locus receptor kinase, SRK gene, a female determinant of self-incompatibility Randhawa et al. 2008). A multiplex PCR method was developed to detect, differentiate and confirm the morphological identification of three root infecting Olphidium ssp.: O. bornovanus, O. brassicae, and O. virulentus. Three primer sets were used comprising one common reverse primer for these species and three species-specific forward primers (Herrera-Vásquez et al. 2009). Multiplex PCR assay was applied to distinguish the existing common cytoplasm resources, Pol, Nap, Cam and Ogu in rapeseed. Four primer pairs specific for the appropriate mitochondrial DNA genes were used accompanied by a nuclear male sterility gene-specific primer pair as an internal control for the presence of nuclear DNA (Zhao et al and references therein). Here we present a multiplex PCR assay for simultaneous detection of the ogura CMS cytoplasm and the Rfo restorer gene, including amplification of a conservative region of the B. napus actin gene as an internal control which can be used in hybrid and recombinant breeding Material and Methods Plant material Brassica napus L., var oleifera lines carrying the ogura CMS cytoplasm, as well as the Rfo restorer lines, restored F 1 hybrids and recombinant lines used in this work were bred at the Plant Breeding and Acclimatization Institute NRI in Poznan, Poland, and at the Strzelce Breeding Company Ltd.

4 204 Katarzyna Mikołajczyk... PCR with a single primer set Total genomic DNA was prepared using the CTAB extraction method (Doyle and Doyle 1990). SCAR markers for the ogura cytoplasmic male sterility (CMS) and the Rfo restorer gene were identified as described by Mikołajczyk et al. (1998 and 2008, respectively). The nucleotide sequences of primers, as well as the primer concentrations, annealing temperatures and the product sizes were as in Table 1. B. napus actin gene fragment comprising a conservative 600 bp region of the 4th exon was amplified with the use of a pair of specific primers, BnapAct4_for and BnapAct4_rev (Tab. 1). PCR amplification was performed in 25 µl reaction mixture containing 10 mm Tris-HCl ph 8.8, 50 mm KCl, 0.08% Nonidet P40, 2 mm MgCl 2, 0,15 mm dntp, 1.0 µm each primer, 0.5 U Taq polymerase (Fermentas, Vilnius, Lithuania) and ng DNA template. Amplification conditions were: 2 min. 30 s at 95 C, followed by 35 cycles of 30 s at 95 C, 30 s at 65 C, 1 min. at 72 C and ending with 15 min. at 72 C. Amplification products were analyzed by 1% agarose gel electrophoresis resolved in 1 TBE buffer by 100 V for 1 h. Multiplex PCR analysis The assay was performed by PCR amplification of genomic DNA with the use of the three pairs of specific primers applied previously for detecting the ogura CMS, the Rfo restorer gene and the actin gene (Tab. 1). Reaction mixture of 25 µl contained 10 mm Tris-HCl ph 8.8, 50 mm KCl, 0.08% Nonidet P40, 2 mm MgCl 2, 0,15 mm dntp, 1.5 µm each primer for amplification of both the ogura CMS and for the Rfo, 1.0 µm each primer for actin, 0.5 U Taq polymerase (Fermentas, Vilnius, Lithuania) and ng DNA template. Amplification conditions were as follows: 2 min. 30 s at 95 C, followed by 35 cycles of 30 s at 95 C, 30 s at 65 C, 1 min. 20 s at 72 C and ending with 15 min. at 72 C. Amplification products were analyzed by 1.4% or 1.0% agarose gel electrophoresis resolved in 1 TBE buffer by 100 V for 1.5 h, or 1.0 h. Results and Discussion Internal control In plants, an actin is the monomeric subunit of microfilaments, one of the three major components of the cytoskeleton, present in all cells. Therefore, when all parameters of multiplex PCR amplification are correct the actin gene fragment should always be revealed. The primers for PCR amplification were designed as

5 Table 1 Amplification conditions of PCR with single primer set and of multiplex analysis Warunki amplifikacji metodą PCR przy użyciu pojedynczych par starterów oraz metodą multipleks PCR Primer nucleotide sequence (5 3 ) Sekwencja nukleotydowa Annealing temperature Temperatura przyłączania starterów [ C] Primer concentration Stężenie [µm] PCR product size Wielkość produktu PCR [bp] Reference Piśmiennictwo 1. CMS CMS_p1 CMS_p Sigareva and Earle, 1997 For: GTCAAAGCAATTGGGTTCAC Mikołajczyk et al Rev: GTCGTTATCGACCTCGCAAGG 2. Rfo SCARC02_for SCARC02_rev Mikolajczyk et al For: TGTAACATAAGAAACGCTTGGT Rev: AAGGATCATTAAACGTCTTTAGGC 3. act BnapAct4_for BnapAct4_rev This study For: CTCGACTCTGGTGATGGTGTG Rev: GTTGGAAAGTGCTGAGGGATGC 4. multiplex (1), (2), and (3) 65 (1), 1.5; (2), 1.5; (3), , 1100, and 600, respectively This study CMS a SCAR marker for the ogura cytoplasmic male sterility marker SCAR dla cytoplazmatycznej męskiej sterylności typu ogura Rfo a SCAR marker for the Rfo restorer gene marker SCAR dla genu restorera Rfo act internal control a SCAR marker for B. napus actin7 cdna kontrola wewnętrzna marker SCAR dla cdna aktyny7 B. napus

6 206 Katarzyna Mikołajczyk... a result of nucleotide sequence alignment of the B. napus actin cdna (AF ) and the A. thaliana actin7 gene (NC003076) (Fig. 1). Four primer pairs, each specific for a sequence of the conservative 4 th exon were tested; three of them revealed products of about 500 base pairs (bp) [Fig. 2, lanes: (1), (2), (3)], and one 600 bp (bp) [Fig. 2, lane (4)]. The last one was chosen as the internal control, as the others produced amplicons of the same size as the ogura SCAR marker [Fig. 3, lane (CMS)]. Fig. 1. Schematic diagram of the B. napus actin7 exons, 2 5 (AF111812). Alignment of the nucleotide sequences of the B. napus exons to the A. thaliana actin7 gene (NC003076) revealed their high identity: 94.4% for exons 2, 89.1% for exons 3, and 90.1% for exons 4, respectively. However, exons 5 revealed only 74.1% of identity. The exon (boxes) and intron (lines) segments derived from alignment of the A. thaliana actin7 gene (NC003076) and the A. thaliana actin7 cdna (NM121018). Positions of primers used for PCR amplification in the multiplex assay marked with arrows; (bp), base pair Schemat eksonów, od 2 do 5 aktyny7 B. napus (AF111812), w odniesieniu do genu A. thaliana; strzałkami oznaczono miejsca przyłączenia starterów stosowanych do amplifikacji PCR Fig. 2. PCR amplifications of the conservative 4 th exon of B. napus actin gene revealed specific products of about 500 bp (primer pairs: 1, 2 and 3) and 600 bp (4). The last one (4) was used as an internal control for the assay; (M), λ DNA Eco RI/Hind III size marker Amplifikacja metodą PCR zachowawczego region eksonu 4 genu aktyny B. napus wykazała produkty specyficzne wielkości około 500 par zasad (pary starterów 1, 2 i 3) oraz 600 par zasad (4). Ten ostatni fragment został wykorzystany jako kontrola wewnętrzna metody; (M), marker wielkości DNA faga λ hydrolizowany enzymami Eco RI i Hind III.

7 A multiplex PCR assay for identification of the ogura Fig. 3. PCR amplification with a single primer set: (act), B. napus actin gene fragment (600 bp); (CMS), the ogura CMS SCAR marker (500 bp); (Rfo), C02 SCAR marker for the Rfo restorer gene (1 100 bp); (M) DNA 1kb Gene Ruler size marker Amplifikacja metodą PCR z zastosowaniem poszczególnych par starterów Multiplex PCR assay Two previously developed SCAR markers were combined in one analysis: a functional SCAR marker for the ogura CMS orf138 mitochondrial (Krishnasamy and Makaroff 1993, Schnable and Wiese 1998) obtained with the use of a pair of primers designed by Sigareva and Earle (1997) (Mikolajczyk et al. 1998) and amplifying a nucleotide sequence of about 500 bp [Fig. 3, lane (CMS)], and the SCAR C02 marker (Mikolajczyk et al. 2008) tightly linked to the Rfo restorer gene (Delourme et al. 1994), revealing a nuclear DNA fragment of about bp [Fig. 3, lane (Rfo)]. The SCAR markers were dominant ones, each revealing one product in agarose gel, as a positive result when the specific nucleotide sequence was present in the analyzed genome, or no one as a negative result (the lack of the appropriate nucleotide sequence in the analyzed genome). However, in the last case, the possibility of an error due to reaction mixture contamination, bad quality of DNA, etc., could not be ruled out. Amplification of a constitutive actin gene was used as an internal control, for the multiplex PCR condition verification. The multiplex assay was designed for making the analysis more efficient by simultaneous analysis of the two markers, thus shortening twice the time of amplification and electrophoresis. The two primer pairs were applied in one reaction mixture in addition to a primer pair for the conservative actin gene fragment of about 600 bp. Applications of initial primer concentrations (5 µm of each primer for the ogura CMS, 2.5 µm for the Rfo gene, and 1.0 µm for the actin gene) revealed intensive band of 500 bp for ogura CMS [Fig. 4, lanes (CMS +, Rfo - ) and (CMS +, Rfo + )], less intensive band of 600 bp for the actin, especially in plants with CMS or Rfo [Fig. 4, lanes (CMS -, Rfo + ), (CMS +, Rfo - )], and hardly visible band of bp for Rfo in plants with CMS and Rfo [Fig. 4, lane (CMS +, Rfo + )]. Equimolar amounts of each primer (2.5µM) revealed the more intense amplification product of the actin gene (Fig. 5, all lanes), and less intense bands for the ogura CMS [Fig. 5, lanes (CMS +, Rfo - ) and (CMS +, Rfo + )] and the Rfo gene

8 208 Katarzyna Mikołajczyk... Fig. 4. Multiplex PCR amplification of the B. napus genomic DNA; with the use of initial as with a single primer set concentraction of each primer; (CMS -, Rfo - ), canola-type male fertile population variety without the Rfo restorer gene; (CMS -, Rfo + ), a male fertile restorer line; (CMS +, Rfo - ), a male sterile line with no restorer gene; (CMS +, Rfo + ), F 1 restored hybrid with the ogura male sterile cytoplasm; (M), DNA 1kb Gene Ruler size marker Amplifikacja metodą wielokrotnego PCR genomowego DNA B. napus z zastosowaniem wyjściowych stężeń poszczególnych starterów Fig. 5. Multiplex PCR with the use of equimolar concentrations (2.5 µm) of each of the primer pair; amplified B. napus DNA samples as in Fig. 3; (M) DNA 1kb Gene Ruler size marker Wielokrotny PCR z zastosowaniem ekwimolarnych stężeń poszczególnych par starterów (po 2.5 µm); amplifikowane próby DNA B. napus jak na rys. 3; (M), marker wielkości DNA 1kb Gene Ruler [Fig. 5, lanes (CMS -, Rfo + ) and (CMS +, Rfo + )]. Ultimately, optimal result was obtained with the use of 1.5 µm of each primer for the ogura CMS and the Rfo gene and 1.0 µm of each primer for the actin gene revealing distinctive products in 1.0% agarose gel resolved in 1 TBE buffer by 100 V for 1.5 h (Fig. 6).

9 A multiplex PCR assay for identification of the ogura Fig. 6. Multiplex PCR amplification products with the use of final primer concentration (Tab. 1), resolved in 1.0% agarose gel by 100 V for 1.5 h; amplified B. napus DNA samples as in Fig. 3; (M) DNA 1kb Gene Ruler size marker Produkty amplifikacji metodą wielokrotnego PCR z zastosowaniem finalnych stężeń starterów (Tab. 1) Our multiplex PCR assay was very useful in routine analyses applied for hybrid and recombinant breeding, i.e. for identification the F 1 hybrids and for monitoring the purity of the Rfo restorer lines, as in the Fig. 7. In order to check the method, 208 DNA samples were analyzed simultaneously by the multiplex assay and by application of the single primer sets for both SCAR markers independently showing their full convergence (not shown). The assay is of high practical value and could be further applied in breeding programs for obtaining high-yielding breeding forms of oilseed rape, according to global trends in oilseed rape breeding. Fig. 7. Routine multiplex PCR analysis of the B. napus recombinant lines and F 1 restored hybrids; (act), (CMS) and (Rfo), reference single set primer PCR amplifications, as in Fig. 2; (H 2 O), control multiplex PCR amplification without matrix DNA; descriptions of plant types as in Fig. 3; (M), DNA 1kb Gene Ruler size marker Rutynowa analiza metodą wielokrotnego PCR linii rekombinantów B. napus i mieszańców zrestorowanych F 1

10 210 Katarzyna Mikołajczyk... References Berg T., Tesoriero L., Hailstones D.L A multiplex real-time PCR assay for detection of Xanthomonas campesrtis from brassicas. Letters in Applied Microbiology, 42: Delourme R., Bucherau A., Hubert N., Renard M., Landry B.S Identification of RAPD markers linked to a fertility restorer gene for the ogura radish cytoplasmic male sterility of rapeseed (Brassica napus L.). Theor. Appl. Genet., 88: Doyle J.J., Doyle J.L Isolation of plant DNA from fresh tissue. Focus, 12: Engelke T., Hirsche J., Roitsch T Metabolically engineered male sterility in rapeseed (Brassica napus L.). Theor. Appl. Genet., 122: Herrera-Vásquez J.Á., Cebrián M. del C., Alfaro-Fernández A., Córdoba-Selles M. del C., Jordá C Multiplex PCR assay for the simultaneous detection and differentiation of Olpidium bornovanus, O. brassicae, and O. virulentus. Mycological Research, 113: Krishnasamy S., Makaroff C.A Characterization of the radish mitochondrial ofrb locus: possible relationship with male sterility in Ogura radish. Curr. Genet., 24: Mikolajczyk K., Dabert M., Nowakowska J., Podkowinski J., Poplawska W., Bartkowiak-Broda I Conversion of the RAPD OPC marker of the Rfo restorer gene into a SCAR marker for rapid selection of oilseed rape. Plant Breeding, 127: Mikołajczyk K., Matuszczak M., Piętka T., Bartkowiak-Broda I., Krzymański J Zastosowanie markerów DNA do badań składników mieszańców (The use of DNA markers for hybrid components analysis in Polish). Rośliny Oleiste Oilseed Crops, XIX (2): Rachlin J., Ding C., Cantor C., Kasif S MuPlex: multi-objective multiplex PCR assay design. Nucleic Acids Research, 33 (Web Server Issue): Randhawa G.J., Chhabra R., Singh M Molecular characterization of Bt cauliflower with multiplet PCR and validation of endogenous reference gene in Brassicaceae family. Current Science, 95 (12): Schnable P.S., Wise R The molecular basis of cytoplasmic male sterility and fertility restoration. Trends in Plant Science, 3 (5): Sigareva M.A., Earle E.D. (1997) Direct transfer of a cold-tolerant Ogura male-sterile cytoplasm into cabbage (Brassica oleracea ssp. capitata) via protoplast fusion. Theor. Appl. Genet., 94: Wittkop B., Snowdon R., Friedt W Status and perspectives of breeding for enhanced yield and quality of oilseed crops for Europe. Euphytica, 170: Zhao H.X., Li Z.J., Hu S.W., Sun G.L., Chang J.J., Zhang Z.H Identification of cytoplasm types in rapeseed (Brassica napus L.) accessions by multiplex PCR assay. Theor. Appl. Genet., 121: