ISSN Annals of Warsaw University of Life Sciences SGGW

Transkrypt

1 ISSN Annals of Warsaw University of Life Sciences SGGW Animal Science No 54 (2) 2015

2 Annals of Warsaw University of Life Sciences SGGW Animal Science No 54 (2) Warsaw 2015 Contents GOLENIA P., REKIEL A.,WIĘCEK J. Comparison of the results of rearing the suckling piglets, receiving different iron preparations 119 NIŻNIKOWSKI R., CZUB G., ŚWIĄ- TEK M., ŚLĘZAK M., GŁOWACZ K. Polymorphism of insulin-like growth factor IGF-1 gene in selected Polish sheep breeds 129 PRZYSUCHA T., GOŁĘBIEWSKI M., WNĘK K., SLÓSARZ J., KUNOW- SKA-SLÓSARZ M. Comparison of calving course of Charolaise purebreds and their crossbreeds with Polish Holstein-Friesian cows 133 PRZYSUCHA T., GOŁĘBIEWSKI M., GRODZKI H., WNĘK K., SLÓSARZ J., KUNOWSKA-SLÓSARZ M., TOKAR- SKI P. Analysis of Hereford beef cattle recording results in Poland 139 REKIEL A., WIĘCEK J., KUCZYŃ- SKA B., BARTOSIK J., WARDA A., FURMAN K. Effect of the backfat thickness at point P 2 during insemination on the selected parameters of colostrum and milk of the sows 153

3 WIEWIÓRA M., ŁUKASIEWICZ M., BARTOSIK J., MAKARSKI M., NIE- MIEC T. Diatomaceous earth in the prevention of worm infestation in purebred pigeons 161 WIĘCEK J., REKIEL A., WARDA A., SOŃTA M., JANUS M., KNIŻEW- SKA W. Effect of pre-slaughter body weight of fatteners on their slaughter value 167

4 SERIES EDITORIAL BOARD Editor-in-Chief Animal Science series Secretary Address of Editorial Office EDITORS THEME EDITOR prof. dr hab. Anna Rekiel dr Katarzyna Góral-Radziszewska Wydział Nauk o Zwierzętach SGGW ul. Ciszewskiego 8, Warszawa, Poland dr Wojciech Hyb statistics editor Natalia Filipczak English language consultant Agata Cienkusz Polish language consultant dr hab. Elżbieta Michalska Genetics and animal breeding dr hab. Elżbieta Pezowicz Biology and ecology dr hab. Iwona Kosieradzka Animal nutrition and feedstuffs dr hab. Tadeusz Kaleta Behaviour and welfare of animal dr hab. Justyna Więcek Animal husbandry and production technology SERIES EDITOR Anna Rekiel SERIES EDITORIAL ADVISORY COUNCIL Prof. DSc. Andrzej Chwalibóg (Denmark) Prof. DSc. Konrad Dąbrowski (USA) Prof. DSc. Ondrey Debréceni (Slovakia) Prof. Ewgienij Dobruk (Belarus) Prof. dr hab. Robert J. Eckert (Poland) Prof. Dr. Sophie Ermidou-Pollet (Greece) Prof. dr hab. Grażyna Garbaczewska (Poland) Prof. DSc. Luis L. Gosálvez (Spain) Prof. DSc. Adrian Harrison (Denmark) Prof. dr hab. Jarosław O. Horbańczuk (Poland) Prof. dr hab. Marta Kamionek (Poland) Prof. Dr Drago Kompan (Slovenia) Prof. Dr Sándor Kukovics (Hungary) Prof. Dr Stoycho Metodiev (Bulgarian) Prof. DSc Francois K. Siebrits (RSA) Prof. dr hab. Jacek Skomiał (Poland) Prof. dr hab. Romuald Zabielski (Poland) The Editorial Board (Office) of Annals of Warsaw University of Life Sciences SGGW. Animal Science informs that the printed version of the journal is the original version. Redakcja Annals of Warsaw University of Life Sciences SGGW. Animal Science informuje, że wersja drukowana czasopisma jest wersją pierwotną (referencyjną). Covered in: AGRO, Index Copernicus (7.83), CAB Direct, CEON, ARIANTA, epnp, PBN, POL-INDEX Bazy: AGRO, Index Copernicus (7,83), CAB Direct, CEON Biblioteka Nauki, ARIANTA, e-publikacje Nauki Polskiej, PBN, POL-INDEX WARSAW UNIVERSITY OF LIFE SCIENCES PRESS ISSN EDITORIAL STAFF Anna Dołomisiewicz Laura Szczepańska Edition: 150 prints PRINT: POLIMAX s.c., 161 L Nowoursynowska St., Warsaw

5 List of Reviewers Vol. 54 Krzysztof Andres, Ireneusz Antkowiak, Emilia Bagnicka, Danuta Borkowska, Marian Brzozowski, Dorota Bugnacka, Jakub Cieślak, Witold Chabuz, Bogumiła Choroszy, Zenon Choroszy, Anna Czech, Ewa Czerniawska-Piątkowska, Andrzej Gugołek, Piotr Janiszewski, Ewa Januś, Anna Kasprzyk, Józef Krzyżewski, Marian Kuczaj, Robert Kupczyński, Maria Markiewicz-Kęszycka, Jan Miciński, Krzysztof Młynek, Sławomir Mroczkowski, Wojciech Neja, Zenon Nogalski, Joanna Pokorska, Piotr Sablik, Tomasz Sakowski, Anna Sawa, Grażyna Sender, Ewa Skrzypczak, Nina Strzałkowska, Małgorzata Szewczuk, Bogdan Szostak, Karolina Szulc, Arkadiusz Terman, Jerzy Wójcik, Jacek Wójtowski, Silvester Žgur

6 Annals of Warsaw University of Life Sciences SGGW Animal Science No 54 (2), 2015: (Ann. Warsaw Univ. of Life Sci. SGGW, Anim. Sci. 54 (2), 2015) Comparison of the results of rearing the suckling piglets, receiving different iron preparations PIOTR GOLENIA, ANNA REKIEL, JUSTYNA WIĘCEK Department of Animal Breeding and Production, Warsaw University of Life Sciences SGGW Abstract: Comparison of the results of rearing the suckling piglets, receiving different iron preparations. The aim of the studies was determine the results of rearing the piglets which received three different preparations of iron (Fe) by injection. The sows, the progeny of which was covered with the observations, were at random assigned before parturition, to one from three experimental groups E1, E2 and E3 (five sows in each group). The rate of growth, feed utilization and health state of the piglets from birth until weaning (35th day of life) was controlled. The highest body weight of five-week old piglets was recorded in group E3; the difference in relation to body weight of the piglets from groups E1 and E2 was equal to 3.47 and 13.15%, respectively (P >0.05). The best equalization of body weight of five-week old piglets was found in groups E3 and E1. The piglets from group E3 consumed the greatest quantity of fixed feed until weaning; in the mentioned group, the body weight gain in total was the highest one (8.44 kg/head). The mean daily gains of the piglets from group E3 were equal to 241 g and they were higher as compared to groups E1 and E2 by 5.24 and 12.62%, respectively. Consumption of solid feed per gain of 1 kg of body weight of the litter amounted in groups E1, E2 and E3 to 4.80, 3.49 and 4.65 kg, respectively. The mentioned index was low what indicates a good milk performance of the sows. All three employed preparations fulfilled their prophylactic function and prevented incidence of anaemia symptoms. Key words: piglets, iron (Fe), Fe preparations INTRODUCTION The reared piglets are expected to reveal good health, quick growth rate and good feed conversion. Therefore, in the case of young pigs, which show a high, genetically determined growth potential, administration of iron-containing preparations is indispensable. They affect favourably metabolism and immunological mechanisms as well as growth and development of neonatal animals (Kostro et al. 2004, Madej et al. 2005, Salle and Auvigne 2006, Winnicka et al. 2012). Deficit of Fe is favourable for anaemia, lowering of resistance, incidence of diseases and increased death rate. The piglets which are inappropriately supplied with iron grow more slowly and reveal worse feed conversion what prolongs the period of reaching the optimum body weight from viewpoint of their safe weaning from mother (Svetina et al. 2006, Maes et al. 2011). Supply of iron in a form of preparations, being injected or administrated per os where Fe occurs in organic or inorganic form, with a regulating role of hepcidine, constitutes a protection of the piglets from

7 120 P. Golenia, A. Rekiel, J. Więcek anaemia (Grela et al. 2005, Sokołowska and Klimek 2008). The composition of iron-containing preparations and their quality and form of administration are different what may cause somewhat different although most frequently positive response of organism of the animal which receives them (Wasiński et al. 1995, Madej et al. 2000, 2005, Czech et al. 2003, Krasucki and Orlicki 2008, Winnicka et al. 2012). The aim of the studies was to determine the results of rearing the piglets kept in the uniform conditions and fed the same way but receiving three different Fe preparations by injection. MATERIAL AND METHODS The studies were conducted in a private pig house in III and IV quarter of The observations included piglets from 15 litters coming from multiparous PWL sows (3 6 reproduction cycle) mated with crossbred boar F1 (Duroc Pietrain). The sows were transferred to farrowing pens (three-part pens) 4 5 days before the expected date of farrowing. The animals were kept in accordance with the standards (Rozporządzenie 2010). The sows were assigned at random to three experimental groups E1, E2 and E3; the number of the piglets, born by the females in the mentioned groups, amounted to 67, 56 and 60 animals, respectively. On the third day of life the piglets received iron-containing preparation (intramuscular injection, behind the ear); the dose of the preparation was consistent with the producer s recommendations; the classified piglets received different preparations (Table 1). Since 10th 14th day of life, the piglets were additionally fed the full-ration mixture of prestarter type. One week before weaning, the loose mixture of starter type was introduced (Table 2). The piglets were weaned at the age of five weeks. TABLE 1. Preparations administrated to piglets in the experimental groups E1, E2 and E3 Experimental groups / preparation E1 / A E2 / B E3 / C Active substance Dose (mg/ml) Active substance Dose (mg/ml) Active substance complex of dextran and iron(iii) Complex of iron hydroxide(iii) and dextran 200 complex of iron(iii) and dextran Source: According to the producer s data. 100 Dose (mg/ml) 586 pentasodium selenate copper chloride thiamine hydrochloride 0.03 vitamin B pyrodoxine hydrochloride cyanocobalamin 0.08 nicotinamide 0.4 pig serum to 1 ml

8 Comparison of the results of rearing the suckling TABLE 2. Raw materials of feed and energetic value as well as the content of nutrients (%) in 1 kg of the mixture Specification Mixture Prestarter Starter barley, wheat, maize, soy extraction wheat, barley, maize, soy extraction meal, products of oil and dairy meal, maize brans, maize DDGS, Feed raw materials industry, soy oil, calcium phosphate, calcium carbonate, sodium try, potato protein, calcium phosphate, wheat brans, products of food indus- chloride, and dietetic additives and vegetal oils, calcium carbonate and antioxidants dietetic additives and antioxidants Metabolic energy, MJ Crude protein Crude oil and fat Crude fibre Crude ash maximum 5 5 Total phosphorus Calcium Sodium Lysine Methionine Methionine + Cysteine Source: According to producer s data. At birth, the whole litters of the piglets were weighed; at weaning, each piglet was weighed individually; daily body weight gains of the piglets were assessed. The quantity of the consumed mixture, its utilization as well as diseases and deaths of the piglets were controlled. In nutrition of the sows, own mixtures were employed; they included the following components: cereals barley, triticale, rye, oats, and legumes pea or lupine of own cultivation as well as commercial protein and mineral components, soy and rape extraction meals, wheat brans, calcium carbonate, acidifier and premix: for suckling sows Rolmix LK 4% Q; for loose sows Rolmix LP 2.5%. The sows received the feed twice a day, with a constant access to water. The piglets were subjected to the basic care and prophylactic treatment: day 1 clipping the canine tooth and abbreviation of tails; day 3 administration of iron and Baycox preparation (against coccidiosis); day 5 7 castration of piglets. At the age of about 21 days, the piglets were vaccinated against Mycoplasma hyopneumoniae (preparation Ingelvac MycoFLEX) and at weaning, the animals were dewormed (intramuscular preparation Paramectin). After weaning, the animals received, as prophylactics, the solution of Colivet preparation for five days (against oedema disease). The sows were regularly dewormed and vaccinated against swine erysipelas and parvovirus (preparation Parvoruvax).

9 122 P. Golenia, A. Rekiel, J. Więcek Statistical analysis of the traits concerning the piglets was carried out by Kruskal-Wallis test, with the utilization of package IBM SPSS Statistics 21. The table contains the mean values and standard error of the mean (SEM). The mean values were given for the following traits: feed intake and consumption by the litter and gain of body weight of the litters. RESULTS AND DISCUSSION In each of the examined three groups, the cases of diarrhoea were found in one litter. Besides it, from among the piglets of one litter from group E1, the cases of streptococciosis were recorded. The best results of rearing and growth were obtained in the piglets from group E3 (P >0.05) Tables 3 and 4. TABLE 3. Results of reproduction and rearing of the piglets Traits Groups E1 E2 E3 Number of the piglets born alive (heads) Number of the piglets weaned from the litter* (heads) Number of piglets born (heads) mean min max SEM Number of piglets reared (heads) mean min max SEM The mean body weight of the piglet on day 1 (kg) mean min max SEM The mean body weight of the piglet on day 35 (kg) mean min max SEM Body weight gain in total at 1 35 day (kg) mean min max SEM The mean daily body weight gain (g) mean min max SEM * Including overlying cases in groups E1, E2, E3; other causes of deaths: in group E2 five piglets, in E3 one piglet.

10 Comparison of the results of rearing the suckling TABLE 4. Body weight gain of the litter and intake and utilization of feed Traits Groups E1 E2 E3 Gain of body weight of the litters (kg) Feed intake by the litter until weaning (kg) Feed conversion per 1 kg of body weight gain of the litter (kg/kg) The piglets from groups E1 and E3 as compared to the animals from group E2 were also more equalized at weaning. The comparison of the results of rearing the piglets and the literature data indicates a practical utility of the employed preparations in prophylaxis of anaemia what is supported by a good rate of growth in the herd (Salle and Auvigne 2006, Krasucki and Orlicki 2008). The better results of rearing the suckling piglets from group E3 could be affected by the employed preparation. Its components have the capability of counteracting the formation of free radicals; they also participate in oxidation and reduction reactions and affect the changes of iron in the body (Ku et al. 1983, Schollenberger 1984). The changes of iron are determined by the level of different elements in the organism; the mutual interactions between iron and copper in organs and in blood were examined (Yip et al. 1985, Dove and Haydon 1991). The supplementation of microelements cannot be excessively high as the surpluses of some of them e.g. copper, and cobalt, zinc, manganese, may have an antagonistic effect in relation to iron, what is favourable for lowering of its content in liver (Kujawiak 1996). In case of different resources of iron in the organism and external supply, the rate of growth of the piglets may vary. Its deficit is favourable for lowering of the growth rate and body weight of the piglets; it may also lead to anaemia. Initially, the limited level of iron results in lowering of its concentration in the spleen, liver and kidneys, and the increase of the efficiency of regulatory proteins for binding of iron. On the successive stage of deficit, the concentration of haemoglobin and Fe in the blood as well as myoglobin in the muscles is reduced. The third stage of iron deficit causes disfunctions of changes which are dependent on the mentioned element. The level and functioning of cytochrome oxidase c, and building-in of iron into hem which is found in the content of haemoglobin and myoglobin is important (Rincker et al. 2005). Deficit of iron forces greater and greater absorption of the discussed element in intestines. Fe excess may cause haemochromatosis or haemosyderosis, being a consequence of greater binding and absorbing of iron in the organism (Svoboda and Drabek 2005, Lipiński and Starzyński 2006). The mentioned changes are rarely observed because the excess of iron in physiological conditions is removed from organism (Artym

11 124 P. Golenia, A. Rekiel, J. Więcek 2008). The excess of iron may be toxic as a free form of this element participates in formation of free radicals which damage DNA, lipids and proteins. It affects negatively the growth and development of animals (Floriańczyk and Sidorowska 1995, Andrews 2002, Chung and Wessling-Resnick 2003). In the regulation of the processes, hepcidine is also participating factor (Ganz 2003). In the studies, it has been demonstrated that iron is the element, affecting positively blood parameters and the growth, development and health state of the piglets (Wasiński et al. 1995, Madej et al. 2000, Czech et al. 2003, Kostro et al. 2004, Salle and Auvigne 2006, Winnicka et al. 2012). Most of the piglets examined in the own studies was characterized by a good rate of growth; their mean body weight at weaning was high. The results were determined by summed effect of several factors; it included the age of the piglets at weaning, good health state and correct supply of the piglet organism in iron. The exception concerned the piglets from group E2, the body weight of which at weaning and body weight gains were lower than it should be expected (Krasucki and Orlicki 2008) but it might be the consequence of somewhat lower body weight of the piglets at birth. In the own studies, the comparison of three preparations, being intramuscularly injected, was carried out. The mentioned way of administration is better as compared to e.g. per os form due to easiness of administration, precise dose and rate of penetration of the preparation to blood circulation (Czech et al. 2003, Rekiel 2013). Kołacz et al. (2001) compared the blood parameters which reflect the management of iron and they found that iron fumarate given in a form of paste, and the liquid as administrated intramuscularly where iron dextrate was the active substance were comparable in respect of the quality. Saturation of transferrine with iron was similar what indicated the comparable availability of the studied preparations. Winnicka et al. (2012) showed the statistically lower (P 0.05) gains of the piglets which received iron preparation in a form of powder vs the group which received another preparation by injection. The authors demonstrated, however, the significantly higher (P 0.01) concentration of iron in blood of the suckling piglets, receiving the preparation in a form of powder per os, as compared to the injected preparations. In the case of own studies, the administration of the iron preparation protected the piglets from occurrence of anaemia what is manifested by a good rate of growth and the results of rearing the piglets. CONCLUSIONS The results of the conducted study allow stating as follows: The highest body weight of five-week piglets was found in group E3: the pig-

12 Comparison of the results of rearing the suckling lets from the mentioned group were higher vs the piglets from groups E1 and E2 by 3.47 and 13.15%, respectively (P >0.05). The best equalization of body weight of five-week piglets was recorded in groups E3 and E1. The piglets from group E3 consumed the highest quantities of fixed feed until weaning and in the mentioned group, the body weight gain in total was the highest one (8.44 kg/head). The mean daily gains of the piglets from group E3 amounted to 241 g and were higher by 5.24 and 12.62%, respectively, as compared to groups E1 and E2. The utilization (conversion) of solid feed per gain of 1 kg of the body weight of the litter in groups E1, E2 and E3 was equal to 4.80, 3.49 and 4.65 kg/kg, respectively. The mentioned parameters were low what indicates a good milk performance of the sows. All three preparations which were employed in the studies, fulfilled their prophylactic function and prevented occurrence of the symptoms of anaemia. The piglets from group E3 were characterized by the highest growth rate and a good state of health. The obtained results indicate the practical suitability of the employed preparation in the herd. REFERENCES ANDREWS N. 2002: Metal transporters and disease. Curr. Opin. Chem. Biol. 6: ARTYM J. 2008: Udział laktoferryny w gospodarce żelazem w organizmie. Część I. Wpływ laktoferryny na wchłanianie, transport i magazynowanie żelaza. Postepy Hig. Med. Dosw. 62: CHUNG J., WESSLING-RESNICK M. 2003: Molecular mechanisms and regulation of iron transport. Crit. Rev. Clin. Lab. Sci. 40: CZECH A., ORLICKI Ł., KRASUCKI W., TRU- CHLIŃSKI J., MATRAS J., GRELA E.R. 2003: Efektywność stosowania doustnego i iniekcyjnego preparatu żelazowego w odchowie prosiąt. Ann. UMCS 21: DOVE C.R., HAYDON K.D. 1991: The effect of copper addition to diets with various iron levels on the performance and hematology of weanling swine. J. Anim. Sci. 69: FLORIAŃCZYK B., SIDOROWSKA W. 1995: Białka uczestniczące w metabolizmie żelaza. Wszechświat 96 (11): GANZ T. 2003: Hepcidin, a key regulator of iron metabolizm and mediator of anemia of inflammation. Blood 102 (3): GRELA E., CZECH A., KAŃCZUGOWSKA B., ZERRAHN JENS E. 2005: Efficacy of iron additive in sulphate or chelate form in piglet diet. Ann. Anim. Sci. 5: KOŁACZ R., BODAK E., DOLIŃSKA B., DO- BRZYCKI Z., RYSZKA F. 2001: Wskaźniki gospodarki żelazowej w surowicy krwi prosiąt ssących po doustnej aplikacji fumaranu żelaza. Medycyna Wet. 57: KOSTRO K., KRASUCKI W., BEDNAREK D., WOJCICKA-LORENOWICZ K., ORLICKI Ł., PIECH T., MADANY J. 2004: Wpływ stosowania wybranych preparatów żelazowych na wskaźniki odporności swoistej oraz poziom białek ostrej fazy u prosiąt osesków. Medycyna Wet. 60: KRASUCKI W., ORLICKI Ł. 2008: Efektywność różnych form preparatów żelazowych w odchowie prosiąt. Medycyna Wet. 64:

13 126 P. Golenia, A. Rekiel, J. Więcek KU P.K., MILLER E.R., ULLREY D.E. 1983: Effect of prenatal iron on serum electrolytes of the baby pig. J. Anim. Sci. 57 (3): KUJAWIAK R. (Ed.) 1996: Racjonalne żywienie zwierząt. Wyd. Sano, Poznań. LIPIŃSKI P., STARZYŃSKI R.R. 2006: Rola białek IRPs (iron regulatory proteins) w regulacji ogólnoustrojowej homeostazy żelaza: lekcje płynące z badań na myszach z nokautem genów Irp1 i Irp2. Postepy Hig. Med. Dosw. 60: MADEJ E., GRZĘDA M., RIHA T., MILCZAK A., 2005: Skuteczność preparatów żelazowych produkcji Biowet Puławy w oddziaływaniu na wzrost i zapobieganie niedokrwistości prosiąt. Medycyna Wet. 61: MADEJ E., ZIEGLER J., BLAMOWSKA M. 2000: Ocena skuteczności preparatu Suiferrin pasta w zapobieganiu niedokrwistości prosiąt. Medycyna Wet. 56: MAES D., STEYAERT M., VANDERHAEGHE C., LOPEZ RODRIGUEZ A., De JONG E., DeL POZO SACRISTAN R., VANGROEN- WEGHE F., DEWULF J. 2011: Comparison of oral versus parenteral iron supplementation on the health and productivity of piglets. Vet. Record 168 (7): 188. REKIEL A. 2013: Żelazo pierwiastek ważny dla prosiąt. Farmer 12: RINCKER M.J., CKARKE S.L., EISENSTEIN R.S., LINK J.E., HILL G.M. 2005: Effects of iron supplementation on binding activity of iron regulatory proteins and the subsequent effect on growth performance and indices of haematological and mineral status of young pigs. J. Anim. Sci. 83: Rozporządzenie Ministra Rolnictwa i Rozwoju Wsi z dnia 15 lutego 2010 r. w sprawie wymagań i sposobu postępowania przy utrzymaniu gatunków zwierząt gospodarskich, dla których normy ochrony zostały określone w przepisach Unii Europejskiej. Dz.U. z 2010 r. nr 56, poz SALLE E., AUVIGNE V. 2006: Comparative study of the efficacy gleptoferron and iron dextran in anemia prevention in piglets. Proceedings of 19 th IPVS Congress, Copenhagen, Denmark, 2, P SCHOLLENBERGER A. 1984: Stan odporności swoistej i nieswoistej prosiąt po zastosowaniu nadmiernych dawek żelaza. Wyd. SGGW-AR, Warszawa. SOKOŁOWSKA E., KLIMEK J. 2007: Hepcydyna hormon uczestniczący w regulacji metabolizmu żelaza w organizmie. Post. Biol. Kom. 34 (1): SVETINA A., VRABAC L.J., BELIĆ M., TURK R. 2006: Relation between erythrocyte parameters and stillbirth in piglets. Vet. Arhiv. 76 (4): SVOBODA M., DRABEK J. 2005: Iron deficiency in suckling piglets: etiology, clinical aspects and diagnosis. Folia Vet. 48: WASIŃSKI B., RUŁKA J., PAWŁOWSKI R., GOŁĘBIEWKI Z. 1995: Porównanie skuteczności doustnego i iniekcyjnego preparatu żelazowego w zapobieganiu anemii prosiąt. Medycyna Wet. 51: WINNICKA O., WIĘCEK J., REKIEL A., BAR- TOSIK J., KORDYASZ M., TOKARSKA G. 2012: Wpływ zróżnicowanych programów odchowu prosiąt na zawartość żelaza we krwi i masę ciała. Roczn. Nauk. PTZ 8 (4): YIP R., REEVES J.D., LONNERDAL B., KEEN C.L., DALLMAN P.R. 1985: Does iron supplementation compromise zinc nutrition in healthy infants. Am. J. Ciln. Nutr. 42: Streszczenie: Porównanie wyników odchowu prosiąt otrzymujących różne preparaty żelaza. Celem badań było określenie wyników odchowu prosiąt otrzymujących iniekcyjnie trzy różne preparaty żelaza. Lochy, których potomstwo objęto obserwacjami, przed porodem przydzielono losowo do jednej z trzech grup doświadczalnych E1, E2 i E3 (każda po pięć loch). Kontrolowano tempo wzrostu, wykorzystanie paszy i stan zdrowia prosiąt od urodzenia do odsadzenia (35. dzień życia). Największą masę ciała pięciotygodniowych prosiąt stwierdzono w grupie E3; różnica w stosunku do masy prosiąt z grup E1 i E2 wyniosła odpowiednio 3,47 i 13,15% (p >0,05). Najlepsze wyrównanie masy ciała pięciotygodniowych prosiąt stwierdzono w grupach E3 i E1. Prosięta z grupy E3 pobrały najwięcej paszy stałej do odsadzenia i w tej grupie przyrost masy ogółem był największy (8,44 kg/szt.). Średnie dobowe przyrosty prosiąt z grupy E3 wyniosły 241 g i były większe względem grup E1 i E2 o odpowiednio:

14 Comparison of the results of rearing the suckling ,24 i 12,62%. Zużycie paszy stałej na przyrost 1 kg masy miotu wyniosło w grupach E1, E2, E3 odpowiednio: 4,80, 3,49 i 4,65 kg. Wskaźnik ten miał małą wartość, co wskazuje na dobrą mleczność loch. Wszystkie trzy stosowane preparaty spełniły swoją profilaktyczną funkcję i zapobiegły wystąpieniu symptomów niedokrwistości. Słowa kluczowe: prosięta, żelazo (Fe), preparaty żelaza MS received November 2015 Author s address: Anna Rekiel Zakład Hodowli Trzody Chlewnej Katedra Szczegółowej Hodowli Zwierząt Wydział Nauk o Zwierzętach SGGW ul. Ciszewskiego 8, Warszawa Poland anna_rekiel@sggw.pl

15 Annals of Warsaw University of Life Sciences SGGW Animal Science No 54 (2), 2015: (Ann. Warsaw Univ. of Life Sci. SGGW, Anim. Sci. 54 (2), 2015) Polymorphism of insulin-like growth factor IGF-1 gene in selected Polish sheep breeds ROMAN NIŻNIKOWSKI 1, GRZEGORZ CZUB 1, MARCIN ŚWIĄTEK 1, MAGDALENA ŚLĘZAK 1, KRZYSZTOF GŁOWACZ 2 1 Department of Animal Breeding and Production 2 Department of Animal Environment Biology Warsaw University of Life Sciences SGGW Abstract: Polymorphism of insulin like growth factor IGF-1 gene in selected Polish sheep breeds. Research was carried out in on 1,751 sheep bred in Poland (1366 ; 385 ) 4 meatwool breeds: Polish Merino, Old type Polish Merino, Corriedale and Żelaźnieńska sheep and 3 meat breeds (Berrichone du cher, Suffolk, Charolaise) from 34 flocks selected randomly across the country. All animals were subjected to identification factor insulin-igf-1 gene, in the assessment of C and T alleles. Summing up, it should be noted that in four meat-wool breeds and two meat breeds (Berrichone du cher, Suffolk) there were no polymorphism of alleles and genotypes of insulin-like growth factor (IGF-1) gene, limiting its scope to determine C allele and CC genotype. Only one Charolaise ewe (breed imported from France) had T allele and C:T genotype. That result indicates the need for further research about sheep imported and adapted in Polish production conditions and assess the adaptation process. Key words: sheep, IGF-1, distribution of alleles and genotypes INTRODUCTION Protein IGF-1 is one of the key components of the pathway of growth hormone (Franco et al. 2005). IGF-1 is produced in liver and is responsible for cell growth and body treatments. It is believed that the effect of growth hormone occurs in the tissue in cooperation with local somatomedin e.g. IGF-1 and stimulates the secretion of hypothalamic somatostatin inhibits secretion of growth hormone (Krzymowski et al. 1998). Insulin growth factor gene is listed among the conditions which were useful to the identification of breeds, as demonstrated in the Mediterranean countries (Pariset et al. 2006). Niżnikowski et al. (2013, 2014) presented a different view in relation to the research carried out on domestic sheep breeds compared to the ancestor of the sheep European mouflon (Ovis aries musimon). Taking into account the fact reported in the cited work conditions influence the incidence of insulin-like gene IGF-1, it was decided to examine its frequency of occurrence in meat-wool breeds: Polish Merino, Old type Polish Merino, Corriedale and Żelaźnieńska sheep and meat breeds: Berrichone du cher, Suffolk, Charolaise (PZO 2014). MATERIAL AND METHODS The studies were conducted in on meat-wool sheep breeds: Polish

16 130 R. Niżnikowski et al. Merino (three flocks from Wielkopolskie Voivodeship, eight flocks from Kujawsko-Pomorskie Voivodeship); Old type Polish Merino (one flock from Wielkopolskie Voivodeship, five flocks from Łódzkie Voivodeship, eight flocks from Kujawsko-pomorskie Voivodeship); Żelaźnieńska Sheep (two flocks from Podlaskie Voivodeship, one flock from Łódzkie Voivodeship) and meat breeds: Berrichone du cher (one flock from Wielkopolskie Voivodeship), Suffolk (two flocks from Wielkopolskie Voivodeship) and Charolaise (two flocks from Wielkopolskie Voivodeship). Ewes and rams were from herd replacement stuff and were randomly selected for sampling (Table 1). For the isolation of genomic DNA blood samples were obtained of animals from vein jugularis into tubes containing anticoagulant EDTA. DNA was isolated from blood leukocytes. In order to obtain high quality DNA suitable for multiple use, blood was purified from the heme compounds, which were erythrocyte lysis products. DNA was isolated by chromatography TABLE 1. Experimental material used in the study in years Breed Sex Polish Merino Old type Polish Merino Corriedale Żelaźnieńska Sheep Berrichone du cher Suffolk Charolaise Total within sex Total Number of ewes and rams , , , , , , , , , , , , , , , , , , , , , , , 5

17 Polymorphism of insulin-like growth factor IGF on mini-columns of silicate (A&A Biotechnology, Poland, and subsequently served as a template DNA for amplification of polymorphic gene allele fragment. Sample genotyping was performed with KASPar system ( which uses a single nucleotide polymorphism (SNP) based on primers listed in Table 2. and Germany, obtained similar results, because Charolaise (meat breed) originated from France and its herd were established in Poland through imports. It worth noted the fact that Charolaise breed was brought to Poland relatively later than Suffolk and Berrichone du cher (PZO 2014). Other tested sheep breeds showed no polymorphism of IGF-1 TABLE 2. The primers and SNP of IGF-1 gene (Pariset et al. 2006) Locus IGF-1 Name insuline-like factor Starters 3 do 5 (forward/reverse) CACACACCTTGTTGCACTCC/ /GCTGAGTTGGTTGGATGCTCT SNP Localization AY737509: 211 C>T Exon 3 A high reliability of SNP method compared to the sequencing method was proved by Green et al. (2006). Based on genotyped DNA samples of ewes and rams, distributions of alleles and genotypes were showed separately for each breed of studied sheep. Alleles and genotypes frequencies were compared depending on sheep breed using χ 2 test and SPSS v.21 software, with assessed range of alleles and genotypes frequency between breeds, sexes and the differences between the sexes in terms of individual alleles and genotypes. RESULTS AND DISSCUSION Studies showed no statistical significance effect of breed and sex within breed on distribution of factor IGF-1 gene alleles and genotypes. Among 1,751 collected samples only one Charolaise ewe had T allele and C:T genotype. In comparison with the results of Pariset et al. (2006) which mainly describing sheep from region of Mediterranean Sea, Black Sea gene alleles and genotypes. That was confirmed by the results of Niżnikowski et al. (2013, 2014) in studies conducted on meat-wool sheep breeds and north- -east short-tailed sheep breeds. It is expected that the distribution of the conditions occurring in sheep breeds in Poland was typical (except Charolaise breed) for this region of the World and different from the observed trends in other European countries (Pariset et al. 2006). Perhaps it has to do with another course of life processes of growth and development, which wrote Krzymowski et al. (1998). In this situation, can be useful series of studies on sheep imported into Poland about polymorphism of alleles and genotypes of insulin-like growth factor gene changed due to processes of adaptation which requires further work in this area. Generally, it should be noted that four meat-wool breeds and two meat breeds showed no polymorphism alleles and genotypes of IGF-1, limiting its scope to determine

18 132 R. Niżnikowski et al. C allele and genotype CC. In imported breed from France only one ewe had T allele and C:T genotype. That result indicates the need for further research about sheep imported and adapted in Polish production conditions and assess the adaptation process, especially on Charolaise breed. REFERENCES FRANCO M.M., ANTUNES R.C., SILVA H.D., GOULARDT L.R. 2005: Association of PIT1, GH and GHRH polymorphisms with performance and carcass traits in Landrace pigs. Journal of Applied Genetics 46 (2): GREEN B.T., HEATON M.P., CLAWSON M.L., LAEGREID W.W. 2006: Linkage disequilibrium across six prion gene regions spanning 20 kbp in U.S. sheep. Mamm Genome 17: KRZYMOWSKI T. (Ed.) 1998: Fizjologia zwierząt. PWRiL, Warszawa: PARISET L., CAPPUCIO I., AJMONE-MAR- SAN P., BRUFORD M., DUNNER S., COR- TES O., ERHARDT G., PRINZENBERG E-M., GUTSCHER K., JOOST S., PINTO- -JUMA G., NIJMAN I.J., LENSTRA J.A., PEREZ T., VALENTINI A., Econogene Consortium, 2006: Characterization of 37 Breed- -Specific Single-Nucleotide Polymorphisms in Sheep. Journal of Heredity 97 (5): PZO 2015: Hodowla Owiec i Kóz w Polsce w 2014 roku. Polski Związek Owczarski. NIŻNIKOWSKI R., CZUB G., GŁOWACZ K., ŚWIĄTEK M., ŚLĘZAK M. 2013: Polymorphism of insulin like growth factor IGF-1 in position 211 in national sheep breeds with carped wool compared to Polish Merino and European Muflon (Ovis aries musimon), Ann. Warsaw Univ. of Life Sci. SGGW, Anim. Sci. 52: NIŻNIKOWSKI R., CZUB G., KAMIŃSKI J., NIERADKO M., ŚWIĄTEK M., GŁOWACZ K., ŚLĘZAK M. 2014: Polymorphism of insulin-like growth factor (IGF-1) gene in Polish Lowland Sheep from Podlasie Voivodeship. Ann. Warsaw Univ. of Life Sci. SGGW, Anim. Sci. 53: SPSS 21.0 for Windows, IBM Ltd. Streszczenie: Polimorfi zm genu insulinopodobnego czynnika wzrostu IGF-1 u wybranych polskich ras owiec. Badania przeprowadzono na 1751 owcach ras hodowanych w Polsce (1366 i 385 ) 4 ras wełnisto-mięsnych: merynos polski, merynos polski starego typu, corriedale i owca żelaźnieńska oraz 3 ras mięsnych (berrichone du cher, suffolk i charolaise) w latach , pochodzących z 34 stad wybranych losowo na obszarze całego kraju. Wszystkie zwierzęta poddane były identyfikacji genu czynnika insulinopodobnego IGF-1, w zakresie oceny występowania alleli C i T. Podsumowując, stwierdzić należy, iż u badanych czterech ras wełnistomięsnych oraz dwu ras mięsnych (berrichone du cher i suffolk) nie wykazano polimorfizmu występowania alleli i genotypów genu insulinopodobnego czynnika wzrostu IGF-1, ograniczając jego zakres do ustalenia jedynie do allelu C i genotypu CC. U importowanej z Francji rasy charolaise stwierdzono odstępstwo od tej reguły tylko u jednej maciorki mającej allel T i genotyp C:T. Wynik ten wskazuje na potrzeby prowadzenia dalszych badań z tego zakresu u owiec pochodzących z importu i adaptowanych w polskich warunkach środowiska produkcyjnego, na podstawie którego można będzie ocenić zakres procesów adaptacyjnych. Słowa kluczowe: owce, IGF-1, rozkład alleli i genotypów MS received November 2015 Author s address: Roman Niżnikowski Zakład Hodowli Owiec i Kóz Katedra Szczegółowej Hodowli Zwierząt Wydział Nauk o Zwierzętach SGGW ul. Ciszewskiego 8, Warszawa Poland roman_niznikowski@sggw.pl

19 Annals of Warsaw University of Life Sciences SGGW Animal Science No 54 (2), 2015: (Ann. Warsaw Univ. of Life Sci. SGGW, Anim. Sci. 54 (2), 2015) Comparison of calving course of Charolaise purebreds and their crossbreeds with Polish Holstein-Friesian cows TOMASZ PRZYSUCHA, MARCIN GOŁĘBIEWSKI, KAROLINA WNĘK, JAN SLÓSARZ, MAŁGORZATA KUNOWSKA-SLÓSARZ Department of Animal Breeding and Production, Warsaw University of Life Sciences SGGW Abstract: Comparison of calving course of Charolaise purebreds and their crossbreeds with Polish Holstein-Friesian cows. Calving course of cows of Charolaise breed covered by bulls of the same breed as well as cows of Polish Holstein-Friesian (PHF) breed inseminated with Charolaise bull s semen was investigated. In purebred population the material was taken from the beef cattle recording scheme provided by the Polish Association of Beef Cattle Breeders and Producers. In case of commercial crossing the material was taken from the questionnaires collected by the technicians representing Mazovian Centre of Animal Breeding and Reproduction in Łowicz. The data base covered calving course degree and calf body weight at birth degree. It was proved, that the significantly higher ratio of deliveries when human help was needed was stated in the purebred Charolaise population (24.5%), in comparison to crossbreeding where the above mentioned ratio was only 12.2%. The most difficult calvings were observed for the calves of the highest birth weight. The high ratio of assisted calvings in commercial crossing as well as in purebred population of Charolaises suggest that all of the deliveries should be monitored by the breeders. It should be also stated that the ratio of difficult calvings in the commercial crossing is significantly lower than that observed in purebred PHF population. Because of so low ratio of assisted calvings in commercial crossing with Charolaise bulls it should be recommended to use the semen of bulls which pedigree show high body weight at birth and muscularity. Key words: Charolaise, calving course, commercial crossing INTRODUCTION Beef cows are not milked, hence the economic results of this branch of beef production depend mainly on the number of healthy and vital calves born from cows without any negative influence on their health and future reproduction. Among many factors influencing the proper calves development, beside of husbandry conditions, the calving course is mentioned by many authors (Nogalski 2004, Grodzki et al. 2009, Przysucha 2009). Calving course depends on many factors like: breed, body weight and condition of cow, calving number, body weight and sex of calf at delivery. Calving difficulty, growth rate and calf muscularity are the main traits used to formulate the evaluation criteria of breeding indexes for beef cattle in many countries. According to many authors (Philippson 1976, Philippson 1977, Burfening et al. 1981, Meijering 1984, Berger 1994, Nogalski and Klupczyński 1999, Grodzki et al. 2010), calving course is influenced by many genetic and phenotypic factors. On the base of the wide literature review Nogalski (2004) and Przysucha (2009) agreed, that the main

20 134 T. Przysucha et al. factors affecting calving course were: cow age (calving number), calf body weight at birth, calf sex, cow caliber and its pelvis area, parents breed, pregnancy length, parents genotypes, cow condition and feeding during pregnancy, calf shape and its position at delivery. All the above mentioned factors are strictly connected one to the other. Following the rules of the most breeding programs for beef breeds it is easy to recognize, that calving course, calf body weight at delivery, calf body shape, daily growth rate, feed conversion, cutting rate and carcass quality are the main items to the breeding value formula (Nogalski and Klupczyński 1999, Przysucha et al. 2005, Przysucha et al. 2007). In the young Polish beef cattle production the purebred female population consists of 14 beef breeds, but Charolaise cows and heifers number amounts to about 15% and in commercial crossing to 8.5%. Charolaise breed is predisposed for the intensive fattening with the very high daily gain at the moderate feedstuffs use. Animals kept for slaughtering can be fattened to the high body weight without any risk of over fattening. The proper use of beef bulls (without regard of their breed) is crucial for the commercial crossing results. This type of crossbreeding is often identified with calving difficulties. Papers provided by many authors clearly proved, that the calving difficulties within specialized beef breeds are the same or even lower (in case of commercial crossing) than those in case of purebred dairy herd (Hanset 1981, Nix et al. 1998, Nogalski 2002, Przysucha and Grodzki 2008, Przysucha et al. 2009). The aim of the research was to determine the frequency of difficult calvings in Charolaise cows and dairy cows inseminated by Charolaise bulls semen in the commercial crossing. MATERIAL AND METHODS The calving course of 98 purebred Charolaise (3 8 years old) cows inseminated by the same breed bulls as well as 123 Polish Holstein-Friesian (PHF) cows serviced by Charolaise bulls semen (commercial crossbreeds) was monitored. Results of beef cattle recording scheme conducted by Polish Association of Beef Cattle Breeders and Producers constituted the material for investigation. In case of commercial crossing (dairy cow Charolaise bull) the calving course was examined by technicians from Mazovian Centre of Animal Breeding and Reproduction in Łowicz. The data base covered calving course degree and calf body weight at birth degree. Calving course was evaluated as: normal, without any assistance (1), help of the breeder needed (2). Depending on body weight at birth (kg) calves were divided into the following groups: up to 35 kg, kg, beyond 45 kg. Statistical analysis of the calving difficulties frequencies was carried out by Chi-square test using SPSS 12.0 (Statistical Product and Service Solution 1998).

21 Comparison of calving course of Charolaise purebreds RESULTS AND DISCUSSION The ratio of calving course examination for purebred and crossbred populations was presented in Table 1. Relatively high percentage of difficult calvings (with assistance needed) in purebred Charolaises and crossbreds from commercial crossing of PHF cows with Charolaise bulls suggests, that all TABLE 1. The ratio of calving course examination for purebred and crossbred populations Population Purebred Commercial crossing Significance at P Calving course with help without any assistanse of the breeder (1) (2) Total N % N % Obtained results show significantly higher ratio of difficult calvings in the purebred Charolaise population in comparison to commercial crossing. The calf body weight at birth had significant influence on calving course ratio. The highest ratio of difficult calvings were found, when calf body weight was the highest (Table 2). Obtained results are the same as those presented by practically all the authors dealing with the problem. of the deliveries should be monitored by the breeder. It should be stated, that the ratio of difficult calvings in commercial crossing with Charolaise bulls is much lower than those shown by the authors dealing with the purebred PHF (Fouz et al. 2013). Because of the relatively small percentage of difficult deliveries in commercial crossing with Charolaise bulls, this breed should be recommended to use for that purpose. The highest calving difficulty, compared with pure TABLE 2. The influence of calf body weight at birth on calving course Population Purebred Commercial crossing Significance at P Calf body weight at birth (kg) without any assistanse (1) Calving course with help of the breeder (2) % < > < >

22 136 T. Przysucha et al. Holsteins was for crosses with Belgian Blue followed by Limousine and Galician Blonde (Fouz et al. 2013). Irrespectively to calves genotype (purebreds or crossbreeds) the frequencies of difficult calvings increase with the birth body weight of the calves (Table 2). REFERENCES BERGER P.J. 1994: Genetic prediction for calving ease in the United States: Data, models and use by the dairy industry. J. Dairy Sci. 77: BURFENING P.J., KRESS D.D., FRIEDRICH R.L., VANIMAN D.D. 1981: Phenotypic and genetic relationships between calving ease, gestation length, birth weight and preweaning growth. J. Anim. Sci. 47 (3): FOUZ R., GANDOY F., SANJUÁN M.L., YUS E., DIÉGUEZ F.J. 2013: The use of crossbreeding with beef bulls in dairy herds: effects on calving difficulty and gestation length. Animal. 7 (2): GRODZKI H., NAWROCKI L., PRZYSUCHA T., GRODZKI G., KONOPKA B. 2009: Chów bydła mięsnego. Wielkopolskie Wydawnictwo Rolnicze, Poznań. GRODZKI H., PRZYSUCHA T., SLÓSARZ J. 2010: The influence of commercial crossbreeding of dairy cows with bulls of French breeds (Blonde d Aquitaine, Charolaise, Limousine) on calving course. Ann. Warsaw Univ. of Life Sci. SGGW, Anim. Sci. 47: HANSET R. 1981: Selection problems when antagonistic effects exist between production characteristics and calving difficulties. Livest. Prod. Sci. 8: MEIJERING A. 1984: Dystocia and stillbirths in cattle A review of causes, relations and implications. Livest. Prod. Sci. 11: 143. NIX J.M., SPITZER J.C., GRIMES L.W., PLY- LER B.B., 1998: A retrospective analysis of factors contributing to calf mortality and dystocia in beef cattle. Theriogenology 49: NOGALSKI Z. 2002: Effect of selected factors on the course of parturition in holstein-friesian heifers. J. of Polish Agric. Universities, Animal Husbandry 5 (2). media.pl/series/volume5/issue2/animal/art- 03.html. NOGALSKI Z. 2004: Zootechniczne uwarunkowania jakości porodu jałówek i krów czarno- -białych. Rozpr. i Monogr. 101, UWM Olsztyn. NOGALSKI Z., KLUPCZYŃSKI J. 1999: Przebieg wycieleń, wielkość i żywotność cieląt w stadzie bydła mięsnego w Mielnie. Zesz. Nauk. Prz. Hod. 44: PHILIPSSON J. 1976: Studies on calving difficulty, stillbirth and associated factors in Swedish cattle breeds. III. Genetic parameters. Acta Agric. Scand. 26: PHILIPSSON J. 1977: Studies on calving difficulty, stillbirth and associated factors in Swedish cattle breeds. VI. Effects of crossbreeding. Acta Agric. Scand. 27: PRZYSUCHA T. 2009: Osobnicze uwarunkowania przebiegu ocieleń krów oraz umięśnienia i żywotności cieląt pochodzących po buhajach rasy piemontese użytkowanych w Polsce i we Włoszech. Ph.D. thesis. Wyd. SGGW, Warszawa. PRZYSUCHA T., GRODZKI H. 2008: Relationship between calving course and calf body weight at birth and calf/cow body weight ratio. Elec. J. of Polish Agric. Universities, Animal Husbandry 11 (3): 1 7. PRZYSUCHA T., GRODZKI H., BRZOZOW- SKI P., ZDZIARSKI K. 2005: Wpływ wybranych czynników na przebieg porodów krów rasy Limousine. Med. Wet. 61 (9): PRZYSUCHA T., GRODZKI H., SLÓSARZ J. 2007: Wpływ masy ciała krowy, kolejności i sezonu ocielenia oraz płci i masy cielęcia przy urodzeniu na wyniki odchowu cieląt rasy salers. Med. Wet. 63 (3): PRZYSUCHA T., GRODZKI H., SLÓSARZ J., GOŁĘBIEWSKI M., KUNOWSKA-SLÓ- SARZ M. 2009: Wpływ kondycji krów rasy Limousine przed ocieleniem na rodzaj porodu. Med. Wet. 65 (12):

23 Comparison of calving course of Charolaise purebreds Statistical product and service solution case version 8.0 for Windows, User s Guide, 1998, by SPSS Inc., USA. Streszczenie: Porównanie przebiegu porodu u krów rasy charolaise i jej mieszańców z bydłem rasy polskiej holsztyńsko-fryzyjskiej. W pracy oceniono przebieg porodów 98 krów rasy charolaise krytych buhajami tej samej rasy oraz 123 krów rasy polskiej holsztyńsko-fryzyjskiej odmiany czarno-białej (phf) krytych w krzyżowaniu towarowym z buhajami mięsnej rasy charolaise. W hodowli czystorasowej materiałem do badań były wyniki oceny użytkowości bydła mięsnego prowadzonej przez Polski Związek Hodowców i Producentów Bydła Mięsnego. W przypadku krzyżowania towarowego materiałem do badań były dane zawarte w Kartach przebiegu ocielenia krowy prowadzonych przez specjalistów Mazowieckiego Centrum Hodowli i Rozrodu Zwierząt Sp. z o.o. w Łowiczu. Dane dotyczące 98 porodów krów rasy charolaise inseminowanych nasieniem buhajów tej samej rasy oraz 123 porodów krów phf inseminowanych nasieniem buhajów mięsnej rasy charolaise obejmowały ocenę przebiegu porodu oraz masę cielęcia przy urodzeniu. Uzyskane wyniki jednoznacznie pokazują, że znacznie większy i statystycznie istotny udział porodów wymagających pomocy człowieka stwierdzono w populacji czystorasowej bydła charolaise (24,5%), w porównaniu z krzyżowaniem towarowym krów mlecznych z buhajami tej rasy, gdzie odsetek trudnych ocieleń wyniósł zaledwie 12,2%. Analiza statystyczna wykazała istotny wpływ masy cielęcia na rozkład ocen przebiegu porodu w obu badanych populacjach. Najwięcej trudnych porodów zanotowano w grupie cieląt o największej masie przy urodzeniu. Stosunkowo duży odsetek porodów wymagających udziału człowieka zarówno w krzyżowaniu towarowym, jak i w populacji czystorasowej charolaise sugeruje potrzebę monitorowania przez hodowcę wszystkich porodów. Należy podkreślić, że odsetek przypadków trudnych ocieleń w krzyżowaniu towarowym z rasą charolaise jest znacznie mniejszy z ich częstością, jaką notuje się u bydła phf utrzymywanego w czystości rasy. Słowa kluczowe: charolaise, rodzaj porodów, krzyżowanie towarowe MS received November 2015 Authors address: Tomasz Przysucha Zakład Hodowli Bydła Katedra Szczegółowej Hodowli Zwierząt Wydział Nauk o Zwierzętach SGGW ul. Ciszewskiego 8, Warszawa Poland tomasz_przysucha@sggw.pl

24 Annals of Warsaw University of Life Sciences SGGW Animal Science No 54 (2), 2015: (Ann. Warsaw Univ. of Life Sci. SGGW, Anim. Sci. 54 (2), 2015) Analysis of Hereford beef cattle recording results in Poland TOMASZ PRZYSUCHA, MARCIN GOŁĘBIEWSKI, HENRYK GRODZKI, KAROLINA WNĘK, JAN SLÓSARZ, MAŁGORZATA KUNOWSKA-SLÓSARZ, PIOTR TOKARSKI Department of Animal Breeding and Production, Warsaw University of Life Sciences SGGW Abstract: Analysis of Hereford beef cattle recording results in Poland. The aim of the study was to assess the utility of selected results of the British Hereford breed with respect to their compliance with the goal of racial breeding and standards adopted by the Polish Association of Breeders and Producers of Beef Cattle (PABPBC). The subject of the analysis were recording results of the British Hereford beef cattle breed in Poland. The study was based on data for the years the National Center of Animal Breeding (NCAB) and the PABPBC for The data set included: N the number of animals tested, min minimum values in the studied traits, max maximum value of the selected features, average average values of the analyzed traits, SD standard deviation. Evaluated properties are: the average weight of cows (kg), the average body weight of calves after birth (kg), the average daily gains for age 210 days (g), the average body weight of calves at the age of 210 days (kg), the average milk yield (kg), the terms of cows and heifers calving aptitude, the distribution of the population according to the order of calving cows. Since 2001 there is a clear, steady decline in the share of population of the breed in the female population of beef cattle. This decrease concern both purebred and crossbred populations. Analysis of the results of evaluation shows that the average body weight of cows did not differ from weights assumed in the breeding goal. The mean body weight of purebred calves at birth did not change significantly in 15 years of assessment. Bulls have demonstrated higher birth weight reaching 35.4 kg. The difference between bulls and heifers was 3.4 kg. Calves were characterized by a high average gains during rearing: 876 1,039 g for heifers and 851 1,122 g for bulls over all years of assessment. In Polish Hereford cattle herds 30.9 to 46.9% of cows was calving during relevant period in recent years. It shows that more than half of the calves born at other times of the year only to a small degree can take full advantage of the pasture. Despite a steady decrease in the population of Hereford cows and cows calving for the second time constituted about 40% of the population. In 2000, only nine cows was after seven calving and in 2013 only 78 (11.8%). Key words: beef cattle, Hereford, beef cattle recording INTRODUCTION Twenty years of the Programme of Beef Cattle Breeding Development in Poland passed in 2014 (Jasiorowski et al. 1996). Due to the sparse pure-bred female population is difficult to talk about own national breeding program. Therefore, the maintenance of high standards of breed is the main task of the PABPBC. Its implementation is, i.a., usability evaluation conducted in beef cattle herds. The PAB- PBC breeding goal for Hereford cows is maintaining body weight of adult cows on the level of approximately kg, and in case of bulls around 900 1,000 kg, ease of calvings, a high level of ma-

25 140 T. Przysucha et al. ternal traits and maintenance of maturity class. Bulls should reach at adulthood the height at sacrum of about 135 cm and cows about 130 cm. In the national beef cattle breeding program there are set out, i.a., the following standards for breeding of Hereford cows entered in the introductory part of the book: the minimum weight gain from birth to 210 days of age 800 g, the minimum weight at first calving 460 kg. The aim of the study was to assess the selected results of the British Hereford with respect to their compliance with the breeding goal and standards adopted by the Polish Association of Breeders and Producers of Beef Cattle (PABPBC). MATERIAL AND METHODS The subject of the analysis were beef cattle recording results for the British Hereford breed in Poland with respect to their compliance with the goal of racial breeding and standards adopted by the PABPBC. The subject of the analysis were recording results of the Hereford beef cattle breed in Poland. The study was based on data for the years the National Center of Animal Breeding (NCAB) and the PABPBC for The data set included: N the number of animals tested, min minimum values in the studied traits, max maximum value of the selected features, average average values of the analyzed traits, SD standard deviation. Evaluated properties are: the average weight of cows (kg), the average body weight of calves after birth (kg), the average daily gains for age 210 days (g), the average body weight of calves at the age of 210 days (kg), the average milk yield (kg), the terms of cows and heifers calving aptitude, the distribution of the population according to the order of calving cows. The calculation of standardized animal body weight for given day in its life was done according to the following formula: MCS = [(MCB MCU) / WW] WS + MCU where: MCS standardized animal body weight (kg), MCB mean body weight of the animal on the actual weighing (kg), MCU actual body weight set for 48 h at birth (kg), WW mean age of the animal on the weighing (days), WS standardized age of the animal (days). There were calculated the average daily weight gain of the animal from the day of birth to 210 days of age, according to the formula: WK PDMC = (MCC MCP) 1,000 / (WK WP) where: PDMC increase in daily body weight (g), MCC final body weight of the animal on the weighing day (kg), MCP initial body weight of the animal on the weighing (kg), age of the animal on the final weighing (days), WP age of the animal on the initial weighing (days).

26 Analysis of Hereford beef cattle recording results in Poland 141 Milk yield in dairy cows is expressed in kg of milk per convention, the conversion 210 day lactation and is calculated according to the formula: WMM210 = McOds 1,700 / calf age where: WMM210 value of mother milk milk yield for 210th day of lactation conversion assuming calf birth weight of 35 kg (per 1 kg body weight gain), which drank 10 kg of milk per day during the first three months and 8 9 kg of milk per day for the remaining months, McOds actual weight of the calf at weaning (kg), calf age actual age of the calf at the time of weaning from the mother (days). RESULTS AND DISCUSSION Table 1 presents the quantitative changes of the female population of Hereford cattle in Poland in the years Since 2001 there is a clear, steady decline in the share of the female population of the breed in beef cattle. This decrease concerned both purebred and crossbred populations. The average body weight of purebred cows are shown in Table 2. Optimum cow body weight and dimensions depend mainly on cattle production system (Morris and Wilton 1976, Andersen TABLE 1. Quantitative changes of the female population of Hereford cattle in Poland* Year Beef breed female population purebred crossbred total Hereford breed purebred Hereford breed crossbred Hereford breed purebred + crossbred Hereford breed share in the population (%) * From 2007 the list includes only the cows.

27 142 T. Przysucha et al. TABLE 2. Body weight of purebred Hereford cows in Cow body weight (kg) Year N min max average SD * * * Body weight after first calving. 1978, Dickerson 1978, Fitzhugh 1978, Nogalski et al. 2000). Genotype and weight of cows are always listed among the many factors responsible for normal growth and development of calves. Many studies have shown that the weight of the cow has a significant impact on calf birth weight as well as daily gains during rearing (Przysucha et al. 2002). Cited authors showed that body weight of cows had highly significant impact on calf weight at birth. Cows with the lowest body weight delivered calves lighter by 6.3 kg than calves born to the heaviest cows. Body weight of cows had significant and highly significant influence on weight of calves aged 120 and 210 days. Highly significant effect of cow body weight on calves weight daily gains for periods from 1 to 210 and 120 to 210 days of age. Highest daily gains in body weight during the whole period of rearing had calves delivered by cows with the highest weight. Therefore the weight of a cow in adulthood is an important feature to be considered for breeding programs (Anderson 1978). According to the breeding goal of the PABPBC, cow body weight in adulthood should be kg for Hereford breed. Analysis of the results of usability evaluation shows that the average body weight of cows did not differ from weights assumed to breeding. Tables 3 and 4 illustrate the average body weight of purebred calves at birth, which did not change significantly in 15 years of assessment. Higher birth weight have demonstrated the bulls reaching 35.4 kg. The difference between bulls and heifers was 3.4 kg. Kamieniecki et al. (1998) reported an average birth weight of Hereford heifers as kg and bulls kg. These are higher weights than shown in the table and those reported by other authors, but they concern calves born to cows from imports. In studies of Trela et al. (1998), the figures were 34.7 and 37.4 kg respectively. Many authors have shown a significant effect of body weight after giving birth to a calf body weight at weaning at the age of 210 days. The highest weight of calves at birth typically have also the highest body weight at the end of the rearing (Przysucha et al. 2002). Przysucha et al. (2002) showed highly significant influence of calf birth

28 Analysis of Hereford beef cattle recording results in Poland 143 TABLE 3. Average body weight of purebred heifers at birth in Body weight (kg) Year N min max average SD 1999* * Regardless of sex. TABLE 4. Average body weight of purebred bulls at birth in Year N Body weight (kg) min max average SD 1999* * Regardless of sex.

29 144 T. Przysucha et al. weight for its later body weight and the size of daily gains for periods of from 1 to 120 and 120 to 210 days of age. Lightest calves at birth (<30 kg) resolved calves with higher birth weight in later periods of fattening and obtained lowest daily gains. Average daily weight gains of purebred calves to 210 days of age are shown in Tables 5 and 6. The presented data show that calves were characterized by one month export the animals weighing about 300 kg at an good price is possible. The gains considerably in excess of the gains of heifers defined in the breeding standard ensure that after weaning with proper nutrition they obtain the required body weight for mating (Przysucha et al. 2005) at the age of 15 months. It should be emphasized that the average daily gains of calves fluctuated considerably TABLE 5. Average daily gains of purebred heifers to 210 days of age Daily gains (g) Year N min max average SD high average body weight gains during the rearing: 876 1,039 g for heifers and 851 1,122 g for bulls within all the years of assessment. It should be noted that since 2009 bulls exceeded a daily gains of 1,000 g. These daily weight gains caused that after short extra supplementary fattening period of about in the last years of assessment. This is confirmed by the high standard deviations. In studies of other authors daily weight gains of Hereford heifers and bulls from birth to 210 days of age were: 914 and 1,012 g respectively (Kamieniecki et al. 1998), and 1,090 and 1,238 g respectively (Trela et al. 1998).

30 Analysis of Hereford beef cattle recording results in Poland 145 TABLE 6. Average daily gains of purebred bulls to 210 days of age Daily gains (g) Year N min max average SD The average body weight of purebred calves at 210 days of age are presented in Tables 7 and 8. The body weights at the time of calves weaning were at the level of kg for heifers and kg for bulls. The studies lead to the conclusion that by the standards of breeding weight at weaning for both heifers and bulls were at medium level. According to other authors, body weight TABLE 7. Average body weight of purebred heifers at 210 days of age in Year N Body weight (kg) min max average SD 1999* * Regardless of sex.

31 146 T. Przysucha et al. TABLE 8. Average body weight of purebred bulls at 210 days of age in Year N Body weight (kg) min max average SD 1999* * Regardless of sex. of Hereford heifers and bulls at the age of 210 days were: 238 and 262 kg respectively (Kamieniecki et al. 1998), and 267 and 301 kg respectively (Trela et al. 1998). Table 9 shows the average milk yield of purebred cows in different years of assessment. As can be seen from the following statement, the minimum milk yield of cows of the breed was about 2,040 kg and the maximum was about 2,196 kg. The data presented should be approached with great caution, because milk yield was calculated based on the weight gain of calves and as we know in the herd calves can always be found TABLE 9. The average milk yield of purebred cows in Year N Estimated milk yield of cows (kg)* min max average SD

32 Analysis of Hereford beef cattle recording results in Poland 147 that approach to other cows and choke or are additionally fed by the breeder. Przysucha et al. (2002) studied the relationship between milk yield of Hereford cows and growth of calves. The highest weight and growth reached calves which mothers had the highest milk yield. The direct relationship of mothers milk yield and calf rearing results indicate many authors, among others: Dobicki (1995), Jasiorowski et al. (1996), Kamieniecki et al. (1998). Table 10 summarizes the terms of cows and heifers calving aptitude analyzed in the coming months in the year in the years Season of birth has a significant impact on the vitality and growth pace of reared calves which directly affects the economic effects of the rearing (Przysucha et al. 2005). In studies of Przysucha et al. (2002) Hereford calves born in the winter season (November to April) showed a slight weight advantage in body weight in all studied periods of life compared to calves born in the summer from May to October. Seasonality in calvings in breeding herds is very important because appropriate term of calving in the future allows to receive breeding material of a very good quality with the least amount of cost of rearing (maximum utilization of pastures). Many authors believe (Dobicki 1996, Jasiorowski et al. 1996) period of mating and the resulting of calving aptitude time should not be longer than 2 3 months. Beef cows maintained all year round in grazing system should make the best offspring in the winter. Calves born in the period after the completion of the first period of milk drinking are prepared to make full use of the pasture then their growth rate is fast calves are healthy and good developed and breeder bear the smallest rearing costs. It should also be noted that in the winter calvings weaning calves moment coincides with the impoverishment of pastures in autumn. the consequence is natural dry- -off pregnant cows. With winter calvings cows mostly deliver in the barn so that it is easier to monitor deliveries and possible assistance in the event of complications. Analyzing the obtained results and assuming that the most favorable period of cows calving aptitude is the period from December to March. It should be noted that from 30.4 to 47.8% of the Polish Hereford cows delivered in recent years during the relevant period cows. It follows that more than half of the calves born at other times of the year only to a small degree can take full advantage of the pasture. Table 11 shows the percentage distribution of calving aptitude of Hereford cows calving order. It should be noted that despite a steady decrease in the population of Hereford cows and cows calving for the second time constituted about 40% of the population. In 2000 there were only nine cows after seven calving and in 2013 already 78 (11.8%). It proves that the life of the cow increases which is of particular economic importance. Long life of cows in herds of beef cattle is one of the main factors allowing for reducing the cost so the breeders should try to use cows as long as possible.

33 148 T. Przysucha et al. TABLE 10. Time of purebred cows and heifers calving in Months Year Unit I II III IV V VI VII VIII IX X XI XII Total N % N % N % N % N % N % N % N % N % N % N % N % N % N % N %

34 Analysis of Hereford beef cattle recording results in Poland 149 TABLE 11. Distribution of the order of calving in Year Unit Order of calving Total 2000 N % N % N % N % N % N % N % N % N % N % N % CONCLUSION Analysis of selected results of the evaluation of British Herefords with respect to their compliance with the breeding goal and standards adopted by the PABPBC shows maintenance of high standards despite the systematic reduction of breeding domestic cattle population of the breed. REFERENCES ANDERSEN B.B. 1978: Animal size and efficiency. with special reference to growth and feed conversion in cattle. Anim. Prod. 27: DICKERSON G.E. 1978: Animal size and efficiency: basic concepts. Anim. Prod. 27: DOBICKI A. 1995: Technologiczne aspekty efektywności produkcji w populacjach mięsnych bydła. Zesz. Nauk. Przeg. Hod. 17:

35 150 T. Przysucha et al. FITZHUGH H.A. 1978: Animal size and efficiency. with special reference to the breeding female. Anim. Prod. 27: JASIOROWSKI H., KIJAK Z., POCZYNAJŁO S., WAJDA S. 1996: Program rozwoju hodowli bydła mięsnego w Polsce. Fundacja Rozwój SGGW, Warszawa: KAMIENIECKI H., WÓJCIK J., SZARKOW- SKI K., SURMACZ F. 1998: Porównanie wyników odchowu cieląt różnych ras mięsnych w Spółdzielczej Agrofirmie Witkowo. Zesz. Nauk. Akademii Rolniczej we Wrocławiu 336: KCHZ : Ocena wartości użytkowej krów oraz ocena i selekcja buhajów. Wyniki za lata Krajowe Centrum Hodowli Zwierząt. MORRIS C.A., WILTON J.W. 1976: The influence of body size on the biological efficiency of cows: A review. Can. Anim. Sci. 56: NOGALSKI Z., KLUPCZYŃSKI J., MICIŃSKI J. 2000: Przebieg porodu. wielkość i żywotność cieląt w zależności od wymiarów ciała krów. Rocz. Nauk. Zoot. 27 (3): PZHiPBM, : Ocena wartości użytkowej bydła ras mięsnych. Wyniki za lata Polski Związek Hodowców i Producentów Bydła Mięsnego. PRZYSUCHA T., CZARNECKI VEL SARNEC- KI M., GRODZKI H., ZDZIARSKI K. 2002: Analiza wpływu wybranych czynników na tempo wzrostu cieląt rasy hereford. Zesz. Nauk. PTZ. 60: PRZYSUCHA T., GRODZKI H., BRZOZOWSKI P., ZDZIARSKI K. 2005: Wpływ wybranych czynników na przebieg porodów krów rasy limousine. Med. Wet. 61 (9): TRELA J., MALINOWSKI E., SUPERA K., PASIERBSKI Z. 1998: Aklimatyzacja bydła rasy hereford w Zootechnicznym Zakładzie Doświadczalnym Kołbacz. Zesz. Nauk. Akademii Rolniczej we Wrocławiu 336: Streszczenie: Analiza wyników oceny użytkowości brytyjskiej rasy hereford w Polsce. Celem pracy była analiza wybranych wyników oceny użytkowości angielskiej rasy hereford w odniesieniu do ich zgodności z celem hodowlanym i standardami rasowymi przyjętymi przez Polski Związek Hodowców i Producentów Bydła Mięsnego (PZHiPBM). Przedmiotem analiz były wyniki oceny użytkowości francuskiej rasy bydła mięsnego hereford w Polsce. W opracowaniu wykorzystano dane Krajowego Centrum Hodowli Zwierząt (KCHZ) za lata oraz PZHiPBM za lata Zbiór danych obejmował: N liczbę badanych zwierząt, min. minimalne wartości w badanej cechy, max. maksymalne wartości badanej cechy, średnia uśrednione wartości badanej cechy, SD odchylenie standardowe. Oceniane cechy to: średnie masy ciała krów (kg), średnie masy ciała cieląt po urodzeniu (kg), średnie przyrosty dobowe do wieku 210 dni (g), średnie masy ciała cieląt w wieku 210 dni (kg), średnia mleczność krów (kg), terminy ocieleń krów i jałowic, rozkład populacji krów według kolejności ocielenia. Od 2001 roku widać wyraźny systematyczny spadek udziału tej rasy w żeńskiej populacji bydła mięsnego. Spadek ten dotyczy zarówno populacji czystorasowej, jak i mieszańców. Analiza wyników oceny użytkowości przedstawia, iż średnie masy ciała krów nie odbiegają od mas założonych w celu hodowlanym. Średnie masy ciała cieląt czystorasowych po urodzeniu, które nie zmieniają się znacząco w ciągu 15 lat prowadzenia oceny. Większą masą urodzeniową wykazały się buhajki, osiągając wagę 35,4 kg. Różnicą między buhajkami a jałówkami wynosiła 3,4 kg. Cielęta charakteryzowały się dużymi średnimi przyrostami w okresie odchowu: g dla cieliczek i g dla buhajków w ciągu wszystkich lat prowadzenia oceny. W polskich stadach bydła hereford cieliło się w ostatnich latach we właściwym okresie od 30,9 do 46,9% krów. Wynika z tego, że ponad połowa cieląt urodzonych w innych okresach roku jedynie w nieznacznym stopniu może w pełni korzystać z pastwiska. Mimo systematycznego zmniejszania populacji krów rasy hereford pierwiastki i krowy cielące się po raz drugi stanowią około 40% populacji. W 2000 roku tylko dziewięć krów było po siódmym ocieleniu, a w 2013 roku było ich już 78 (11,8%). Słowa kluczowe: bydło mięsne, rasa hereford, ocena użytkowości bydła mięsnego

36 Analysis of Hereford beef cattle recording results in Poland 151 MS received November 2015 Authors address: Tomasz Przysucha Zakład Hodowli Bydła Katedra Szczegółowej Hodowli Zwierząt Wydział Nauk o Zwierzętach SGGW ul. Ciszewskiego 8, Warszawa Poland tomasz_przysucha@sggw.pl

37 Annals of Warsaw University of Life Sciences SGGW Animal Science No 54 (2), 2015: (Ann. Warsaw Univ. of Life Sci. SGGW, Anim. Sci. 54 (2), 2015) Effect of the backfat thickness at point P 2 during insemination on the selected parameters of colostrum and milk of the sows ANNA REKIEL 1, JUSTYNA WIĘCEK 1, BEATA KUCZYŃSKA 1, JUSTYNA BARTOSIK 1, AGNIESZKA WARDA 2, KATARZYNA FURMAN 1 1 Department of Animal Breeding and Production, Warsaw University of Life Sciences SGGW 2 Polish Pig Breeders and Producers Association POLSUS Abstract: Effect of the backfat thickness at point P 2 during insemination on the selected parameters of colostrum and milk of the sows. The studies included 32 females F1 (PL PLW), inseminated with the semen from Duroc boars. The females were assigned to two groups: L lean sows: P 2 18 mm at mating (n = 16 heads), and F fat sows: P 2 >18 mm (n = 16 heads). The observations were carried on from the day of effective mating/insemination throughout the period of gestation and nutrition until weaning (35 th day of lactation). Fatness of the sows (measurements of backfat thickness at points P 2 and P 4 ) and their muscling (height of M. longissimus dorsi at point P 4 M) at mating and in high pregnancy (104 th ±1 2 day of gestation) were controlled. The samples of colostrum and milk were collected from all sows (64 samples in total). Basic chemical compositions, somatic cell count SCC, and active acidity ph, were determined. Thickness of backfat at point P 2 did not have any influence on chemical composition of colostrum and milk, SCC and ph; in spite of it. The control of the sows condition is justified as there was indicated a significant difference (P 0.05) in the content of lactose (21 st day) in favour of group F vs group L (0.56 percentage points). The mentioned result indicates the need of continuing the studies because lactose is a valuable, easily assimilated component of mother feed for the newborns. Key words: sows, backfat P 2, quality of colostrum and milk INTRODUCTION Lactation a part of lactation cycle, being understood as process of synthesis and production and secretion of milk by mammary glands of the females is the important factor of the mammals evolution (Rekiel 2003). The composition of milk was described in the XIX century (Rekiel 2006). Since the mentioned period, many publications dedicated to the composition and nutritive value of milk and to the factors affecting the level of milk production by the sows have appeared in scientific literature (Migdał et al. 2000, 2003, Rekiel 2003, 2006, Beyer et al. 2007, Beyga and Rekiel 2009, Farmer and Quesnel 2009, Rekiel et al. 2011, King ori 2012, Szyndler-Nędza et al. 2013). Fat reserves (backfat thickness at P 2 and P 4 ) constitute the background for evaluation of the sows condition in five-score BCS scale (Body Condition Scoring), being a tool which enables the correct management of the herd (Rekiel and Beyga 2008, Bowker 2013). The quality and quantity of the produced colostrum and milk are dependent, i.a., on the condition, determined by protein

38 154 A. Rekiel et al. and fat reserves in the body (Beyga and Rekiel 2009, King ori 2012). Klavier et al. (1981) found that the sows, which were heavier in parturition day as compared to the lighter ones, produced by 19% more milk during the first 12 days of lactation; the relationship of productivity and body weight was confirmed by King and Eason (1998). Beyga and Rekiel (2009) and Rekiel et al. (2011) demonstrated that the milk of the sows being in a good condition contained more fat and inconsiderably more calcium and phosphorus what progressively affected the rate of growth of the progeny. In the studies, there was also stated that the body weight and fatness and the dynamics of changes in fat reserves affected the pregnancy retention and reproduction performance (Walkiewicz et al. 1994, Koczanowski et al. 2000, Beyga and Rekiel 2009). Walkiewicz et al. (1994) found that in the case of the gilts with thicker backfat at mating (>15 mm) as compared to those ones with lower fat reserves (<15 mm), the level of fat in the milk was higher (on the 11 th day of lactation by 1%). The domination was maintained during throughout the whole lactation, revealing, however, a decreasing tendency (on 21 st and 42 th day, the mentioned difference was equal to 0.4 and 0.1%, respectively). Similar differences and changes were recorded for dry solids content. The content of ash, protein and lactose was little differentiated. In the case of more fattened gilts, as compared to more lean ones, the level of unsaturated fatty acids C 16:1 and C 18:2 was higher. The aim of the studies was to determine the effect of fat reserves (thickness of backfat at P 2 at mating/insemination) on the selected parameters of colostrum and milk of the sows of hybrids F1 (Polish Landrace Polish Large White), i.e. basic chemical composition, active acidity (ph) and somatic cell count (SCC). MATERIAL AND METHODS The studies included 32 sows F1 (PL PLW), inseminated with the semen from Duroc boars. The females were assigned to two groups: L lean sows: P 2 18 mm at mating (n = 16 heads), and F fat sows: P 2 >18 mm (n = 16 heads). The measurements of the backfat thickness and M. longissimus dorsi (MLD) in the sows were conducted at mating and in high pregnancy (104 th ±1 2 day of gestation), using Pig-log 105 equipment according to method for evaluation of life performance of breeding animals (Eckert and Adamczyk 1993, Regulation of the Minister of Agriculture and Food Economy, Dz.U nr 47, poz. 470, Regulation of the Minister of Agriculture and Rural Development, Dz.U nr 169, poz. 1389). The observations were carried on from the day of effective mating/insemination throughout the period of gestation and nutrition until weaning (35 th day of lactation). The intake of feed by the sows and fatness (at points P 2 and P 4 ) and musculature (height of MLD at P 4 M) were controlled. The samples of colostrum and milk were collected from the sows and evaluated (basic chemical composition, somatic cell count SCC,

39 Effect of the backfat thickness at point P 2 during and active acidity ph (64 samples in total). During the experiment, the sows were fed individually with the full-ration mixture pregnant sow (LP sow in gestation) and suckled sow (LK sow in lactation) Table 1, in accordance with the Polish nutrient requirements for pigs (1993). The mentioned mixtures were prepared from maize and wheat meal, wheat bran and protein concentrate. The sows were kept in grouped pen from fourth week after insemination but the feed was administrated individually in feeding station, controlled by computer. The additional feeding of piglets with the mixture prestarter 5864 MPU 4% (ad libitum) was commenced at the end of the first week of life; after 3 4 weeks of rearing the mixture starter was introduced (Table 1). TABLE 1. Basic composition of the mixtures, employed in feeding of sows and piglets Mixtures Mixtures Basic composition for sows for piglets Prestarter (%) LP LK Starter Dry matter Crude ash Crude protein Crude fat Crude fibre The sows were kept for three weeks in individual pens and then, in groups. Ten days before farrowing, they were transported to three-part parturition pens in which they stayed until weaning of piglets at the age of five weeks. The animals were supervised by veterinary surgeon and the piglets were subjected to standard care treatment. The basic analyses of the mixtures were performed according to AOAC procedures (2006). Colostrum was sampled from the sows in the day of parturition and the milk samples were collected on the 21 st day of lactation, in the quantity of 50 ml/head, to the containers with preservative (Mlekostat CC). Before collecting the samples, the sows obtained oxytocin in injections (1 ml/100 kg body weight). For determination of somatic cell count (SCC) in colostrum and milk, Somacount 150 instrument by Bentley company, was employed. For determination of dry matter, protein, fat and lactose content by spectrophotometric method in infrared, the apparatus Milkoscan FT 120 by Foss Electric was used. For determination of active acidity (ph) the ph-meter ph 211 was employed. The results were statistically developed with utilization of package SPSS Statistics 21. The normality of distribution was checked by Shapiro-Wilk test. Somatic cell count was subjected to logarithmic transformation. The differences between the groups were checked by t-student test (traits with a normal distribution) or U Mann-Whitney test (the remaining traits). RESULTS AND DISCUSSION The reserves of lipids (measurements of backfat thickness in points P 2 and P 4 ) and of protein (height of M. longissimus dorsi at point P 4 M) and evaluated life performance of meatiness are given in Table 2. The opinions on the thickness of backfat in gilts at the first mating are different.

40 156 A. Rekiel et al. TABLE 2. Thickness of backfat at points P 2 and P 4 and of M. longissimus dorsi at P 4 M and the assessed meatiness Group of sows Significance Traits lean fat between the x SEM x SEM groups Mating P ** P 4 mm ** P 4 M ns Meatiness % ** 104 th day of gestation P ns P 4 mm ** P 4 M ns Meatiness % * *Significant at P 0.05, **significant at P 0.001, ns differences statistically insignificant. Dupas and Briend (1997) and Whittemore et al. (1995), after Grzyb et al. (2007), stated that the thickness of backfat in point P 2 should be equal to 15 mm; according to Tummaruk et al. (2007), after Grzyb et al. (2007), for the gilts of hybrids, it should amount to mm; and for the gilts of crossbreds of national breeds (PL PLW) mm (Rekiel et al. 2000). Besides it, Rekiel (2002) stated that at commencing the reproduction performance, the mean thickness of back fat should not be less than 16 mm. From the own studies, it is followed that the sows from group L had the mean thickness of backfat at point P 2 somewhat lower (by 0.98 mm) than the recommended one (Table 2). The meatiness of the sows from group L vs group F differed significantly (P 0.001). Łyczyński et al. (2000), after Grzyb et al. (2007), informs that the improvement of meatiness causes decline of reproduction effectiveness. Rekiel and Więcek (2002a) revealed, however, that the gilts with a lower meatiness as primiparas delivered and reared more numerous litters. The results of the studies of Beyga and Rekiel (2009) and Szyndler-Nędza et al. (2013) confirmed the relationship of the sow s condition and the reproduction traits and milk performance of the females and rearing of their progeny. In the own studies, differences in fatness and muscling were maintained in the sow groups L and F (comparative evaluation of the results of the studies from first and 104 th day of gestation) what confirms the stability of lipid and protein reserves in their bodies. In case of the differentiation of the sows condition in groups F and L, any differences in basic composition and in somatic cell count (SCC and log SCC) and colostrum, as being statistically confirmed, were not found. All evaluated milk parameters in F and L groups of the sows were similar, except for the level of lactose. The content of lactic sugar was significantly (P 0.05) higher in milk of

41 Effect of the backfat thickness at point P 2 during the sows from group F as compared to group L (difference equal to 0.56 percentage point p.p.). The mentioned result is different than those ones obtained by Walkiewicz et al. (1994) and Revell et al. (1998) who recorded lower content of lactose in the milk of more fattened sows. The milk contained more lactose than colostrum in the group of the lean sows (by 1.72 p.p.) and the group of fat sows by 2.60 p.p. (Migdał et al. 2000, 2003). Paściak et al. (2003), Renaudaeu et al. (2003) inform that the level of lactose remained relatively stable and that one of dry matter, fat and protein varied. The results of the studies of Beyga and Rekiel (2009) indicate that the level of lactose in colostrum and milk of the sows which differed in fat reserves in high pregnancy stage (before parturition) was similar. As it was given by the cited authors, the level of lactose in colostrum was lower than in the milk and it was equal to about 3.5%; the results of the own studies are comparable with the cited literature. The level of lactose may become little increased during lactation. It is an important fact because it is the component of mother feed, being very well digested and assimilated by the piglets; it was revealed in the studies (Beyga and Rekiel 2009, King ori 2012, Szyndler-Nędza et al. 2013) that the quality of colostrum and milk affected the results of the progeny rearing. Migdał et al. (2000, 2003), Rekiel (2003, 2006) and Beyga and Rekiel (2009) informed that the milk of the sows was characterized by a high content of fat (about 7%). Fat of colostrum (considerably lower quantity than in milk) is valuable due to the higher participation of unsaturated fatty acids UFA). In the own studies, any significant differences between the sow groups F and L in respect of fat content in colostrum as well as in milk were not found; it is the result being different than that one obtained by Beyga and Rekiel (2009). As compared to milk, the colostrum samples, collected from the sows, contained less fat, irrespectively of the group. The mentioned result was consistent with the literature data (Migdał et al. 2000, 2003, Beyga and Rekiel 2009). In the case of healthy sows, ph of colostrum is equal to ; acidity of milk increases during the successive days after completion of parturition and reaches the level of 6.6 (Rekiel 2003). In the both examined groups of the sows, the acidity was correct (Table 3). Values for SCC and log SCC in colostrum and milk, as obtained in the own studies are comparable with the results of the studies of other authors (Rekiel and Więcek 2002b, Rekiel 2003, Beyga and Rekiel 2009). Values of SCC of the healthy sows should not exceed /ml. The result below /ml is recognized as correct although indicating the possibility of incidence of subclinical inflammatory state. Values of SCC on the level of /ml, being supplemented by the results of other diagnostic tests, constitutes the background for the diagnosing the inflammatory state MMA (Rekiel 2003).

42 158 A. Rekiel et al. TABLE 3. Chemical, physical and cytological parameters of colostrum and milk of the sows Group of sows Significance Trait lean fat between the x SEM x SEM groups Colostrum Dry matter ns Solids-not-fat ns Fat % ns Protein ns Lactose ns SCC ns SCC Logarithm ns Milk Dry matter ns Solids-non-fat ns Fat % ns Protein ns Lactose * SCC ns SCC logarithm ns ph ns *Significant at P 0.05, ns differences statistically insignificant. The obtained results of the studies confirm the justness of controlling the fat reserves in the reproduction managed sows, constituting the background for assessment of condition, in spite of the fact that the effect of fatness of females on the content of basic constituents of colostrum and milk was not found. In case of higher fat reserves in body of the sows, only a significant increase of lactose content in milk was recorded. of lactose in favour of group F vs group L (0.56 p.p.). The mentioned result indicates the need of continuing the studies as lactose is a valuable, easily assimilated component of mother feed for the newborns. Acknowledgements Source of research financing: author s project of the State Committee for Scientific Research, project N N and DS. CONCLUSIONS Fat reserves at mating (backfat thickness at point P 2 ) did not have any effect on chemical composition of colostrum and milk, SCC and ph; in spite of it, the control of the sows condition seems to be justified as there was indicated a significant difference (P 0.05) in the content REFERENCES AOAC 2006: Official Methods of Analysis of the Association of Official Analytical Chemists. 17th edn., Arlington, Virginia, USA. BEYER M., JENTSCH W., KUHLA S., WIT- TENBURG H., KREIENBRING F., SCHOL- ZE H., RUDOLPH P.E., METGES C.C. 2007: Effects of dietary energy intake during gestation and lactation on milk yield and composi-

43 Effect of the backfat thickness at point P 2 during tion of first, second and fourth parity sows. Arch. Anim. Nutr. 61 (6): BEYGA K., REKIEL A. 2009: Effect of the backfat thickness of sows in late pregnancy on the composition of colostrum and milk. Arch. Anim. Breed. 52: BOWKER B.C. 2013: Meat science and muscle biology symposium: in utero factors that influence postnatal muscle growth, carcass composition, and meat quality. J. Anim. Sci. 91: DUPAS M., BRIEND K. 1997: Aktualne problemy związane z żywieniem loch. Trzoda Chlewna 4: ECKERT R., ADAMCZYK J. 1993: Ocena przyżyciowa młodych knurków. Stan hodowli i wyniki oceny świń. Instytut Zootechniki XI, Kraków. FARMER C., QUESNEL H. 2009: Nutritional, hormonal and environmental effects on colostrum in sows. J. Anim. Sci. 87: GRZYB M., REKIEL A., WIĘCEK J., 2007: Wpływ przyrostu dziennego, otłuszczenia i mięsności oszacowanych przyżyciowo loszek rasy pbz na ich użytkowość rozpłodową. Rocz. Nauk. Pol. Tow. Zoot. 3 (2): KING R.H., EASON P.J. 1998: The effect of body-weight of sows on the response to dietary lysine during lactation. J. Anim. Sci. 76 (Suppl. 1): 162 (Abstr.). KING ORI A.M. 2012: Sow lactation: colostrum and milk yield a Review. J. Anim. Sci. Adv. 2 (6): KLAVER J., VANKEMPEN G.J.M., DELANGE P.G.B., VERSTEGEN M.W.A., BOER H. 1981: Milk composition and daily yield of different components as affected by sow condition and lactation feeding regiment. J. Anim. Sci. 52: KOCZANOWSKI J., MIGDAŁ W., KLO- CEK CZ., STAWARZ M. 2000: Wpływ otłuszczenia loszek przed pierwszym pokryciem na ich użytkowość rozpłodową. Biul. Nauk. 7: ŁYCZYŃSKI A., BARTKOWIAK Z., POS- PIECH E., URBANIAK M. 2000: Wpływ wybranych cech oceny przyżyciowej na użytkowość rozpłodową loch. Biul. Nauk., UWM Olsztyn 7: MIGDAŁ W., PIESZKA M., BAROWICZ T., PI- ETRAS M. 2003: Chemical composition of colostrum and milk of sows receiving CLA in feed. Med. Wet. 59: MIGDAŁ W., ŽIVKOVIČ B., FABIAN M. 2000: Chemical composition of colostrum and milk in lactation of sows. Biotechnol. Anim. Husb. 17: PAŚCIAK P., MIGDAŁ W., WOJTYSIAK D., POŁTOWICZ K. 2003: Skład chemiczny siary i mleka loch JSR. Rocz. Nauk. Zoot. 17: Polish nutrient requirements for pigs, Instytut Fizjologii i Żywienia Zwierząt PAN w Jabłonnej. Omnitech Press, Warszawa. REKIEL A. 2000: Cykl laktacyjny u lochy. Medycyna Wet. 56 (3): REKIEL A. 2002: Wpływ odmiennych technik zasuszania na poziom rezerw tłuszczowych i wyniki reprodukcji. Wyd. SGGW, Warszawa. REKIEL A. 2003: Wybrane aspekty fizjologiczne i produkcyjne laktacji u lochy. Acta Sci. Pol. Zootechn. 2 (2): REKIEL A. 2006: Fizjologiczne i zdrowotne aspekty laktacji u loch. Post. Nauk Rol. 2: REKIEL A., BEYGA K. 2008: Kondycja loch i jej ocena. Przegl. Hod. 9: REKIEL A., WIĘCEK J. 2002a: Wpływ otłuszczenia, umięśnienia i masy ciała loszek przy pierwszym pokryciu na ich dalszą użytkowość rozpłodową. Prace i Mat. Zoot. Zesz. Spec. 13: REKIEL A., WIĘCEK J. 2002b: Związek między liczbą komórek somatycznych a zawartością wybranych makroskładników w mleku loch. Medycyna Wet. 58 (11): REKIEL A., WIĘCEK J., BEYGA K. 2011: Analysis of the relationship between fatness of late pregnant and lactating sows and selected lipid parameters of blood, colostrum and milk. Ann. Anim. Sci. 11 (4): RENAUDAEU D., NOBLET J., DOURMAND J.Y. 2003: Effect of ambient temperature on mammary gland metabolism in lactating sows. J. Anim. Sci. 81:

44 160 A. Rekiel et al. REVELL D.K., WILLIAMS I.H., MULLAN B.P., RANFORD J.L., SMITS R.J. 1998: Body composition at farrowing and nutrition during lactation affect the performance of primiparous sows. I. Voluntary feed intake, weight loss and plasma metabolites. J. Anim. Sci. 76: Rozporządzenie Ministra Rolnictwa i Gospodarki Żywnościowej z dnia 5 maja 1999 r. w sprawie zakresu i metod prowadzenia oceny wartości użytkowej i hodowlanej zwierząt oraz sposobu oznakowania i identyfikacji zwierząt do celów hodowlanych Dz.U. 1999, nr 47, poz Rozporządzenie Ministra Rolnictwa i Rozwoju Wsi z dnia 26 września 2002 r. zmieniające rozporządzenie w sprawie zakresu i metod prowadzenia oceny wartości użytkowej i hodowlanej zwierząt oraz sposobu oznakowania i identyfikacji zwierząt do celów hodowlanych. Dz.U. 2002, nr 169, poz SZYNDLER-NĘDZA M., RÓŻYCKI M., ECK- ERT R., MUCHA A., KOSKA M., SZULC T. 2013: Relationships between chemical composition of colostrum and milk and rearing performance of piglets during a 21-day lactation. Ann. Anim. Sci. 13 (4): TUMMARUK P., TANTASUPARUK W., TECHAKUMPHU M., KUNAVONGKRIT A. 2007: Age, body weight and backfat thickness at first observed oestrus in crossbred Landrace Yorkshire gilts, seasonal variations an their influence on subsequence reproductive performance. Anim. Reprod. Sci. 99 (1 2): WALKIEWICZ A., WIELBO E., KAMYK P., STASIAK A., 1994: Wpływ rozwoju somatycznego loszek na początkową rozrodczość, zdolność laktacyjną i skład chemiczny mleka. Ann. UMCS, Lublin Polonia, EE 12, 12: WHITTEMORE C.T., ETIENNE M., DOUR- MOND J.Y. 1995: Nutrition and body condition in relation to productivity. 46th Ann. Meet. EAAP, Prague, 4 7 September, P 4.5, 331. Streszczenie: Wpływ grubości słoniny w punkcie P 2 przy inseminacji na wybrane parametry siary i mleka loch. Badaniami objęto 32 samice F1 (pbz wbp), inseminowane nasieniem knurów rasy duroc. Lochy przydzielono do grupy L (chude), o średniej grubości słoniny w punkcie P 2 18 mm (n = 16 sztuk) lub grupy F (grube), o P 2 >18 mm (n = 16 sztuk). Obserwacje prowadzono od dnia skutecznego pokrycia/inseminacji loch, przez okres ciąży i odchowu potomstwa, do odsadzenia prosiąt w 35. dniu odchowu. Kontrolowano otłuszczenie loch (pomiary grubości słoniny w punktach P 2 i P 4 ) i ich umięśnienie (wysokość mięśnia najdłuższego grzbietu w punkcie P 4 M) przy pokryciu oraz w ciąży wysokiej (104 ±1 2 dzień ciąży). Od wszystkich loch pobrano próby siary i mleka (łącznie 64 próby). Określono podstawowy skład chemiczny, liczbę komórek somatycznych LKS oraz kwasowość czynną ph. Grubość słoniny w punkcie P 2 nie miała wpływu na skład chemiczny siary i mleka, LKS i ph, mimo to kontrola kondycji loch jest zasadna. Wykazano bowiem istotną różnicę (P 0,05) w zawartości laktozy w mleku (21. dzień) na korzyść grupy F względem grupy L (0,56 p.p.). Wynik ten wskazuje na potrzebę kontynuacji badań, gdyż laktoza jest wartościowym, łatwo przyswajalnym składnikiem pokarmu matczynego dla noworodków. Słowa kluczowe: lochy, słonina w punkcie P 2, jakość siary i mleka MS received November 2015 Author s address: Anna Rekiel Zakład Hodowli Trzody Chlewnej Katedra Szczegółowej Hodowli Zwierząt Wydział Nauk o Zwierzętach SGGW ul. Ciszewskiego 8, Warszawa Poland anna_rekiel@sggw.pl

45 Annals of Warsaw University of Life Sciences SGGW Animal Science No 54 (2), 2015: (Ann. Warsaw Univ. of Life Sci. SGGW, Anim. Sci. 54 (2), 2015) Diatomaceous earth in the prevention of worm infestation in purebred pigeons MAŁGORZATA WIEWIÓRA 2, MONIKA ŁUKASIEWICZ 1, JUSTYNA BARTOSIK 3, MATEUSZ MAKARSKI 4, TOMASZ NIEMIEC 4 1 Department of Animal Breeding and Production, Warsaw University of Life Sciences SGGW 2 Faculty of Animal Sciences, Aves Scientific Circle 3 Department of Preclinical Sciences, Warsaw University of Life Sciences SGGW 4 Department of Animal Nutrition and Biotechnology, Warsaw University of Life Sciences SGGW Abstract: Diatomaceous earth in the prevention of worm infestation in purebred pigeons. The aim of the study was to determine the effectiveness of diatomaceous earth in the prevention of worm infestation in purebred pigeons and forms of its application. Diatomaceous earth (diatomite) was given to pigeons in the province of Mazovia. The following pigeon breeds were used in the experiment: motyl warszawski, białoogon białolot berliński, szpak i mewka. An addition of the natural mineral at 2% of the daily dose of feed was given for three weeks in 10 dovecotes. The pigeons were divided into two groups. The Group I comprised 150 birds in five dovecotes. These birds were given grain (feed mix for pigeons, made by Kampol) plus diatomite mixed with a mineral additive (mineral complementary feed, made by Biowet). Group II comprised 150 birds in the other five dovecotes. These birds were given grain (feed mix for pigeons, made by Kampol) mixed with diatomite. The experiment found that the number of parasite eggs in the group I was reduced after a week following the application of diatomite, whereas the number of Capillaria nematode eggs and the proportion of Eimeria coccidia oocysts decreased considerably in group II. Key words: Diatomaceous earth (diatomite), parasites, pigeons INTRODUCTION Purebred pigeons are kept by a number of breeders and hobbyists and they have many admirers and enthusiasts around the world. However, the birds are susceptible to infestation by parasites, which poses many problems for their owners. Breeders must struggle with both internal and external pigeon parasites, which frequently cause permanent damage or death to the birds. Parasitic diseases are also an underlying cause of many other diseases, mainly infectious ones. Moreover, pathogens transmitted by pigeons can pose a potential threat to human health or life. It is important from a breeder s perspective to have not only an efficacious drug against the parasitoses already detected, but also to have some preventive measures ready. There are several de-worming products for pigeons, but these are synthetic substances. Synthetic drugs are not usually neutral to the bird s body, they weaken it and have a negative effect on the internal organs (liver) and breeding performance. The optimal solution for pigeon owners would be a natural product which is non-invasive and can effectively prevent parasitic diseases. Amorphous diatomaceous earth of freshwater origin is a proposed product that meets these criteria.

46 162 M. Wiewióra et al. Diatomaceous earth (Fig. 1), or diatomite, are fossilised remnants of shells of diatoms, which were microscopic unicellular algae living in water several FIGURE 1. Diatomaceous earth ( wikiwand.com/pl/ziemia_okrzemkowa,2015) million years ago which formed layers of organogenic rocks when the water bodies dried out. Shells of diatoms in diatomaceous earth are made mainly from silicon dioxide (SiO 2 ) and trace amounts of other minerals. Consumed by humans or animals, they pass through the gastrointestinal tract, with small amounts being absorbed to the bloodstream as orthosilicic acid (H 4 SiO 4 ). Moving along the digestion tract, diatom shells destroy parasites and their eggs along their way and they are subsequently excreted. This is a physical process, the rough surface of the shells rubs against the parasites bodies, damaging them and causing their death. Additionally, cylindrical shells of diatoms have pores which absorb water from the environment, which dehydrates pathogen bodies and ultimately kills them. Diatoms are not identical in all deposits of diatomaceous earth. Deposits of freshwater origin are characterised by a stable content of diatoms with permanent (cylindrical), durable shells. Saltwater deposits contain a mixture of different diatom types, with different shapes and their fossilised shells are relatively brittle. The constant composition and durable structure of diatomaceous earth are important for its effectiveness. An important aspect is that usable diatomaceous earth is amorphous, i.e. non-crystalline. Crystalline silica has very hard, sharp and relatively thick particles, which are harmful to the walls of the gastrointestinal tract in humans and animals and it is used, for example, in filtration systems. Amorphous silica is gentler, it rubs against the walls of the digestive tract with no damage (Haney 2015). The amorphous form of diatomaceous earth is commonly used in the USA in agriculture and in animal breeding, e.g. as an anti-caking agent added to fodders and a product for controlling internal and external parasites in farm animals (Quartes 1992, Fields 2000, Dawson 2004, Maurer et al. 2009). The aim of the study was to determine the effectiveness of diatomaceous earth in the prevention of worm infestation in purebred pigeons and forms of its application. MATERIAL AND METHODS Amorphous diatomaceous earth from freshwater deposits of Melosira preicelanica human- and animal-consumable grade diatoms obtained from the purest source available in the USA, according to the Food and Drug Administra-