Genetyka człowieka. Podstawy

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "Genetyka człowieka. Podstawy"

Transkrypt

1 Genetyka człowieka Podstawy 1

2 Fenotypy badane w genetyce człowieka W większości choroby jednogenowe (Mendlowskie) wieloczynnikowe nowotwory (mutacje somatyczne) zaburzenia chromosomowe Inne cechy (elementy zmienności prawidłowej) jednogenowe (rzadko) markery molekularne wieloczynnikowe np. inteligencja, cechy behawioralne Badania obserwacyjne, nie eksperymentalne zasada największej wiarygodności 2

3 MONOGENOWE CZYNNIKI GENETYCZNE DZIEDZICZENIE MENDLOWSKIE NIEPEŁNA PENETRACJA GENU DZIEDZICZENIE WIELOCZYNNIKOWE Z DOMINACJĄ POJEDYNCZEGO LOCUS DZIEDZICZENIE WIELOCZYNNIKOWE POLIGENOWE 3 CZYNNIKI ŚRODOWISKOWE

4 Zależność wystąpienia objawów od wieku Zaburzenia chromosomowe ciąża i tuż po urodzeniu Monogenowe ciąża i dzieciństwo Wieloczynnikowe często też w późniejszym wieku (wpływ środowiska, stylu życia) Gelehrter, Collins, Ginsburg: Principles of Medical Genetics, Williams & Wilkins, Baltimore

5 Odziedziczalność Za każdy fenotyp odpowiada interakcja genotypu ze środowiskiem Odziedziczalność:proporcja zmienności fenotypowej wyjaśnianej zmiennością genetyczną w populacji badania bliźniąt Monozygotyczne (MZ) vs. dizygotyczne (DZ) badania adopcji agregacja rodzinna częstość objawów u krewnych I stopnia przewyższa obserwowaną u dalszych krewnych i osób niespokrewnionych 5

6 Badania bliźniąt - statystyka Model ACE: trzy składowe: A (additive genetics) suma czynników genetycznych C (common environment) wspólne środowisko E (unique environment) różnice środowiska Bliźnięta monozygotyczne: wspólne geny (A) i środowisko (C) korelacja (r MZ ) szacuje A+C; E = 1 - r MZ Bliźnięta dizygotyczne: wspólne 50% genów i środowisko korelacja (r MZ ) szacuje ½A + C Stąd: r MZ = A + C r DZ = 1 2 A + C A = 2(r MZ r DZ ) 6

7 Badania bliźniąt Przykład Wikimedia Commons 7

8 Agregacja rodzinna Choroby afektywne (ostre cykliczne zaburzenia nastroju) jednobiegunowa (epizody depresyjne) dwubiegunowa (epizody maniakalne i depresyjne) Choroba jednobiegunowa ryzyko w populacji ~3 % (mężczyźni) ~5-9% (kobiety) krewni I stopnia osoby chorej ryzyko ~10% stosunkowo mała odziedziczalność Choroba dwubiegunowa ryzyko w populacji ~1% krewni I stopnia osoby chorej ryzyko ~ 20% istotna odziedziczalność 8

9 Cechy jednogenowe Prosty wzór dziedziczenia Bardzo wysoka odziedziczalność (często ~100%) Oprócz chorób nieliczne cechy o charakterze anegdotycznym zdolność do zwijania języka w trąbkę, odstający płatek uszny, smak PTC, itp. markery immunologiczne (grupy krwi) układ AB0, czynnik Rh markery molekularne 9

10 Choroby jednogenowe Znanych jest bardzo wiele chorób jednogenowych ~4500, z tego dla ~1700 nieznany gen Większość jest bardzo rzadka (najczęstsze ~1/1000-1/2000 urodzeń) problem chorób sierocych (orphan diseases) W sumie ~4/1000 żywych urodzeń Autosomalne ~4100 chorób, z tego ~1600 nieznany gen Sprzężone z X ~ 360 chorób, z tego ~140 nieznany gen Sprzężone z Y 9 chorób, z tego 5 nieznany gen Mitochondrialne 10

11 Analiza rodowodów 11

12 Autosomalne, recesywne Chorzy najczęściej mają zdrowych rodziców (heterozygotyczni nosiciele) Często pojedyncze przypadki w rodzinach Ryzyko rośnie w przypadku związków krewniaczych 12

13 Jednogenowe autosomalne choroby krwi Talasemie mutacje null i hipomorficzne w genach globin (np. defekty splicingu) najczęstsze choroby jednogenowe występują głównie w populacjach śródziemnomorskich (do 10% w niektórych populacjach) i u Arabów, także w Azji Anemia sierpowata 1/500 urodzeń u Afroamerykanów Wysoka częstość w populacjach z obszarów malarycznych oporność na malarię heterozygot 13

14 Choroby jednogenowe krwi na świecie 14 World Health Organization

15 β-talasemia defekt składania Exon 1 Exon 2 Exon 3 Exon Exon 2 β654 Exon 3 3 ss 5 ss 3'ss (572) UCUUUCAG GGCAAUAAUGAUACAAUGUAUCAUGCCUCUUUGCACCAUUCUAAAGAAUAACAG (629) (630) UGAUAAUUUCUGGGUUAAG GCAAUAGCAAUAUUUCUGCAUAUAAAUAUUUCUGCAUAUAAAU (695) 15 β-654: C -> U tworzy nowe miejsce styku 5 Rys. dr Zbigniew Domiński, University of North Carolina at Chapel Hill

16 β-talasemia defekt składania Exon 1 Exon 2 Exon 3 Splicing Exon 1 Exon 2 Exon 3 Białko Translacja Β-globin 16 Rys. dr Zbigniew Domiński, University of North Carolina at Chapel Hill

17 Terapia składania? 17

18 Mukowiscydoza Najczęstsza choroba autosomalna recesywna w populacjach Europy północnej ~1/2000 urodzeń Mutacje utraty funkcji genu CFTR 70% delecja jednego aminokwasu, zaburzenia transportu białka do błony 15% - mutacje częste (kilkanaście) 15% - mutacje rzadkie Wikimedia Commons 18

19 Choroba Tay-Sachsa Silna zależność populacyjna u Żydów aszkenazyjskich 1 osoba na 30 jest nosicielem, w innych grupach 1 na 300 podobnie wysoka częstość u Kanadyjczyków pochodzenia francuskiego (inna mutacja niż u Aszkenazyjczyków) i Cajunów w USA Defekt enzymu (heksozaminidaza A) akumulacja gangliozydów (związki lipidowe) w neuronach neurodegeneracja śmierć ok. 4 r. ż. 19

20 Przyczyny wysokiej częstości allelu recesywnego w populacji Efekt założycielski Izolowane populacje wywodzące się z małych grup Przewaga heterozygot Talasemie, anemia sierpowata - malaria Mukowiscydoza: większa oporność na enterotoksyny bakteryjne (np. cholera) Choroba Tay-Sachsa: wyższa inteligencja heterozygot?? kontrowersyjna teoria Kompensacja rodzicielska Rodzice, którzy utracili dziecko chętniej decydują się na kolejne 20

21 Autosomalne, dominujące Występują w każdym pokoleniu Fenotyp homozygot często cięższy niż heterozygot Duży udział mutacji de novo Czynniki zmieniające wzór dziedziczenia zmienna penetracja zmienna ekspresyjność 21

22 Rodzinna hipercholesterolemia Dominacja przez haploinsuficjencję Mutacje w genach LDLR (receptor LDL low density lipoprotein) i ApoB (apolipoproteina B część kompleksu LDL odpowiedzialna za oddziaływanie z receptorem) Heterozygoty: podwyższony poziom LDL we krwi, miażdżyca, choroby serca ok. 40 r. życia leczenie: statyny, dieta Homozygoty: ciężkie schorzenia serca i naczyń już w dzieciństwie leczenie: trudne, wysokie dawki statyn, przeszczep wątroby 22

23 Penetracja Prawdopodobieństwo wystąpienia objawów choroby u osoby z danym genotypem (np. zmutowany allel) 100% - typowy wzór dziedziczenia dominującego <100% - tzw. niepełna penetracja Trudna do wyznaczenia Wpływ środowiska, wieku, tła genetycznego Efekty epigenetyczne Piętno genomowe wpływa na penetrację w sposób zależny od płci rodzicielskiej 23

24 Ekspresyjność Ten sam odziedziczony allel może dawać różne efekty fenotypowe u różnych osób Penetracja czy będzie jakikolwiek fenotyp Ekspresyjność jaki będzie fenotyp Podłoże Wpływ środowiska, wieku, tła genetycznego 24

25 Zespół Marfana Dominująca mutacja w genie FBN1 kodującym fibrylinę białko tkanki łącznej Zmutowane białko blokuje polimeryzację białka prawidłowego Defekty tkanki łącznej, aorty i zastawek serca, wysoki wzrost, arachnodaktylia Ok. 1:5 000 osób 25

26 Ekspresyjność w zespole Marfana 4 grupy objawów: serce aorta (rozwarstwienie - przyczyna śmierci) oko szkielet 26

27 Sprzężenie z płcią Chromosom X Nigdy nie ma przekazywania ojciec syn Zawsze przekazywany od ojca do córki Jeżeli cecha recesywna, to chorują przeważnie mężczyźni, kobiety są nosicielkami Mozaikowatość heterozygotycznych kobiet 27

28 Mozaikowatość inaktywacji X Mutacja genu odpowiadającego za barwę futra (czarne lub rude) na chromosomie X U samic łaty czarne i rude zależnie od inaktywacji Samce albo czarne, albo rude 28

29 Królewska hemofilia Wikimedia Commons 29

30 Dystrofie mięśniowe Mutacje w genie dystrofiny białka kompleksu łączącego cytoszkielet, poprzez błonę, z macierzą zewnątrzkomórkową, błoną podstawną Dystrofia Duchenne a (DMD) ciężka, mutacje nullomorficzne Dystrofia Beckera (BMD) lżejsza, mutacje hipomorficzne 30 Rys. dr Zbigniew Domiński, University of North Carolina at Chapel Hill

31 Duchenne vs. Becker Wiele mutacji w DMD to mutacje nonsens Delecja nawet całych pojedynczych eksonów daje allel hipomorficzny (BMD) repetytywna struktura białka ABD ABD Duchenne muscular dystrophy Becker muscular dystrophy ABD C-ter 31 Rys. dr Zbigniew Domiński, University of North Carolina at Chapel Hill

32 Terapia modyfikująca składanie 32

33 33 Faza I/IIa wstępne badania kliniczne

34 Dziedziczenie mitochondrialne Charakterystyczny wzór rodowodu (dziedziczenie matczyne) Najczęściej neuropatologie (w tym zaburzenia wzroku i słuchu), miopatologie, zaburzenia metaboliczne (kwasica mleczanowa, cukrzyca) Mutacje punktowe, rozległe delecje lub deplecja mtdna Przy ciężkich mutacjach najczęściej heteroplazmia, stąd duże zróżnicowanie objawów u różnych osób w rodzinie (efekty progowe) Złożone relacje genotyp/fenotyp dana mutacja może powodować różne objawy, a podobne objawy mogą być wywołane różnymi mutacjami 34

35 mtdna człowieka par zasad koduje - 13 białek łańcucha oddechowego (z 84), 2 rrna (16 S i 12 S), 22 trna Zwarty - brak intronów, brak lub niewielkie obszary niekodujące między genami, czasem brak pełnego kodonu STOP (wprowadzany poprzez poliadenylację) Dziedziczenie od matki (mitochondria plemnika niszczone przez mechanizm zależny od ubikwitynacji 35

36 Dziedziczenie mitochondrialne Wyłącznie od matki Homoplazmia wszystkie cząsteczki mtdna w komórce takie same Heteroplazmia różne allele mtdna w tej samej komórce wiele kopii efekty ilościowe, progowe Heterogenność: różne mutacje, podobny fenotyp Plejotropia 36

37 Pułapki analizy rodowodów Niepełna penetracja Plejotropia i zmienna ekspresyjność Heterogenność (różne mutacje dają ten sam obraz kliniczny) Antycypacja przy ekspansjach trójkowych Piętno genomowe Fenokopie (np. cukrzyca) 37

38 Zaburzenia chromosomowe W przypadku autosomów ciężki i plejotropowy fenotyp przeważnie letalny tylko 3 wyjątki Główna przyczyna spontanicznych poronień (często nie dochodzi do zagnieżdżenia zarodka) W przypadku chromosomów płci (X,Y) fenotyp może być łagodniejszy 38

39 Zaburzenia autosomów Trisomia 21 zespół Downa ~1/800 urodzeń, zależnie od wieku matki Częste poronienia samoistne (75%) Zaburzenia rozwojowe, opóźnienie umysłowe Choroby serca, otyłość, cukrzyca, Alzheimer Trisomia 13 zespół Patau ~1/8000 1/ urodzeń Wady rozwojowe (przepukliny, serce, czaszka i mózg) Średnia przeżywalność: 2 dni, mniej niż 6 miesięcy, bardzo rzadko kilkanaście lat Trisomia 18 zespół Edwardsa 1/3000 1/8000 urodzeń Liczne wady rozwojowe, niedorozwój, mikrocefalia, wady serca 5% szans na przeżycie 1 r. ż. 39

40 Wiek matki a zespół Downa W ok. 85% nondysjunkcja w oogenezie 40 Wikimedia Commons

41 Zaburzenia chromosomów płci - cięższe X0 zespół Turnera ~1/2500 dziewczynek Cukrzyca 2 x częściej, nadciśnienie, osteoporoza, niedoczynność tarczycy Normalna długość życia IQ na ogół normalne XXY zespół Klinefeltera ~1/1000 chłopców Długie ręce i nogi 70% drobne problemy rozwojowe i z uczeniem Piersi, żeńskie owłosienie, bezpłodność 41

42 Zaburzenia chromosomów płci - lekkie XXX XYY Lekkie objawy ze względu na inaktywację X, zwykle brak ewidentnych zewnętrznych objawów Niekiedy zaburzenia cyklu menstrualnego i umiarkowane problemy rozwoju intelektualnego, wysoki wzrost ~1/1000 dziewczynek bardzo rzadko XXXX i XXXXX (kilkaset przypadków w historii, cięższe objawy) Zwykle brak ewidentnych zewnętrznych objawów, >90% nie wie, że ma ten kariotyp ~1/1000 chłopców Nieco zwiększone ryzyko opóźnień w nauce, wysoki wzrost, normalny poziom testosteronu Wcześniejsze doniesienia o korelacji z zachowaniem agresywnym - fałszywe 42