Antywirulentny potencjał białek fagowych

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "Antywirulentny potencjał białek fagowych"

Transkrypt

1 Antywirulentny potencjał białek fagowych Grażyna Majkowska-Skrobek Zakład Biologii Patogenów i Immunologii Instytut Genetyki i Mikrobiologii UWr IMMUNOGENNOŚĆ BAKTERII PATOGENNOŚĆ BAKTERII BAKTERIOFAGI BIAŁKA FAGOWE 1

2 Bakteriofagi fagoterapia Gruzja antybiotykoterapia F. Twort ( ) F. d Herelle ( ) A. Fleming ( ) terapia oparta na fagach i ich białkach Bakteriofag (gr. phagein-jeść) LIZA 2

3 rząd Caudivirales 96% znanych fagów gospodarze: Eubacteria i Archaea ikozaedralna główka + ogonek, brak osłonki (płytka podstawna, włókna, haczyki) liniowe dsdna rodzina Myoviridae 8 rodzajów [25% fagów ogonkowych, opisanych1300] rodzinasiphoviridae 9 rodzajów [61% fagów ogonkowych, opisanych ponad 3200] rodzinapodoviridae podrodzina Autographivirinae (3 rodz.) podrodzina Picovirinae (2 rodz.) 6 rodzajów [14% fagów ogonkowych, opisanych 750] DEPOLIMERAZY Cykl lityczny 1. Rozpoznanie i adsorbcja faga do komórki 2. Wprowadzenie DNA fagowego do komórki i degradacja DNA gospodarza 3. Synteza wczesnych białek wirusowych ENDOLIZYNY 4. Replikacja genomu i synteza późnych białek wirusowych 5. Składanie i dojrzewanie 6. Uwalnianie 3

4 Bariery na powierzchni bakterii GRAM + GRAM -- Adsorbcja degradacja polisacharydów otoczkowych liazy alginatowe hialuronidazy endosialidazy depolimerazy alginat hialuronian kwas polisialowy amyloworan polisacharydy Klebsiella (K-antygen) 4

5 Adsorbcja degradacja LPSu endoramnozydazy Adsorbcja degradacja peptydoglikanu VAPGHs virion-associated peptidoglycan hydrolases Exoliziny = lizyny strukturalne 1. lizozym (gp5 fagat4) 2. transglikozylazy (gp16 fagat7; białko P7 faga PRD1) 3. N-acetyl-muramoylamidases 4. Glukozaminidazy 5. endopeptydazy (białko P5 faga phi6 ; Tal2009 fagatuc2009) 5

6 Klebsiella pneumoniae Jeden z najczęstszych czynników zakażeń w szpitalu poza szpitalem Zakażenia dróg moczowych Ropnie wątroby Zakażenia łożyska krwi (urosepsis, odcewnikowe) Zapalenie płuc Zakażenia skory i tkanki podskórnej Zapalenie otrzewnej Zapalenie dróg żółciowych Zapalenie opon m-rdz ANTYBIOTYKI penicyliny, wczesne cefalosporyny, fluorochinolony leki I rzutu cefalosporyny III generacji cudowne leki lat aminoglikozydy rezerwa karbapenemy leki ostatniej szansy szczepy wielooporne, szpitale, ciężkie zakażenia Klebsiella pneumoniae Paczosa et al

7 a) KP15 Myoviridae family b) KP27 Myoviridae family c) KP16 Siphoviridae family d) KP36 Siphoviridae family e) KP32 Podoviridae family f) KP34 Podoviridae family Kęsik-Szeloch et al. Virology Journal 2013 łysinka halo murawa Plaque morphology of KP36 on K. pneumoniae 486 7

8 PCR Produkcja rekombinowanych depolimeraz Dodanie Adeniny (wektor zakończony Tyminą) Polimeraza Dream Taq Produkt PCR Oczyszczanie produktów PCR LIGACJA 8

9 SEKWENCJA DEPOLIMERAZY atggcactatacagagaaggcaaagcggctatggccgcagacggaaccgttaccgggactggcacaaaatggcaatcttcgctttcgctgattcgcccaggcgcgacgattatgtttttgtcgtc accaattcaaatggccgtcgtaaacaaggtg gttagcgatactgaaattaaagccatcaccacaaacggcgctgtcgtagcgtctagcgattacgcgatcctgttaagtgactcacttaccgttgacggtctggcgcaagatgttgctgaaactctgcgctactatcagtcacaggaaaccgtgatcgc ggatgcagtcgagttcttcaagaactttgatttcgattccctgcaagatcttgctaaccaaattaatgcagactctgaatctgcacaatcaagcgctgcggctgctgctgcgtctgaaaatgcggccaaaacttcagagaataacgccaagtcttcaga ggtggctgcggagaatgcaagagaccaagttcagcagatcattaatgacgctggagacgcatcaacactggttgtgctggcgaatcctgatggatttaggcacatagggcgttgcaaagatattgccactctgaggacaattgagccagtagaa agccggcaggttattgaggttctaagctactacaacggcttggcacaaggaggcggaacattctggtacgatcctaacgattcagtaactgaggacaatggcgggagttgtattgtcacaaatggcggaaagcgctggaagcgaatcattgacg gagcggtagatgttttgagctttggagccaagccagacgatataagttttgatagcgcccctcacattcaagccgcacttgacaaccatgacgcagtatcattgtacggacgcagctattatatcggaagcccgatctatatgccgtcaaggactgtgt tcgatggtatgggaggaaagctaacctccatagctccaagcacggctggcttcatggctgggtcaatcttcgcgcctggaaactaccacccagacttttgggaagaggttccgaaggtagcggcc accacgacgcttgggagtgccaacatcac gctggcagatccgaatatagtgaacgttggagacatcatccggctttcgtcaaccactggtgtcctgagcgccgggttcttcgtttccgagtatctacagatggcccgcgtcttgagtaagacaggcaatgtcatcacgattgatggcccggttgaatc gcagcttacgttggtggcagctaatgccaaccagccagggtatcttgcgcgcttcaataaaccgttgttctgctgtgtcgattcaataattcagaatatcgaaatcgatacctgggattactggactgccgactcagcaacttataacgtaaaattctcga atatatggggttcagcaaaggcagtggcctatggcaacaccttctgccgttcacttttcgaggatatacggattgttttctccgggcgtgtatcggagttggcttttgggtcgcatgacacgaacctagttcgcatcacggctattgccagccctaaaggct tatctgcatcagttgtctttggttgggctgaatctggcaggcgctgcacgattgataccttttctatcatgttgaacgctaatgctaatcccagcacggtaattcgtgtatctggtcatcgggatagcttgatcaagaacggaagcatatatgtccataacaa caccaataatatccttagcgtcgagaactatggcactaccgctgatggtgttagaccagattgcgacaacataacgttcgagaacgtgagcatcttcgtaactggatcatctgctgtagtgtgtgatgtatataaatccgccgacaactcggttattaaa aatgttgcgtttaaaaacataaaatatttcgggcctacaccaagcgtcgcattataccgcgctcgcggaacgttggcgaatttcgtgaagggagttcaggcgaacatatcttccgatactggcggagccattgttctcagcaattcggaaaataacgtt ctgacatttaccggcccggtgagcgttacatcgctcgtctctgctgccgcaaaaaatacgttgtccatcagaaactatgccagatctagcgcgaaggcgaacaatttcacgcaagagtctaccttgaacgtgactgatactacggcaaacgctgtca gcaaagaatttacatatcctgctggctctctcagaattaacgataagatcaagctgtcgttgggtggtagtacggctgggactgtcggtaaaaagaccgtacaggtgggtttcattgggtctgac ggtgcgttcaagtacgttgagttggcagctttggc aaccgatcaagtatattggacgatggaggttgaaatatcgttcctcaggacgacgaatagccagacaaatgagcttgagacctcggctattatcacttccttcctttcgaagggtgcggctaccggcgcggcattatctggctcaagggcgctggcg gttgtgtcggatttagcgctctcgaattttgtcgtccaagttcgcgcctggaaggaaaatgcggcagatggattgtcactgtcaagaatgaatcttcagttagaagatttgacggca taa Produkcja rekombinowanych depolimeraz cd. indukcja ekspresji IPTG E.coli zebranie komórek bakteryjnych przez wirowanie 9

10 Produkcja rekombinowanych depolimeraz cd. 1. lizat (przed nałożeniem na kolumnę) oczyszczone białko Majkowska-Skrobek et al. Viruses 2016 Charakterystyka depolimeraz 10

11 Relative activity [%] Relative activity [%] Charakterystyka depolimeraz ph Tm=65 O C temperature [ C] Majkowska-Skrobek et al. Viruses 2016 Anty-wirulentny potencjał depolimeraz in vivo Galleria mellonella PBS 24h po infekcji % survival * * 10 7 CFU 10 7 CFU + depokp CFU after depokp36 treatment n = 30 p < time post infection (h) Majkowska-Skrobek et al. Viruses

12 survivial rate (%) Anty-wirulentny potencjał depolimeraz in vitro control depokp32 (10 μg/ml) depokp32 (50 μg/ml) depokp32 (100 μg/ml) time (h) ENDOLIZYNY TERAPIA FAGOWA LIZA BAKTERII IDENTYFIKACJA I DETEKCJA BAKTERII DEPOLIMERAZY UWRAŻLIWIENIE BAKTERII NA CZYNNIKI ANTYBAKTERYJNE I MECHANIZMY UKŁADU ODPORNOŚCIOWEGO 12

13 BIOLOGIA MOLEKULARNA klonowanie ekspresja oczyszczanie interakcje BIOINFORMATYKA identyfikacja przewidywanie struktury dokowanie modelowanie homologii BIOLOGIA STRUKTURALNA krystalizacja określenie struktury przestrzennej Kryształy depokp36 Institute of Biostructures and Bioimaging, National Research Council, Naples 13

Zakażenie pszczoły miodnej patogenem Nosema ceranae. Diagnostyka infekcji wirusowych pszczoły miodnej

Zakażenie pszczoły miodnej patogenem Nosema ceranae. Diagnostyka infekcji wirusowych pszczoły miodnej Zakażenie pszczoły miodnej patogenem Nosema ceranae Diagnostyka infekcji wirusowych pszczoły miodnej Plan 1. Znaczenie ekologiczne i gospodarcze pszczół 2. Choroby pszczół i ich diagnostyka 3. Podstawy

Bardziej szczegółowo

Oporność na antybiotyki w Unii Europejskiej

Oporność na antybiotyki w Unii Europejskiej Podsumowanie danych z 2014 roku o oporności na antybiotyki w Unii Europejskiej Dane z monitorowania sieci EARS-Net Listopad 2015 Poważne zagrożenie: oporność na antybiotyki w Unii Europejskiej Oporność

Bardziej szczegółowo

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka

Inżynieria genetyczna- 6 ECTS. Inżynieria genetyczna. Podstawowe pojęcia Część II Klonowanie ekspresyjne Od genu do białka Inżynieria genetyczna- 6 ECTS Część I Badanie ekspresji genów Podstawy klonowania i różnicowania transformantów Kolokwium (14pkt) Część II Klonowanie ekspresyjne Od genu do białka Kolokwium (26pkt) EGZAMIN

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Ochrony Antybiotyków. AktualnoŚci Narodowego Programu

Ochrony Antybiotyków. AktualnoŚci Narodowego Programu AktualnoŚci Narodowego Programu Ochrony Antybiotyków Numer 2/2014 Raport Światowej Organizacji Zdrowia nt. Oporności Drobnoustrojów (kwiecień 2014) wybrane najważniejsze wnioski nt. monitorowania antybiotykooporności

Bardziej szczegółowo

Podstawy mikrobiologii. Wirusy bezkomórkowe formy materii oŝywionej

Podstawy mikrobiologii. Wirusy bezkomórkowe formy materii oŝywionej Podstawy mikrobiologii Wykład 3 Wirusy bezkomórkowe formy materii oŝywionej Budowa wirusów Wirusy nie mają budowy komórkowej, zatem pod względem biologicznym nie są organizmami Ŝywymi! Są to twory nukleinowo

Bardziej szczegółowo

Przegląd moich tematów badawczych

Przegląd moich tematów badawczych Czy jest coś, czego się nie da zrobid z bakteriofagiem? Przegląd moich tematów badawczych Marcin Łoś Katedra Biologii Molekularnej Uniwersytet Gdaoski Czym jest bakteriofag? http://micro.magnet.fsu.edu/cells/virus.html

Bardziej szczegółowo

18 listopada Europejskim Dniem Wiedzy o Antybiotykach

18 listopada Europejskim Dniem Wiedzy o Antybiotykach 18 listopada Europejskim Dniem Wiedzy o Antybiotykach Już po raz trzeci 18 listopada Europa obchodzi Dzień Wiedzy o Antybiotykach. Został on ustanowiony w 2008 roku przez Komisję Europejską na wniosek

Bardziej szczegółowo

Wirusy i bakterie. Barbara Lewicka

Wirusy i bakterie. Barbara Lewicka Wirusy i bakterie Barbara Lewicka Budowa wirusa HIV a) glikoproteina 120, b) glikoproteina 41, c) lipidowa osłonka zewnętrzna, d) białkowa osłonka rdzenia, e) proteaza, f) kapsyd, g) RNA, h) odwrotna

Bardziej szczegółowo

Spis treœci. 1. Wstêp... 1

Spis treœci. 1. Wstêp... 1 Spis treœci 1. Wstêp........................................................... 1 Czêœæ 1: MIKROBIOLOGIA OGÓLNA..................................... 3 2. Budowa i taksonomia bakterii.....................................

Bardziej szczegółowo

Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII "

Kurs pt.  MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII Warszawa, 6 lutego 2011 r. Szanowna Pani! Szanowny Panie! Niniejszym uprzejmie informuję, że organizowany jest Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII " Kurs odbędzie się w dniach

Bardziej szczegółowo

SHL.org.pl SHL.org.pl

SHL.org.pl SHL.org.pl Polityka antybiotykowa w oddziale pediatrycznym Adam Hermann Zespół Kontroli Zakażeń Szpitalnych Stowarzyszenie Higieny Lecznictwa Fundacja Instytut Profilaktyki Zakażeń Adam Hermann Stare Jabłonki 05-07.10.2014r.

Bardziej szczegółowo

Diagnostyka molekularna w OIT

Diagnostyka molekularna w OIT Diagnostyka molekularna w OIT B A R B A R A A D A M I K K A T E D R A I K L I N I K A A N E S T E Z J O L O G I I I I N T E N S Y W N E J T E R A P I I U N I W E R S Y T E T M E D Y C Z N Y W E W R O C

Bardziej szczegółowo

ŚWIATOWY DZIEŃ ZDROWIA 7 kwietnia 2011

ŚWIATOWY DZIEŃ ZDROWIA 7 kwietnia 2011 ŚWIATOWY DZIEŃ ZDROWIA 7 kwietnia 2011 Światowy Dzień Zdrowia (ang. World Health Day ) obchodzony jest każdego roku 7 kwietnia, w rocznicę założenia Światowej Organizacji Zdrowia (WHO). Corocznie Organizacja

Bardziej szczegółowo

18 listopada Europejskim Dniem Wiedzy o Antybiotykach

18 listopada Europejskim Dniem Wiedzy o Antybiotykach 18 listopada Europejskim Dniem Wiedzy o Antybiotykach Już po raz trzeci, 18 listopada Europa obchodzi Dzień Wiedzy o Antybiotykach (EDWA). Został on ustanowiony w 2008 roku przez Komisję Europejską na

Bardziej szczegółowo

Gdzie chirurg nie może - - tam wirusy pośle. czyli o przeciwnowotworowych terapiach wirusowych

Gdzie chirurg nie może - - tam wirusy pośle. czyli o przeciwnowotworowych terapiach wirusowych Gdzie chirurg nie może - - tam wirusy pośle czyli o przeciwnowotworowych terapiach wirusowych Wirusy zwiększające ryzyko rozwoju nowotworów HBV EBV HCV HTLV HPV HHV-8 Zmniejszenie liczby zgonów spowodowanych

Bardziej szczegółowo

Ćwiczenie 1. Oznaczanie wrażliwości szczepów na metycylinę

Ćwiczenie 1. Oznaczanie wrażliwości szczepów na metycylinę XI. Antybiotyki i chemioterpeutyki ćwiczenia praktyczne W przedstawionych ćwiczeniach narysuj i zinterpretuj otrzymane wyniki badań mechanizmów oporności. Opisz rodzaje krążków użytych do badań oraz sposób

Bardziej szczegółowo

Kraków, dn. 24.06.2014 r. I. ZAMAWIAJĄCY

Kraków, dn. 24.06.2014 r. I. ZAMAWIAJĄCY Kraków, dn. 24.06.2014 r. Zapytanie ofertowe nr 1/OF/2014 na zakup usługi badawczej w ramach projektu o akronimie ONKOFAG współfinansowanego ze środków Narodowego Centrum Badań i Rozwoju w ramach Programu

Bardziej szczegółowo

dr hab. Beata Krawczyk Katedra Mikrobiologii PG

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Metody amplifikacji kwasów nukleinowych dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej pj j w ramach Europejskiego Funduszu Społecznego Amplifikacja

Bardziej szczegółowo

Biotechnologia studia stacjonarne II stopnia - Biotechnologia drobnoustrojów

Biotechnologia studia stacjonarne II stopnia - Biotechnologia drobnoustrojów Biotechnologia studia stacjonarne II stopnia - Biotechnologia drobnoustrojów Tematy prac dyplomowych i magisterskich na rok 205/206 Nazwisko, imię promotora Temat pracy Kierunek, rok, forma studiów Liczba

Bardziej szczegółowo

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7

PROJEKT WSPÓŁFINANSOWANY PRZEZ UNIĘ EUROPEJSKĄ Z EUROPEJSKIEGO FUNDUSZU ROZWOJU REGIONALNEGO 1 z 7 Poznań, dnia 28.04.2014 r. BioVentures Institute Spółka z ograniczoną odpowiedzialnością ul. Promienista 83 60 141 Poznań Zapytanie ofertowe nr 01/2014 Projekt Nowa technologia wytwarzania szczepionek

Bardziej szczegółowo

Poradnia Immunologiczna

Poradnia Immunologiczna Poradnia Immunologiczna Centrum Onkologii Ziemi Lubelskiej im. św. Jana z Dukli Lublin, 2011 Szanowni Państwo, Uprzejmie informujemy, że w Centrum Onkologii Ziemi Lubelskiej im. św. Jana z Dukli funkcjonuje

Bardziej szczegółowo

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy

Zakład Chorób Ryb. PIWet. Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy PIWet Zakład Chorób Ryb Zastosowanie molekularnych metod do diagnostyki wirusowych chorób ryb, wirusa krwotocznej posocznicy łososiowatych o (VHS), wirusa zakaźnej a martwicy układu krwiotwórczego (IHN)

Bardziej szczegółowo

Pałeczki jelitowe Enterobacteriaceae wytwarzające karbapenemazy(cpe)

Pałeczki jelitowe Enterobacteriaceae wytwarzające karbapenemazy(cpe) Pałeczki jelitowe Enterobacteriaceae wytwarzające karbapenemazy(cpe) w Polsce sytuacja w 206 Autorzy Zakład Epidemiologii i Mikrobiologii Klinicznej NIL: Dorota Żabicka Katarzyna Bojarska Małgorzata Herda

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

TESTY Z BIOLOGII (fragment)

TESTY Z BIOLOGII (fragment) TESTY Z BIOLOGII (fragment) Autor:...Dawid Pawlos Projekt okładki:...rafael Pawlos Korekta językowa:...agnieszka Sanetra Wydanie I Copyright by Dawid Pawlos 2015 Wszelkie prawa zastrzeżone. Kopiowanie

Bardziej szczegółowo

Zagadnienia egzaminacyjne z przedmiotu Mikrobiologia kosmetologiczna dla studentów II roku kierunku Kosmetologia

Zagadnienia egzaminacyjne z przedmiotu Mikrobiologia kosmetologiczna dla studentów II roku kierunku Kosmetologia Zagadnienia egzaminacyjne z przedmiotu Mikrobiologia kosmetologiczna dla studentów II roku kierunku Kosmetologia I. Zagadnienia omawiane na wykładach. Uzupełnieniem zagadnień omawianych na wykładach są

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

Zakażenia w Oddziałach Intensywnej Terapii SEPSA Możliwe miejsca zakażenia Czynniki patogenne Bakterie G dodatnie, G ujemne Bakterie beztlenowe Grzyby Wirusy Pierwotniaki Zakażenia szpitalne Występują

Bardziej szczegółowo

SZCZEPIENIA OCHRONNE U DOROSŁYCH lek. Kamil Chudziński Klinika Anestezjologii i Intensywnej Terapii CSK MSW w Warszawie 10.11.2015 Szczepionki Zabite lub żywe, ale odzjadliwione drobnoustroje/toksyny +

Bardziej szczegółowo

Terapia fagowa nadzieje i obawy

Terapia fagowa nadzieje i obawy Borgis Terapia fagowa nadzieje i obawy *Paweł Kowalczyk 1, Karol Chalimoniuk 2, Agnieszka Danielak 2, Dorota Dziedziela 2, Paulina Jankowska 2, Marzena Kowalska 2, Joanna Laskowska 2, Marzena Rachocka

Bardziej szczegółowo

Podstawy wirusologii SYLABUS A. Informacje ogólne

Podstawy wirusologii SYLABUS A. Informacje ogólne Podstawy wirusologii SYLABUS A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod przedmiotu Język przedmiotu

Bardziej szczegółowo

Ochrony Antybiotyków. Aktualnosci Narodowego Programu. Numer 3/2011. Lekooporność bakterii

Ochrony Antybiotyków. Aktualnosci Narodowego Programu. Numer 3/2011. Lekooporność bakterii Aktualnosci Narodowego Programu Ochrony Antybiotyków Numer 3/2011 Opracowanie: lek.med. Monika Wanke, Warszawski Uniwersytet Medyczny, Warszawa Lekooporność bakterii Od 2008 roku Europa obchodzi Dzień

Bardziej szczegółowo

Uniwersytet Śląski w Katowicach str. 1 Wydział

Uniwersytet Śląski w Katowicach str. 1 Wydział Uniwersytet Śląski w Katowicach str. 1 Kierunek i poziom studiów: Chemia, drugi Sylabus modułu: Przedmiot B związany ze specjalnością (0310- CH-S2-002) Nazwa wariantu modułu: Biochemia z elementami genetyki

Bardziej szczegółowo

KARTA KURSU. Biotechnology in Environmental Protection. Kod Punktacja ECTS* 1

KARTA KURSU. Biotechnology in Environmental Protection. Kod Punktacja ECTS* 1 KARTA KURSU Nazwa Nazwa w j. ang. Biotechnologia w ochronie środowiska Biotechnology in Environmental Protection Kod Punktacja ECTS* 1 Koordynator Prof. dr hab. Maria Wędzony Zespół dydaktyczny: Prof.

Bardziej szczegółowo

Wektory DNA - klonowanie molekularne

Wektory DNA - klonowanie molekularne Wektory DNA - klonowanie molekularne Fragment DNA (np. pojedynczy gen) można trwale wprowadzić do komórek gospodarza (tzn. zmusić go do powielania w tym gospodarzu) tylko wtedy, gdy zostanie on wbudowany

Bardziej szczegółowo

Mikroorganizmy Zmodyfikowane Genetycznie

Mikroorganizmy Zmodyfikowane Genetycznie Mikroorganizmy Zmodyfikowane Genetycznie DEFINICJA Mikroorganizm (drobnoustrój) to organizm niewidoczny gołym okiem. Pojęcie to nie jest zbyt precyzyjne lecz z pewnością mikroorganizmami są: bakterie,

Bardziej szczegółowo

Rodzaje autoprzeciwciał, sposoby ich wykrywania, znaczenie w ustaleniu diagnozy i monitorowaniu. Objawy związane z mechanizmami uszkodzenia.

Rodzaje autoprzeciwciał, sposoby ich wykrywania, znaczenie w ustaleniu diagnozy i monitorowaniu. Objawy związane z mechanizmami uszkodzenia. Zakres zagadnień do poszczególnych tematów zajęć I Choroby układowe tkanki łącznej 1. Toczeń rumieniowaty układowy 2. Reumatoidalne zapalenie stawów 3. Twardzina układowa 4. Zapalenie wielomięśniowe/zapalenie

Bardziej szczegółowo

Personalizacja leczenia w hematoonkologii dziecięcej

Personalizacja leczenia w hematoonkologii dziecięcej MedTrends 2016 Europejskie Forum Nowoczesnej Ochrony Zdrowia Zabrze, 18-19 marca 2016 r. Personalizacja leczenia w hematoonkologii dziecięcej Prof. dr hab. n. med. Tomasz Szczepański Katedra i Klinika

Bardziej szczegółowo

Europejski Dzień Wiedzy o Antybiotykach

Europejski Dzień Wiedzy o Antybiotykach Europejski Dzień Wiedzy o Antybiotykach Tego dnia z inicjatywy Europejskiego Centrum ds. Zapobiegania i Kontroli Chorób w wielu państwach przeprowadzane są kampanie społeczne mające na celu zwiększenie

Bardziej szczegółowo

Bożena Nejman-Faleńczyk

Bożena Nejman-Faleńczyk Kontrola replikacji fagów lambdoidalnych niosących geny toksyn Shiga w świetle potencjalnych nowych metod ich wykrywania i terapii zakażeń enterokrwotocznymi szczepami Escherichia coli Bożena Nejman-Faleńczyk

Bardziej szczegółowo

Charakterystyka nowo odkrytego bakteriofaga ΦAGATE wyizolowanego z wody i osadów Jeziora Góreckiego.

Charakterystyka nowo odkrytego bakteriofaga ΦAGATE wyizolowanego z wody i osadów Jeziora Góreckiego. UNIWERSYTET IM. ADAMA MICKIEWICZA WYDZIAŁ BIOLOGII INSTYTUT BIOLOGII EKSPERYMENTALNEJ Charakterystyka nowo odkrytego bakteriofaga ΦAGATE wyizolowanego z wody i osadów Jeziora Góreckiego. Praca doktorska

Bardziej szczegółowo

Narodowy Instytut Leków ul. Chełmska 30/34, 00-725 Warszawa Tel. 022 851-46-70, Fax. 022 841-29-49 www.korld.edu.pl Warszawa, dn. 21.10.2009r.

Narodowy Instytut Leków ul. Chełmska 30/34, 00-725 Warszawa Tel. 022 851-46-70, Fax. 022 841-29-49 www.korld.edu.pl Warszawa, dn. 21.10.2009r. Narodowy Instytut Leków ul. Chełmska 30/34, 00-725 Warszawa Tel. 022 851-46-70, Fax. 022 841-29-49 www.korld.edu.pl Warszawa, dn. 21.10.2009r. Wytyczne postępowania w przypadku wykrycia szczepów pałeczek

Bardziej szczegółowo

Przedmowa do wydania polskiego 11 Wstęp 13 Podziękowania 14

Przedmowa do wydania polskiego 11 Wstęp 13 Podziękowania 14 Spis treści Przedmowa do wydania polskiego 11 Wstęp 13 Podziękowania 14 1. Wstęp i ustalanie rozpoznania 15 Co to jest mukowiscydoza? 15 Skąd nazwa mukowiscydoza? 16 Kiedy można podejrzewać występowanie

Bardziej szczegółowo

Seminarium Wpływ realizacji pobytów stażowych (szkoleniowych) na rozwój potencjału dydaktycznego postdoców i doktorantów

Seminarium Wpływ realizacji pobytów stażowych (szkoleniowych) na rozwój potencjału dydaktycznego postdoców i doktorantów Seminarium Wpływ realizacji pobytów stażowych (szkoleniowych) na rozwój potencjału dydaktycznego postdoców i doktorantów 7 wrzesień 2011 roku sala Rady Wydziału, ul. Oczapowskiego 1A Projekt POKL. 04.01.01-00-178/09

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

ZAKŁAD WIRUSOLOGII Instytut Mikrobiologii

ZAKŁAD WIRUSOLOGII Instytut Mikrobiologii ZAKŁAD WIRUSOLOGII Instytut Mikrobiologii DNI OTWARTE 11-15.05.2015 w GODZ. 10-14 www.biol.uw.edu.pl/wirusologia Zespół Dr Monika Radlińska kierownik (+22) 554 14 19 e-mail: m.radlinska@biol.uw.edu.pl

Bardziej szczegółowo

Leczenie biologiczne w nieswoistych zapaleniach jelit - Dlaczego? Co? Kiedy? VI Małopolskie Dni Edukacji w Nieswoistych Zapaleniach Jelit

Leczenie biologiczne w nieswoistych zapaleniach jelit - Dlaczego? Co? Kiedy? VI Małopolskie Dni Edukacji w Nieswoistych Zapaleniach Jelit Leczenie biologiczne w nieswoistych zapaleniach jelit - Dlaczego? Co? Kiedy? VI Małopolskie Dni Edukacji w Nieswoistych Zapaleniach Jelit Co to są nieswoiste zapalenia jelit? Grupa chorób w których dochodzi

Bardziej szczegółowo

Projekt Alexander w Polsce w latach

Projekt Alexander w Polsce w latach Projekt Alexander w Polsce w latach 1996-2008 NaduŜywanie antybiotyków i chemioterapeutyków oraz ich niewłaściwe stosowanie doprowadziło do globalnego zagroŝenia, jakim jest powstawanie i szerzenie się

Bardziej szczegółowo

Wybrane zastosowania metod inżynierii genetycznej

Wybrane zastosowania metod inżynierii genetycznej Wybrane zastosowania metod inżynierii genetycznej Inżynieria genetyczna to inaczej ingerencja w materiał genetyczny organizmów, w celu zmiany ich właściwości dziedzicznych. Polega ona na wprowadzaniu do

Bardziej szczegółowo

Zalecenia rekomendowane przez Ministra Zdrowia. KPC - ang: Klebsiella pneumoniae carbapenemase

Zalecenia rekomendowane przez Ministra Zdrowia. KPC - ang: Klebsiella pneumoniae carbapenemase Zalecenia dotyczące postępowania w przypadku identyfikacji w zakładach opieki zdrowotnej szczepów bakteryjnych Enterobacteriaceae wytwarzających karbapenemazy typu KPC * * KPC - ang: Klebsiella pneumoniae

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

18 listopada. www.antybiotyki.edu.pl

18 listopada. www.antybiotyki.edu.pl DDlaczego obchodzimy Europejski Dzień Wiedzy o Antybiotykach? Antybiotyki stają się ofiarą własnego sukcesu. Powszechne nadużywanie i nieodpowiedzialne stosowanie antybiotyków prowadzi do ograniczenia

Bardziej szczegółowo

Pozaszpitalne zapalenia płuc u dzieci

Pozaszpitalne zapalenia płuc u dzieci Pozaszpitalne zapalenia płuc u dzieci Katarzyna Krenke Klinika Pneumonologii i Alergologii Wieku Dziecięcego Warszawski Uniwersytet Medyczny Thorax 2011;66: suppl. 2 Zapalenia płuc - etiologia Nowe czynniki

Bardziej szczegółowo

Skąd się wzięła biologia syntetyczna? Co to są standardowe części biologiczne?

Skąd się wzięła biologia syntetyczna? Co to są standardowe części biologiczne? Skąd się wzięła biologia syntetyczna? Mało kto zdaje sobie sprawę z tego, że termin "biologia syntetyczna" został ukuty w 1974 roku przez polskiego genetyka i biochemika Wacława Szybalskiego. Biologia

Bardziej szczegółowo

18 listopada. www.antybiotyki.edu.pl

18 listopada. www.antybiotyki.edu.pl Wystawa sfinansowana ze środków będących w dyspozycji Ministra Zdrowia w ramach programu zdrowotnego pn. Narodowy Program Ochrony Antybiotyków na lata 2011-2015 DDlaczego obchodzimy Europejski Dzień Wiedzy

Bardziej szczegółowo

Profilaktyka zakażeń układu moczowego i immunoterapia. Paweł Miotła II Katedra i Klinika Ginekologii UM w Lublinie

Profilaktyka zakażeń układu moczowego i immunoterapia. Paweł Miotła II Katedra i Klinika Ginekologii UM w Lublinie Profilaktyka zakażeń układu moczowego i immunoterapia Paweł Miotła II Katedra i Klinika Ginekologii UM w Lublinie Zakażenia układu moczowego (ZUM) 10-20% zakażeń poza szpitalnych 40-50% zakażeń szpitalnych

Bardziej szczegółowo

1. Biotechnologia i inżynieria genetyczna zagadnienia wstępne 13

1. Biotechnologia i inżynieria genetyczna zagadnienia wstępne 13 Spis treści Przedmowa 11 1. Biotechnologia i inżynieria genetyczna zagadnienia wstępne 13 1.1. Wprowadzenie 13 1.2. Biotechnologia żywności znaczenie gospodarcze i społeczne 13 1.3. Produkty modyfikowane

Bardziej szczegółowo

ZALECENIA POLSKIEGO TOWARZYSTWA NEFROLOGII DZIECIĘCEJ (PTNFD)

ZALECENIA POLSKIEGO TOWARZYSTWA NEFROLOGII DZIECIĘCEJ (PTNFD) ZALECENIA POLSKIEGO TOWARZYSTWA NEFROLOGII DZIECIĘCEJ (PTNFD) DOTYCZĄCE POSTĘPOWANIA Z DZIECKIEM Z ZAKAŻENIEM UKŁADU MOCZOWEGO Zasady leczenia Grupa Ekspertów PTNFD ZALECENIE 4. Postępowanie z dzieckiem

Bardziej szczegółowo

ANTYBIOTYKOOPORNOŚĆ: ZAGROŻENIE DLA ZDROWIA PUBLICZNEGO. materiał prasowy Europejskiego Dnia Wiedzy o Antybiotykach (18 listopada)

ANTYBIOTYKOOPORNOŚĆ: ZAGROŻENIE DLA ZDROWIA PUBLICZNEGO. materiał prasowy Europejskiego Dnia Wiedzy o Antybiotykach (18 listopada) ANTYBIOTYKOOPORNOŚĆ: ZAGROŻENIE DLA ZDROWIA PUBLICZNEGO materiał prasowy Europejskiego Dnia Wiedzy o Antybiotykach (18 listopada) i Światowego Tygodnia Wiedzy o Antybiotykach 2016 (14-20 listopada) Antybiotyki

Bardziej szczegółowo

ŚRODA 4 września 2013

ŚRODA 4 września 2013 X JUBILEUSZOWE REGIONALNE FORUM MEDYCYNY ZAKAŻEŃ - od teorii do praktyki "PROBLEMY ANTYBIOTYKOTERAPII ZAKAŻEŃ" oraz DZIEŃ DIAGNOSTY LABORATORYJNEGO W WOJEWÓDZTWIE WARMIŃSKO-MAZURSKIM ŚRODA 4 września 2013

Bardziej szczegółowo

OFERTA TEMATÓW PRAC DYPLOMOWYCH (MAGISTERSKICH) do zrealizowania w Katedrze MIKROBIOLOGII

OFERTA TEMATÓW PRAC DYPLOMOWYCH (MAGISTERSKICH) do zrealizowania w Katedrze MIKROBIOLOGII OFERTA TEMATÓW PRAC DYPLOMOWYCH (MAGISTERSKICH) do zrealizowania w Katedrze MIKROBIOLOGII Opracowanie zestawu do wykrywania DNA Aspergillus flavus za pomocą specjalistycznego sprzętu medycznego. Jednym

Bardziej szczegółowo

HIV A UKŁAD ODPORNOŚCIOWY CZ. II

HIV A UKŁAD ODPORNOŚCIOWY CZ. II HIV A UKŁAD ODPORNOŚCIOWY CZ. II Sposoby zakażenia Wirus HIV występuje głównie we krwi i nasieniu chorego mężczyzny lub wydzielinie pochwy chorej kobiety. Aby doszło do zainfekowania następnej choroby

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

Zapalenia płuc u dzieci. Joanna Lange

Zapalenia płuc u dzieci. Joanna Lange Zapalenia płuc u dzieci Joanna Lange choroba przebiegająca z dusznością, gorączką oraz różnymi objawami osłuchowymi, potwierdzona (zgodnie z definicją kliniczno - radiologiczną) lub nie (zgodnie z definicją

Bardziej szczegółowo

SHL.org.pl SHL.org.pl

SHL.org.pl SHL.org.pl Krystyna Paszko Monitorowanie patogenów alarmowych w Szpitalu św. Wojciecha w Gdańsku nowe przepisy i ich konsekwencje dla monitorowania patogenów alarmowych XII Konferencja naukowo-szkoleniowa SHL Stare

Bardziej szczegółowo

MIKROORGANIZMY W PRODUKCJI KOSMETYKÓW I WYBRANYCH FARMACEUTYKÓW. wykłady

MIKROORGANIZMY W PRODUKCJI KOSMETYKÓW I WYBRANYCH FARMACEUTYKÓW. wykłady MIKROORGANIZMY W PRODUKCJI KOSMETYKÓW I WYBRANYCH FARMACEUTYKÓW wykłady 1 BIOTECHNOLOGIA ANTYBIOTYKÓW 1928 r. A. Fleming penicylina ANTYBIOTYKI 1940-1944 r. S. A. Waksman aktynomycyna streptomycyna Antybiotyki

Bardziej szczegółowo

Anna Durka. Opiekun pracy: Dr n. med. Waldemar Machała

Anna Durka. Opiekun pracy: Dr n. med. Waldemar Machała Anna Durka Zastosowanie aktywowanego białka C (Xigris) u pacjentów leczonych z powodu ciężkiej sepsy w II Zakladzie Anestezjologii i Intensywnej Terapii USK nr 2 im. WAM w Łodzi. Opiekun pracy: Dr n. med.

Bardziej szczegółowo

FAX : (22) 488 37 70 PILNE

FAX : (22) 488 37 70 PILNE KARTA ZAPALENIA OTRZEWNEJ Nr Przypadku Baxter: Data raportu:... Data otrzymania informacji przez Baxter:... (wypełnia Baxter) (wypełnia Baxter) Proszę wypełnić poniższe pola i odesłać faxem do: Baxter

Bardziej szczegółowo

AUTOREFERAT. dr Krystyna Dąbrowska

AUTOREFERAT. dr Krystyna Dąbrowska AUTOREFERAT dr Krystyna Dąbrowska Samodzielne Laboratorium Bakteriofagowe Instytut Immunologii i Terapii Doświadczalnej Polska Akademia Nauk Wrocław, 20 sierpnia 2014 1 1. Krystyna Dąbrowska 2. Posiadane

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo

Powikłania zapaleń płuc

Powikłania zapaleń płuc Powikłania zapaleń płuc Katarzyna Krenke Klinika Pneumonologii i Alergologii Wieku Dziecięcego Warszawski Uniwersytet Medyczny Miejscowe powikłania zapaleń płuc Powikłany wysięk parapneumoniczny/ropniak

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ===============================================================================================

Bardziej szczegółowo

Tissue - (Tkanka) Infection - (Infekcja ) TIME. Moisture - (Wilgoć) Edge - (Naskórkowanie )

Tissue - (Tkanka) Infection - (Infekcja ) TIME. Moisture - (Wilgoć) Edge - (Naskórkowanie ) Mgr Katarzyna Mucha Tissue - (Tkanka) Infection - (Infekcja ) Moisture - (Wilgoć) TIME Edge - (Naskórkowanie ) TIME skrót i reguła KONCEPCJA OPRACOWANA W 2002, rok później opublikowana Definiuje cztery

Bardziej szczegółowo

1. Układ odpornościowy. Odporność humoralna

1. Układ odpornościowy. Odporność humoralna Zakres zagadnień do poszczególnych tematów zajęć Seminaria 1. Układ odpornościowy. Odporność humoralna Ludzki układ odpornościowy Składowe i mechanizmy odporności wrodzonej Składowe i mechanizmy odpowiedzi

Bardziej szczegółowo

Antybiotykoterapia w OAiIT

Antybiotykoterapia w OAiIT Antybiotykoterapia w OAiIT dr n. med. Ewa Trejnowska Oddział Anestezjologii I Intensywnej Terapii Szpital Vital Medic w Kluczborku Przewodnicząca Sekcji Mikrobiologii i Zakażeń PTAiIT Regionalny Koordynator

Bardziej szczegółowo

WIEDZA. wskazuje lokalizacje przebiegu procesów komórkowych

WIEDZA. wskazuje lokalizacje przebiegu procesów komórkowych Załącznik nr 7 do zarządzenia nr 12 Rektora UJ z 15 lutego 2012 r. Opis zakładanych efektów kształcenia na studiach podyplomowych Nazwa studiów: Medycyna Molekularna w Praktyce Klinicznej Typ studiów:

Bardziej szczegółowo

Ochrony Antybiotyków. AktualnoŚci Narodowego Programu

Ochrony Antybiotyków. AktualnoŚci Narodowego Programu AktualnoŚci Narodowego Programu Ochrony Antybiotyków Numer 1/2016 Podsumowanie aktualnych danych nt. konsumpcji antybiotyków w krajach Unii Europejskiej dane Europejskiej sieci Monitorowania Konsumpcji

Bardziej szczegółowo

w roku akademickim 2015/2016 1a 1b 1a 1b 1a 1b 1a 1b 1a 1b Fizyka z elementami biofizyki s.7,8 PP

w roku akademickim 2015/2016 1a 1b 1a 1b 1a 1b 1a 1b 1a 1b Fizyka z elementami biofizyki s.7,8 PP Rozkład zajęć w semestrze 1 stosowana rok I Poniedziałek Wtorek Środa Czwartek Szkolenie w zakresie praw i obowiązków studenta s.122 KK 5.10.2015 / Podstawy technologii roślinnej ćw. gr 1a s. 010 PP od

Bardziej szczegółowo

Oporność krzyżowa (równoległa)

Oporność krzyżowa (równoległa) Wprowadzenie do chemioterapii zakażeń Zasady prowadzenia chemioterapii zakażeń: empirycznej i celowanej Dr hab. n. med. Marzena Dworacka Katedra i Zakład Farmakologii Uniwersytetu Medycznego im. K. Marcinkowskiego

Bardziej szczegółowo

Streptococcus pneumoniae

Streptococcus pneumoniae Streptococcus pneumoniae Bakteria Streptococcus pneumoniae jest Gram (+) dwoinką i należy do najgroźniejszych bateryjnych patogenów człowieka. Odpowiedzialna jest za szereg chorób inwazyjnych o wysokiej

Bardziej szczegółowo

Blok licencjacki genetyczny

Blok licencjacki genetyczny Blok licencjacki genetyczny Za twórcę genetyki uważa się czeskiego zakonnika Grzegorza Mendla, który w 1866 r. odkrył podstawowe prawa przekazywania cech dziedzicznych i postawił hipotezę istnienia jednostek

Bardziej szczegółowo

Rekomendacje diagnostyczne inwazyjnych zakażeń bakteryjnych nabytych poza szpitalem M. Kadłubowski, A. Skoczyńska, W. Hryniewicz, KOROUN, NIL, 2009

Rekomendacje diagnostyczne inwazyjnych zakażeń bakteryjnych nabytych poza szpitalem M. Kadłubowski, A. Skoczyńska, W. Hryniewicz, KOROUN, NIL, 2009 Opracowanie: Marcin Kadłubowski, Anna Skoczyńska, Waleria Hryniewicz Krajowy Ośrodek Referencyjny ds. Diagnostyki Bakteryjnych Zakażeń Ośrodkowego Układu Nerwowego (KOROUN) Zakład Epidemiologii i Mikrobiologii

Bardziej szczegółowo

WNIOSEK O WYDANIE ZGODY NA ZAMKNIĘTE UŻYCIE GMO

WNIOSEK O WYDANIE ZGODY NA ZAMKNIĘTE UŻYCIE GMO WNIOSEK O WYDANIE ZGODY NA ZAMKNIĘTE UŻYCIE GMO 1. Informacje o użytkowniku GMO i osobach odpowiedzialnych za realizację planowanego zamkniętego użycia GMO 1.1 (*) Nazwa i siedziba użytkownika lub imię,

Bardziej szczegółowo

Ampli-LAMP Salmonella species

Ampli-LAMP Salmonella species Novazym Products Novazym Polska ul. Żywokostowa 23, 61-680 Poznań, tel. +48 0 61 610 39 10, fax +48 0 61 610 39 11, email info@novazym.com Zestaw do identyfikacji materiału genetycznego bakterii z rodzaju

Bardziej szczegółowo

MINISTER ZDROWIA NARODOWY PROGRAM OCHRONY ANTYBIOTYKÓW

MINISTER ZDROWIA NARODOWY PROGRAM OCHRONY ANTYBIOTYKÓW MINISTER ZDROWIA PROGRAM ZDROWOTNY PN. NARODOWY PROGRAM OCHRONY ANTYBIOTYKÓW MODUŁ I Monitorowanie zakażeń szpitalnych oraz inwazyjnych zakażeń bakteryjnych dla celów epidemiologicznych, terapeutycznych

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

Technologie wytwarzania szczepionek

Technologie wytwarzania szczepionek Technologie wytwarzania szczepionek Szczepionki preparaty biofarmaceutyczne chroniące organizm przed czynnikami infekcyjnymi poprzez pobudzenie jego odpowiedzi immunologicznej. Szczepionki klasyczne (I

Bardziej szczegółowo

HARMONOGRAM ZAJĘĆ dla studentów Uniwersyteckiego Centrum Medycyny Weterynaryjnej UJ-UR Mikrobiologia weterynaryjna II rok 2013/2014 semestr letni

HARMONOGRAM ZAJĘĆ dla studentów Uniwersyteckiego Centrum Medycyny Weterynaryjnej UJ-UR Mikrobiologia weterynaryjna II rok 2013/2014 semestr letni HARMONOGRAM ZAJĘĆ dla studentów Uniwersyteckiego Centrum Medycyny Weterynaryjnej UJ-UR Mikrobiologia weterynaryjna rok 2013/2014 semestr letni Wykłady: czwartek: 10.45-12.15 sala wykładowa, Katedra Mikrobiologii,

Bardziej szczegółowo

Program ćwiczeń z mikrobiologii dla studentów III roku Oddziału Analityki Medycznej, rok akademicki 2014/2015 SEMESTR LETNI

Program ćwiczeń z mikrobiologii dla studentów III roku Oddziału Analityki Medycznej, rok akademicki 2014/2015 SEMESTR LETNI Program ćwiczeń z mikrobiologii dla studentów III roku Oddziału Analityki Medycznej, rok akademicki 2014/2015 SEMESTR LETNI Wykłady (16 godz.): Środa 12.15-13.45 Ćwiczenia (60 godz.) środa: 9.45-12.00

Bardziej szczegółowo

Zadanie 2. (2 pkt) Na schemacie przedstawiono namnażanie się retrowirusa HIV wewnątrz limfocytu T (pomocniczego) we krwi człowieka.

Zadanie 2. (2 pkt) Na schemacie przedstawiono namnażanie się retrowirusa HIV wewnątrz limfocytu T (pomocniczego) we krwi człowieka. Zadanie 1. (3 pkt) W aptekach dostępne są bez recepty różnego rodzaju preparaty lecznicze podnoszące odporność, zwane immunostymulatorami. Przeważnie zawierają substancje pochodzenia roślinnego, np. z

Bardziej szczegółowo

Iwona Mruk. Katedra Mikrobiologii Wydział Biologii Uniwersytet Gdański AUTOREFERAT

Iwona Mruk. Katedra Mikrobiologii Wydział Biologii Uniwersytet Gdański AUTOREFERAT Iwona Mruk Katedra Mikrobiologii Wydział Biologii Uniwersytet Gdański AUTOREFERAT Gdańsk 2013 1. IMIĘ, NAZWISKO, ADRES DO KORESPONDENCJI dr Iwona Mruk Katedra Mikrobiologii Wydział Biologii Uniwersytet

Bardziej szczegółowo

Wielolekooporne Gram-ujemne,,superbakterie" oraz powodowane przez nie zakażenia wewnątrzszpitalne.

Wielolekooporne Gram-ujemne,,superbakterie oraz powodowane przez nie zakażenia wewnątrzszpitalne. Wielolekooporne Gram-ujemne,,superbakterie" oraz powodowane przez nie zakażenia wewnątrzszpitalne. Na przełomie XX i XXI wieku głównym problemem w szpitalach i placówkach opieki zdrowotnej w Europie oraz

Bardziej szczegółowo

Postęp wiedzy w zakresie wpływu genetyki na ujawnianie się PMWS w stadzie świń

Postęp wiedzy w zakresie wpływu genetyki na ujawnianie się PMWS w stadzie świń Postęp wiedzy w zakresie wpływu genetyki na ujawnianie się PMWS w stadzie świń PMWS (Post-weaning multisystemic wasting syndrome) Zespół wyniszczenia poodsadzeniowego u świń Pierwsze objawy choroby zarejestrowano

Bardziej szczegółowo

ANTYBIOTYKOOPORNOŚĆ: ZAGROŻENIE DLA ZDROWIA PUBLICZNEGO

ANTYBIOTYKOOPORNOŚĆ: ZAGROŻENIE DLA ZDROWIA PUBLICZNEGO ANTYBIOTYKOOPORNOŚĆ: ZAGROŻENIE DLA ZDROWIA PUBLICZNEGO materiał prasowy Europejskiego Dnia Wiedzy o Antybiotykach i Światowego Tygodnia Wiedzy o Antybiotykach Antybiotyki jeszcze do niedawna były najskuteczniejszą

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecnośd Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

Odporność zestaw wszystkich mechanizmów biorących udział w wytworzeniu odpowiedzi odpornościowej. W znaczeniu bardziej ogólnym oznacza zdolność do

Odporność zestaw wszystkich mechanizmów biorących udział w wytworzeniu odpowiedzi odpornościowej. W znaczeniu bardziej ogólnym oznacza zdolność do Odporność zestaw wszystkich mechanizmów biorących udział w wytworzeniu odpowiedzi odpornościowej. W znaczeniu bardziej ogólnym oznacza zdolność do czynnej i biernej ochrony organizmu przed patogenami.

Bardziej szczegółowo

Scenariusz lekcji, przeprowadzonej w klasie II/III szkoły ponadgimnazjalnej, z przyrody

Scenariusz lekcji, przeprowadzonej w klasie II/III szkoły ponadgimnazjalnej, z przyrody Scenariusz lekcji, przeprowadzonej w klasie II/III szkoły ponadgimnazjalnej, z przyrody 1. Wątek i TEMAT: B. Nauka i technologia 9. Wynalazki, które zmieniły świat Temat 32: Nowoczesne szczepionki (wycieczka)

Bardziej szczegółowo

Analysis of infectious complications inf children with acute lymphoblastic leukemia treated in Voivodship Children's Hospital in Olsztyn

Analysis of infectious complications inf children with acute lymphoblastic leukemia treated in Voivodship Children's Hospital in Olsztyn Analiza powikłań infekcyjnych u dzieci z ostrą białaczką limfoblastyczną leczonych w Wojewódzkim Specjalistycznym Szpitalu Dziecięcym w Olsztynie Analysis of infectious complications inf children with

Bardziej szczegółowo