ENDOKRYNOLOGIA POLSKA
|
|
- Henryka Jasińska
- 8 lat temu
- Przeglądów:
Transkrypt
1 E P ENDOKRYNOLOGIA POLSKA POLISH JOURNAL OF ENDOCRINOLOGY ORIGINAL PAPERS
2 / ORIGINAL PAPERS Endokrynologi Polsk / Polish Journl of Endocrinology Tom/Volume 54; Numer/Numer 4/2003 ISSN X Serum ldosterone level in ptients with the thyroid function normlities. Prt I. Hyperthyroidism Czesłw Mrcisz, Eugeniusz Józef Kuchrz 1, Gerrd Jonderko, Mgdlen Mrcisz, Grzegorz Nowkowski Deprtment of Internl Medicine, Medicl University of Silesi, Ktowice, Polnd 1 Deprtment of Internl Medicine nd Rheumtology, Medicl University of Silesi, Ktowice, Polnd Summry The im of the study ws evlution of influence of hyperthyroidism during therpy on sl nd poststimultory serum ldosterone level in reltion to plsm renin ctivity nd plsm tril ntriuretic peptide level. Investigtions were crried out in 74 ptients with hyperthyroidism nd 37 helthy controls. Serum level of ldosterone, plsm renin ctivity nd tril ntriuretic peptide level s well s ldosterone/plsm renin ctivity rtio were determined in ll investigted sujects under sl conditions (fter 3 dys of ppliction of norml sodium diet nd lying position fter 8 hr of ed rest) nd fter stimultion with low-sodium diet for three dys nd upright position for 3 hr. The ptients with hyperthyroidism were evluted three times, efore initition of the therpy, two weeks fter thimzole tretment nd fter ttinment of euthyroid stte (men 9 months). An increse in poststimultory plsm renin ctivity nd serum ldosterone level under sl conditions s well s plsm tril ntriuretic peptide level under sl nd poststimultory conditions were found in the ptients. The poststimultory ldosterone/ plsm renin ctivity rtio ws lower in the hyperthyroid ptients thn in the controls. A negtive correltion etween ldosterone level nd tril ntriuretic peptide level ws shown in the ptients fter ppliction of low sodium diet nd upright position. It is concluded tht in the hyperthyroid ptients n increse in serum ldosterone under sl condition nd lterl ldosterone/plsm renin ctivity rtio indicte for uncoupling in the reninngiotensin-ldosterone system. Key words: hyperthyroidism, serum ldosterone, uncoupling in renin-ldosterone system Czesłw Mrcisz, MD, PhD Deprtment of Internl Medicine, Medicl University of Silesi, ul. Edukcji 102, Tychy, Polnd Aldosteronemi u chorych z zurzenimi czynności trczycy. Część I. Ndczynność trczycy Czesłw Mrcisz, Eugeniusz Józef Kuchrz 1, Gerrd Jonderko, Mgdlen Mrcisz, Grzegorz Nowkowski Ktedr i Oddził Kliniczny Choró Wewnętrznych, Śląsk Akdemi Medyczn, Ktowice 1 Ktedr i Klinik Choró Wewnętrznych i Reumtologii, Śląsk Akdemi Medyczn, Ktowice Streszczenie Celem prcy ył ocen wpływu ndczynności trczycy (NdT) podczs leczeni n ldosteronemię podstwową i postymulcyjną z uwzględnieniem ktywności reninowej osocz (ARO) i stężeni przedsionkowego peptydu ntriuretycznego (ANP) w osoczu. Bdni przeprowdzono u 74 chorych z NdT i 37 osó zdrowych, stnowiących grupę kontrolną. U wszystkich dnych osó oznczono stężenie ldosteronu (Aldo) w surowicy krwi, ARO i stężenie ANP w osoczu orz określono wskźnik Aldo/ARO njpierw w wrunkch podstwowych, czyli po trzydniowej diecie normosodowej i w pozycji leżącej po 8 godzinch odpoczynku nocnego i drugi rz po stymulcji trzydniowym stosowniem diety uogosodowej i 3 godzinch pionizcji. U chorych z NdT dni powtórzono po 2 tygodnich stosowni metizolu i w okresie uzysknej eutyreozy, średnio po 9 miesiącch leczeni. W porównniu z grupą kontrolną u chorych z NdT wykzno istotne zwiększenie podstwowej ldosteronemii, postymulcyjnej ARO i stężeni ANP oznczonego w ou wrunkch. U chorych z NdT wielkość postymulcyjnego wskźnik Aldo/ARO ył istotnie mniejsz niż w grupie kontrolnej. W wrunkch diety uogosodowej połączonej z pionizcją wykzno u chorych z NdT ujemną współzmienność pomiędzy stężeniem Aldo i ANP. Autorzy wnioskują, że u chorych z NdT występuje zwiększenie ldosteronemii podstwowej; w nstępstwie zś stosowni diety uogosodowej i pionizcji stwierdz się nieprwidłową wielkość wskźnik Aldo/ARO, co przemwi z rozkojrzeniem w ukłdzie reninowongiotensynowo-ldosteronowym. Słow kluczowe: ndczynność trczycy, ldosteronemi, rozkojrzenie reninowo-ldosteronowe 401
3 Aldosteron w ndczynności trczycy Mrcisz C. Introduction Thyroid function normlities re ssocited with numer of system nd orgn mnifesttion. It is well known tht hyperthyroidism nd hypothyroidism result in severe involvement in the crdiovsculr system, including chnges in lood pressure. Aldosterone (Aldo) is one of the hormones responsile for lood pressure control. Serum level of Aldo in ptients with hyperthyroidism ws reported to e norml [1-6] or enhnced [7, 8]. The lst findings reveled to ptients with moderte or severe hyperthyroidism [7]. The poststimultory increse in serum Aldo ws found to e lower in hyperthyroid ptients thn in the helthy controls [5, 9], nd ws suggested to result from chronic depletion of potssium in the ptients [9]. Degrdtion of Aldo ws found to e ccelerted in the ptients with hyperthyroidism s it ws shown y enhnced metolic clernce of this hormone [3, 9] nd shortening of its hlf-life time fter intrvenous injection of tritium leled Aldo to the hyperthyroid ptients [3]. Incresed urinry output of Aldo ws reported in ptients with hyperthyroidism [2]. Additionlly, in hyperthyroid ptients, impired Aldo secretion response to ngiotensin II ws found [2, 8] nd it indictes for functionl uncoupling of the renin-ngiotensin-ldosterone system. The mechnism of this phenomenon remins uncler. The present study ws designed to evlute the sl nd poststimultory serum Aldo level in reltion to plsm renin ctivity (PRA) nd plsm tril ntriuretic peptide (ANP) level in ptients with hyperthyroidism during therpy. therpy, two weeks fter thimzole tretment nd fter ttinment of euthyroid stte (verge fter 9 months of therpy). The control group consisted of 37 helthy individuls ged 32.2 ± 8.4 yr. (35 femle, 2 mle). They were evluted only once. Blood ws smpled from the ulnr vein t AM fter n overnight fsting. The following indices were mesured with rdioimmune methods: Aldo level nd PRA (Institute for Reserch, Production nd Appliction of Rdioisotopes, Prgue, Czech Repulic), ANP level (Amershm, UK), T 3, T 4 (Deprtment of Rdioimmunology, OBRI, Świerk ner Otwock, Polnd), ft 4 nd ft 3 (Amershm, UK), TSH (Frmos Dignostic, Finlnd). Serum sodium nd potssium level ws determined with ionoselective electrodes. The rtio Aldo level/pra ws clculted. The mesurements ech time were done twice, under sl conditions i. e. in lying position fter 8 hr of ed rest nd fter ppliction of diet contining 120 mmol of sodium nd 70 mmol of potssium dily, for three dys. The second mesurements were done fter stimultion with low-sodium diet (10 mmol of sodium nd 70 mmol of potssium dily) for three dys nd upright position for 3hr. At lest 15 hr efore lood smpling the ptients were restricted for smoking, coffee or lck tee drinking. Sttisticl nlysis ws crried out with the Student s t-test for pired results nd with the Fisher F, Stterthwite s or Student s t-tests for unpired dt. Liner regression ws clculted. The proility less or equl p = 0.05 ws considered sttisticlly significnt. Ptients nd methods Seventy-four ptients with hyperthyroidism ged 33.5 ± 9.1 yr. (70 femle, 4 mle) were investigted. Hyperthyroidism ws cused y Grves disese in 60 ptients nd y nodulr toxic goiter in remining 14 ptients. Dignosis of hyperthyroidism ws mde on the se of clinicl evlution nd mesurement of serum hormone levels: totl thyroxine (T 4 ), totl triiodothyronine (T 3 ), free thyroxine (ft 4 ), free triiodothyronine (ft 3 ), nd thyrothropin (TSH). The ptients with circultory filure, renl, heptic nd endocrine or metolic disese s well s those with hypertension (lood pressure higher thn 160/90 mm Hg) nd pregnnt or lctting women were excluded from the study. Ptients receiving ny tretment two weeks prior to the study nd individuls older thn 50 yr. were lso excluded. All ptients were treted with thimzole (1-methyl-2-imidzolothiol, Polf Polnd) in dily dose of mg (verge dose 54.5 mg) The drug in this dose ws given t lest for 2 weeks then the dose ws tpered to 5-10 mg/dy. The ptients were evluted three times, efore initition of the Results Tle I summrizes the otined results. Under sl conditions serum Aldo level ws higher in the untreted hyperthyroid ptients thn in the controls. There ws no difference etween the ptients nd controls fter ppliction of low sodium diet lthough this diet resulted in significnt increse in serum Aldo level in ll investigted groups. There ws no difference etween the ptients nd controls in sl PRA. Appliction of low sodium diet resulted in enhncement of PRA. This increse ws the highest in the untreted hyperthyroid ptients nd ws smller during therpy. There ws no difference in poststimultory PRA in the hyperthyroid ptients fter ttinment of euthyroid stte nd the controls. Under sl conditions, the Aldo/PRA rtio ws similr in the ptients nd the controls nd ws decresed fter ppliction of low sodium diet in the untreted ptients nd those receiving therpy for two weeks. An increse in plsm sl nd stimulted ANP levels ws oserved in the ptients efore the initition of the tretment nd fter two weeks of therpy. The 402
4 Endokrynologi Polsk / Polish Journl of Endocrinology 2003; 4 (54) Tle I. Serum ldosterone (Aldo), plsm tril ntriuretic peptide (ANP) levels, plsm renin ctivity (PRA) in hyperthyroid ptients during therpy nd helthy individuls (x ± SEM) Prmeter Hyperthyroid ptients (n = 74) Helthy individuls (n = 37) Sttisticl significnce of difference Serum Aldo level (pg/ml) PRA (ng/ml/h) Aldo/PRA index Before tretment A ± ± 16.3*** 1.76 ± ± 0.51*** ± ± 5.5*** Short-term tretment B ± ± 15.7*** 1.61 ± ± 0.45*** ± ± 4.3*** Long-term tretment (euthyroid stte) C ± ± 21.6 *** 1.47 ± ± 0.56*** ± ± 15.5 H ± ± 38.5*** A : H < 0.01 C : A < 0.01 (p) 1.63 ± ± 0.81*** A : H < 0.001; B : H < 0.05; B : A < 0.05; C : A < ± ± 10.1 A:H < 0.05; B:H < 0.05 Plsm ANP level (pg/ml) 87.6 ± ± 3.0** 72.4 ± ± ± ± ± ± 2.6* A:H < 0.001; B:H<0.001; B:A < 0.001; C:A<0.001; C:B < 0.001; A:H<0.001; B:H < 0.001; C: H<0.01; B:A < 0.001; C:A< 0.001; C:B< 0.01 Serum sodium level (mmol/l) ± ± ± ± ± ± ± ± 0.50 C : A < 0.01 Serum potssium level (mmol/l) 4.47 ± ± 0.04* 4.46 ± ± 0.03*** 4.44 ± ± 0.03** 4.43 ± ± 0.07 *p<0.05 vs vlue of sl conditions; **p<0.01 vs vlue of sl conditions; ***p<0.001 vs vlue of sl conditions. - sl conitions; - low-sodium diet nd upright position. smll difference in stimulted levels ws still visile in euthyroid ptients. There ws no difference etween the ptients nd controls in serum sodium nd potssium levels. Under sl conditions, wek positive correltion ws found etween serum Aldo level nd PRA in the untreted ptients (r=0.26, p<0.05) nd fter two weeks of mngement with thimzole (r=0.24, p<0.05). In the untreted ptients nd those fter ttinment of euthyroid stte, under conditions of low sodium diet, negtive correltion etween serum Aldo level nd plsm ANP level ws shown (r= -0.31, p<0.01 nd r=-0.25, p<0.05, respectivelly). In the control group under stimulted conditions, high positive correltion ws found etween PRA nd serum Aldo level (r=0.59, p<0.001). Discussion Serum Aldo level determined under sl conditions in ptients with hyperthyroidism ws shown to e higher thn in the helthy controls. This finding is concomitnt with reports of Tked et l. [8] nd Mtwiejenko et l. [7] s well s with enhnced serum Aldo level found in ptients with severe hyperthyroidism y Ogihr et l. [4]. There re lso reports of norml serum Aldo under conditions of n excess of thyroid hormones [1-6] lthough some tendency to enhnce serum Aldo ws found in these reports. The discrepnt results of serum Aldo ws reported in niml models of hyperthyroidism [2, 11] It is possile tht n ltered serum Aldo level in the ptients is relted to potssium metolism. Cin et l. [9] suggested tht chronic potssium depletion my e responsile for ltered relese of Aldo. They oserved decresed Aldo level in ptients with hyperthyroidism nd potssium deficiency. Incresed dietry supply of potssium resulted in significnt enhncement of serum Aldo. The reports indicting for norml serum Aldo level in ptients with hyperthyroidism descried significntly lower potssium level in the ptients [6]. In descried study, there were no differences in potssium level under sl conditions, thus differences in serum Aldo could not result from ltered serum potssium. This finding 403
5 Aldosteron w ndczynności trczycy Mrcisz C. ws supported y report of Montiel et l. [11]. Using n niml model of hyperthyroidism, they found n increse in serum Aldo in hyperthyroid rts which ws not ccompnied y ltered serum potssium level. Stimultion with low-sodium diet nd the upright position resulted in incresed Aldo levels in ptients with hyperthyroidism, which were comprle to the effect oserved in helthy individuls, despite of more pronounced escltion of PRA in these sujects efore tretment. This is consistent with the results otined y Asmh et l. [1], who oserved similr increse in Aldo levels nd two-fold increse in plsm renin concentrtions in sujects with hyperthyroidism compred with euthyroid ptients, fter stimultion with furosemide. In our previous study we showed tht intensity of Aldo relese fter stimultion in sujects with hyperthyroidism ws not dependent on slt-sensitivity of rteril lood pressure [12]. In the present study there ws lso no correltion etween poststimultory PRA nd serum Aldo level in the ptients with hyperthyroidism while such correltion ws reveled in the helthy individuls. This finding is similr to others reports [5, 10]. It indictes tht n excess of thyroid hormones leds to uncoupling of the renin-ngiotensinldosterone system. As result the Aldo/PRA ws found to e significntly decresed in the hyperthyroid ptients. A decresed Aldo/PRA rtio ws shown only in ptients under conditions of low sodium diet nd upright position. Under sl conditions, there ws no difference etween the ptients with hyperthyroidism nd the controls. Shigemtsu et l. [10] reported decrese in the Aldo/PRA rtio found in hyperthyroid ptients only fter stimultion. The decrese disppered when the ptients ttined the euthyroid stte. The presented results re in greement with the report of Shigemtsu et l. [10]. The uncoupling of the renin-ngiotensin-ldosterone system ws reported in other ppers s well [5, 9]. The mechnism of this poststimultory uncoupling in ptients with hyperthyroidism remins unknown. An intrvenous infusion of ngiotensin II in hyperthyroid ptients or in nimls with n excess of thyroid hormones resulted in enhncement of serum Aldo level which ws significntly lower thn in the helthy controls [2, 8]. It indictes tht Aldo relese due to ngiotensin II is impired under conditions of hyperthyroidism. The decresed rectivity of the ngiotensin receptors in the suprrenl glnds my e responsile for the oserved phenomenon. On the other hnd, Serni et l. [13] did not found chnges in the density of ngiotensin receptors in the suprrenl glnds of dogs treted for 14 dys with triiodothyronine. ANP ws found to e potent inhiitor of Aldo secretion [14, 15] lso under conditions of stimultion of Aldo relese y ngiotensin II [16, 17]. Our results support the concept tht ANP responsile for the inhiition of Aldo relese under conditions of low sodium diet nd upright position in the ptients with hyperthyroidism. In these ptients, negtive correltion etween serum Aldo level nd ANP level ws shown. Moreover, serum ANP level ws found to e higher in the ptients under low sodium diet nd upright position s compred to the ptients under sl conditions. A negtive correltion etween serum Aldo level nd PRA ws shown lso in the ptients who ttined euthyroid stte. In these ptients, the Aldo/PRA rtio ws norml which seems to e relted to the norml serum ANP level. It is concluded tht uncoupling of the renin-ngiotensin-ldosterone system is cumultive result of n excess of ANP nd thyroid hormones. Appliction of low sodium diet nd upright position in the ptients with hyperthyroidism is ssocited with n increse of serum potssium without ltertion in serum sodium level. It my e cused y hyperthyroidism-induced trnsminerliztion of uncler mechnism. An increse in serum potssium effects synthesis nd relese of Aldo. The erlier mentioned works of Cin et l. [9] nd Kigoshi et l. [2] showed tht dministrtion of potssium or drenocorticotropic hormone to hyperthyroid mice cused n increse in serum Aldo similr to tht found in helthy nimls. It my e hypothesized tht n increse in serum potssium level in hyperthyroid ptients is compenstory mechnism to uncoupling of the renin-ngiotensin-ldosterone system. The higher poststimultory increse in Aldo in these ptients reported in this study confirmed this hypothesis. This increse ws higher thn reported y others [5, 9]. Further studies on the regultory mechnism of Aldo synthesis nd secretion re needed. Conclusions 1. Hyperthyroidism is ssocited with n increse of serum ldosterone level under sl conditions 2. Appliction of low sodium diet nd upright position in ptients with hyperthyroidism cuses decrese in ldosterone/renin rtio suggesting the uncoupling in the renin-ngiotensin-ldosterone system. Suppression of ldosterone secretion y tril ntriuretic peptide is proposed s the mechnism contriuting to this phenomenon. References 1. Asmh BJ, Wn Nzimoon WM, Norzmi K et l. Plsm renin nd ldosterone in thyroid diseses. Horm Met Res 1997; 29: Kigoshi T, Kneko M, Nkno S et l. Aldosterone response to vrious stimuli in hyperthyroidism: in vivo nd in vitro 404
6 Endokrynologi Polsk / Polish Journl of Endocrinology 2003; 4 (54) studies. Nippon Niunpi Gkki Zsshi 1993; 69: (str.) 3. Luetscher JA, Cohn AP, Cmrgo CA et l. Aldosterone secretion nd metolism in hyperthyroidism nd myxedem. J Clin Endocrinol Met 1963; 23: Ogihr T, Ht T, Mruym A et l. Blood pressure reponse to n ngiotensin II ntgonist in thyrotoxic ptients with nd without high lood pressure. Endocrinol Jpn 1980; 27: Słowińsk-Srzednick J, Zgliczyński S, Czech W. Dysocjcj ukłdu reninowo-ngiotensynowo-ldosteronowego w ndczynności trczycy. Pol Tyg Lek 1984; 39: Sucheck-Rchoń K, Wyrzykowski B, Krup-Wojciechowsk B. Ukłd renin-ngiotensyn-ldosteron i gospodrk elektrolitow u koiet chorych n ndczynność trczycy. Pol Tyg Lek 1987; 36: Mtwiejenko EG, Goroiec WF, Dustow AD. Sostojnie sistemy renin-ngiotenzin-ldosteron pri tireoidnoj ptołogii po dnnym rdioimmunologiczeskowo nliz. Ter Arch 1987; 59: Tked Y, Miymori I, Iked M et l. Responses of plsm rdykinin nd the renin ngiotensin xis to ngiotensin II in hyperthyroid ptients. Nippon Niunpi Gkki Zsshi 1986; 62: (str). 9. Cin JP, Dluhy RG, Willims GH et l. Control of ldosterone secretion in hyperthyroidism. J Clin Endocrinol Met 1973; 36: Shigemtsu S, Iwski T, Aizw T et l. Plsm tril ntriuretic peptide, plsm renin ctivity nd ldosterone during tretment of hyperthyroidism due to Grves disese. Horm Met Res 1989; 21: Montiel M, Jimenez E, Nrvez JA, Morell M. Reninngiotensin-ldosterone system in hyper- nd hypothyroid rts during sodium depletion. Endocrine Res Commun ; 9: Mrcisz C, Jonderko G, Kuchrz EJ. Influence of short-time ppliction of low sodium diet on lood pressure in ptients with hyperthyroidism or hypothyroidism during therpy. Am J Hypertens 2001; 14: Serni C, Mrchnt C, Brown L, Hoey A. Crdic ngiotensin receptors in experimentl hyperthyroidism in dogs. Crdiovsc Res 1993; 27: Bruun NE, Skott P, Giese J. Renl nd endocrine effects of physiologicl vritions of tril ntriuretic fctor in norml humns. Am J Physiol 1991; 260: R217-R Clinkingerd C, Sessions Ch, Shenker Y. The physiologicl role of tril ntriuretic hormone in the regultion of ldosterone nd slt nd wter metolism. J Clin Endocrinol Met 1990; 70: Atrshi K, Mulrow PJ, Frnco-Senz R et l. Inhiition of ldosterone production y n tril extrct. Science 1984; 224: Needlemn PH, Greenwld JE. Atriopeptin: crdic hormone intimtely involved in fluid, electrolyte nd loodpressure homeostsis. N Engl J Med 1986; 314:
7 / ORIGINAL PAPERS Endokrynologi Polsk / Polish Journl of Endocrinology Tom/Volume 54; Numer/Numer 4/2003 ISSN X Serum ldosterone level in ptients with the thyroid function normlities. Prt II. Hypothyroidism Czesłw Mrcisz, Eugeniusz Józef Kuchrz 1, Gerrd Jonderko, Jonn Strszeck Deprtment of Internl Medicine, Medicl University of Silesi, Ktowice, Polnd 1 Deprtment of Internl Medicine nd Rheumtology, Medicl University of Silesi, Ktowice, Polnd Summry The im of the study ws evlution of influence of hypothyroidism on sl nd poststimultory serum ldosterone level in reltion to plsm renin ctivity nd plsm tril ntriuretic peptide level. Investigtions were crried out in 31 ptients with primry hypothyroidism (efore initition of therpy nd fter ttinment of euthyroid stte due to mngement with L-thyroxine). Serum level of ldosterone, plsm renin ctivity nd tril ntriuretic peptide level s well s ldosterone/ plsm renin ctivity rtio were determined in ll sujects under sl conditions (fter 3 dys of ppliction of norml sodium diet nd lying position fter 8 hr. of ed rest) nd fter stimultion with low-sodium diet for three dys nd upright position for 3 hr). An increse in serum sl ldosterone level nd decrese in plsm renin ctivity under sl nd poststimultory conditions were found in the untreted ptients. The ldosterone/ plsm renin ctivity rtio ws higher under sl conditions. Smll differences in plsm ANP were seen fter ttinment of euthyreosis. It is concluded tht in hypothyroid ptients n increse in ldosterone level nd uncoupling in the renin-ldosterone system re found under sl conditions. Key words: hypothyroidism - serum ldosterone level - uncoupling in the renin-ldosterone system. Czesłw Mrcisz, MD, PhD Deprtment of Internl Medicine, Medicl University of Silesi, ul. Edukcji 102, Tychy, Polnd Aldosteronemi u chorych z zurzenimi czynności trczycy. Część II. Niedoczynność trczycy Czesłw Mrcisz, Eugeniusz Józef Kuchrz 1, Gerrd Jonderko, Jonn Strszeck Ktedr i Oddził Kliniczny Choró Wewnętrznych, Śląsk Akdemi Medyczn, Ktowice 1 Ktedr i Klinik Choró Wewnętrznych i Reumtologii, Śląsk Akdemi Medyczn, Ktowice Streszczenie Celem prcy yło ustlenie wpływu niedoczynności trczycy (NiedT) n ldosteronemię podstwową i postymulcyjną z uwzględnieniem ktywności reninowej osocz (ARO) i stężeni przedsionkowego peptydu ntriuretycznego (ANP) w osoczu. Bdni przeprowdzono u 31 chorych z pierwotną NiedT przed leczeniem i w okresie eutyreozy uzysknej leczeniem L-tyroksyną i u 24 osó zdrowych stnowiących grupę kontrolną. U wszystkich dnych osó oznczono stężenie ldosteronu (Aldo) w surowicy krwi, ARO i stężenie ANP w osoczu orz wielkość wskźnik Aldo/ ARO, dwukrotnie, njpierw w wrunkch podstwowych, czyli w pozycji leżącej i po trzydniowym stosowniu diety normosodowej i powtórnie po trzydniowej diecie uogosodowej i trzygodzinnej pionizcji. W porównniu z grupą kontrolną u nie leczonych chorych z NiedT ldosteronemi podstwow ył istotnie wyższ ARO podstwow i postymulcyjn istotnie niższ, wielkość zś wskźnik Aldo/ARO dnego w wrunkch podstwowych ył wyższ. Podczs leczeni L-tyroksyną w okresie eutyreozy stężenie ANP w osoczu yło wyższe niż w grupie kontrolnej. Autorzy wnioskują, że chorych z NiedT dnych w wrunkch podstwowych cechuje zwiększenie ldosteronemii i rozkojrzenie ukłdu reninowo-ldosteronowego Słow kluczowe: niedoczynność trczycy, ldosteronemi, rozkojrzenie reninowo-ldosteronowe 406
8 Endokrynologi Polsk / Polish Journl of Endocrinology 2003; 4 (54) Introduction In the prt I of the study, significnt chnges in serum ldosterone (Aldo) level in ptients with hyperthyroidism were reported [1]. There re lso reports indicting for disturnces of Aldo level in ptients with hypothyroidism. It ws found tht secretion of Aldo in hypothyroid ptients ws only slightly diminished ut its hlf-life time ws significntly prolonged nd metolic clernce ws impired [2]. The evlution of serum Aldo level in ptients with hypothyroidism reveled contrdictory results, lower [3, 4] or higher [5, 6] thn in the helthy individuls were reported s well s some studies did not found difference etween the hypothyroid ptients nd the controls [7-11]. Stimultion of Aldo secretion with ngiotensin II, drenocorticotropic hormone, potssium or furosemide ws found to produce lower increse in Aldo in hypothyroid ptients thn in the helthy individuls [4]. Similr finding were reported in niml models of hypothyroidism. Appliction of low sodium diet to these nimls resulted in smller enhncement of Aldo secretion thn in the helthy nimls [12]. It hs een concluded tht responsiveness of the suprrenl glnd to stimuli of Aldo secretion is impired under conditions of the thyroid hormone deficiency. The present study ws designed to evlute serum Aldo level in ptients with hypothyroidism during therpy including sl nd poststimultory plsm renin ctivity (PRA) nd plsm level of tril ntriuretic peptide (ANP). Ptients nd methods Thirty one ptients with primry hypothyroidism ged 38.1 ± 1.5 yr. (26 femle, 5 mle) nd 24 helthy individuls (22 femle, 2 mle) ged 35.4 ± 1.8 yr. were investigted. Dignosis of hypothyroidism ws mde on the se of clinicl evlution nd serum hormone level. Ptients with circultory filure, metolic diseses, lood pressure higher thn 160/90 mm Hg, pregnnt women or receiving tretment in the lst 2 weeks prior investigtion were excluded from the study. All investigted sujects were younger thn 50 yr. The ptients were investigted efore introduction of the therpy nd fter ttinment of euthyroid stte (on n verge 12 months lter). The ptients were treted with L-thyroxin (Eltroxin, Glxo) in dily dose µg (men dose 198 µg). The controls were investigted only once. Blood ws smpled from the ulnr vein t AM fter n overnight fsting. The following indices were mesured with rdioimmune methods: Aldo level nd PRA (Institute for Reserch, Production nd Appliction of Rdioisotopes, Prgue, Czech Repulic), ANP level (Amershm, UK), triiodothyronine (T 3 ), thyroxine (T 4 ) (Deprtment of Rdioimmunology, OBRI, Świerk ner Otwock, Polnd), free T 4 nd free T 3 (Amershm, UK), thyrotropin (TSH) (Frmos Dignostic, Finlnd). Serum sodium nd potssium level ws determined with ionoselective electrodes. The rtio Aldo level/pra ws clculted. The mesurements ech time were done twice, under sl conditions (i. e. in lying position fter 8 hr of ed rest nd fter ppliction of diet contining 120 mmol of sodium nd 70 mmol of potssium dily, for three dys). The second mesurements were done fter stimultion with low-sodium diet (10 mmol of sodium nd 70 mmol of potssium dily) for three dys nd upright position for 3 hr. At lest 15 hr efore lood smpling investigted persons were restricted for smoking, coffee or lck te drinking. Sttisticl nlysis ws crried out with the Student s t-test for pired results nd with the Fisher F, Stterthwit s or Student s t-test for unpired dt. Liner regression ws clculted. The proility less or equl to p=0.05 ws considered s sttisticlly significnt. Results Tle I summrizes the results of the determined indices in the ptients nd controls. An increse in serum Aldo level ws found in the ptients with hypothyroidism under sl conditions. Appliction of low sodium diet nd upright position resulted in significnt increse in serum Aldo level in ll investigted groups of sujects. PRA ws lower in the untreted hypothyroid ptients under sl conditions s compred with the controls. Similrly, PRA ws low in the untreted ptients fter stimultion nd incresed in those fter ttinment of euthyroid stte. The Aldo/PRA rtio under sl condition ws higher in the untreted ptients thn in those fter therpy or the controls. There ws lso significnt difference in plsm ANP etween the group of the thyroxine-treted ptients nd controls. Sustitution with L-thyroxine nd susequent euthyreosis resulted in incresed plsm ANP level tht ws higher thn in helthy individuls. There ws no difference in serum sodium level. In the setting of low sodium diet ppliction serum potssium level in the ptients ws higher thn tht in the controls despite the tretment. Discussion The present study hs shown tht serum Aldo level in ptients with hypothyroidism evluted under sl conditions ws higher thn in the helthy individuls. This suject is controversil in previously pulished reports. Most of the studies indicte for norml Aldo level in ptients with hypothyroidism [7-11]. Serum Aldo level is relted 407
9 Aldosteron w niedoczynności trczycy Mrcisz C. Tle I. Aldosterone (Aldo), plsm tril ntriuretic peptide (ANP) levels, plsm renin ctivity (PRA) in hypothyroid ptients during therpy nd helthy individuls (x ± SEM) Prmeter Hypothyroid ptients (n = 31) Helthy persons (n = 24) Sttisticl significnce of difference Serum Aldo level (pg/ml) PRA (ng/ml/h) Aldo/PRA index Plms ANP level (pg/ml) Before tretment A ± ± 30.1*** 1.12 ± ± 0.45*** ± ± ± ± 2.2 After ttinment of euthyroid stte B H ± ± 32.6*** 1.36 ± ± 0.85*** ± ± 12.1** 52.0 ± ± 2.6* ± ± 51.0*** 1.60 ± ± 0.98*** ± ± ± ± 2.6* (p) A : H < 0.01; B : H < 0.05 A : H < 0.01 A : H < 0.01; B : A < A : H < 0.05 B : A < 0.01 B : H < 0.05; B : A < 0.05 B : H < 0.01 Serum sodium level (mmol/l) ± ± ± ± ± ± 0.55 Serum potssium level (mmol/l) 4.48 ± ± 0.06** 4.53 ± ± 0.07** 4.32 ± ± 0.05 B : H < 0.05 A : H < 0.05; B : H < 0.01 *p<0.05 vs vlue of sl conditions; **p<0.01 vs vlue of sl conditions; ***p<0.001 vs vlue of sl conditions. - sl conitions; - low-sodium diet nd upright position. to the hormone secretion in the suprrenl glnds, the process regulted y numer of fctors nd rte of degrdtion of Aldo. Luetscher et l. [2] descried decrese in metolic clernce of Aldo nd significnt increse in the hormone turnover hlf-time in ptients with hypothyroidism. Arlot et l. [5] oserved n increse in serum Aldo level in hypothyroid ptients nd suggested tht it ws cused y hypovolemi. Infusion of isotonic or hipotonic fluid to the ptients resulted in decrese Aldo level in the ptients. Fommei nd Iervsi [6] showed two-fold increse in serum Aldo levels in the ptients with short-term hypothyroidism resulting from totl thyroidectomy compred with euthyroid sujects. A trend to enhnce serum Aldo ws lso shown y Mtwiejenko et l. [13] in ptients with light hypothyroidism. Our results of studies in ptients with light or moderte hypothyroidism re concordnt with these investigtions. The lck of correltion etween serum Aldo level nd PRA reported in this study nd n increse in Aldo/PRA rtio in ptients with hypothyroidism indicte for dissocition in the renin-ngiotensinldosterone system under conditions of the thyroid hormone deficiency. This phenomenon is impired fter ppliction of low sodium diet nd upright position. Lck of correltion of serum Aldo level nd PRA in hypothyroid ptients ws lso reported in nother report [4]. The otined results lso indicte for lck of correltion etween serum Aldo level nd thyroid hormone concentrtions. Studies on niml model of hypothyroidism reveled significntly decresed rectivity of the renl Aldo receptors [14]. Thyroid hormone deficiency ws reported to e ssocited with decresed N, K-ATP-se in the renl tuule [14]. Administrtion of triiodothyronine restored the enzyme ctivity only in presence of Aldo. On the se of these findings it cn e hypothesized the reported increse in serum Aldo level in the hypothyroid ptients is compenstory mechnism to impired Aldo receptor rectivity. Evlution of the renl Aldo receptors in the hypothyroid ptients is needed for further evlution of this hypothesis. In the present study, stimultion of the Aldo secretion with low sodium diet ws found to led to the similr increse in Aldo level in the hypothyroid ptients nd helthy controls. In our previously pulished study concerning the issue of slt-sensitivity of rteril lood pressure in ptients with thyroid function disorders, we showed tht there ws no difference in post-stimultion increse in serum Aldo concentrtions etween the groups of sujects with slt-sensitive nd slt-nonsensitive lood pressure mong ptients with hypothyroidism. Only n escltion of PRA ws less pronounced in the slt-nonsensitive sujects [15]. Animl studies of Montiel et l. [12] reveled tht diet sodium depletion in hypothyroid rts cused lower increse in Aldo level thn in the helthy nimls. Srut et l. [4] suggested tht hypothyroidism is ssocited with suppressed Aldo secretion in the suprrenl glnd stimulted with drenocortico- 408
10 Endokrynologi Polsk / Polish Journl of Endocrinology 2003; 4 (54) tropin, potssium or furosemide. In our studies, men increse in ldosterone ws pg/ml in the ptients nd ws lower thn in the helthy individuls (289.9 pg/ml). The results hve wide distriution proly due to other fctors effecting the serum Aldo level, thus the difference ws found to e sttisticlly nonsignificnt. It is of interest tht serum potssium level ws significntly higher in the ptients fter stimultion s compred with potssium level under sl condition nd those in helthy sujects. This difference is suggested to e relted to serum Aldo level. Attinment of euthyroid stte ws not ssocited with chnges in sl or poststimultory serum Aldo level, lthough the rtio Aldo/PRA ecme norml. It indictes tht the uncoupling in the reninngiotensin-ldosterone system in the hypothyroid ptients is corrected fter ttinment of euthyroid stte. Mechnism responsile for unltered higher serum Aldo level in the ptients fter the tretment remins uncler. It is ssumed tht Aldo level is resulted from complex of fctors influencing on the hormone synthesis, relese nd metolism. This is proly the cuse of contrdictory results reported y the other investigtors, who found n increse [3, 8], decrese [6, 10] or lck of chnges [9] in serum Aldo level in hypothyroid ptients fter therpy. Prk et l. [3] suggested tht incresed ctyvity renin-ngiotensin-ldosterone system during L-thyroxine tretment of these ptients ws ssocited with reduction of effective plsm volume. Plsm ANP concentrtions in ptients with hypothyroidism efore tretment were not dependent on conditions of the experiment nd comprle to tht otined in helthy controls. Rolndi et l. [16] lso showed unchnged concentrtions of this peptide in ptients with hypothyroidism, ut Kohno et l. [17] confirmed this only in the disese of moderte intensity, while in severe hypothyroidism concentrtions of ANP were decresed. In our study ttinment of euthyroid stte led to n increse in ANP concentrtions higher thn in the control group. Mechnisms underlying this phenomenon re uncler. Nevertheless, it my e ssumed tht incresed relese of ANP from myocrdiocytes ws ssocited with direct effect of dministered L-thyroxine on the hert s well s with hemodynmic chnges induced y therpy of hypothyroidism. References 1. Mrcisz C, Kuchrz EJ, Jonderko G et l. Serum ldosterone level in ptients with the thyroid function normlities. Prt I. Hyperthyroidism. (in press) 2. Luetscher JA, Cohn AP, Cmrgo CA et l. Aldosterone secretion nd metolism in hyperthyroidism nd myxedem. J Clin Endocrinol Met 1963; 23: Prk CW, Shin YS, Ahn SJ et l. Thyroxine tretment induces upregultion of renin-ngiotensin-ldosterone system due to decresing effective plsm volume in ptient with primry myxoedem. Nephrol Dil Trnsplnt 2001; 16: Srut T, Kitjim W, Hyshi M et l. Renin nd ldosterone in hypothyroidism: reltion to excretion of sodium nd potssium. Clin Endocrinol 1980; 12: Arlot S, Mesmcque A, Llu JD et l. Plsm renin ctivity nd ldosterone in untreted hypothyroidism. Horm Met Res 1988; 20: Fommei E, Iervsi G. The role of thyroid hormone in lood pressure homeostsis: evidence from short-term hypothyroidism in humns. J Clin Endocrinol Met 2002; 87: Asmh BJ, Wn Nzimoon WM, Norzmi K et l. Plsm renin nd ldosterone in thyroid diseses. Horm Met Res 1997; 29: Mrks P., Anderson J, Vincent R. Aldosterone in myxedem. Lncet 1978; 2: Rom-Bogusłwskj ES, Komrow IW. Riegulcij sekrecji ldosteron u olnych tireotoksikozom. Tireoidnyje gormony kk wozmożnyje stimuljtory ktiwnosti sistemy reninngiotenzin-ldosteron. Prol Endokrinol 1986; 32: Strkow NT, Egrt FM, Atmnow TM, Nzrow AN. O ptogenezje i leczjeni rterilnoj gipertenzji u olnych gipotireozom. Klin Med. 1986; 64: Yo B, Xio-Min L, Zhi-Sheng G et l. Effect of cute wter loding on plsm levels of ntidiuretic hormone AVP, ldosterone, ANP frctionl excretion of sodium nd plsm nd urine osmollities in myxedem. Clin Med J 1990;103: Montiel M, Jimenez E, Nrvez JA, Morell M. Reninngiotensin-ldosterone system in hyper- nd hypothyroid rts during sodium depletion. Endocrine Res Commun ; 9: Mtwiejenko EG, Goroiec WF, Dzustow AD.: Sostojnie sistemy renin-ngiotenzin-ldosteron pri tireoidnoj ptologii po dnnym rdioimmunologiczeskowo nliz. Ter Arch 1987; 59: Brlet C, Doucet A. Triiodothyronine enhnces renl response to ldosterone in the rit collecting tuule. J Clin Invest 1987; 79: Mrcisz C, Jonderko G, Kuchrz EJ. Influence of short-time ppliction of low sodium diet on lood pressure in ptients with hyperthyroidism or hypothyroidism during therpy. Am J Hypertens 2001; 14: Rolndi E, Sntniello B, Bgnsco M et l. Thyroid hormones nd tril ntriuretic hormone secretion: study in hyper- nd hypothyroid ptients. Act Endocrinol (Copenh.) 1992; 127: Kohno M, Murkw K, Ysunri K et l. Circulting tril ntriuretic peptides in hyperthyroidism nd hypothyroidism. Am J Med 1987; 83: Conclusion An increse in serum ldosterone level under sl conditions nd uncoupling in the renin-ngiotensin-ldosterone level re shown in the ptients with hypothyroidism. 409
11 / ORIGINAL PAPERS Endokrynologi Polsk / Polish Journl of Endocrinology Tom/Volume 54; Numer/Numer 4/2003 ISSN X Detection of DNA of humn ppillomvirus (HPV) herpesviruses (HSV), cytomeglovirus (CMV) nd chlmydi pneumonie in the upper respirtory trct in children with IDDM y using polymerse chin rection. Kędzi A 1, Goździck-Józefik A 2, Oręplsk A 2, Olejnik A 2, Kormn E 1 1 Krol Mrcinkowski School of Medicine, Poznń, Polnd 2 Deprtment of Moleculr Virology Adm Mickiewicz University of Poznń, Poznń, Polnd Astrct The smers from upper respirtory trct in children with IDDM nd helthy were nlysed for the presence of DNA, HPV, HSV, CMV nd Chlmydi pneumonie y PCR method. Aout (90)% of children were infected y HPV, HSV nd Chlmydi pneumonie. In control group only 40%. CMV ws not present. Wykrywnie DNA wirus rodwczk człowiek (HPV), wirusów z grupy Herpes (HSV), wirus cytomeglii (CMV) i chlmydi pneumonie w górnych drogch oddechowych u dzieci z cukrzycą insulinozleżną przy zstosowniu metody PCR. Kędzi A 1, Goździck-Józefik A 2, Oręplsk A 2, Olejnik A 2, Kormn E 1 1 Akdemi Medyczn im. Krol Mrcinkowskiego w Poznniu 2 Zkłd Wirusologii Molekulrnej Uniwersytetu im. A. Mickiewicz w Poznniu Streszczenie W DNA izolownym z wymzów z górnych dróg oddechowych, pornych od dzieci z IDDM i dzieci zdrowych identyfikowno oecność DNA, wirusów opryszczki (HSV), cytomeglii (CMV), rodwczk ludzkiego (HPV) orz kterie Chlmydi pneumoni stosując rekcję łńcuchową polimerzy (PCR). U około 90% dnych dzieci chorych n cukrzycę typu I stwierdzono oecność infekcji HPV, HSV i Ch. pneumonie, ntomist u dzieci zdrowych tylko u 40% dnych. W dnym mterile klinicznym nie stwierdzono infekcji CMV. Dr A. Kędzi Akdemi Medyczn Szpitln 27/33, Poznń 410
12 Endokrynologi Polsk / Polish Journl of Endocrinology 2003; 4 (54) Introduction Insulin dependent dietes (type I, IDDM) is chronic disese cused y et cell destruction, often immune medited, tht leds to loss of insulin secretion nd solute insulin deficiency [1-3]. The etiology of IDDM is multifctoril, involving genetic dispositions, utoimmune response nd enviromentl fctors. Using microstellite mrkers for nlysis of humn genome hs reveled more thn 20 regions tht my hve some correltions with IDDM [1,2,4,5]. The primry loci susceptiility to type 1 dietes hve een mpped to the HLA- DR nd DQ regions on chromosome 6, the other regions were locted on chromosome 2,4, 11p15, 4, 17 or 18 [4, 6-8]. In the most ptients, the ethiology of utoimmune process nd et cell destruction is not known. The process is medited y mcrophges nd T lymphocytes with detectle utontiodies to vrious et cell ntigens. Bet cell- utoimmunity my remit nd repper in the course of virl infections. Virus infections pper to initite utoimmunity rther thn precipitte dietes in sujects with utoimmunity. Mny results suggest tht certin viruses (HSV, mumps, ruell, retroviruses nd rotvirus) hve een implicted in IDDM development [9-13]. The im of the present study ws to recognise the humn ppillomviruses (HPVs) s well s cytomeglovirus (CMV), herpesviruses (types 1 nd 2) nd Chlmydi pneumonie infections in upper respirtory trct of children with IDDM nd helthy y using polymerse chin rection (PCR). The informtion regrding the risk of serious infections relted to dietes would help define the enviromentl fctors of dietes nd possily enhnce our understnding of the mechnism involved in development IDMM. Mterils nd methods Description of ptients: The exmintions included 61 children nd dolescents from 6 to 17 yers (verge 11.3) yers of ge who hd dietes from 0 to 10 yers. The verge ge of dietes ws 4.6. All study children insulin HM type (Novo Nordisk Eli Lilly) received (Tle I). The study group of children hd not ny symptoms of infections. The control group mke 70 children in good helth. Methods Tle I Length of time of dietes, dily insulin unit per kilogrm of ody weight nd level of glycosilted hemogloin Length of time of IDDM Men dose of insulin/u/kg HA 1 C [%] In the time of dignosis to 5 yers yers The smers from upper respirtory trct of children were tken y sptul for extrction of DNA. DNA ws isolted y proteinse K digestion (proteinse K 1 mg/ml, SDS 2%, Tris HCl 10 mm EDTA, 1mM ph 8.8) for 12 hrs t 57oC nd phenol extrction (2-3 times). DNA ws precipitted from superntnt in sodium cette ethnol solution, dissolved in 50 µl of TE (Tris HCl 10mM, EDTA 1mM) nd exmined for the presence of HPV, CMV, HSV nd Ch. pneumonie, y PCR (2 µl from 50 µl) for nlysis with specific sets of primers, complementry to the different regions of virl genomes (Tle II). The PCR products of HPV were lso nlyzed y hyridiztion of nucleic cids. The virus DNA (HPV 6, 11, 16, 18) for nucleic cid hyridiztion ws leled with 32P. After hyridiztion the utogrphic procedure ws used for detection of HPV virus DNA [14]. The mplifiction of HPV DNA ws performed s descried [15], CMV [16] nd Chlmydi pnuemonie [17]. The primers (ARK-Germny) used in PCR study re present in Tle II. The PCR products were nlysed y grose gel electrophoresis nd PAGE (for CMV products). Control proes of DNA, HPV, CMV, HSV were cloned in plsmid vector. The control group consisted of 70 helthy children (without IDDM). PCR mplifiction Herpesviruses, Chlmydie pnumonie, HPV nd CMV PCR ws crried out using primer pirs (Tle II) for mplifiction of virl DNA. The mplifiction of product (length s in Tle II) ws expected with the used primer pir. PCR ws performed in totl volume 10 l. The finl mixture contined 1 M primers, 200 M deoxynucleotide triphosphtes, 1x PCR uffer (10 mm Tris-HCl (ph 8.8), 50 mm KCl, 0.1% Triton X- 100) 1.5 mm MgCl 2, nd 1.0 U/25 µl of mixture of Tq polymerse. The smples were mplified for 30 cycles. Ech cycle consisted of the following steps: denturtion t 95ºC for 1 min. (first cycle for 90 sec), nneling t 54ºC for 30 sec, primer extension t 72ºC for 1 min. in DNA therml cycler (Minicycler BIOMETRA) After mplifiction, the smples were incuted t 72ºC for 5 min nd seprted in grose gel y electrophoresis. 411
13 HPV u dzieci chorych n cukrzycę Kędzi A. Tle II Primers for the PCR study Primers Sequences 5 3 HPV 6/ ACAGGCTTTGGTGCTATGGACTTT GTACTGCGTGTAGTATCAACAACAG Lenght (p) of mplified products The mplifiction rection ccording to HPV CMV MY09 MY11 IE1 IE2 Chlmydi pneumonie CHT53-1 CHT53-2 HSV HSV1 HSV2 CGTCCMARRGGAWACTGATC GCMCAGGGWCATAAYAATGG M=A+C, R=A+G, W=A+T, Y=C+T CCACCCGTGGTGCCAGCTCC CCCGCTCCTCCTGAGCACCC ATGATCGCGGTTTCTGTTGCCA TCTACGTTGTTTTGCAGCGAG CATCACCGACCCGGAGAGGGAC GGGCCAGGCGCTTGTTGGTGTA descried in methods Results In the upper respirtory trct ll of the ptients with IDDM HPV 6 nd 11 were present. Aout 30% of children were lso infected y HPV 16/18. Wheres in the control group only 40% of children were infected y HPV 6 nd 11, nd HPV 16/18 were not present (Tle III). The children with IDDM were lso more frequently infected y HSV (90 %) nd Chlmydi pneumonie (80%) s in the control group (30%). In the study DNA infection with CMV ws not detected. This study provides evidence for mucosl HPV, HSV nd Chlmydi penumonie infection in IDDM children. Tle III Frequency infection of the upper respirtory trct children with IDDM (n=61) in reltion to helthy children (n=70) Type of viruses Children with IDDM Control group No % No % SD HPV 6/ U=7.3 P<0.05 HPV 16/ U=4.8 P=0.05 HSV U=6.9 P<0.05 CMV NS Chlmydi pneumonie U=5.7 P<0.05 Discussion Although the experimentl literture supports n ssocition etween dietes nd infection the strong epidemiologicl evidence linking dietes to serious infection is lcking. Individuls with dietes might e t higher risk for severe infection nd infection relted moridity cused y ltered defense mechnisms nd /or incresed presence of underlying disorders tht predispose mortlity. The preliminry results of our study indicted tht children with the type I of dietes re very sensitive to HPV, HSV virl infection s well s Chlmydie pneumonie. These pthogens re lso present in helthy individuls however immune control mechnism proly effectively prevent overt disese nd terminte virus repliction. Infection y HPV type 6 nd 11 hs een shown to cuse wrt-like lesions in the mouth, phrynx nd esophgus of humns. Types 16 nd 18 of HPV re the most significnt risk fctor for cervicl cncer. Highly oncogenic re lso HSV viruses. The initil infection y HSV occurs through rek in the mucous memrnes (eye, mouth, throt, genitls) or skin where locl repliction occurs. From these plces virus spreds to regionl lymph nodes, where it multiplies further. HSV cn e lso disseminted into the lood nd to distnt orgns [18]. The mjor herpesviruses tht infected mn re cytomeglovirus. CMVs re the most common cuse of intruterine infections. The viruses cn lso induced diseses of new-orn which usully ffecting the slivry glnd, rin, kidneys, liver, nd lungs [18,19]. In study DNA HSV 1 nd 2 ws detected ut not CMV. Proly in future study there will e etter to use ure s source of DNA CMV. Tissue culture isoltion of virus from ure is the stndrd procedure for detection of CMV infection [20]. Znghellini et l. 412
14 Endokrynologi Polsk / Polish Journl of Endocrinology 2003; 4 (54) in other study indicted the presence of CMV in 32 (59.2%) of 54 urinus in symptomtic individuls. CMV ws lso isolted from sliv of sujects, vginl sws of 2 of 5, nd 1 white lood cell smple [21]. CMV ws lso detected in our study in neworn children from CMV positive mother [22]. Infection with Chlmydi pneumonie is very common nd in world-wide popultion 30-50% of people hve ntiodies to Chlmydi pneumonie. This pthogene is lso detected in 80% of IDDM children. Chlmydi pneumonie hve een estlished s new species tht cused respirtory nd crdio-vsculr diseses [23]. Brrio et l [24] lso indicted tht Helicocter pylori infection is often present in dietic ptients. These infections could e one of the cuses of chronic trophic gstritis, which is more frequent in longstnding dietes mellitus. The children with IDDM nd Helicocter pylori infection hd lso incresed dily insulin compred with the requirement of their uninfected peers [25]. Identifiction of different pthogens in respirtory trct of IDDM children inclines for further deep study. The results cn e importnt under tretment. The mny pthogens with infected children my e involved in pthogenesis of dietics. The reson of this ssocition requires dditionl investigtion on the other fctors involved in infection. In vitro DNA mplifiction vi the PCR is promising method tht my e dpted to this clinicl prolem. These ssys cn detect infective nd noninfective pthogens in short time (in one or two dys) in smll clinicl proe, however the products of PCR hve to e checked y nucleic cid hydridiztion, restriction nlysis or sequencing. References 1. Pugliese A, Eisenrth GS. Type I Dietes mellitus of mn: Genetic susceptiility nd resistnce, type I dietes. Moleculr, Cellulr, nd Clinicl Immunology 2001; 7ed Oxford Press 2. Seissler J, de Sonnville JJ, Morgenthler NG, Steinrenner H, Glwe D, Khoo-Morgenthler UY, Lu MS, Notkins AL, Heine RJ, Scherum WA. Immunologicl heterogeneity in typei dietes: presence of distinct utontiody pttern in ptients cute onset nd slowly progressive disese. Dietol 1998; 41: Eisenrth GS. Type I dietes mellitus. A chronic utoimmune disese. N Eng J Med 1989; 21: Owerch D, Gy KH. The serch for IDDM susceptiility genes: the next genertion. Dietes 1996; 45: Owerch D,Gy KH. Linkge of the VNTR/insulingene nd type I dietes mellitus: incresed gene shring in ffected siiling pirs. Am J Hum Genet 1994; 5: Hshimoto L, Hit C, Berssi JP. Genetic mpping of susceptiility locus for insulin-dependent dietes mellitus on chromosome 11q. Nture 1994; 371: Hyer RN, Julier C, Buckey JD. High resolution mpping for susceptiility genes in humn polygenic disese: insulindependent dietes mellitus nd chromosome 11q. Am J Hum Genet 1994; 48: Dcou-Voutetkis C, Sertedki A, Mnitis-Christidis M, Srri C, Krdim G, Petersen MB, Xidr A, Knrion M, Nicolidou P. Insulin dependent dietes mellitis (IDDM) nd utoimmune thyroiditis in oy with ring chromosome 18: dditionl evidence of utoimmunity or IDDM gene(s) on chromosome 18. J Med Genet 1999; 36: Bertoni AG, Sydh S, Brncti FL. Dietes nd risk of infection-relted mortlity in the U.S. Dietes Cre 2001; 24: Pk CY, Hyone-Myong E, McArthur RG Yoon JW. Assocition of cytomeglovirus infection with utoimmune type I dietes. Lncet 1988; 2: Hyoty H, Hiltunen M, Reunnen A, Leinikki P, Vesikri T, Lounm R, Tuomilehto J, Akerlom HK. Decline of mumps ntiodies in type I (insulin dependent) dietic children nd plteu in the rising incidence of type I dietes fter introduction of the mumps-mesles-ruelle vccine in Finlnd. Childhood Dietes in Finlnd Study Group. Dietologi 1993; 36: Grves PM, Norris JM, Pllnsch MA, Gerling IC, Rewers M. The role of enterovirl infections in development of IDDM: limittions of current pproches. Dietes 1997; 46: Dlquist GG.Viruses nd other perintl exposures s inititing events for et-cell destruction. Ann Med 1997; 29: Smrook J, Fritoch BR, Mnitis T. Moleculr cloning. A lortory mnul. Cold Spring Hrour Lortory, Tucker RA, Jhnson PR, Reeves WC, Icenugle JP. Using polymerse chin rection to genotype humn ppillomvirus DNAs in smples contining multiple HPVs my produce inccurte results. Journl of Virol Meth 1993; 43: Innis MA, Gerfnd DH, Snisky JJ, White TJ. PCR Protocols: A Guide to Methods nd Applictions. Acdemic Press, Inc 1990, Shit D, Detection of humn cytomeglovirus. 43: Kuot Y. A new primer pir for detection Chlmydie pneumonie y Polymerse Chin Rection. Microiol Immunol 1997; 40: Fields BN, Knipe DM, Howley PM, Chnock RM, Melnick JL, Month TP, Roizmn B, Strus SE. Fields Virology, Lippincott-Rven Pulishers, Pss RF. Epidemiology nd trnsmission of cytomeglovirus. J Infect Dis 1985; 249: Polic B, Hengel H, Krmpotic A, Trgovcich J, Pvic I, Luccronin P, Jonjic S, Kszinowski UH. Hierrchicl nd redundnt lymphocyte suset control precludes cytomeglovirus repliction during ltent infectionnnnn. J Exp Med 1998; 6: Znghellini F, Boppn SB, Emery VC, Griffiths PD, Pss RF. Asymptomtic primry cytomeglovirus infection: virologic nd immunologic fetures. J Infect Dis 1999 ;3: Olejnik A, Trk A, Kędzi W, Schmidt M, Gozdzick- Jozefik A, Kornck K, Kędzi H, Spczyński M. Identifiction of HCMV virus in cervicl sws of pregnnt women nd neworn. Pol J of Gynecol Invest 2001; 3: Kuo Ch, Jckson LA, Cmpell LA, Gryston JT. Chlmydie pneumonie. Clin Microiol Rev 1995; 8: Brrio R, Rolnd MB, Alonso M, Cnton R, Cmrero C. Helicocter pylori infection with prentl cell ntiodies in children nd ndolescents with insulin dependent dietes mellitus. J Peditr Endocrinol Met 1997; 10: Beque RE, Mirz A, Compton T, Comes R, Vrgs A. Helicocter pylori infections nd insulin requirement mong children with type I dietes mellitus. Peditrics 1999; 6:
15 / ORIGINAL PAPERS Endokrynologi Polsk / Polish Journl of Endocrinology Tom/Volume 54; Numer/Numer 4/2003 ISSN X Serum concentrtions of tumor necrosis fctor TNF-α nd it s solule receptors in oese women with insulin resistnce Mgdlen Olszneck-Glininowicz, Brr Zhorsk-Mrkiewicz, Jonn Jnowsk, Piotr Kocełk*, Mrek Śliw*, Aleksnder Żurkowski Deprtment of Pthophysiology, Silesin University School of Medicine, Ktowice, Polnd * Student Scientific Assocition t Dept. of Pthophysiology, Silesin University School of Medicine, Ktowice, Polnd Summry Ojective: Tumor necrosis fctor TNF-α is one of known fctors contriuting to development of insulin resistnce in musculr nd dipose tissue. Previous study showed, tht in oesity there is n incresed synthesis of TNF-α y ft cells, which is reflected in incresed serum concentrtions of TNF-α in oese ptients. Therefore the im of present study ws evlution the serum concentrtions of the TNF-α nd it s solule receptors in oese women with nd without insulin resistnce. Mteril nd methods: The study groups consisted of 102 oese women. All sujects were dignosed s hving simple oesity with no concomitnt diseses nor phrmcologicl tretment. The serum concentrtions of glucose nd insulin ws mesured nd study group ws divided on the sis of HOMA index into two sugroups: A oese without insulin resistnce (n = 28; men ge 40.9 ± 11.9 yr.; BMI 34.7 ± 4.2 kg/m 2 ) nd B oese with insulin resistnce (n = 74; men ge 40.7 ± 10.4 yr.; BMI 37.2 ± 5.3 kg/m 2 ). The control group consisted of 24 helthy, len women without insulin resistnce, t men ge 30.7 ± 10.0 yr.; BMI 21.6 ± 1.7 kg/m 2. Body weight nd height were mesured nd ody mss index ws clculted with stndrd formul weight (kg)/height (m) 2. Body composition ws mesured using ioimpednce method (Bodystt). Serum concentrtions of glucose were mesured using enzymtic procedure, insulin y RIA. HOMA index ws clculted with formul. Serum concentrtions of TNF-α nd it s solule receptors stnfr1 nd stnfr2 were mesured y ELISA. Results: Sugroup B chrcterized y significntly higher ody mss index nd dipose tissue in kg content when compred to sugroup A. Serum concentrtion of glucose did not differ etween sugroups A nd B nd when compred to controls. Serum concentrtion of insulin ws significntly higher in sugroup B when compred to sugroup A nd when compred to controls. There were no differences in serum concentrtions of insulin etween sugroup A nd controls. Serum concentrtions of TNF-α, did not differ etween sugroups A nd B, ut ws significntly higher in oth sugroups when compred to len controls. Also serum concentrtions of oth solule receptors did not differ etween sugroups A nd B, did not lso differ in serum concentrtions of stnfr1 nd stnfr2 etween oth sugroups A nd B nd controls. Conclusions: 1. Higher plsm concentrtion of TNF-α in oese ptients with fsting serum concentrtion of glucose in references rnge did not correlte with insulin sensitivity. 2. In ptients with incresed insulin serum concentrtion ppered correltion etween serum concentrtions oth stnfr1 nd stnfr2 nd crohydrte metolism. Key words: tumor necrosis fctor lph, solule receptors of TNF, insulin resistnce, oesity 414
16 / ORIGINAL PAPERS Endokrynologi Polsk / Polish Journl of Endocrinology Tom/Volume 54; Numer/Numer 4/2003 ISSN X Stężenie czynnik mrtwicy nowotworów TNF-α i jego rozpuszczlnych receptorów w surowicy otyłych koiet insulinooporność Mgdlen Olszneck-Glininowicz, Brr Zhorsk-Mrkiewicz, Jonn Jnowsk, Piotr Kocełk*, Mrek Śliw*, Aleksnder Żurkowski Ktedr Ptofizjologii Śląskiej Akdemii Medycznej w Ktowicch * Koło STN przy Ktedrze Ptofizjologii Śl.A.M. w Ktowicch Streszczenie Wstęp: Jednym ze znnych czynników przyczynijących się do powstwni insulinooporności w tknce mięśniowej i tłuszczowej jest czynnik mrtwicy nowotworów TNF-α. Dotychczsowe dni wykzły, że jego syntez przez komórki tłuszczowe wzrst w stnie otyłości co znjduje swoje odzwierciedlenie we wzroście surowiczego stężeni TNF-α u otyłych pcjentów. Dltego celem oecnej prcy ył ocen stężeń TNF-α i jego rozpuszczlnych receptorów w surowicy otyłych koiet ez insulinooporności i z insulinoopornością. Mterił i metod: Bdniu poddno grupę 102 otyłych koiet ez choró towrzyszących i nie stosujących frmkoterpii. Po wykonniu oznczeń stężeni w surowicy glukozy i insuliny, grupę dną podzielono n podstwie wskźnik HOMA n dwie podgrupy: A otyli ez insulinooporności (n = 28) wiek 40,9 ± 11,9 lt; BMI 34,7 ± 4,2 kg/m2 i B otyli z insulinoopornością (n = 74) wiek 40,7 ± 10,4 lt; BMI 37,2 ± 5,3 kg/m2. Grupę kontrolną stnowiły 24 zdrowe, szczupłe koiety ez insulinooporności, wiek 30,7 ± 10,0 lt; BMI 21,6 ± 1,7 kg/m2. Zmierzono msę cił i wzrost, wskźnik msy cił wyliczono ze wzoru. Oceny skłdu cił dokonno metodą ioimpedncji przy użyciu prtu Bodystt. Stężenie w surowicy glukozy oznczono metodą kolorymetryczną, insuliny metodą rdioimmunoenzymtyczną. Wskźnik HOMA oliczono ze wzoru. Stężenie w surowicy TNF-α i jego rozpuszczlnych receptorów stnfr1 i stnfr2 oznczono przy użyciu metody ELISA. Wyniki: Podgrup B chrkteryzowł się istotnie wyższym indeksem msy cił i zwrtością tknki tłuszczowej wyrżoną w kg w porównniu z podgrupą A. Surowicze stężeni glukozy nie różniły się istotnie w podgrupch A i B orz w porównniu z grupą kontrolną. Ntomist stężenie insuliny yło istotnie wyższe w podgrupie B w porównniu z podgrupą A orz w porównniu z grupą kontrolną. Nie yło różnic w stężeniu insuliny pomiędzy podgrupą A grupą kontrolną. Stężenie w surowicy TNF-α, nie różniło się w podgrupch A i B, le yło istotnie wyższe w ou tych podgrupch w porównniu ze szczupłą grupą kontrolną. Również stężeni rozpuszczlnych receptorów stnfr1 i stnfr2 nie różniły się w podgrupch A i B, nie yło tkże różnic w stężeniu stnfr1 i stnfr2 pomiędzy podgrupmi A i B grupą kontrolną. Wnioski: 1. Zwiększone surowicze stężenie TNF-α u otyłych pcjentów z prwidłowym poziomem glikemii n czczo nie jest związne ze stnem insulinowrżliwości. 2. U pcjentów z podwyższonym surowiczym stężeniem insuliny uwidczni się związek pomiędzy surowiczymi stężenimi stnfr1 i stnfr2 gospodrką węglowodnową. Słow kluczowe: czynnik mrtwicy nowotworów lf, rozpuszczlne receptory TNF, insulinooporność, otyłość M. Olszneck Glininowicz Ktedr Ptofizjologii Śląskiej Akdemii Medycznej w Ktowicch ul. Medyków 18, Ktowice tel./fx ( 032 ) E-mil: mgols@esculp.pl Prc wykonn w rmch grntu KBN nr C008/P05/2000 projektu celowego zmwinego Nr PCZ Wstęp Insulinooporność jest stnem upośledzonej odpowiedzi iologicznej orgnizmu n endoi egzogenną insulinę. W początkowej fzie rozwoju zurzenie to jest wyrównywne zwiększoną produkcją insuliny przez komórki β trzustki. Po wyczerpniu zdolności kompenscyjnej trzustki i spdku produkcji endogennej insuliny dochodzi do rozwoju cukrzycy t. 2 [1]. Stn insulinooporności sprzyj również wystąpieniu tkich choró jk ndciśnienie, choro niedokrwienn serc, zurzeni lipidowe, które w połączeniu z otyłością typu ndroidlnego określne są jko zespół metoliczny [2]. Dotychczs wykzno, że do powstwni insulinooporności przyczyniją się m. in. związki produkowne przez komórki iłej tknki tłusz- 415
17 TNF- otyłość i insulinooporność Olszneck-Glininowicz M. czowej, tkie jk wolne kwsy tłuszczowe, leptyn i czynnik mrtwicy nowotworów (TNF-α) [3]. TNF-α jest wielofunkcyjną cytokiną wywierjącą plejotropowe dziłnie w różnych tknkch i gtunkch [4]. TNF-α wywier swoje dziłnie n komórki przez 2 receptory TNFR1 (p60) i TNFR2 (p 80). Znjdują się one w różnych proporcjch orz różnej liczie prwie n wszystkich komórkch orgnizmu. Ich rozpuszczlne formy czyli pozwione domen wewnątrzkomórkowych receptory łonowe znjdują się w krążeniu i konkurują z receptormi łonowymi o wolny lignd [5]. Po rz pierwszy TNF-α zidentyfikowno jko produkt mkrofgów w przewlekłych stnch zplnych orz w złośliwych procesch nowotworowych. Aktywcj ukłdu TNF-α w tych stnch powodowł podniesienie wydtku energetycznego i zmniejszenie msy cił. Dlsze dni wykzły, że u otyłych ludzi dochodzi do ndekspresji mrna TNF-α w tknce tłuszczowej orz do wzrostu produkcji TNF-α przez dipocyty [6]. W nszych wcześniejszych prcch oserwowliśmy tkże wyższe stężeni TNF-α w surowicy pcjentów z ndwgą i otyłością w porównniu do grupy kontrolnej [7, 8]. Wydje się, że wzrost wydzielni TNF-α przez dipocyty w otyłości może yć jednym z mechnizmów zpoiegjących niepohmownemu przyrostowi msy cił, poniewż wywier on ktoliczne dziłni n tknkę tłuszczową. Do ktolicznych dziłń TNF-α nleżą: hmownie lipogenezy poprzez oniżnie ktywność lipzy lipoproteinowej (LPL) n poziomie mrna orz jej przemin potrnslcyjnych, oniżenie ekspresji dwóch głównych czynników regultorowych różnicowni komórek tknki tłuszczowej, czynnik trnskrypcyjnego α (CEBPα) orz jądrowego receptor prolifercji peroksysomów (PPARγ2). Bdni n hodowlch komórek predipocytrnych gryzoni wykzły, że TNF-α hmuje również syntezę i ktywcję niektórych innych enzymów lipogenicznych, tkich jk dehydrogenz glicerolo- 3-fosftzy (GPDH), kokroksylz cetylokoenzymu A i syntz kwsów tłuszczowych. Drugim kierunkiem dziłni TNF-α n metolizm tknki tłuszczowej jest poudznie lipogenezy poprzez poudznie ktywności hormonowrżliwej lipzy (HL) [9, 10]. Wpływ TNF-α n rozwój insulinooporności w komórkch tłuszczowych może yć również jednym z mechnizmów kontrregelcyjnych w dlszym przyroście msy cił, poniewż insulin jest hormonem hmującym lipolizę orz poudzjącym lipogenezę. TNF-α dził co njmniej w dwóch miejscch sygnłu insuliny, tj. n poziomie receptor i n poziomie postreceptorowym. W hodowlch komórkowych hmuje utofosforylcję receptor insuliny poprzez indukcję fosforylcji seryny, sustrtu 1 receptor insuliny co prowdzi do spdku ktywności kinzy tyrozynowej receptor insulinowego [11]. Innym mechnizmem dziłni TNF-α n ten szlk sygnłowy jest stymulcj TNFR1, któr prowdzi do cytotoksyczności, wzrostu produkcji IL-6 i ktywcji sfingomielinzy, co hmuje stymulowną insuliną fosforylcję tyrozyny IRS-1 [12]. Alterntywnym szlkiem dziłni TNF-α n sygnł insuliny jest oniżnie ekspresji genu GLUT4 [13]. Poz tym TNF-α może wywierć ezpośredni wpływ n komórki β wysp trzustkowych, co prowdzi do hmowni stymulownej glukozą sekrecji insuliny [14]. Celem oecnej prcy ył ocen stężeń TNF-α i jego rozpuszczlnych receptorów w surowicy otyłych koiet ez insulinooporności i z insulinoopornością. Mterił i metod Bdniu poddno grupę 102 otyłych koiet. Po wykonniu oznczeń stężeni w surowicy glukozy i insuliny, grupę dną podzielono n podstwie wskźnik HOMA (wyliczonego ze wzoru HOMA = stężenie insuliny n czczo (µiu/ ml) x stężenie glukozy n czczo (mmol/l)/22,5; wrtości prwidłowe < 2,77) n dwie podgrupy: A otyli ez insulinooporności (n = 28); B otyli z insulinoopornością (n = 74). Grup A wiek 40,9 ± 11,9 lt; ms cił 90,0 ± 12,3 kg; BMI 34,7 ± 4,2 kg/m2. Grup B wiek 40,7 ± 10,4 lt; ms cił 98,3 ± 16,4 kg; BMI 37,2 ± 5,3 kg/ m2. Grupę kontrolną stnowiły 24 zdrowe, szczupłe koiety ez insulinooporności, wieku 30,7 ± 10,0 lt; ms cił 58,4 ± 7,1 kg; BMI 21,6 ± 1,7 kg/m2. Chrkterystykę grup przedstwi tel I. Wszyscy dni yli zdignozowni jko otyłość prost ez choró towrzyszących, z wrtościmi profilu lipidowego i glikemii w grnicch normy. U wszystkich dnych wykluczono występownie ostrych i przewlekłych choró zplnych. Bdnie przeprowdzono po udzieleniu informcji i wyrżeniu zgody przez pcjentki. N przeprowdzenie dni uzyskno zgodę Komisji Etycznej. Zmierzono msę cił i wzrost, wskźnik msy cił wyliczono ze wzoru BMI = ms cił (kg) / [wzrost (m)] 2. Oceny skłdu cił dokonno metodą ioimpedncji przy użyciu prtu Bodystt. Próki krwi yły poierne rno n czczo (15 godzin od osttniego posiłku). Stężenie glukozy w surowicy oznczono metodą kolorymetryczną przy użyciu odczynników firmy Cormy. Stężenie insuliny oznczono metodą rdioimmunoenzymtyczną przy użyciu zestwów firmy Dignostic Products Corportion, czułość metody 1,2 µiu/ml. 416
18 Endokrynologi Polsk / Polish Journl of Endocrinology 2003; 4 (54) Wskźnik HOMA oliczono według podnego powyżej wzoru. Stężenie w surowicy TNF-α i jego rozpuszczlnych receptorów stnfr1 i stnfr2 oznczono przy użyciu wysoce czułej metody ELISA firmy Genzyme Dignostics Cmridge. Czułość metody dl TNF-α < 0,18 pg/ml, dl stnfr1 < 3,0 pg/ml i dl stnfr2 < 1 pg/ml. Uzyskne dne nlizowno przy użyciu progrmu komputerowego STATISTICA. Ze względu n rozkłd normlny do nlizy różnic pomiędzy grupmi użyto testu t-student; z wrtość znmienną sttystycznie przyjęto p<0,05. Do porównni związków pomiędzy ozncznymi prmetrmi wewnątrz dnych grup użyto nlizy korelcji Person; z istotne sttystycznie uznno korelcje z p<0,05. Wyniki Różnice prmetrów ntropometrycznych i skłdu cił w dnych grupch przedstwi tel I. Podgrup B chrkteryzowł się istotnie wyższym indeksem msy cił i zwrtością tknki tłuszczowej wyrżoną w kg w porównniu z podgrupą A. Surowicze stężeni glukozy nie różniły się istotnie w podgrupch A i B orz w porównniu z grupą kontrolną. Ntomist stężenie insuliny yło istotnie wyższe w podgrupie B (otyłe z insulinoopornością) w porównniu z podgrupą A (otyłe ez insulinooporności) orz w porównniu z grupą kontrolną. Nie yło różnic w stężenich insuliny pomiędzy podgrupą A grupą kontrolną. Wrtości glukozy, insuliny i wskźnik HOMA przedstwi tel II. Stężenie w surowicy TNF-α nie różniło się w podgrupch A i B, le yło istotnie wyższe w ou tych podgrupch w porównniu z grupą kontrolną. Również stężeni rozpuszczlnych receptorów stnfr1 i stnfr2 nie różniły się w podgrupch A i B, nie yło tkże różnic w stężeniu stnfr2 pomiędzy podgrupmi A i B grupą kontrolną (tel III). Tel I. Chrkterystyk dnych grup dnych A i B i grupy kontrolnej. Grup A Grup B Grup kontroln Wiek (lt) 40,9 ± 11,9 40,7 ± 10,4 30,7 ± 10,0 ++#### Ms cił (kg) 90,0 ± 12,3 98,3 ± 16,4 ** 58,4 ± 7,1 ++++#### BMI (kg/m 2 ) 34,7 ± 4,2 37,2 ± 5,3 * 21,6 ± 1,7 ++++#### Ms eztłuszczow (kg) 51,4 ± 6,5 54,0 ± 6,7 45,1 ± 4,4 +++### Ms eztłuszczow (%) 57,5 ± 6,1 55,6 ± 7,2 77,6 ± 4, ##### Tknk tłuszczow (kg) 38,6 ± 9,9 44,3 ± 13,4 * 13,3 ± 3, ##### Tknk tłuszczow (%) 42,5 ± 6,1 44,4 ± 7,2 22,3 ± 4, ##### * p<0,05; ** p<0,01; ***** p<0, test t między grupmi A i B ++ p<0,01; +++ p<0,005; p<0, test t między grupmi A i kontrolną ### p<0,005; #### p<0,0001; ###### 0, test t między grupmi B i kontrolną Tel II. Stężenie w surowicy glukozy i insuliny orz wrtości wskźnik HOMA Grup A Grup B Grup kontroln Glukoz (mmol/l) 4,8 ± 0,7 5,1 ± 1,1 4,7 ± 0,5 Insulin (µiu/l) 9,6 ± 2,9 22,7 ± 11,4 ***** 8,4 ± 2,7 ##### HOMA 2,0 ± 0,5 5,3 ± 3,1 ***** 1,7 ± 0,5 ##### ***** p<0, test t między grupmi A i B ###### p<0, test t między grupmi B i kontrolną Tel III. Stężenie w surowicy TNF-α i rozpuszczlnych receptorów TNF 1 i 2. Grup A Grup B Grup kontroln TNF-α (pg/ml) 7,4 ± 3,4 7,0 ± 2,9 2,5 ± 1, ##### stnfr1 (pg/ml) 1296,4 ± 216,9 1263,1 ± 391,7 1173,5 ± 101,0 stnfr2 (pg/ml) 1883,1 ± 471,1 1930,4 ± 598,5 1766,4 ± 499, p < 0, test t między grupmi A i kontrolną ###### p < 0, test t między grupmi B i kontrolną 417
19 TNF- otyłość i insulinooporność Olszneck-Glininowicz M. W podgrupie A nie oserwowno istotnych sttystycznie korelcji pomiędzy surowiczymi stężenimi TNF-α i jego rozpuszczlnych receptorów msą cił, BMI i zwrtością tknki tłuszczowej orz surowiczymi stężenimi glukozy i insuliny. W podgrupie B surowicze stężenie TNF-α korelowło istotnie z % zwrtością tknki tłuszczowej (r=0,24; p<0,05) le nie oserwowno związku pomiędzy jego stężeniem prmetrmi gospodrki węglowodnowej. Zoserwowno ntomist istotny związek pomiędzy surowiczym stężeniem ou rozpuszczlnych receptorów TNF wrtością wskźnik HOMA (odpowiednio r=0,45; p=0,000 i r=0,25; p=0,03). Był również istotny związek pomiędzy surowiczymi stężenimi stnfr1 i insuliny (r =0,56; p=0,000). Dyskusj Wcześniejsze dni wykzły zwiększoną ekspresję mrna TNF-α w tknce tłuszczowej otyłych gryzoni i ludzi. W nszych wcześniejszych prcch opisywliśmy również podwyższone stężenie TNF-α w surowicy otyłych pcjentów [6, 7, 8]. Poniewż TNF-α jest uznnym meditorem insulinooporności, celem oecnej prcy ył ocen związku jego surowiczego stężeni ze stopniem insulinooporności. Mimo, że ms cił w podgrupie B ył istotnie wyższ w porównniu do podgrupy A, nie zoserwowliśmy różnic w stężeniu TNF-α w surowicy otyłych pcjentek insulinoopornych i nieinsulinoopornych. Wydje się, że może to wynikć z rku różnic w procentowej zwrtości tknki tłuszczowej. Ntomist w ou tych podgrupch stężenie TNF-α yło istotnie wyższe w porównniu do grupy kontrolnej. Nie yło również istotnych związków pomiędzy stężeniem TNF-α stężenimi surowiczymi glukozy i insuliny orz wrtościmi wskźnik HOMA, ztem podwyższony surowiczy poziom TNF-α u dnych otyłych nie ył ezpośrednio związny z ich stnem insulinowrżliwości. Oserwcje te są zgodne z wynikmi uzysknymi przez Kellerer i wsp. [15], przeprowdzonymi n grupie potomstw pcjentów z cukrzycą typu 2 z ndwgą i otyłością. Bdcze ci stwierdzili, że chociż niewielu uczestników eksperymentu yło insulinoopornych (użyto metody klmr euglikemicznych) to u większości występowło podwyższone surowicze stężenie TNF-α. Oni również nie wykzli korelcji między stężeniem TNF-α stopniem insulinowrżliwości. Również Ktsuki i wsp. [16] nie zoserwowli różnic w surowiczym stężeniu TNF-α pomiędzy zdrowymi szczupłymi i szczupłymi z cukrzycą t. 2 orz pomiędzy otyłymi ez choró towrzyszących i otyłymi z cukrzycą t. 2, le zuwżyli, że stężenie TNF-α yło istotnie wyższe w ou grupch otyłych w odniesieniu do grupy szczupłych. Bdcze ci tkże nie oserwowli istotnej korelcji pomiędzy stężeniem TNF-α insulinoopornością we wszystkich dnych grupch. Bertin i wsp. [17], ocenijąc stężenie TNF-α w surowicy otyłych pcjentów z cukrzycą typu 2, wykzli rk związku pomiędzy jego stężeniem płcią, wiekiem, stężeniem w surowicy n czczo glukozy i hemogloiny glikozylownej. Oserwowli ntomist dodtnią korelcję pomiędzy stężeniem TNF-α polem trzewnej tknki tłuszczowej (oceninym metodą tomogrfii komputerowej) orz BMI. W nszej prcy, mimo podwyższonego stężeni TNF-α w ou podgrupch otyłych, dodtnią korelcję pomiędzy surowiczym stężeniem TNF-α % zwrtością tknki tłuszczowej (r=0,24; p=0,03) oserwowliśmy tylko w podgrupie z insulinoopornością. Brk tkiego związku w podgrupie A jest trudny do wytłumczeni i wymg dlszych szczegółowych dń, z dokłdną oceną pol tłuszczu wiscerlnego orz z równoczesną oceną stężeń TNF-α w surowicy orz tknce tłuszczowej wiscerlnej i podskórnej. Oserwcje uzyskne z nszej prcy i cytownych dń sugerują, że podwyższone surowicze stężenie TNF-α nie jest związne ezpośrednio ze stnem insulinowrżliwości dnych. Wyrźnie jednk widoczny jest związek pomiędzy otyłością wzrostem surowiczego stężeni TNF-α, co dodtkowo popierją oserwcje uzyskne w nszych wcześniejszych dnich, gdzie po redukcji msy cił oserwowliśmy istotny spdek surowiczego stężeni TNF-α [8]. Nie możn jednk trktowć tego spostrzeżeni jko rgumentu przeciwko udziłowi TNF-α w rozwoju insulinooporności, poniewż n podstwie uzysknych wyników nie możn wyciągć wniosków dotyczących związków przyczynowo-skutkowych między nlizownymi stężenimi TNF-α w surowicy insulinoopornością n poziomie komórkowym w tknce tłuszczowej i mięśnich szkieletowych. Poniewż endogenne wytwrznie TNF-α prowdzi do uwlnini jego rozpuszczlnych receptorów, niektóre dni sugerują, że poziomy stnfr1 lepiej odzwierciedlją stopień ktywcji ukłdu TNF niż sme poziomy TNF-α, oznczliśmy tkże stężeni rozpuszczlnych receptorów TNF-α [18]. Nie wykzliśmy różnic w stężenich rozpuszczlnych receptorów TNF-α w podgrupch A i B orz pomiędzy nimi grupą kontrolną. W nszej wcześniejszej prcy również nie oserwowliśmy różnic surowiczych stężeń stnfrs pomiędzy otyłymi grupą kontrolną szczupłych. Oserwowliśmy ntomist istotny wzrost surowiczego stężeni ou rozpuszczlnych receptorów TNF po redukcji msy cił [8]. 418
20 Endokrynologi Polsk / Polish Journl of Endocrinology 2003; 4 (54) Wyniki te różnią się od uzysknych przez Huner i wsp. [19], którzy oserwowli istotnie wyższe stężenie ou rozpuszczlnych receptorów TNF w surowicy otyłych w porównniu z grupą kontrolną szczupłych. Możliwe, że różnice te wynikją z dooru grupy, poniewż dcze ci ocenili stężenie rozpuszczlnych receptorów TNF u otyłych z trzecim stopniem otyłości i prwie połowę grupy stnowili otyli z cukrzycą typu 2. Ntomist Strączkowski i wsp. [20], którzy porównywli stężeni stnfrs u szczupłych osó z cukrzycą typu 2 w wywidzie rodzinnym i u szczupłych osó ez cukrzycy w wywidzie, zoserwowli wyrźnie wyższy stopień insulinooporności i wyższe surowicze stężenie stnfr2 w pierwszej grupie. W podgrupch A i B stężeni stnfr1 i stnfr2 nie korelowło z żdnym z oceninych prmetrów ntropometrycznych. Te oserwcje są zgodne z nszymi wcześniejszymi wynikmi, orz z wynikmi Mohmed-Ali i wsp. [5]. Różnią się ntomist od wyników Hotmisligil i wsp. [21], którzy oserwowli istotny związek pomiędzy stężeniem stnfr2 w surowicy BMI. W podgrupie B surowicze stężenie stnfr1 korelowło z surowiczym stężeniem insuliny, wrtość wskźnik HOMA korelowł dodtnio ze stężenimi ou rozpuszczlnych receptorów, przy czym silniejsz korelcj dotyczył stężeni stnfr1. Oserwcje te są zgodne z wynikmi dń Uysl i wsp. [12], przeprowdzonymi n myszch o/o z mutcjmi zerowymi receptorów TNF, które wykzły że TNFR1 jest odpowiedzilny z pośredniczenie dziłniom TNF-α n sygnł insuliny in vivo. Tkże Strączkowski i wsp. [20] oserwowli związek surowiczego stężeni stnfr2, le nie stnfr1, ze stopniem insulinooporności. Pośrednio istnieje również podoieństwo z wynikmi Hotmisligil i wsp. [21] orz Huner i wsp. [19], którzy wykzli związek pomiędzy surowiczym stężeniem stnfr2 stężeniem insuliny. W podgrupie A nie oserwowliśmy korelcji pomiędzy stężenimi rozpuszczlnych receptorów stężenimi insuliny i glukozy orz wrtością wskźnik HOMA. Zstnwijący jest rk podonych korelcji w podgrupie A mimo porównywlnych z podgrupą B surowiczych stężeń rozpuszczlnych receptorów. Wydje się, że może to yć związne z istotnie niższym surowiczym stężeniem insuliny w podgrupie ez insulinooporności. W ou podgrupch surowicze stężenie glukozy nie różniło się istotnie, nie yło tkże różnic w surowiczym stężeniu glukozy w porównniu z grupą kontrolną. Wydje się, że prwidłow glikemi n czczo w połączeniu z istotnie wyższym stężeniem w surowicy insuliny w podgrupie B wskzuje n wczesny etp rozwoju insulinooporności, stąd może wynikć rk różnic w surowiczym stężeniu TNF-α i jego rozpuszczlnych receptorów. T sugesti jest zgodn z wynikmi wcześniejszych dń, które wykzły, że dziłnie TNF-α jest rczej późną zminą w rozwoju insulinooporności [14, 22]. Wnioski: 1. Zwiększone surowicze stężenie TNF-α u otyłych pcjentów z prwidłowym poziomem glikemii n czczo nie jest związne ze stnem insulinowrżliwości. 2. U pcjentów z podwyższonym surowiczym stężeniem insuliny uwidczni się związek pomiędzy surowiczymi stężenimi stnfr1 i stnfr2 gospodrką węglowodnową. Piśmiennictwo 1. Hotmisligil GS. Moleculr mechnisms of insulin resistnce nd the role of the dipocyte. Intern J Oes 2000; 24 Suppl 4: Blüher M, Krtzsch J, Pschke R. Plsm levels of tumor necrosis fctor-α, ngiotensin II, growth hormone, nd IGF-I re not elevted in insulin-resistnt oese individuls with impired glucose tolernce. Dietes Cre 2001; 24: Früheck G, Gomez-Amrosi J, Muruzl JF, Burrell A. The dipocyte: model for integrtion of endocrine nd metolic signling in energy metolism regultion. J Biol Chem 2001; 280: Liu LS, Spelleken M, Röhring K, et l. Tumor necrosis fctorα cutely inhiits insulin signling in humn dipocytes. Impliction of the p80 tumor necrosis fctor receptor. Dietes 1998; 47: Mohmed-Ali V, Goodrick S, Bulmer K, et l. Production of solule tumor necrosis fctor receptors y humn sucutneous dipose tissue in vivo. J Clin Endocrinol Met 1999; 82: Kern PA, Sghizdeh M, Ong JM, et l. The expression of tumor necrosis fctor in humn dipose tissue. Regultion y oesity, weight loss nd reltionship to lipoprotein lipse. J Clin Invest 1995; 95: Zhorsk-Mrkiewicz B, Jnowsk J, Olszneck- Glininowicz M, Mjewski T. Serum concentrtions of tumor necrosis fctor in oese women. J Endocrinol Invest 1999; 22 Suppl. 7: 66 (str.) 8. Zhorsk-Mrkiewicz B. Jnowsk J, Olszneck- Glininowicz M, Żurkowski A. Serum concentrtions of TNF-α nd solule TNF-α receptors in oesity. Intern J Oes 2000; 24: Mohmed-Ali V, Goodrick S, Rwesh A, et l. Sucutneous dipose tissue releses interleukin-6, ut not tumor necrosis fctor-α, in vivo. J Clin Endocrinol Met 1997; 82: Petruschke T, Huner H. Tumor necrosis fctor-lph prevents the differentition of humn dipocyte precursor cell nd cused delipidtion of newly developed ft cells. J Clin Endocrinol Met 1993; 76: Kroder G, Bossenmier B, Kellerer M, et l. Tumor necrosis fctor-α nd hyperglycemi-induced insulin resistnce. Evidence for different mechnisms nd different effects on insulin signling. J Clin Invest 1996; 97: Uysl KT, Wiesrock SM, Mrino MW, Hotmisligil GS. Protection from oesity-induced insulin resistnce in mice lcking TNF-lph function. Nture 1997; 389: Stephens JM, Lee J, Pilch PF. Tumor necrosis fctorα - induced insulin resistnce in 3T3-L1 dipocytes is ccompnied y loss of insulin receptor sustrte-1 419
www.irs.gov/form990. If "Yes," complete Schedule A Schedule B, Schedule of Contributors If "Yes," complete Schedule C, Part I If "Yes," complete Schedule C, Part II If "Yes," complete Schedule C, Part
Bardziej szczegółowoIs there a relationship between age and side dominance of tubal ectopic pregnancies? A preliminary report
Is there a relationship between age and side dominance of tubal ectopic pregnancies? A preliminary report Czy istnieje zależność pomiędzy wiekiem i stroną, po której umiejscawia się ciąża ektopowa jajowodowa?
Bardziej szczegółowoZespół Omenna u kuzynów: różny przebieg kliniczny i identyczna mutacja genu RAG1.
PRACE KAZUISTYCZNE / CASE REPORTS 367 Zespół Omenna u kuzynów: różny przebieg kliniczny i identyczna mutacja genu RAG1. Omenn s syndrome in cousins: different clinical course and identical RAG1 mutation
Bardziej szczegółowowww.irs.gov/form990. If "Yes," complete Schedule A Schedule B, Schedule of Contributors If "Yes," complete Schedule C, Part I If "Yes," complete Schedule C, Part II If "Yes," complete Schedule C, Part
Bardziej szczegółowoLek. Ewelina Anna Dziedzic. Wpływ niedoboru witaminy D3 na stopień zaawansowania miażdżycy tętnic wieńcowych.
Lek. Ewelina Anna Dziedzic Wpływ niedoboru witaminy D3 na stopień zaawansowania miażdżycy tętnic wieńcowych. Rozprawa na stopień naukowy doktora nauk medycznych Promotor: Prof. dr hab. n. med. Marek Dąbrowski
Bardziej szczegółowoOcena wpływu ludzkiego antygenu leukocytarnego HLA B5701 na progresję zakażenia HIV 1 i odpowiedź na leczenie antyretrowirusowe.
ROZPRAWA DOKTORSKA Ocena wpływu ludzkiego antygenu leukocytarnego HLA B5701 na progresję zakażenia HIV 1 i odpowiedź na leczenie antyretrowirusowe. Promotor: Dr hab. n. med. Justyna D. Kowalska Klinika
Bardziej szczegółowo!850016! www.irs.gov/form8879eo. e-file www.irs.gov/form990. If "Yes," complete Schedule A Schedule B, Schedule of Contributors If "Yes," complete Schedule C, Part I If "Yes," complete Schedule C,
Bardziej szczegółowowww.irs.gov/form990. If "Yes," complete Schedule A Schedule B, Schedule of Contributors If "Yes," complete Schedule C, Part I If "Yes," complete Schedule C, Part II If "Yes," complete Schedule C, Part
Bardziej szczegółowoCystatin C as potential marker of Acute Kidney Injury in patients after Abdominal Aortic Aneurysms Surgery preliminary study
Cystatin C as potential marker of Acute Kidney Injury in patients after Abdominal Aortic Aneurysms Surgery preliminary study Anna Bekier-Żelawska 1, Michał Kokot 1, Grzegorz Biolik 2, Damian Ziaja 2, Krzysztof
Bardziej szczegółowoHelena Boguta, klasa 8W, rok szkolny 2018/2019
Poniższy zbiór zadań został wykonany w ramach projektu Mazowiecki program stypendialny dla uczniów szczególnie uzdolnionych - najlepsza inwestycja w człowieka w roku szkolnym 2018/2019. Składają się na
Bardziej szczegółowoSSW1.1, HFW Fry #20, Zeno #25 Benchmark: Qtr.1. Fry #65, Zeno #67. like
SSW1.1, HFW Fry #20, Zeno #25 Benchmark: Qtr.1 I SSW1.1, HFW Fry #65, Zeno #67 Benchmark: Qtr.1 like SSW1.2, HFW Fry #47, Zeno #59 Benchmark: Qtr.1 do SSW1.2, HFW Fry #5, Zeno #4 Benchmark: Qtr.1 to SSW1.2,
Bardziej szczegółowoRozdział 1. Nazwa i adres Zamawiającego Gdyński Ośrodek Sportu i Rekreacji jednostka budżetowa Rozdział 2.
Z n a k s p r a w y G O S I R D Z P I 2 70 1 3 7 2 0 1 4 S P E C Y F I K A C J A I S T O T N Y C H W A R U N K Ó W Z A M Ó W I E N I A f U d o s t p n i e n i e w r a z z r o z s t a w i e n i e m o g
Bardziej szczegółowoOcena skuteczności preparatów miejscowo znieczulających skórę w redukcji bólu w trakcie pobierania krwi u dzieci badanie z randomizacją
234 Ocena skuteczności preparatów miejscowo znieczulających skórę w redukcji bólu w trakcie pobierania krwi u dzieci badanie z randomizacją The effectiveness of local anesthetics in the reduction of needle
Bardziej szczegółowoLogo pole ochronne. 1/2 a. 1/4 a
1/2 1/4 Logo pole ochronne Obszr wokół znku, w obrębie którego nie może się pojwić żdn obc form, zrówno grficzn jk i tekstow to pole ochronne. Do wyznczeni pol ochronnego służy moduł konstrukcyjny o rozmirze
Bardziej szczegółowoOpenPoland.net API Documentation
OpenPoland.net API Documentation Release 1.0 Michał Gryczka July 11, 2014 Contents 1 REST API tokens: 3 1.1 How to get a token............................................ 3 2 REST API : search for assets
Bardziej szczegółowoRozpoznawanie twarzy metodą PCA Michał Bereta 1. Testowanie statystycznej istotności różnic między jakością klasyfikatorów
Rozpoznawanie twarzy metodą PCA Michał Bereta www.michalbereta.pl 1. Testowanie statystycznej istotności różnic między jakością klasyfikatorów Wiemy, że możemy porównywad klasyfikatory np. za pomocą kroswalidacji.
Bardziej szczegółowodeep learning for NLP (5 lectures)
TTIC 31210: Advanced Natural Language Processing Kevin Gimpel Spring 2019 Lecture 6: Finish Transformers; Sequence- to- Sequence Modeling and AJenKon 1 Roadmap intro (1 lecture) deep learning for NLP (5
Bardziej szczegółowoMachine Learning for Data Science (CS4786) Lecture11. Random Projections & Canonical Correlation Analysis
Machine Learning for Data Science (CS4786) Lecture11 5 Random Projections & Canonical Correlation Analysis The Tall, THE FAT AND THE UGLY n X d The Tall, THE FAT AND THE UGLY d X > n X d n = n d d The
Bardziej szczegółowomechanizmach latencji i onkogenezy BLV. Wykazano, że zakażenie BLV powoduje wzrost aktywności telomerazy i skracanie sekwencji telomerowych we
STRESZCZENIE Celem pracy była ocena sekrecji cytokin oraz aktywności telomerazy i długości telomerów w populacjach komórek dendrytycznych (DCs) generowanych z krwi i tkanek limfatycznych zwierząt zakażonych
Bardziej szczegółowowww.irs.gov/form990. If "Yes," complete Schedule A Schedule B, Schedule of Contributors If "Yes," complete Schedule C, Part I If "Yes," complete Schedule C, Part II If "Yes," complete Schedule C, Part
Bardziej szczegółowoMaPlan Sp. z O.O. Click here if your download doesn"t start automatically
Mierzeja Wislana, mapa turystyczna 1:50 000: Mikoszewo, Jantar, Stegna, Sztutowo, Katy Rybackie, Przebrno, Krynica Morska, Piaski, Frombork =... = Carte touristique (Polish Edition) MaPlan Sp. z O.O Click
Bardziej szczegółowoTowards Stability Analysis of Data Transport Mechanisms: a Fluid Model and an Application
Towards Stability Analysis of Data Transport Mechanisms: a Fluid Model and an Application Gayane Vardoyan *, C. V. Hollot, Don Towsley* * College of Information and Computer Sciences, Department of Electrical
Bardziej szczegółowoUnit of Social Gerontology, Institute of Labour and Social Studies ageing and its consequences for society
Prof. Piotr Bledowski, Ph.D. Institute of Social Economy, Warsaw School of Economics local policy, social security, labour market Unit of Social Gerontology, Institute of Labour and Social Studies ageing
Bardziej szczegółowoINTRODUCTION STRESZCZENIE. Jakub Gierczyƒski, Ma gorzata Ga àzka-sobotka, Miros aw J. Wysocki, Jerzy Gryglewicz
Indictors on ntionl helth fund expenditures... INDICATORS ON NATIONAL HEALTH FUND EXPENDITURES FOR MEDICAL SERVICES IN 2012, IN SELECTED DISEASES, IN TERMS OF THE NATIONAL AND REGIONAL LEVEL, WITH PARTICULAR
Bardziej szczegółowoGdański Uniwersytet Medyczny. Polimorfizm genów receptorów estrogenowych (ERα i ERβ) a rozwój zespołu metabolicznego u kobiet po menopauzie
Gdański Uniwersytet Medyczny Mgr Karolina Kuźbicka Polimorfizm genów receptorów estrogenowych (ERα i ERβ) a rozwój zespołu metabolicznego u kobiet po menopauzie Rozprawa doktorska Promotor: dr hab. n.
Bardziej szczegółowoS.A RAPORT ROCZNY Za 2013 rok
O P E R A T O R T E L E K O M U N I K A C Y J N Y R A P O R T R O C Z N Y Z A 2 0 1 3 R O K Y u r e c o S. A. z s i e d z i b t w O l e ~ n i c y O l e ~ n i c a, 6 m a j a 2 0 14 r. S p i s t r e ~ c
Bardziej szczegółowo. ) (Pirronen et al., 2002)
4 1 * 4 (89/11/0 : 88/1/5 : ) (17) 190 1 4 1. 56 HyLine W6 96 90. 4 11 4 : 15 0/ 0/1 1 4.( ) 50 ) ( 1. 50 15 50 15. 6/5 /4 1.(P
Bardziej szczegółowoZakopane, plan miasta: Skala ok. 1: = City map (Polish Edition)
Zakopane, plan miasta: Skala ok. 1:15 000 = City map (Polish Edition) Click here if your download doesn"t start automatically Zakopane, plan miasta: Skala ok. 1:15 000 = City map (Polish Edition) Zakopane,
Bardziej szczegółowoTychy, plan miasta: Skala 1: (Polish Edition)
Tychy, plan miasta: Skala 1:20 000 (Polish Edition) Poland) Przedsiebiorstwo Geodezyjno-Kartograficzne (Katowice Click here if your download doesn"t start automatically Tychy, plan miasta: Skala 1:20 000
Bardziej szczegółowoUkryte funkcjonalności w oprogramowaniu i urządzeniach elektronicznych. mgr inż. Paweł Koszut
Ukryte funkcjonalności w oprogramowaniu i urządzeniach elektronicznych mgr inż. Paweł Koszut Ukryte funkcjonalności w oprogramowaniu i urządzeniach elektronicznych Zamiast wstępu : Inspiracja GSM w Grecji
Bardziej szczegółowoEDYTA KATARZYNA GŁAŻEWSKA METALOPROTEINAZY ORAZ ICH TKANKOWE INHIBITORY W OSOCZU OSÓB CHORYCH NA ŁUSZCZYCĘ LECZONYCH METODĄ FOTOTERAPII UVB.
Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej Uniwersytet Medyczny w Białymstoku EDYTA KATARZYNA GŁAŻEWSKA METALOPROTEINAZY ORAZ ICH TKANKOWE INHIBITORY W OSOCZU OSÓB CHORYCH NA ŁUSZCZYCĘ
Bardziej szczegółowoPro-tumoral immune cell alterations in wild type and Shbdeficient mice in response to 4T1 breast carcinomas
www.oncotarget.com Oncotarget, Supplementary Materials Pro-tumoral immune cell alterations in wild type and Shbdeficient mice in response to 4T1 breast carcinomas SUPPLEMENTARY MATERIALS Supplementary
Bardziej szczegółowoLCD (Liquid Crystal Display)
LCD (Liquid Crystal Display) Polarizing filter. Thin film with a vertical ais. Liquid crystal Polarizing filter. Thin film with a horizontal ais. Polarizing filter. Thin film with a horizontal ais. Polarizing
Bardziej szczegółowoKatowice, plan miasta: Skala 1: = City map = Stadtplan (Polish Edition)
Katowice, plan miasta: Skala 1:20 000 = City map = Stadtplan (Polish Edition) Polskie Przedsiebiorstwo Wydawnictw Kartograficznych im. Eugeniusza Romera Click here if your download doesn"t start automatically
Bardziej szczegółowoLEARNING AGREEMENT FOR STUDIES
LEARNING AGREEMENT FOR STUDIES The Student First and last name(s) Nationality E-mail Academic year 2014/2015 Study period 1 st semester 2 nd semester Study cycle Bachelor Master Doctoral Subject area,
Bardziej szczegółowoKonsorcjum Śląskich Uczelni Publicznych
Konsorcjum Śląskich Uczelni Publicznych Dlaczego powstało? - świat przeżywa dziś rewolucję w obszarze edukacji, - naszym celem jest promocja śląskiego jako regionu opartego na wiedzy, i najnowszych technologiach,
Bardziej szczegółowoHemoRec in Poland. Summary of bleeding episodes of haemophilia patients with inhibitor recorded in the years 2008 and 2009 04/2010
HemoRec in Poland Summary of bleeding episodes of haemophilia patients with inhibitor recorded in the years 2008 and 2009 04/2010 Institute of Biostatistics and Analyses. Masaryk University. Brno Participating
Bardziej szczegółowoExtraclass. Football Men. Season 2009/10 - Autumn round
Extraclass Football Men Season 2009/10 - Autumn round Invitation Dear All, On the date of 29th July starts the new season of Polish Extraclass. There will be live coverage form all the matches on Canal+
Bardziej szczegółowoKarpacz, plan miasta 1:10 000: Panorama Karkonoszy, mapa szlakow turystycznych (Polish Edition)
Karpacz, plan miasta 1:10 000: Panorama Karkonoszy, mapa szlakow turystycznych (Polish Edition) J Krupski Click here if your download doesn"t start automatically Karpacz, plan miasta 1:10 000: Panorama
Bardziej szczegółowoHas the heat wave frequency or intensity changed in Poland since 1950?
Has the heat wave frequency or intensity changed in Poland since 1950? Joanna Wibig Department of Meteorology and Climatology, University of Lodz, Poland OUTLINE: Motivation Data Heat wave frequency measures
Bardziej szczegółowoCS 6170: Computational Topology, Spring 2019 Lecture 09
CS 6170: Computtionl Topology, Spring 2019 Lecture 09 Topologicl Dt Anlysis for Dt Scientists Dr. Bei Wng School of Computing Scientific Computing nd Imging Institute (SCI) University of Uth www.sci.uth.edu/~beiwng
Bardziej szczegółowoARNOLD. EDUKACJA KULTURYSTY (POLSKA WERSJA JEZYKOWA) BY DOUGLAS KENT HALL
Read Online and Download Ebook ARNOLD. EDUKACJA KULTURYSTY (POLSKA WERSJA JEZYKOWA) BY DOUGLAS KENT HALL DOWNLOAD EBOOK : ARNOLD. EDUKACJA KULTURYSTY (POLSKA WERSJA Click link bellow and free register
Bardziej szczegółowoRozdział 1. Nazwa i adres Zamawiającego Gdyński Ośrodek Sportu i Rekreacji jednostka budżetowa Rozdział 2.
Z n a k s p r a w y G O S I R D Z P I 2 7 1 0 5 32 0 1 4 S P E C Y F I K A C J A I S T O T N Y C H W A R U N K Ó W Z A M Ó W I E N I A f W y k o n a n i e p r z e g l» d ó w k o n s e r w a c y j n o -
Bardziej szczegółowoaforementioned device she also has to estimate the time when the patients need the infusion to be replaced and/or disconnected. Meanwhile, however, she must cope with many other tasks. If the department
Bardziej szczegółowoO F E R T A H o t e l Z A M E K R Y N * * * * T a m, g d z i e b łł k i t j e z i o r p r z e p l a t a s ił z s o c z y s t z i e l e n i t r a w, a r a d o s n e t r e l e p t a z m i a r o w y m s z
Bardziej szczegółowoEGZAMIN MATURALNY Z JĘZYKA ANGIELSKIEGO POZIOM ROZSZERZONY MAJ 2010 CZĘŚĆ I. Czas pracy: 120 minut. Liczba punktów do uzyskania: 23 WPISUJE ZDAJĄCY
Centralna Komisja Egzaminacyjna Arkusz zawiera informacje prawnie chronione do momentu rozpoczęcia egzaminu. Układ graficzny CKE 2010 KOD WPISUJE ZDAJĄCY PESEL Miejsce na naklejkę z kodem dysleksja EGZAMIN
Bardziej szczegółowoOcena wpływu nasilenia objawów zespołu nadpobudliwości psychoruchowej na masę ciała i BMI u dzieci i młodzieży
Ewa Racicka-Pawlukiewicz Ocena wpływu nasilenia objawów zespołu nadpobudliwości psychoruchowej na masę ciała i BMI u dzieci i młodzieży Rozprawa na stopień doktora nauk medycznych PROMOTOR: Dr hab. n.
Bardziej szczegółowoProfil alergenowy i charakterystyka kliniczna dorosłych. pacjentów uczulonych na grzyby pleśniowe
lek. Krzysztof Kołodziejczyk Profil alergenowy i charakterystyka kliniczna dorosłych pacjentów uczulonych na grzyby pleśniowe Rozprawa na stopień doktora nauk medycznych Promotor: dr hab. n. med. Andrzej
Bardziej szczegółowoWojewodztwo Koszalinskie: Obiekty i walory krajoznawcze (Inwentaryzacja krajoznawcza Polski) (Polish Edition)
Wojewodztwo Koszalinskie: Obiekty i walory krajoznawcze (Inwentaryzacja krajoznawcza Polski) (Polish Edition) Robert Respondowski Click here if your download doesn"t start automatically Wojewodztwo Koszalinskie:
Bardziej szczegółowoAnalysis of infectious complications inf children with acute lymphoblastic leukemia treated in Voivodship Children's Hospital in Olsztyn
Analiza powikłań infekcyjnych u dzieci z ostrą białaczką limfoblastyczną leczonych w Wojewódzkim Specjalistycznym Szpitalu Dziecięcym w Olsztynie Analysis of infectious complications inf children with
Bardziej szczegółowoWarsztaty Ocena wiarygodności badania z randomizacją
Warsztaty Ocena wiarygodności badania z randomizacją Ocena wiarygodności badania z randomizacją Każda grupa Wspólnie omawia odpowiedź na zadane pytanie Wybiera przedstawiciela, który w imieniu grupy przedstawia
Bardziej szczegółowoCharakterystyka kliniczna chorych na raka jelita grubego
Lek. Łukasz Głogowski Charakterystyka kliniczna chorych na raka jelita grubego Rozprawa na stopień doktora nauk medycznych Opiekun naukowy: Dr hab. n. med. Ewa Nowakowska-Zajdel Zakład Profilaktyki Chorób
Bardziej szczegółowoKatedra i Zakład Biochemii Kierownik Katedry: prof. dr hab. n. med. Ewa Birkner
mgr Anna Machoń-Grecka Cytokiny i czynniki proangiogenne u pracowników zawodowo narażonych na oddziaływanie ołowiu i jego związków Rozprawa na stopień doktora nauk medycznych Promotor: prof. dr hab. n.
Bardziej szczegółowoKatarzyna Durda STRESZCZENIE STĘŻENIE KWASU FOLIOWEGO ORAZ ZMIANY W OBRĘBIE GENÓW REGULUJĄCYCH JEGO METABOLIZM JAKO CZYNNIK RYZYKA RAKA W POLSCE
Pomorski Uniwersytet Medyczny Katarzyna Durda STRESZCZENIE STĘŻENIE KWASU FOLIOWEGO ORAZ ZMIANY W OBRĘBIE GENÓW REGULUJĄCYCH JEGO METABOLIZM JAKO CZYNNIK RYZYKA RAKA W POLSCE Promotor: dr hab. prof. nadzw.
Bardziej szczegółowoITIL 4 Certification
4 Certification ITIL 3 Certification ITIL Master scheme ITIL Expert 5 Managing across the lifecycle 5 3 SS 3 SD 3 ST 3 SO 3 CS1 4 OSA 4 PPO 4 RCV 4 SOA Ścieżka lifecycle Ścieżka Capability 3 ITIL Practitioner
Bardziej szczegółowoMachine Learning for Data Science (CS4786) Lecture 11. Spectral Embedding + Clustering
Machine Learning for Data Science (CS4786) Lecture 11 Spectral Embedding + Clustering MOTIVATING EXAMPLE What can you say from this network? MOTIVATING EXAMPLE How about now? THOUGHT EXPERIMENT For each
Bardziej szczegółowoAnalysis of Movie Profitability STAT 469 IN CLASS ANALYSIS #2
Analysis of Movie Profitability STAT 469 IN CLASS ANALYSIS #2 aaaklnictzzjb9tgfmcnadpg7oy0lxa9edva9kkapdarhyk2k7gourinlwsweyzikuyiigvyleiv/cv767fpf/5crc1xt9va5mx7w3m/ecuqw1kuztpx/rl3/70h73/w4cog9dhhn3z62d6jzy+yzj766txpoir9nzszisjynetqr+rvlfvyoozu5xbybpsxb1wahul8phczdt2v4zgchb7uecwphlyigrgkjcyiflfyci0kxnmr4z6kw0jsokvot8isntpa3gbknlcufiv/h+hh+eur4fomd417rvtfjoit5pfju6yxiab2fmwk0y/feuybobqk+axnke8xzjjhfyd8kkpl9zdoddkazd5j6bzpemjb64smjb6vb4xmehysu08lsrszopxftlzee130jcb0zjxy7r5wa2f1s2off2+dyatrughnrtpkuprlcpu55zlxpss/yqe2eamjkcf0jye8w8yas0paf6t0t2i9stmcua+inbi2rt01tz22tubbqwidypvgz6piynkpobirkxgu54ibzoti4pkw2i5ow9lnuaoabhuxfxqhvnrj6w15tb3furnbm+scyxobjhr5pmj5j/w5ix9wsa2tlwx9alpshlunzjgnrwvqbpwzjl9wes+ptyn+ypy/jgskavtl8j0hz1djdhzwtpjbbvpr1zj7jpg6ve7zxfngj75zee0vmp9qm2uvgu/9zdofq6r+g8l4xctvo+v+xdrfr8oxiwutycu0qgyf8icuyvp/sixfi9zxe11vp6mrjjovpmxm6acrtbia+wjr9bevlgjwlz5xd3rfna9g06qytaoofk8olxbxc7xby2evqjmmk6pjvvzxmpbnct6+036xp5vdbrnbdqph8brlfn/n/khnfumhf6z1v7h/80yieukkd5j0un82t9mynxzmk0s/bzn4tacdziszdhwrl8x5ako8qp1n1zn0k6w2em0km9zj1i4yt1pt3xiprw85jmc2m1ut2geum6y6es2fwx6c+wlrpykblopbuj5nnr2byygfy5opllv4+jmm7s6u+tvhywbnb0kv2lt5th4xipmiij+y1toiyo7bo0d+vzvovjkp6aoejsubhj3qrp3fjd/m23pay8h218ibvx3nicofvd1xi86+kh6nb/b+hgsjp5+qwpurzlir15np66vmdehh6tyazdm1k/5ejtuvurgcqux6yc+qw/sbsaj7lkt4x9qmtp7euk6zbdedyuzu6ptsu2eeu3rxcz06uf6g8wyuveznhkbzynajbb7r7cbmla+jbtrst0ow2v6ntkwv8svnwqnu5pa3oxfeexf93739p93chq/fv+jr8r0d9brhpcxr2w88bvqbr41j6wvrb+u5dzjpvx+veoaxwptzp/8cen+xbg==
Bardziej szczegółowoTYRE PYROLYSIS. REDUXCO GENERAL DISTRIBUTOR :: ::
TYRE PYROLYSIS Installation for rubber waste pyrolysis designed for processing of used tyres and plastic waste (polyethylene, polypropylene, polystyrene), where the final product could be electricity,
Bardziej szczegółowoRozdział 1. Nazwa i adres Zamawiającego Gdyński Ośrodek Sportu i Rekreacji jednostka budżetowa Rozdział 2.
Z n a k s p r a w y G O S I R D Z P I 2 7 1 03 3 2 0 1 4 S P E C Y F I K A C J A I S T O T N Y C H W A R U N K Ó W Z A M Ó W I E N I A f U d o s t p n i e n i e t e l e b i m ó w i n a g ł o n i e n i
Bardziej szczegółowoENGLISH GRAMMAR. reported speech stylistic inversion both, either, neither have & have got
ENGLISH GRAMMAR reported speech stylistic inversion both, either, neither have & have got REPORTED SPEECH, mowa zależna stosujemy, kiedy przekazujemy czyjąś wypowiedź, nie cytując jej wprost. KONSTRUKCJA:
Bardziej szczegółowoBIOPHYSICS. Politechnika Łódzka, ul. Żeromskiego 116, Łódź, tel. (042)
BIOPHYSICS Prezentacja multimedialna współfinansowana przez Unię Europejską w ramach Europejskiego Funduszu Społecznego w projekcie pt. Innowacyjna dydaktyka bez ograniczeń - zintegrowany rozwój Politechniki
Bardziej szczegółowoWeronika Mysliwiec, klasa 8W, rok szkolny 2018/2019
Poniższy zbiór zadań został wykonany w ramach projektu Mazowiecki program stypendialny dla uczniów szczególnie uzdolnionych - najlepsza inwestycja w człowieka w roku szkolnym 2018/2019. Tresci zadań rozwiązanych
Bardziej szczegółowoSTRESZCZENIE Słowa kluczowe: Wstęp Cel pracy
STRESZCZENIE Słowa kluczowe: Noworodek urodzony przedwcześnie, granulocyt obojętnochłonny, molekuły adhezji komórkowej CD11a, CD11b, CD11c, CD18, CD54, CD62L, wczesne zakażenie, posocznica. Wstęp W ostatnich
Bardziej szczegółowoHAPPY ANIMALS L01 HAPPY ANIMALS L03 HAPPY ANIMALS L05 HAPPY ANIMALS L07
HAPPY ANIMALS L0 HAPPY ANIMALS L0 HAPPY ANIMALS L0 HAPPY ANIMALS L07 INSTRUKCJA MONTAŻU ASSEMBLY INSTRUCTIONS Akcesoria / Fittings K ZW W8 W7 Ø x 6 szt. / pcs Ø7 x 70 Narzędzia / Tools DO MONTAŻU POTRZEBNE
Bardziej szczegółowoChapter 1: Review Exercises
Chpter : Review Eercises Chpter : Review Eercises - Evlute the following integrls:..... 6. 8. ( + ) 9. +.. ( + ). ( ). 8. 9....... 6. 7. (csc + + ) sin tn 6. ( )( + ) 7. ) 8.. + ( + )( ). ( ) sin sin sec
Bardziej szczegółowoHAPPY ANIMALS L02 HAPPY ANIMALS L04 HAPPY ANIMALS L06 HAPPY ANIMALS L08
HAPPY ANIMALS L02 HAPPY ANIMALS L04 HAPPY ANIMALS L06 HAPPY ANIMALS L08 INSTRUKCJA MONTAŻU ASSEMBLY INSTRUCTIONS Akcesoria / Fittings K O G ZW W8 W4 20 szt. / pcs 4 szt. / pcs 4 szt. / pcs 4 szt. / pcs
Bardziej szczegółowoKnovel Math: Jakość produktu
Knovel Math: Jakość produktu Knovel jest agregatorem materiałów pełnotekstowych dostępnych w formacie PDF i interaktywnym. Narzędzia interaktywne Knovel nie są stworzone wokół specjalnych algorytmów wymagających
Bardziej szczegółowoEuropean Crime Prevention Award (ECPA) Annex I - new version 2014
European Crime Prevention Award (ECPA) Annex I - new version 2014 Załącznik nr 1 General information (Informacje ogólne) 1. Please specify your country. (Kraj pochodzenia:) 2. Is this your country s ECPA
Bardziej szczegółowo2 0 0 M P a o r a z = 0, 4.
M O D E L O W A N I E I N Y N I E R S K I E n r 4 7, I S S N 1 8 9 6-7 7 1 X A N A L I Z A W Y T R Z Y M A O C I O W A S Y S T E M U U N I L O C K 2, 4 S T O S O W A N E G O W C H I R U R G I I S Z C Z
Bardziej szczegółowoFig 5 Spectrograms of the original signal (top) extracted shaft-related GAD components (middle) and
Fig 4 Measured vibration signal (top). Blue original signal. Red component related to periodic excitation of resonances and noise. Green component related. Rotational speed profile used for experiment
Bardziej szczegółowoOcena częstości występowania bólów głowy u osób chorych na padaczkę.
lek. med. Ewa Czapińska-Ciepiela Ocena częstości występowania bólów głowy u osób chorych na padaczkę. Rozprawa na stopień doktora nauk medycznych Promotor Prof. dr hab. n. med. Jan Kochanowski II Wydział
Bardziej szczegółowoOSI Data Link Layer. Network Fundamentals Chapter 7. Version Cisco Systems, Inc. All rights reserved. Cisco Public 1
OSI Data Link Layer Network Fundamentals Chapter 7 Version 4.0 1 Warstwa Łącza danych modelu OSI Network Fundamentals Rozdział 7 Version 4.0 2 Objectives Explain the role of Data Link layer protocols in
Bardziej szczegółowoEvaluation of the main goal and specific objectives of the Human Capital Operational Programme
Pracownia Naukowo-Edukacyjna Evaluation of the main goal and specific objectives of the Human Capital Operational Programme and the contribution by ESF funds towards the results achieved within specific
Bardziej szczegółowoINSTYTUT GENETYKI I HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK W JASTRZĘBCU. mgr inż. Ewa Metera-Zarzycka
INSTYTUT GENETYKI I HODOWLI ZWIERZĄT POLSKIEJ AKADEMII NAUK W JASTRZĘBCU mgr inż. Ewa Metera-Zarzycka Profil metaboliczny osocza krwi i wartość biologiczna mleka krów w gospodarstwach ekologicznych Praca
Bardziej szczegółowoLED PAR 56 7*10W RGBW 4in1 SLIM
LED PAR 56 7*10W RGBW 4in1 SLIM USER MANUAL Attention: www.flash-butrym.pl Strona 1 1. Please read this specification carefully before installment and operation. 2. Please do not transmit this specification
Bardziej szczegółowoSWPS Uniwersytet Humanistycznospołeczny. Wydział Zamiejscowy we Wrocławiu. Karolina Horodyska
SWPS Uniwersytet Humanistycznospołeczny Wydział Zamiejscowy we Wrocławiu Karolina Horodyska Warunki skutecznego promowania zdrowej diety i aktywności fizycznej: dobre praktyki w interwencjach psychospołecznych
Bardziej szczegółowo89/11/6 : 89/9/7 : 1389 /120 / * 2 1. :.. 1383 196 1383 :... 100 :. :.... :.(1)..... 4..(1) Email: rafiei@med.mui.ac.ir *.. 2. : 1 1499 SPSS... (1)..1 100 92/5 83/9 100 93/6 72/1. 100.(4-2).(5) 1383...
Bardziej szczegółowoOpis i zakres czynności sprzątania obiektów Gdyńskiego Centrum Sportu
O p i s i z a k r e s c z y n n o c is p r z» t a n i a o b i e k t ó w G d y s k i e g o C e n t r u m S p o r t u I S t a d i o n p i ł k a r s k i w G d y n i I A S p r z» t a n i e p r z e d m e c
Bardziej szczegółowoSTOSUNEK HEMODIALIZOWANYCH PACJENTÓW Z ZABURZENIAMI
Wojciech Marcin Orzechowski STOSUNEK HEMODIALIZOWANYCH PACJENTÓW Z ZABURZENIAMI DEPRESYJNYMI DO LECZENIA TYCH ZABURZEŃ Rozprawa na stopień naukowy doktora nauk o zdrowiu Promotor: prof. dr hab. n. med.,
Bardziej szczegółowoOcena zależności stężeń interleukin 17, 22 i 23 a wybranymi parametrami klinicznymi i immunologicznymi w surowicy chorych na łuszczycę plackowatą
Agnieszka Nawrocka Ocena zależności stężeń interleukin 17, 22 i 23 a wybranymi parametrami klinicznymi i immunologicznymi w surowicy chorych na łuszczycę plackowatą Łuszczyca jest przewlekłą, zapalną chorobą
Bardziej szczegółowoTTIC 31210: Advanced Natural Language Processing. Kevin Gimpel Spring Lecture 8: Structured PredicCon 2
TTIC 31210: Advanced Natural Language Processing Kevin Gimpel Spring 2019 Lecture 8: Structured PredicCon 2 1 Roadmap intro (1 lecture) deep learning for NLP (5 lectures) structured predic+on (4 lectures)
Bardziej szczegółowoSargent Opens Sonairte Farmers' Market
Sargent Opens Sonairte Farmers' Market 31 March, 2008 1V8VIZSV7EVKIRX8(1MRMWXIVSJ7XEXIEXXLI(ITEVXQIRXSJ%KVMGYPXYVI *MWLIVMIWERH*SSHTIVJSVQIHXLISJJMGMEPSTIRMRKSJXLI7SREMVXI*EVQIVW 1EVOIXMR0E]XS[R'S1IEXL
Bardziej szczegółowoInstallation of EuroCert software for qualified electronic signature
Installation of EuroCert software for qualified electronic signature for Microsoft Windows systems Warsaw 28.08.2019 Content 1. Downloading and running the software for the e-signature... 3 a) Installer
Bardziej szczegółowoWydział Fizyki, Astronomii i Informatyki Stosowanej Uniwersytet Mikołaja Kopernika w Toruniu
IONS-14 / OPTO Meeting For Young Researchers 2013 Khet Tournament On 3-6 July 2013 at the Faculty of Physics, Astronomy and Informatics of Nicolaus Copernicus University in Torun (Poland) there were two
Bardziej szczegółowoAnkiety Nowe funkcje! Pomoc magda.szewczyk@slo-wroc.pl. magda.szewczyk@slo-wroc.pl. Twoje konto Wyloguj. BIODIVERSITY OF RIVERS: Survey to students
Ankiety Nowe funkcje! Pomoc magda.szewczyk@slo-wroc.pl Back Twoje konto Wyloguj magda.szewczyk@slo-wroc.pl BIODIVERSITY OF RIVERS: Survey to students Tworzenie ankiety Udostępnianie Analiza (55) Wyniki
Bardziej szczegółowoCzy mamy dowody na pozalipidoweefekty stosowania statyn?
Czy mamy dowody na pozalipidoweefekty stosowania statyn? Zbigniew Gaciong Katedra i Klinika Chorób Wewnętrznych, Nadciśnienia Tętniczego i Angiologii, Warszawski Uniwersytet Medyczny Definicja Plejotropia,
Bardziej szczegółowoEGZAMIN MATURALNY Z JĘZYKA ANGIELSKIEGO POZIOM ROZSZERZONY MAJ 2010 CZĘŚĆ I. Czas pracy: 120 minut. Liczba punktów do uzyskania: 23 WPISUJE ZDAJĄCY
Centralna Komisja Egzaminacyjna Arkusz zawiera informacje prawnie chronione do momentu rozpoczęcia egzaminu. Układ graficzny CKE 2010 KOD WPISUJE ZDAJĄCY PESEL Miejsce na naklejkę z kodem dysleksja EGZAMIN
Bardziej szczegółowowww.irs.gov/form990. If "Yes," complete Schedule A Schedule B, Schedule of Contributors If "Yes," complete Schedule C, Part I If "Yes," complete Schedule C, Part II If "Yes," complete Schedule C, Part
Bardziej szczegółowoKlaps za karę. Wyniki badania dotyczącego postaw i stosowania kar fizycznych. Joanna Włodarczyk
Klaps za karę Wyniki badania dotyczącego postaw i stosowania kar fizycznych Joanna Włodarczyk joanna.wlodarczyk@fdds.pl Warszawa, 1.12.2017 Fundacja Dajemy Dzieciom Siłę, 2017 Informacje o badaniu Badanie
Bardziej szczegółowoLatent Dirichlet Allocation Models and their Evaluation IT for Practice 2016
Latent Dirichlet Allocation Models and their Evaluation IT for Practice 2016 Paweł Lula Cracow University of Economics, Poland pawel.lula@uek.krakow.pl Latent Dirichlet Allocation (LDA) Documents Latent
Bardziej szczegółowoABOUT NEW EASTERN EUROPE BESTmQUARTERLYmJOURNAL
ABOUT NEW EASTERN EUROPE BESTmQUARTERLYmJOURNAL Formanminsidemlookmatmpoliticsxmculturexmsocietymandm economyminmthemregionmofmcentralmandmeasternm EuropexmtheremismnomothermsourcemlikemNew Eastern EuropeImSincemitsmlaunchminmPw--xmthemmagazinemhasm
Bardziej szczegółowoEXAMPLES OF CABRI GEOMETRE II APPLICATION IN GEOMETRIC SCIENTIFIC RESEARCH
Anna BŁACH Centre of Geometry and Engineering Graphics Silesian University of Technology in Gliwice EXAMPLES OF CABRI GEOMETRE II APPLICATION IN GEOMETRIC SCIENTIFIC RESEARCH Introduction Computer techniques
Bardziej szczegółowoHippo Boombox MM209N CD. Instrukcja obsługi User s Manual
Hippo Boombox Instrukcja obsługi User s Manual OPIS PRZYCISKÓW: PL ON-OFF/MODE: 1. Włącz on/off: Naciśnij przycisk, aby włączyć urządzenie. Przytrzymaj dłużej, aby wyłączyć. 2. MODE: Wybierz źródło sygnału:
Bardziej szczegółowoPIERWIASTKI W UKŁADZIE OKRESOWYM
PIERWIASTKI W UKŁADZIE OKRESOWYM 1 Układ okresowy Co można odczytać z układu okresowego? - konfigurację elektronową - podział na bloki - podział na grupy i okresy - podział na metale i niemetale - trendy
Bardziej szczegółowoStargard Szczecinski i okolice (Polish Edition)
Stargard Szczecinski i okolice (Polish Edition) Janusz Leszek Jurkiewicz Click here if your download doesn"t start automatically Stargard Szczecinski i okolice (Polish Edition) Janusz Leszek Jurkiewicz
Bardziej szczegółowoEgzamin maturalny z języka angielskiego na poziomie dwujęzycznym Rozmowa wstępna (wyłącznie dla egzaminującego)
112 Informator o egzaminie maturalnym z języka angielskiego od roku szkolnego 2014/2015 2.6.4. Część ustna. Przykładowe zestawy zadań Przykładowe pytania do rozmowy wstępnej Rozmowa wstępna (wyłącznie
Bardziej szczegółowoSPECYFIKACJA ISTOTNYCH WARUNKÓW ZAMÓWIENIA
Z n a k s p r a w y G C S D Z P I 2 7 1 0 1 12 0 1 5 S P E C Y F I K A C J A I S T O T N Y C H W A R U N K Ó W Z A M Ó W I E N I A D o s t a w a ( u d o s t p n i e n i e ) a g r e g a t u p r» d o t w
Bardziej szczegółowoANKIETA ŚWIAT BAJEK MOJEGO DZIECKA
Przedszkole Nr 1 w Zabrzu ANKIETA ul. Reymonta 52 41-800 Zabrze tel./fax. 0048 32 271-27-34 p1zabrze@poczta.onet.pl http://jedyneczka.bnet.pl ŚWIAT BAJEK MOJEGO DZIECKA Drodzy Rodzice. W związku z realizacją
Bardziej szczegółowo