Pytania kwiecień, maj

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "Pytania kwiecień, maj"

Transkrypt

1 Pytania kwiecień, maj Od czego zależy to czy jakość zasad w technice NGS jest zakodowana w skali phred 33 czy 64? Czy są jakieś kryteria wyboru tego kodowania? Z czego wynika dobór kodowania skali phred w ocenie jakości nukleotydów? Czy jest to uzależnione od wybranej metody sekwencjonowania i wtedy zawsze kodowanie będzie to samo, czy skala może być zmienna? Zależy od sekwenatora jakiego użyliśmy. Można zrobić przekodowanie. W jaki sposób wyliczona została jakość w tej skali i przypisana konkretnym symbolom w kodzie, które następnie odpowiadają nukleotydom w sekwencji? Czy jeśli prawdopodobieństwo błędnego odczytania nukleotydów jest wysokie to takie nukleotydy należy wyciąć? ASCII jest 7-bitowy kodowany jako liczby całkowite, float jest 32 bitowy W jaki sposób usuwane są adaptery (gdy nie robi tego sekwenator)? Jaki wpływ mają nieprawidłowo usunięte adaptery? Możemy je usunąć jeżeli znamy sekwencję, np. programmem trimmomatic. Nie usunięte adaptery mogą utrudniać mapowanie do genomu referencyjnego lub asemblacje sekwencje nie pochodzą od organizmu, który badamy, więc zmniejszają podobieństwo odczytów.

2 Pytania kwiecień, maj Czym się charakteryzuje genom referencyjny? Skąd możemy go pozyskać do badań/analizy? Czy możemy sami go wybrać? Czy musi spełniać jakieś konkretne wymagania? Co w momencie gdy marker według jednej z nich np. (Bonferoni'ego) osiąga wynik poniżej 0,05 i jest istotny, a wynik dla innej korekty (np Sidak) nie osiąga progu istotności? Wynik której korekty powinniśmy przyjąć? Czy w bioconductorze można znaleźć pakiet, który mógłby być wykorzystany do analizy różnicy w ekspresji genów, badanej metodą Real Time PCR? Tak, pakiety: ddct, EasyqpcR, HTqPCR (dla metod wysokoprzepustowych) Pakiety w Bioconduktorze charakteryzują się tym, że są bardziej rozbudowane niż pakiety w programie R. Czy oprócz tego są one dokładniejsze w analizie danych? Czy są one uznawane za bardziej rzetelne i profesjonalne przy publikowaniu wyników w artykułach?

3 Do odpowiedzi: Dlaczego program podaje kilka adnotacji, dla jednego wariantu dla tego samego genu? Jakie błędy można popełnić na etapie przygotowywania matrycy do sekwencjonowania NGS, a jakie na etapie amplifikacji klonalnej, które spowodują otrzymanie fałszywego wyniku lub jego braku?

4 Egzamin 20 czerwca Czas trwania: 45 minut krótkich pytań: otwartych (odpowiedz max 2-3 zdania), uzupełnianie, wymienianie, zaznacz zdanie prawdziwe, itp., proste obliczenia (może się przydać kalkulator) Pytania z wykładów oraz z materiału ćwiczeniowego

5 Wprowadzenie do programowania w języku Python oraz jego zastosowanie w bioinformatyce Wykład 10 Bioinformatyczna analiza danych Dr Wioleta Drobik-Czwarno

6 Języki programowania Język programowania to język stworzony do opisu kolejnych kroków, które mają być podjęte przez komputer. ~ instrukcja dawana komputerowi przez człowieka. Język używany przez procesor to kod maszynowy Kod pisany w języku programowania jest przetwarzany na kod maszynowy tak, by mógł zostać przetworzony przez procesor

7 Klasyfikacja Interpretowane Na bieżąco tłumaczone na język maszynowy komputera przez program zwany interpreterem Kompilowane Kod źródłowy jest tłumaczony na kod maszynowy (wykonywalny program) przez program zwany kompilatorem Jedna instrukcja w kodzie źródłowym to kilka (języki niskiego poziomu), kilkaset instrukcji (języki wysokiego poziomu) w kodzie maszynowym

8 Główne składowe każdego programu Zmienne Funkcje Sterowanie przepływem wykonywania programu instrukcje warunkowe pętle Schemat blokowy algorytmu Algorytm to jednoznaczny przepis wykonania pewnej czynności w skończonym czasie np. zmiana pewnych danych wejściowych do pewnych danych wynikowych

9 Dlaczego biotechnolodzy powinni coś wiedzieć o programowaniu? Jak opisać problem badawczy w języku informatyki? Potrzebna jest podstawowa wiedza programistyczna, która umożliwi wykonanie prostych zadań, które przyspieszą / wzbogacą prowadzone badania Dlaczego? Rosnąca lawinowo ilość danych Nowe formaty danych Automatyzacja pracy z plikami / innymi programami Wstępna ocena wyników bez żmudnego przeglądania setek plików Przewaga na rynku pracy

10 Dlaczego Python? Łatwy do nauki Największy potencjał w naukach biologicznych (alternatywy: R, Pearl, Julia) Bardzo dobry język do niemal wszystkich zastosowań od prostych skryptów do profesjonalnych, złożonych programów Darmowy Wszystkie systemy operacyjne Powszechnie używany na całym świecie

11 O języku Utworzony w 1991 roku przez Guido Van Rossum Jest językiem interpretowanym, ogólnego przeznaczenia, umożliwia zarówno programowanie funkcyjne jak i obiektowe Używany w wielu firmach (np. google, yahoo, Red Hat) oraz jednostkach badawczych na całym świecie (CERN, Nasa) Nazwa? Potrzebna była nazwa która jest krótka, unikalna, trochę tajemnicza

12 Jak korzystać z Pythona? Terminal i notatnik Ipython (Jupyter notebook) IDLE (Windows) proste zintegrowane środowisko graficzne (IDE) dla Pythona Napisane w Pythonie przy użyciu biblioteki Tkinter

13 Witaj Świecie Python to język o wyjątkowo prostej składni Najprostszą instrukcją jest print, które wypisuje linijkę tekstu na ekranie Instrukcja print jest inaczej traktowana w wersjach pythona 2.X, a inaczej 3.X Python 2.X: print Witaj Świecie Python 3.X: print( Witaj Świecie )

14 Najważniejsze typy zmiennych Zmienne to wydzielone miejsce w pamięci komputera, gdzie można zapisywać dane, mają swoją nazwę i zawartość (dane). Python jest językiem zorientowanym obiektowo każda zmienna jest obiektem Ciąg znaków (z ang. string) Używamy pojedynczego lub podwójnego cudzysłowu Np. dna = gcatgacgttattacgactctgtc Liczby Liczby całkowite (z ang. integer) Liczby rzeczywiste (z ang. float) najczęściej kodowane jako liczba zmiennoprzecinkowa tzn. zapisywane są z określoną (różną) dokładnością do miejsca po przecinku Typ logiczny (z ang. boolean) Wartości True lub False

15 Struktury danych Ciąg znaków (String)

16 Struktury danych Lista Zawsze używamy nawiasu kwadratowego [ ], kolejne elementy listy są oddzielone przecinkami Dane w jednej liście mogą być różnego typu Kolejność jest ważna, indeksowanie zaczynamy od 0 Niemodyfikowalną listę nazywamy krotką (z ang. tupla) element 0 element 1 element 2

17 Struktury danych Słownik Jest to zmienny (modyfikowalny), nieposortowany zestaw par klucz : wartość Wartości: dowolny obiekt w pythonie Klucze: są indeksami słownika może być to dowolny niezmienny typ np. liczby, ciągi znaków Klucze muszą być unikatowe jest to jedyna droga do odnalezienia w słowniku informacji ponieważ nie posiadają one porządku

18 Struktury danych Słownik Poniżej przykład dla kodów IUPAC dla aminokwasów:

19 Instrukcje warunkowe Operatory zwracają zawsze False lub True: == - sprawdź czy jest równe!= - sprawdź czy jest różne in czy obiekt znajduje się w liście lub innym obiekcie is sprawdza czy zmienne wskazuję na ten sam obszar w pamięci komputera not zmienia wartość wyrażenia logicznego na przeciwne Przykłady: x = 2 print x == 2 wypisze wartość True print x!= 2 wypisze wartość False print x == 3 wypisze wartość False print x < 3 wypisze wartość True imiona = [ Jan, Robert ] imie = Jan if imie in imiona: print Nazywasz się Jan lub Robert

20 Pętle Pętla for: Lista = [1,2,3,4,5] for i in Lista: print i Pętla while: licznik = 0 while licznik < 5: print licznik Zawsze zawiera warunek logiczny, pętla działa dopóki jest spełniony (wartość True) licznik += 1 # to samo co licznik = licznik + 1 Instrukcje: break - zakończenie pętli continue pozwala opuścić blok instrukcji niżej i wrócić do nagłówka

21 Jak wygląda program komputerowy napisany w języku Python? Liczenie nukleotydów def oznacza deklarację nowej funkcji, składnia: def nazwa(argumenty): Transkrypcja Uwaga! Rozmieszczenie wcięć w tekście i ich głębokość są istotne! (intendancja) Sekwencja odwrotnie komplementarna

22 Pythonowy odpowiednik Bioconductora Zestaw narzędzi (bibliotek) opartych na języku python z zastosowaniem do obliczeniowej biologii molekularnej Wspiera liczne formaty danych takie jak: Fasta, Pliki wynikowe BLAST, ClustalW, GenBank, Pubmed, Medline, Unigene, SwissProt, ExPASy Przykład: from Bio import Seq >>> seq = Seq.Seq("ATGCATGCATGATGATCG") >>> print seq Seq('ATGCATGCATGATGATCG', Alphabet()) >>>

23 Zasoby Bardzo duża ilość darmowych publikacji, kursów, książek, wprowadzających do Pythona Programowania możemy nauczyć się wyłącznie przez praktykę

24 Roslind jest serwerem do nauki bioinformatyki oraz programowania poprzez rozwiązywanie problemów Zainspirowany projektami takimi jak Euler i Google Code Jam Nazwa pochodzi od imienia Rosalind Franklin, której badania w dziedzinie krstalografii promieni X umożliwiły wykrycie podwójnej helisy DNA przez Watsona i Cricka. Portal dzieli się na następujące działy: Village nauka podstaw programowania w języku python Stronghold zestaw zadań do rozwiązania Armory rozwiązywanie problemów przy użyciu gotowych narzędzi

25 Rosalind Struktura problemów Projekty od najprostszych do coraz bardziej złożonych

26 Rosalind Działy tematyczne: kombinatoryka przyrównywanie sekwencji spektrofotometria mas programowanie dynamiczne asemblacja genomów rearanżacje genomów grafy dziedziczenie teoria zbiorów prawdopodobieństwo analiza sekwencji dynamika populacji

27 Przykładowe zadanie

28

29 Literatura Ekmekci B., McAnany Ch. E., Mura C An Introduction to Programming for Bioscientists: A Python-Based Primer. PLOS One. Jones M Python for Biologists. A programming course for complete beginners. Serwis learnpython.org

Python dla początkujących. Małgorzata Niewiem AGH, GGiOŚ, Katedra Geoinformatyki i Informatyki Stosowanej SATIM Satelitarny Monitoring

Python dla początkujących. Małgorzata Niewiem AGH, GGiOŚ, Katedra Geoinformatyki i Informatyki Stosowanej SATIM Satelitarny Monitoring Python dla początkujących Małgorzata Niewiem AGH, GGiOŚ, Katedra Geoinformatyki i Informatyki Stosowanej SATIM Satelitarny Monitoring Wstęp Stworzony w latach 90 przez Guido van Rossum Nazwa pochodzi od

Bardziej szczegółowo

Python. Skąd taka nazwa? Kurs systemu UNIX 1

Python. Skąd taka nazwa? Kurs systemu UNIX 1 Python Skąd taka nazwa? Kurs systemu UNIX 1 Cechy języka marketing Obiektowy (dużo prostszy od C++) Darmowy Nie tylko Unix (choć tam najpopularniejszy) Wiele bibliotek (np. Tkinter, czyli interfejs do

Bardziej szczegółowo

Programowanie w języku C++ Grażyna Koba

Programowanie w języku C++ Grażyna Koba Programowanie w języku C++ Grażyna Koba Kilka definicji: Program komputerowy to ciąg instrukcji języka programowania, realizujący dany algorytm. Język programowania to zbiór określonych instrukcji i zasad

Bardziej szczegółowo

ECDL Podstawy programowania Sylabus - wersja 1.0

ECDL Podstawy programowania Sylabus - wersja 1.0 ECDL Podstawy programowania Sylabus - wersja 1.0 Przeznaczenie Sylabusa Dokument ten zawiera szczegółowy Sylabus dla modułu Podstawy programowania. Sylabus opisuje, poprzez efekty uczenia się, zakres wiedzy

Bardziej szczegółowo

Naukę zaczynamy od poznania interpretera. Interpreter uruchamiamy z konsoli poleceniem

Naukę zaczynamy od poznania interpretera. Interpreter uruchamiamy z konsoli poleceniem Moduł 1 1. Wprowadzenie do języka Python Python jest dynamicznym językiem interpretowanym. Interpretowany tzn. że kod, który napiszemy możemy natychmiast wykonać bez potrzeby tłumaczenia kodu programistycznego

Bardziej szczegółowo

Informatyka- wykład. Podstawy programowania w Pythonie. dr Marcin Ziółkowski

Informatyka- wykład. Podstawy programowania w Pythonie. dr Marcin Ziółkowski Informatyka- wykład Podstawy programowania w Pythonie dr Marcin Ziółkowski Instytut Matematyki i Informatyki Akademia im. Jana Długosza w Częstochowie 23 listopada 2015 r. JĘZYK PYTHON Język Python jest

Bardziej szczegółowo

Python wprowadzenie. Warszawa, 24 marca PROGRAMOWANIE I SZKOLENIA

Python wprowadzenie. Warszawa, 24 marca PROGRAMOWANIE I SZKOLENIA Python wprowadzenie Warszawa, 24 marca 2017 Python to język: nowoczesny łatwy w użyciu silny można pisać aplikacje Obiektowy klejący może być zintegrowany z innymi językami np. C, C++, Java działający

Bardziej szczegółowo

Programowanie Strukturalne i Obiektowe Słownik podstawowych pojęć 1 z 5 Opracował Jan T. Biernat

Programowanie Strukturalne i Obiektowe Słownik podstawowych pojęć 1 z 5 Opracował Jan T. Biernat Programowanie Strukturalne i Obiektowe Słownik podstawowych pojęć 1 z 5 Program, to lista poleceń zapisana w jednym języku programowania zgodnie z obowiązującymi w nim zasadami. Celem programu jest przetwarzanie

Bardziej szczegółowo

Podstawy Programowania C++

Podstawy Programowania C++ Wykład 3 - podstawowe konstrukcje Instytut Automatyki i Robotyki Warszawa, 2014 Wstęp Plan wykładu Struktura programu, instrukcja przypisania, podstawowe typy danych, zapis i odczyt danych, wyrażenia:

Bardziej szczegółowo

Przegląd języka Python. Łukasz Anwajler

Przegląd języka Python. Łukasz Anwajler Przegląd języka Python Łukasz Anwajler lukasz.anwajler@pjwstk.edu.pl Nie wierzcie mi na słowo Zaraz zobaczymy: czym jest Python dlaczego warto go używać jakie ma zastosowania gdzie z niego korzystają jakzacząć

Bardziej szczegółowo

Podstawy programowania w języku C

Podstawy programowania w języku C Podstawy programowania w języku C WYKŁAD 1 Proces tworzenia i uruchamiania programów Algorytm, program Algorytm przepis postępowania prowadzący do rozwiązania określonego zadania. Program zapis algorytmu

Bardziej szczegółowo

Zaawansowany kurs języka Python

Zaawansowany kurs języka Python Wykład 1. 4 października 2013 Plan wykładu 1 2 3 4 Typy proste Kolekcje Instrukcje w języku (przypomnienie) Wykładowca: Termin wykładu: piątek, 10:15 12:00, sala 119 Strona wykładu http://www.ii.uni.wroc.pl/

Bardziej szczegółowo

Podstawy programowania skrót z wykładów:

Podstawy programowania skrót z wykładów: Podstawy programowania skrót z wykładów: // komentarz jednowierszowy. /* */ komentarz wielowierszowy. # include dyrektywa preprocesora, załączająca biblioteki (pliki nagłówkowe). using namespace

Bardziej szczegółowo

Programowanie komputerów

Programowanie komputerów Programowanie komputerów Wykład 1-2. Podstawowe pojęcia Plan wykładu Omówienie programu wykładów, laboratoriów oraz egzaminu Etapy rozwiązywania problemów dr Helena Dudycz Katedra Technologii Informacyjnych

Bardziej szczegółowo

Język programowania zbiór reguł określających, które ciągi symboli tworzą program komputerowy oraz jakie obliczenia opisuje ten program.

Język programowania zbiór reguł określających, które ciągi symboli tworzą program komputerowy oraz jakie obliczenia opisuje ten program. PYTHON Język programowania zbiór reguł określających, które ciągi symboli tworzą program komputerowy oraz jakie obliczenia opisuje ten program. Aby program napisany w danym języku mógł być wykonany, niezbędne

Bardziej szczegółowo

Podstawy Programowania Podstawowa składnia języka C++

Podstawy Programowania Podstawowa składnia języka C++ Podstawy Programowania Podstawowa składnia języka C++ Katedra Analizy Nieliniowej, WMiI UŁ Łódź, 3 października 2013 r. Szablon programu w C++ Najprostszy program w C++ ma postać: #include #include

Bardziej szczegółowo

Technologie informacyjne - wykład 12 -

Technologie informacyjne - wykład 12 - Zakład Fizyki Budowli i Komputerowych Metod Projektowania Instytut Budownictwa Wydział Budownictwa Lądowego i Wodnego Politechnika Wrocławska Technologie informacyjne - wykład 12 - Prowadzący: Dmochowski

Bardziej szczegółowo

JAVA?? to proste!! Autor: wojtekb111111

JAVA?? to proste!! Autor: wojtekb111111 1 JAVA?? to proste!! 2 Niniejszy tutorial przedstawia krótkie wprowadzenie do programowania w języku JAVA. Jakie narzędzia na początku potrzebujemy do rozpoczęcia programowania w tym języku? JDK (java

Bardziej szczegółowo

Definicje. Algorytm to:

Definicje. Algorytm to: Algorytmy Definicje Algorytm to: skończony ciąg operacji na obiektach, ze ściśle ustalonym porządkiem wykonania, dający możliwość realizacji zadania określonej klasy pewien ciąg czynności, który prowadzi

Bardziej szczegółowo

Java EE produkcja oprogramowania

Java EE produkcja oprogramowania Java EE produkcja oprogramowania PPJ PODSTAWY PROGRAMOWANIA W JAVIE PODSTAWY JĘZYKA JAVA 1 Warszawa, 2016Z 2 Ogólna charakterystyka języka Java 3 Java 1/2 Język programowania Java został opracowany przez

Bardziej szczegółowo

Pascal typy danych. Typy pascalowe. Zmienna i typ. Podział typów danych:

Pascal typy danych. Typy pascalowe. Zmienna i typ. Podział typów danych: Zmienna i typ Pascal typy danych Zmienna to obiekt, który może przybierać różne wartości. Typ zmiennej to zakres wartości, które może przybierać zmienna. Deklarujemy je w nagłówku poprzedzając słowem kluczowym

Bardziej szczegółowo

Liczby losowe i pętla while w języku Python

Liczby losowe i pętla while w języku Python Liczby losowe i pętla while w języku Python Mateusz Miotk 17 stycznia 2017 Instytut Informatyki UG 1 Generowanie liczb losowych Na ogół programy są spójne i prowadzą do przewidywanych wyników. Czasem jednak

Bardziej szczegółowo

Język programowania PASCAL

Język programowania PASCAL Język programowania PASCAL (wersja podstawowa - standard) Literatura: dowolny podręcznik do języka PASCAL (na laboratoriach Borland) Iglewski, Madey, Matwin PASCAL STANDARD, PASCAL 360 Marciniak TURBO

Bardziej szczegółowo

METODY I JĘZYKI PROGRAMOWANIA PROGRAMOWANIE STRUKTURALNE. Wykład 02

METODY I JĘZYKI PROGRAMOWANIA PROGRAMOWANIE STRUKTURALNE. Wykład 02 METODY I JĘZYKI PROGRAMOWANIA PROGRAMOWANIE STRUKTURALNE Wykład 02 NAJPROSTSZY PROGRAM /* (Prawie) najprostszy przykład programu w C */ /*==================*/ /* Między tymi znaczkami można pisać, co się

Bardziej szczegółowo

Wprowadzenie. Organizacja pracy i środowisko programistyczne. Mirosław Ochodek

Wprowadzenie. Organizacja pracy i środowisko programistyczne. Mirosław Ochodek Wprowadzenie Organizacja pracy i środowisko programistyczne Mirosław Ochodek Miroslaw.Ochodek@pwsz.pila.pl Miroslaw.Ochodek@cs.put.poznan.pl Dane kontaktowe Mirosław Ochodek E-mail: Miroslaw.Ochodek@pwsz.pila.pl

Bardziej szczegółowo

1 Podstawy c++ w pigułce.

1 Podstawy c++ w pigułce. 1 Podstawy c++ w pigułce. 1.1 Struktura dokumentu. Kod programu c++ jest zwykłym tekstem napisanym w dowolnym edytorze. Plikowi takiemu nadaje się zwykle rozszerzenie.cpp i kompiluje za pomocą kompilatora,

Bardziej szczegółowo

Programowanie. programowania. Klasa 3 Lekcja 9 PASCAL & C++

Programowanie. programowania. Klasa 3 Lekcja 9 PASCAL & C++ Programowanie Wstęp p do programowania Klasa 3 Lekcja 9 PASCAL & C++ Język programowania Do przedstawiania algorytmów w postaci programów służą języki programowania. Tylko algorytm zapisany w postaci programu

Bardziej szczegółowo

PLAN WYNIKOWY PROGRAMOWANIE APLIKACJI INTERNETOWYCH. KL III TI 4 godziny tygodniowo (4x30 tygodni =120 godzin ),

PLAN WYNIKOWY PROGRAMOWANIE APLIKACJI INTERNETOWYCH. KL III TI 4 godziny tygodniowo (4x30 tygodni =120 godzin ), PLAN WYNIKOWY PROGRAMOWANIE APLIKACJI INTERNETOWYCH KL III TI 4 godziny tygodniowo (4x30 tygodni =120 godzin ), Program 351203 Opracowanie: Grzegorz Majda Tematyka zajęć 1. Wprowadzenie do aplikacji internetowych

Bardziej szczegółowo

Elżbieta Kula - wprowadzenie do Turbo Pascala i algorytmiki

Elżbieta Kula - wprowadzenie do Turbo Pascala i algorytmiki Elżbieta Kula - wprowadzenie do Turbo Pascala i algorytmiki Turbo Pascal jest językiem wysokiego poziomu, czyli nie jest rozumiany bezpośrednio dla komputera, ale jednocześnie jest wygodny dla programisty,

Bardziej szczegółowo

Jeśli chcesz łatwo i szybko opanować podstawy C++, sięgnij po tę książkę.

Jeśli chcesz łatwo i szybko opanować podstawy C++, sięgnij po tę książkę. Języki C i C++ to bardzo uniwersalne platformy programistyczne o ogromnych możliwościach. Wykorzystywane są do tworzenia systemów operacyjnych i oprogramowania użytkowego. Dzięki niskiemu poziomowi abstrakcji

Bardziej szczegółowo

1 Podstawy c++ w pigułce.

1 Podstawy c++ w pigułce. 1 Podstawy c++ w pigułce. 1.1 Struktura dokumentu. Kod programu c++ jest zwykłym tekstem napisanym w dowolnym edytorze. Plikowi takiemu nadaje się zwykle rozszerzenie.cpp i kompiluje za pomocą kompilatora,

Bardziej szczegółowo

Języki programowania zasady ich tworzenia

Języki programowania zasady ich tworzenia Strona 1 z 18 Języki programowania zasady ich tworzenia Definicja 5 Językami formalnymi nazywamy każdy system, w którym stosując dobrze określone reguły należące do ustalonego zbioru, możemy uzyskać wszystkie

Bardziej szczegółowo

Programowanie robota mobilnego E-puck w języku Python

Programowanie robota mobilnego E-puck w języku Python Programowanie robota mobilnego E-puck w języku Python Joanna Ratajczak Mirela Kaczmarek 1 Zasady bezpieczeństwa W trakcie pracy z robotem E-puck, rys. 1, należy zachować ostrożność. Pod żadnym pozorem

Bardziej szczegółowo

Algorytm. a programowanie -

Algorytm. a programowanie - Algorytm a programowanie - Program komputerowy: Program komputerowy można rozumieć jako: kod źródłowy - program komputerowy zapisany w pewnym języku programowania, zestaw poszczególnych instrukcji, plik

Bardziej szczegółowo

Wykład V. Rzut okiem na języki programowania. Studia Podyplomowe INFORMATYKA Podstawy Informatyki

Wykład V. Rzut okiem na języki programowania. Studia Podyplomowe INFORMATYKA Podstawy Informatyki Studia Podyplomowe INFORMATYKA Podstawy Informatyki Wykład V Rzut okiem na języki programowania 1 Kompilacja vs. interpretacja KOMPILACJA Proces, który przetwarza program zapisany w języku programowania,

Bardziej szczegółowo

Wstęp do programowania

Wstęp do programowania Wstęp do programowania Podstawowe konstrukcje programistyczne Paweł Daniluk Wydział Fizyki Jesień 2013 P. Daniluk (Wydział Fizyki) WP w. II Jesień 2013 1 / 34 Przypomnienie Programowanie imperatywne Program

Bardziej szczegółowo

Wydział Zarządzania AGH. Katedra Informatyki Stosowanej. Podstawy VBA cz. 1. Programowanie komputerowe

Wydział Zarządzania AGH. Katedra Informatyki Stosowanej. Podstawy VBA cz. 1. Programowanie komputerowe Wydział Zarządzania AGH Katedra Informatyki Stosowanej Podstawy VBA cz. 1 Programowanie 1 Program wykładu Struktura programu Instrukcja przypisania Wprowadzanie danych Wyprowadzanie wyników Instrukcja

Bardziej szczegółowo

PROGRAMOWANIE W PYTHONIE OD PIERWSZYCH KROKÓW

PROGRAMOWANIE W PYTHONIE OD PIERWSZYCH KROKÓW PROGRAMOWANIE W PYTHONIE OD PIERWSZYCH KROKÓW http://metodycy.torun.pl/ m.informatyka@metodycy.torun.pl 1. Wprowadzenie do Pythona podstawowe informacje Python to język programowania wysokiego poziomu,

Bardziej szczegółowo

Oczywiście plik musi mieć rozszerzenie *.php

Oczywiście plik musi mieć rozszerzenie *.php Oczywiście plik musi mieć rozszerzenie *.php Znaczniki PHP komunikują serwerowi gdzie rozpoczyna się i kończy kod PHP. Tekst między nimi jest interpretowany jako kod PHP, natomiast poza nimi jako kod HTML.

Bardziej szczegółowo

Podstawy programowania w Pythonie

Podstawy programowania w Pythonie Podstawy programowania w Pythonie Wykład 2 dr Andrzej Zbrzezny Instytut Matematyki i Informatyki Akademia Jana Długosza w Częstochowie 10 października 2012 dr Andrzej Zbrzezny (IMI AJD) Podstawy programowania

Bardziej szczegółowo

Python wstęp do programowania dla użytkowników WCSS

Python wstęp do programowania dla użytkowników WCSS Python wstęp do programowania dla użytkowników WCSS Dr inż. Krzysztof Berezowski Instytut Informatyki, Automatyki i Robotyki Politechniki Wrocławskiej Wprowadzenie CHARAKTERYSTYKA JĘZYKA Filozofia języka

Bardziej szczegółowo

Programowanie w Ruby

Programowanie w Ruby Programowanie w Ruby Wykład 1 Marcin Młotkowski 3 października 2012 Plan wykładu Sprawy organizacyjne Wykład Źródła wiedzy Zaliczenia O języku Historia i pochodzenie języka O języku Instrukcje złożone

Bardziej szczegółowo

INFORMATYKA KLASA VII Wymagania na poszczególne oceny

INFORMATYKA KLASA VII Wymagania na poszczególne oceny INFORMATYKA KLASA VII Wymagania na poszczególne oceny Wymagania na każdy stopień wyższy niż dopuszczający obejmują również wymagania na stopień poprzedni. Wymagania na ocenę celującą obejmują stosowanie

Bardziej szczegółowo

Swift (pol. jerzyk) nowy język programowania zaprezentowany latem 2014 r. (prace od 2010 r.)

Swift (pol. jerzyk) nowy język programowania zaprezentowany latem 2014 r. (prace od 2010 r.) Swift (pol. jerzyk) nowy język programowania zaprezentowany latem 2014 r. (prace od 2010 r.) przeznaczony do programowania zarówno pod ios jak i Mac OS X bazuje na logice Objective-C bez kompatybilności

Bardziej szczegółowo

BIOINFORMATYKA BIOLOGICZNE BAZY DANYCH

BIOINFORMATYKA BIOLOGICZNE BAZY DANYCH http://theta.edu.pl/ Podstawy Bioinformatyki II BIOINFORMATYKA BIOLOGICZNE BAZY DANYCH 1 Czym jest bioinformatyka? 2 Bioinformatyka Bioinformatyka jest interdyscyplinarną dziedziną nauki obejmującą wykorzystanie

Bardziej szczegółowo

Język ludzki kod maszynowy

Język ludzki kod maszynowy Język ludzki kod maszynowy poziom wysoki Język ludzki (mowa) Język programowania wysokiego poziomu Jeśli liczba punktów jest większa niż 50, test zostaje zaliczony; w przeciwnym razie testu nie zalicza

Bardziej szczegółowo

Programowanie dla początkujących w 24 godziny / Greg Perry, Dean Miller. Gliwice, cop Spis treści

Programowanie dla początkujących w 24 godziny / Greg Perry, Dean Miller. Gliwice, cop Spis treści Programowanie dla początkujących w 24 godziny / Greg Perry, Dean Miller. Gliwice, cop. 2017 Spis treści O autorach 11 Podziękowania 12 Wprowadzenie 13 CZĘŚĆ I ZACZNIJ PROGRAMOWAĆ JUŻ DZIŚ Godzina 1. Praktyczne

Bardziej szczegółowo

Wprowadzenie do języka Java

Wprowadzenie do języka Java WSNHiD, Programowanie 2 Lab. 1 [ część 1 ] Wprowadzenie do języka Java Wprowadzenie Język programowania Java jest obiektowym językiem programowania. Powstał w 1995 i od tej pory był intensywnie rozwijany.

Bardziej szczegółowo

Automatyzacja pracy w AutoCAD

Automatyzacja pracy w AutoCAD Automatyzacja pracy w AutoCAD 1 Informacje wstępne BASIC (Beginners All-Purpose Symbolic Instruction Code) Rok powstania: 1963 r. Cel realizacji: nauczanie studentów programowania umożliwienie programowania

Bardziej szczegółowo

Niezwykłe tablice Poznane typy danych pozwalają przechowywać pojedyncze liczby. Dzięki tablicom zgromadzimy wiele wartości w jednym miejscu.

Niezwykłe tablice Poznane typy danych pozwalają przechowywać pojedyncze liczby. Dzięki tablicom zgromadzimy wiele wartości w jednym miejscu. Część XIX C++ w Każda poznana do tej pory zmienna może przechowywać jedną liczbę. Jeśli zaczniemy pisać bardziej rozbudowane programy, okaże się to niewystarczające. Warto więc poznać zmienne, które mogą

Bardziej szczegółowo

Dariusz Brzeziński. Politechnika Poznańska, Instytut Informatyki

Dariusz Brzeziński. Politechnika Poznańska, Instytut Informatyki Dariusz Brzeziński Politechnika Poznańska, Instytut Informatyki Język programowania prosty bezpieczny zorientowany obiektowo wielowątkowy rozproszony przenaszalny interpretowany dynamiczny wydajny Platforma

Bardziej szczegółowo

Sprzęt komputera - zespół układów wykonujących programy wprowadzone do pamięci komputera (ang. hardware) Oprogramowanie komputera - zespół programów

Sprzęt komputera - zespół układów wykonujących programy wprowadzone do pamięci komputera (ang. hardware) Oprogramowanie komputera - zespół programów Sprzęt komputera - zespół układów wykonujących programy wprowadzone do pamięci komputera (ang. hardware) Oprogramowanie komputera - zespół programów przeznaczonych do wykonania w komputerze (ang. software).

Bardziej szczegółowo

Zajęcia nr 1 Podstawy programowania. dr inż. Łukasz Graczykowski mgr inż. Leszek Kosarzewski Wydział Fizyki Politechniki Warszawskiej

Zajęcia nr 1 Podstawy programowania. dr inż. Łukasz Graczykowski mgr inż. Leszek Kosarzewski Wydział Fizyki Politechniki Warszawskiej Zajęcia nr 1 Podstawy programowania dr inż. Łukasz Graczykowski mgr inż. Leszek Kosarzewski Wydział Fizyki Politechniki Warszawskiej Ramowy program warsztatów 1. Pierwsze: Podstawy programowania 2. Drugie:

Bardziej szczegółowo

Pętla for. Matematyka dla ciekawych świata -19- Scilab. for i=1:10... end. for k=4:-1:1... end. k=3 k=4. k=1. k=2

Pętla for. Matematyka dla ciekawych świata -19- Scilab. for i=1:10... end. for k=4:-1:1... end. k=3 k=4. k=1. k=2 Pętle wielokrotne wykonywanie ciągu instrukcji. Bardzo często w programowaniu wykorzystuje się wielokrotne powtarzanie określonego ciągu czynności (instrukcji). Rozróżniamy sytuacje, gdy liczba powtórzeń

Bardziej szczegółowo

JAVA. Platforma JSE: Środowiska programistyczne dla języka Java. Wstęp do programowania w języku obiektowym. Opracował: Andrzej Nowak

JAVA. Platforma JSE: Środowiska programistyczne dla języka Java. Wstęp do programowania w języku obiektowym. Opracował: Andrzej Nowak JAVA Wstęp do programowania w języku obiektowym Bibliografia: JAVA Szkoła programowania, D. Trajkowska Ćwiczenia praktyczne JAVA. Wydanie III,M. Lis Platforma JSE: Opracował: Andrzej Nowak JSE (Java Standard

Bardziej szczegółowo

Temat 1: Podstawowe pojęcia: program, kompilacja, kod

Temat 1: Podstawowe pojęcia: program, kompilacja, kod Temat 1: Podstawowe pojęcia: program, kompilacja, kod wynikowy. Przykłady najprostszych programów. Definiowanie zmiennych. Typy proste. Operatory: arytmetyczne, przypisania, inkrementacji, dekrementacji,

Bardziej szczegółowo

Podstawy bioinformatyki - biologiczne bazy danych

Podstawy bioinformatyki - biologiczne bazy danych Podstawy bioinformatyki - biologiczne bazy danych Czym jest bioinformatyka? Bioinformatyka Bioinformatyka jest interdyscyplinarną dziedziną nauki obejmującą wykorzystanie metod obliczeniowych do badania

Bardziej szczegółowo

Modelowanie rynków finansowych z wykorzystaniem pakietu R

Modelowanie rynków finansowych z wykorzystaniem pakietu R Modelowanie rynków finansowych z wykorzystaniem pakietu R Wprowadzenie do pakietu R Mateusz Topolewski woland@mat.umk.pl Wydział Matematyki i Informatyki UMK Plan działania 1 Co i dlaczego...? 2 Przechowywanie

Bardziej szczegółowo

Zapisywanie algorytmów w języku programowania

Zapisywanie algorytmów w języku programowania Temat C5 Zapisywanie algorytmów w języku programowania Cele edukacyjne Zrozumienie, na czym polega programowanie. Poznanie sposobu zapisu algorytmu w postaci programu komputerowego. Zrozumienie, na czym

Bardziej szczegółowo

Programowanie obiektowe

Programowanie obiektowe Programowanie obiektowe Wykład 2: Wstęp do języka Java 3/4/2013 S.Deniziak: Programowanie obiektowe - Java 1 Cechy języka Java Wszystko jest obiektem Nie ma zmiennych globalnych Nie ma funkcji globalnych

Bardziej szczegółowo

Język JAVA podstawy. wykład 1, część 3. Jacek Rumiński. Politechnika Gdańska, Inżynieria Biomedyczna

Język JAVA podstawy. wykład 1, część 3. Jacek Rumiński. Politechnika Gdańska, Inżynieria Biomedyczna Język JAVA podstawy wykład 1, część 3 1 Język JAVA podstawy Plan wykładu: 1. Krótka historia Javy 2. Jak przygotować sobie środowisko programistyczne 3. Opis środowiska JDK 4. Tworzenie programu krok po

Bardziej szczegółowo

Podstawy programowania.

Podstawy programowania. Kod przedmiotu: PPR Podstawy programowania. Rodzaj przedmiotu: kierunkowy; obowiązkowy Wydział: Informatyki Kierunek: Informatyka Specjalność (specjalizacja): - Poziom studiów: pierwszego stopnia Profil

Bardziej szczegółowo

Języki i metodyka programowania

Języki i metodyka programowania Języki i metodyka programowania www.ee.pw.edu.pl/~slawinsm Dr inż. Maciej Sławiński M.Slawinski@ee.pw.edu.pl GE518l Konsultacje: śr. 13 00-13 45 SK201/GE518l pt. 10 15-11 00 GE518l/SK201 Algorytmika Literatura

Bardziej szczegółowo

ALGORYTMY I PROGRAMY

ALGORYTMY I PROGRAMY ALGORYTMY I PROGRAMY Program to ciąg instrukcji, zapisanych w języku zrozumiałym dla komputera. Ten ciąg instrukcji realizuje jakiś algorytm. Algorytm jest opisem krok po kroku jak rozwiązać problem, czy

Bardziej szczegółowo

JAVAScript w dokumentach HTML - przypomnienie

JAVAScript w dokumentach HTML - przypomnienie Programowanie obiektowe ćw.1 JAVAScript w dokumentach HTML - przypomnienie JavaScript jest to interpretowany, zorientowany obiektowo, skryptowy język programowania. Skrypty JavaScript są zagnieżdżane w

Bardziej szczegółowo

Wstęp do programowania

Wstęp do programowania Wstęp do programowania Podstawowe konstrukcje programistyczne Paweł Daniluk Wydział Fizyki Jesień 2014 P. Daniluk (Wydział Fizyki) WP w. II Jesień 2014 1 / 38 Przypomnienie Programowanie imperatywne Program

Bardziej szczegółowo

Programowanie. Pascal - język programowania wysokiego poziomu. Klasa 2 Lekcja 9 PASCAL

Programowanie. Pascal - język programowania wysokiego poziomu. Klasa 2 Lekcja 9 PASCAL Programowanie Pascal - język programowania wysokiego poziomu Klasa 2 Lekcja 9 PASCAL Język programowania Do przedstawiania algorytmów w postaci programów służą języki programowania. Tylko algorytm zapisany

Bardziej szczegółowo

Wiadomości wstępne Środowisko programistyczne Najważniejsze różnice C/C++ vs Java

Wiadomości wstępne Środowisko programistyczne Najważniejsze różnice C/C++ vs Java Wiadomości wstępne Środowisko programistyczne Najważniejsze różnice C/C++ vs Java Cechy C++ Język ogólnego przeznaczenia Można programować obiektowo i strukturalnie Bardzo wysoka wydajność kodu wynikowego

Bardziej szczegółowo

PLAN WYNIKOWY PROGRAMOWANIE APLIKACJI INTERNETOWYCH. KL IV TI 6 godziny tygodniowo (6x15 tygodni =90 godzin ),

PLAN WYNIKOWY PROGRAMOWANIE APLIKACJI INTERNETOWYCH. KL IV TI 6 godziny tygodniowo (6x15 tygodni =90 godzin ), PLAN WYNIKOWY PROGRAMOWANIE APLIKACJI INTERNETOWYCH KL IV TI 6 godziny tygodniowo (6x15 tygodni =90 godzin ), Program 351203 Opracowanie: Grzegorz Majda Tematyka zajęć 2. Przygotowanie środowiska pracy

Bardziej szczegółowo

Programowanie od pierwszoklasisty do maturzysty. Grażyna Koba

Programowanie od pierwszoklasisty do maturzysty. Grażyna Koba Programowanie od pierwszoklasisty do maturzysty Grażyna Koba Krąg trzydziestolecia nauki programowania C++, Java Scratch, Baltie, Logo, Python? 2017? Informatyka SP, GIMN, PG 1987 Elementy informatyki

Bardziej szczegółowo

Uwagi dotyczące notacji kodu! Moduły. Struktura modułu. Procedury. Opcje modułu (niektóre)

Uwagi dotyczące notacji kodu! Moduły. Struktura modułu. Procedury. Opcje modułu (niektóre) Uwagi dotyczące notacji kodu! Wyrazy drukiem prostym -- słowami języka VBA. Wyrazy drukiem pochyłym -- inne fragmenty kodu. Wyrazy w [nawiasach kwadratowych] opcjonalne fragmenty kodu (mogą być, ale nie

Bardziej szczegółowo

Bloki anonimowe w PL/SQL

Bloki anonimowe w PL/SQL Język PL/SQL PL/SQL to specjalny język proceduralny stosowany w bazach danych Oracle. Język ten stanowi rozszerzenie SQL o szereg instrukcji, znanych w proceduralnych językach programowania. Umożliwia

Bardziej szczegółowo

Laboratorium Wstawianie skryptu na stroną: 2. Komentarze: 3. Deklaracja zmiennych

Laboratorium Wstawianie skryptu na stroną: 2. Komentarze: 3. Deklaracja zmiennych 1. Wstawianie skryptu na stroną: Laboratorium 1 Do umieszczenia skryptów na stronie służy znacznik: //dla HTML5 ...instrukcje skryptu //dla HTML4 ...instrukcje

Bardziej szczegółowo

Podstawy języka C++ Maciej Trzebiński. Instytut Fizyki Jądrowej Polskiej Akademii Nauk. Praktyki studenckie na LHC IVedycja,2016r.

Podstawy języka C++ Maciej Trzebiński. Instytut Fizyki Jądrowej Polskiej Akademii Nauk. Praktyki studenckie na LHC IVedycja,2016r. M. Trzebiński C++ 1/14 Podstawy języka C++ Maciej Trzebiński Instytut Fizyki Jądrowej Polskiej Akademii Nauk Praktyki studenckie na LHC IVedycja,2016r. IFJ PAN Przygotowanie środowiska pracy Niniejsza

Bardziej szczegółowo

Dynamiczne przetwarzanie stron. dr Beata Kuźmińska-Sołśnia

Dynamiczne przetwarzanie stron. dr Beata Kuźmińska-Sołśnia Dynamiczne przetwarzanie stron dr Beata Kuźmińska-Sołśnia KLIENT Witaj INTERNET SERWER Plik HTML Witaj wyświetlanie przez przeglądarkę Witaj! Serwer WWW komputer

Bardziej szczegółowo

Cw.12 JAVAScript w dokumentach HTML

Cw.12 JAVAScript w dokumentach HTML Cw.12 JAVAScript w dokumentach HTML Wstawienie skryptu do dokumentu HTML JavaScript jest to interpretowany, zorientowany obiektowo, skryptowy język programowania.skrypty Java- Script mogą być zagnieżdżane

Bardziej szczegółowo

Technologie cyfrowe. Artur Kalinowski. Zakład Cząstek i Oddziaływań Fundamentalnych Pasteura 5, pokój 4.15

Technologie cyfrowe. Artur Kalinowski. Zakład Cząstek i Oddziaływań Fundamentalnych Pasteura 5, pokój 4.15 Technologie cyfrowe Artur Kalinowski Zakład Cząstek i Oddziaływań Fundamentalnych Pasteura 5, pokój 4.15 Artur.Kalinowski@fuw.edu.pl Semestr letni 2014/2015 Zadanie algorytmiczne: wyszukiwanie dane wejściowe:

Bardziej szczegółowo

Język JAVA podstawy. Wykład 3, część 3. Jacek Rumiński. Politechnika Gdańska, Inżynieria Biomedyczna

Język JAVA podstawy. Wykład 3, część 3. Jacek Rumiński. Politechnika Gdańska, Inżynieria Biomedyczna Język JAVA podstawy Wykład 3, część 3 1 Język JAVA podstawy Plan wykładu: 1. Konstrukcja kodu programów w Javie 2. Identyfikatory, zmienne 3. Typy danych 4. Operatory, instrukcje sterujące instrukcja warunkowe,

Bardziej szczegółowo

Elementy języka C. ACprogramislikeafastdanceonanewlywaxeddancefloorbypeople carrying razors.

Elementy języka C. ACprogramislikeafastdanceonanewlywaxeddancefloorbypeople carrying razors. Wykład 3 ACprogramislikeafastdanceonanewlywaxeddancefloorbypeople carrying razors. Waldi Ravens J. Cichoń, P. Kobylański Wstęp do Informatyki i Programowania 75 / 146 deklaracje zmiennych instrukcja podstawienia

Bardziej szczegółowo

Programowanie, algorytmy i struktury danych

Programowanie, algorytmy i struktury danych 1/44 Programowanie, algorytmy i struktury danych materiały do wykładu: http://cez.wipb.pl/moodle/ email: m.tabedzki@pb.edu.pl strona: http://aragorn.pb.bialystok.pl/~tabedzki/ Marek Tabędzki Wymagania

Bardziej szczegółowo

Pytania sprawdzające wiedzę z programowania C++

Pytania sprawdzające wiedzę z programowania C++ Pytania sprawdzające wiedzę z programowania C++ Wstęp 1. Zaprezentuj mechanikę tworzenia programu napisanego w języku C++. 2. Co to jest kompilacja? 3. Co to jest konsolidacja? 4. Co to jest kod wykonywalny?

Bardziej szczegółowo

KURS C/C++ WYKŁAD 2. char znak; znak = a ; Program 2 #include<stdio.h> void main() { char znak; while( (znak = getchar() )!= t ) putchar(znak); }

KURS C/C++ WYKŁAD 2. char znak; znak = a ; Program 2 #include<stdio.h> void main() { char znak; while( (znak = getchar() )!= t ) putchar(znak); } KURS C/C++ WYKŁAD 2 Instrukcje iteracyjne Instrukcja while Składnia tej instrukcji jest następująca: while (wyrażenie) instrukcja W pętli while wykonanie instrukcji powtarza się tak długo, jak długo wartość

Bardziej szczegółowo

Wykład z Technologii Informacyjnych. Piotr Mika

Wykład z Technologii Informacyjnych. Piotr Mika Wykład z Technologii Informacyjnych Piotr Mika Uniwersalna forma graficznego zapisu algorytmów Schemat blokowy zbiór bloków, powiązanych ze sobą liniami zorientowanymi. Jest to rodzaj grafu, którego węzły

Bardziej szczegółowo

PHP: bloki kodu, tablice, obiekty i formularze

PHP: bloki kodu, tablice, obiekty i formularze 1 PHP: bloki kodu, tablice, obiekty i formularze SYSTEMY SIECIOWE Michał Simiński 2 Bloki kodu Blok if-else Switch Pętle Funkcje Blok if-else 3 W PHP blok if i blok if-else wyglądają tak samo i funkcjonują

Bardziej szczegółowo

Programowanie strukturalne i obiektowe

Programowanie strukturalne i obiektowe Programowanie strukturalne i obiektowe Język C część I Opracował: Grzegorz Flesik Literatura: A. Majczak, Programowanie strukturalne i obiektowe, Helion, Gliwice 2010 P. Domka, M. Łokińska, Programowanie

Bardziej szczegółowo

Podstawy programowania w Pythonie

Podstawy programowania w Pythonie Podstawy programowania w Pythonie Wykład 1 dr Andrzej Zbrzezny Instytut Matematyki i Informatyki Akademia Jana Długosza w Częstochowie 3 października 2012 dr Andrzej Zbrzezny (IMI AJD) Podstawy programowania

Bardziej szczegółowo

Wstęp do programowania INP001213Wcl rok akademicki 2017/18 semestr zimowy. Wykład 1. Karol Tarnowski A-1 p.

Wstęp do programowania INP001213Wcl rok akademicki 2017/18 semestr zimowy. Wykład 1. Karol Tarnowski A-1 p. Wstęp do programowania INP001213Wcl rok akademicki 2017/18 semestr zimowy Wykład 1 Karol Tarnowski karol.tarnowski@pwr.edu.pl A-1 p. 411B Plan wykładów (1) Algorytmy i programy Proste typy danych Rozgałęzienia

Bardziej szczegółowo

Wprowadzenie do programowania

Wprowadzenie do programowania do programowania ITA-104 Wersja 1 Warszawa, Wrzesień 2009 ITA-104 do programowania Informacje o kursie Zakres tematyczny kursu Opis kursu Kurs przeznaczony jest do prowadzenia przedmiotu do programowania

Bardziej szczegółowo

Programowanie. Projektowanie funkcje programu tworzenie algorytmu i struktur danych. Programowanie implementacja algorytmu kompilacja programu

Programowanie. Projektowanie funkcje programu tworzenie algorytmu i struktur danych. Programowanie implementacja algorytmu kompilacja programu Programowanie V Dariusz Skibicki Wydział Inżynierii Mechanicznej Uniwersytet Technologiczno-Przyrodniczy im. Jana i Jędrzeja Śniadeckich w Bydgoszczy dariusz.skibicki(at)utp.edu.pl Programowanie Projektowanie

Bardziej szczegółowo

PROLOG WSTĘP DO INFORMATYKI. Akademia Górniczo-Hutnicza. Wydział Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej.

PROLOG WSTĘP DO INFORMATYKI. Akademia Górniczo-Hutnicza. Wydział Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej. Akademia Górniczo-Hutnicza Wydział Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej WSTĘP DO INFORMATYKI Adrian Horzyk PROLOG www.agh.edu.pl Pewnego dnia przyszedł na świat komputer Komputery

Bardziej szczegółowo

Funkcje i instrukcje języka JavaScript

Funkcje i instrukcje języka JavaScript Funkcje i instrukcje języka JavaScript 1. Cele lekcji a) Wiadomości Uczeń : zna operatory i typy danych języka JavaScript, zna konstrukcję definicji funkcji, zna pętlę If i For, Do i While oraz podaje

Bardziej szczegółowo

Podstawy Informatyki sem. I 2014/2015 studia zaoczne Elektronika i Telekomunikacja!

Podstawy Informatyki sem. I 2014/2015 studia zaoczne Elektronika i Telekomunikacja! Podstawy Informatyki sem. I 2014/2015 studia zaoczne Elektronika i Telekomunikacja! Krzysztof Grudzień kgrudzi@kis.p.lodz.pl! Zbigniew Chaniecki zch@kis.p.lodz.pl 1 program zajęć - wykład Podstawowe pojęcia

Bardziej szczegółowo

Wykład 4. Algorytmy i programy. Algorytmy + struktury danych = programy. Niklaus Wirth. Algorytm = logika + sterowanie.

Wykład 4. Algorytmy i programy. Algorytmy + struktury danych = programy. Niklaus Wirth. Algorytm = logika + sterowanie. Wykład 4 Algorytmy + struktury danych = programy Niklaus Wirth Algorytm = logika + sterowanie Robert Kowalski J. Cichoń, P. Kobylański Wstęp do Informatyki i Programowania 80 / 277 algorytm program język

Bardziej szczegółowo

Zapis algorytmów: schematy blokowe i pseudokod 1

Zapis algorytmów: schematy blokowe i pseudokod 1 Zapis algorytmów: schematy blokowe i pseudokod 1 Przed przystąpieniem do napisania kodu programu należy ten program najpierw zaprojektować. Projekt tworzącego go algorytmu może być zapisany w formie schematu

Bardziej szczegółowo

Laboratorium 03: Podstawowe konstrukcje w języku Java [2h]

Laboratorium 03: Podstawowe konstrukcje w języku Java [2h] 1. Typy. Java jest językiem programowania z silnym systemem kontroli typów. To oznacza, że każda zmienna, atrybut czy parametr ma zadeklarowany typ. Kompilator wylicza typy wszystkich wyrażeń w programie

Bardziej szczegółowo

Języki i metody programowania

Języki i metody programowania Języki i metody programowania Wykład 3 dr hab. Bożena Woźna-Szcześniak bwozna@gmail.com Instytut Matematyki i Informatyki Akademia Jana Długosza w Częstochowie hab. Andrzeja Zbrzezngo Wartości boolowskie

Bardziej szczegółowo

Jak napisać program obliczający pola powierzchni różnych figur płaskich?

Jak napisać program obliczający pola powierzchni różnych figur płaskich? Część IX C++ Jak napisać program obliczający pola powierzchni różnych figur płaskich? Na początku, przed stworzeniem właściwego kodu programu zaprojektujemy naszą aplikację i stworzymy schemat blokowy

Bardziej szczegółowo

Wstęp do programowania

Wstęp do programowania Wstęp do programowania wykład 4 Piotr Cybula Wydział Matematyki i Informatyki UŁ 2012/2013 http://www.math.uni.lodz.pl/~cybula Instrukcje pętli Pętle służą do iteracyjnego wykonywania pewnych kroków Zazwyczaj

Bardziej szczegółowo