KARTA ODPOWIEDZI konkurs biologiczny ETAP REJONOWY Prawidłowe odpowiedzi Punktacja Uwagi

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "KARTA ODPOWIEDZI konkurs biologiczny ETAP REJONOWY Prawidłowe odpowiedzi Punktacja Uwagi"

Transkrypt

1 Nr zad. Max punktów 1. 3 pkt. A. wiroidy B. wirusy C. priony 2. 5 pkt. KULISTE KARTA ODPOWIEDZI konkurs biologiczny ETAP REJONOWY Prawidłowe odpowiedzi Punktacja Uwagi WYDŁUŻONE BAKTERIE SPIRALNIE SKRĘCONE FORMY ROZGAŁĘZIONE Za poprawne przyporządkowanie nazwy tworu do jego opisu - po Za wpisanie 9 nazw form bakterii w pustych miejscach schematu 5 pkt. 8-7 nazw 4 pkt. 6-5 nazw 3 pkt. 4 nazwy 2 pkt. 3-2 nazwy 1-0 nazw 0 pkt. PAŁECZKI LASECZKI PROMIENIOWCE DWOINKI ZIARNIAKI PRĄTKI ŚRUBOWCE KRĘTKI PACIORKOWCE GRONKOWCE 3. 2 pkt. nazwa mitochondrium funkcja przeprowadza proces oddychania wewnątrzkomórkowego / zachodzi w nim proces uwalniania energii w komórce Za podanie j nazwy składnika komórki i funkcji po przyznajemy punkt Strona 1 z 8

2 4. 5 pkt. ameba podział komórki drożdże pączkowanie chlorella podział komórki kropidlak zarodniki skrętnica fragmentacja Za podanie go sposobu rozmnażania bezpłciowego każdego z organizmów po 5. Prawidłowa odpowiedź: A Za zaznaczenie poprawnej odpowiedzi 6. 3 pkt. I rak rzeczny II pomrów wielki III bielinek kapustnik Za przyporządkowanie nazw gatunków do wykresów po 7. rodzaj termoregulacji ( zwierzęta zmiennocieplne i stałocieplne) Za podanie go kryterium 8. 4 pkt. A. Temperatura otoczenia Skórne naczynia krwionośne Ilość krwi przepływająca przez skórne naczynia krwionośne Utrata ciepła 10 0 C obkurczone zmniejsza się maleje Za wykreślenie 6 nieprawidłowych słów - 3 pkt. 5-4 słów 2 pkt. 3-2 słów 1-0 słów 0 pkt. przyznajemy punkt. Odpowiedź w poleceniu B może przyznajemy punkt C rozszerzone zwiększa się rośnie Za podanie innego, poprawnego sposobu termoregulacji B. gruczoły potowe/ wydzielanie potu/ pocenie się Strona 2 z 8

3 9. 5 pkt. A. 1. tętnice odprowadzają krew od serca, żyły doprowadzają krew do serca 2. żyły posiadają zastawki, tętnice ich nie mają B. żyła główna górna i dolna, tętnica płucna C. Przez płuca przepływa również 5 litrów krwi., ponieważ tyle samo krwi, ile wraca z ciała do prawej części serca i płynie do płuc, wraca z płuc i wypływa z lewej części serca do ciała, gdyż układ krwionośny człowieka jest zamknięty pkt. Chrząstki w kształcie podkowy umożliwiają rozciąganie przełyku podczas połykania pokarmu/ chrząstki w kształcie obręczy uniemożliwiałyby połykanie pokarmu, gdyż przełyk musi się rozszerzyć pkt. Probówki nr 1 i 2. W tych probówkach zarówno ślina jak i sok żołądkowy nie zawierają lipazy, dlatego tłuszcz nie zostanie rozłożony i zabarwi się na kolor czerwony. W probówce 3 sok trzustkowy zawiera lipazę/ enzymy rozkładające tłuszcze, stąd brak czerwonego zabarwienia. Za podanie 2 różnic między tętnicami a żyłami po Za wypisanie wszystkich naczyń z krwią odtlenowaną Za właściwą odpowiedź Za poprawne uzasadnienie Za udzielenie poprawnej odpowiedzi na pytanie 2 pkt. Za podanie właściwych numerów probówek Za poprawne uzasadnienie 2 pkt. W poleceniu A punkty przyznajemy za podanie różnic, ale tylko tych, które są widoczne na rysunku. Odpowiedzi w poleceniu A i C mogą być sformułowane poprawne przyznajemy punkt/ przyznajemy punkt. W uzasadnieniu musi pojawić się słowo lipaza lub enzym rozkładający tłuszcze, tylko w takim przypadku przyznajemy 2 pkt. Strona 3 z 8

4 12. 3 pkt. Należy podkreślić następujące słowa: a) tętnica z krwią tętniczą z produktami przemiany materii b) żyła z krwią żylną oczyszczoną z produktów przemiany materii c) moczowód z moczem ostatecznym Za podkreślenie wszystkich właściwych słów w zdaniu a, b i c po pkt. 1. MELATONINA 2. TYROKSYNA 3. PARATHORMON 4. GLUKAGON 5. PROGESTERON pkt. Polecenie 1. A. ciało neuronu/ perykarion B. dendryt C. akson/neuryt D. osłonka mielinowa Polecenie 2. B. - przewodzi impuls nerwowy do ciała neuronu D. zwiększa tempo przewodzenia impulsów nerwowych we włóknie nerwowym / jest doskonałym izolatorem elektryczności/ zapobiega rozpraszaniu się impulsu nerwowego/ chroni akson Za zakreślenie prawidłowych nazw hormonów w punktach 1-5 po Za wpisanie 4 nazw elementów neuronu 2 pkt. 3-2 nazw 1-0 nazw 0 pkt. Za podanie funkcji struktury B Za podanie funkcji struktury D 15. Prawidłowa odpowiedź: C Za zaznaczenie poprawnej odpowiedzi Odpowiedzi w poleceniu 2 mogą pkt. choroby wirusowe AIDS, choroba wywoływana przez wirusa HPV wirusa brodawczaka ludzkiego (wywołuje raka szyjki macicy), wirusowe zapalenie wątroby typu B Za podanie przykładów chorób bakteryjnych i wirusowych po choroby bakteryjne kiła, rzeżączka Strona 4 z 8

5 17. 2 pkt. Złamana kość została oznaczona cyfrą 5. Warunkiem unieruchomienia jest zablokowanie dwóch sąsiadujących z miejscem złamania stawów/ usztywnienie ręki wraz ze stawem nadgarstkowym i łokciowym. Za wpisanie poprawnej cyfry wskazującej złamaną kość Za podanie sposobu unieruchomienia kości przyznajemy punkt pkt. Cechy budowy DNA RNA Za prawidłowe uzupełnienie Aby przyznać Ilość nici budujących 2 1 każdego wiersza po punkt, wszystkie cząsteczkę. Rodzaje nukleotydów. adeninowy, guaninowy, tyminowy, cytozynowy adeninowy, guaninowy, uracylowy, cytozynowy informacje w danym wierszu muszą być Zasady azotowe. adenina, guanina, tymina, adenina, guanina, uracyl, poprawne. cytozyna cytozyna Cukier deoksyryboza ryboza pkt Za przyporządkowanie 4 opisów do właściwych rysunków 3 pkt. 3 opisów 2 pkt. 2 opisów 1-0 opisów 0 pkt pkt. Genom, allel, fenotyp, zmienność genetyczna, gen, kariotyp, genotyp Za wpisanie 7 poprawnych pojęć 5 pkt. 6 pojęć 4 pkt. 5 pojęć 3 pkt. 4 pojęć 2 pkt. 3-2 pojęć 1-0 pojęć 0 pkt pkt nukleotydów Za udzielenie poprawnych Odpowiedzi mogą Strona 5 z 8

6 22. 3 pkt. A. transkrypcja B. replikacja 2. 8 aminokwasów 3. Nie każdy kodon koduje aminokwas. Są 3 kodony STOP, które warunkują zakończenie biosyntezy białka. 4. Większość aminokwasów jest kodowana przez więcej niż jeden kodon / ten sam aminokwas może być kodowany przez kilka różnych kodonów, gdyż kodonów (64) jest znacznie więcej niż aminokwasów (20). Transkrypcja to proces przepisania informacji dotyczącej budowy białka z DNA na odpowiednią kolejność nukleotydów w mrna/ na mrna. Replikacja DNA to proces syntezy DNA prowadzący do powstania dwóch cząsteczek DNA z jednej. odpowiedzi na każde z pytań, wraz z uzasadnieniem (pytanie 3 i 4) po Za nazwanie obu procesów Za wyjaśnienie każdego z procesów po Odpowiedzi mogą 23. TACGCACCTAAAGAACGTTGGCGCATT Za podanie poprawnej sekwencji pkt. 6. Odłączanie się od rybosomu cząsteczek trna pozbawionych aminokwasów. 3. Połączenie w cytoplazmie mrna z rybosomem. 5. Łączenie aminokwasów dostarczonych przez trna. 1. Przepisanie informacji z nici DNA na mrna. 4. Transport do rybosomu aminokwasów przez cząsteczki trna. 2. Transport cząsteczki mrna z jądra do cytoplazmy. 7. Zwijanie się łańcucha aminokwasów w celu wytworzenia j struktury przestrzennej. Za prawidłowe ponumerowanie 7 zdań - 6 pkt. 6 zdań 5 pkt. 5 zdań 4 pkt. 4 zdań 3 pkt. 3 zdań 2 pkt. 2 zdań 1-0 zdań 0 pkt. Strona 6 z 8

7 25. 4 pkt. 1. Króliki będą miały tłuszcz biały, gdyż w pokarmie nie ma ksantofilu, który mógłby nadać mu barwę żółtą. 2. Króliki będą miały tłuszcz żółty, gdyż w pokarmie znajduje się ksantofil, nadający żółty kolor, a króliki będące homozygotami recesywnymi nie są zdolne do wytwarzania enzymu rozkładającego ten barwnik pkt. A. c) B. c) pkt. A. Kobieta X D X d Mężczyzna - X D Y Syn X d Y Za właściwą odpowiedź na pytanie 1 i 2 po Za poprawne uzasadnienia po Za zaznaczenie poprawnej odpowiedzi w pytaniu A i B po Za poprawne ustalenie genotypów 3 osób po Za prawidłowe wypełnienie szachownicy genetycznej Odpowiedzi mogą B. X D X d X D X D X D X D X d Y X D Y X d Y Za udzielenie poprawnej odpowiedzi dotyczącej męskich potomków Odpowiedź: 100% dziewczynek zdrowych ( połowa to nosicielki genu na daltonizm). 50% chłopców zdrowych i 50% chłopców chorych na daltonizm / Możemy się spodziewać zdrowych dziewczynek, a w przypadku chłopców takie samo prawdopodobieństwo przyjścia na świat chorego lub zdrowego dziecka. Za udzielenie poprawnej odpowiedzi dotyczącej żeńskich potomków Odpowiedzi mogą Strona 7 z 8

8 28. 4 pkt. A. Rośliny transgeniczne otrzymuje się przez wprowadzenie do chromosomu roślinnego obcego DNA, które jest przekazywane następnym pokoleniom. B. zwiększona odporność na choroby, szkodniki, niekorzystne warunki atmosferyczne, podwyższenie trwałości przechowywanych owoców zwiększona zawartość pożądanych składników odżywczych C. Techniki inżynierii genetycznej/inżynieria genetyczna. Za udzielenie prawidłowych odpowiedzi na pytania A i C po W pytaniu B za wypisanie 2 celów modyfikacji genetycznych po Odpowiedzi mogą być sformułowane inaczej. Jeśli są poprawne przyznajemy punkt / Strona 8 z 8

KONKURS BIOLOGICZNY DLA UCZNIÓW SZKÓŁ GIMNAZJALNYCH

KONKURS BIOLOGICZNY DLA UCZNIÓW SZKÓŁ GIMNAZJALNYCH pieczątka WKK Kod ucznia - - Dzień Miesiąc Rok DATA URODZENIA UCZNIA Drogi Uczniu! GRATULACJE! KONKURS BIOLOGICZNY DLA UCZNIÓW SZKÓŁ GIMNAZJALNYCH ETAP REJONOWY Witaj na II etapie konkursu biologicznego.

Bardziej szczegółowo

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A...

Pamiętając o komplementarności zasad azotowych, dopisz sekwencję nukleotydów brakującej nici DNA. A C C G T G C C A A T C G A... 1. Zadanie (0 2 p. ) Porównaj mitozę i mejozę, wpisując do tabeli podane określenia oraz cyfry. ta sama co w komórce macierzystej, o połowę mniejsza niż w komórce macierzystej, gamety, komórki budujące

Bardziej szczegółowo

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :.

CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A. imię i nazwisko :. klasa :.. ilość punktów :. CORAZ BLIŻEJ ISTOTY ŻYCIA WERSJA A imię i nazwisko :. klasa :.. ilość punktów :. Zadanie 1 Przeanalizuj schemat i wykonaj polecenia. a. Wymień cztery struktury występujące zarówno w komórce roślinnej,

Bardziej szczegółowo

KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP REJONOWY 2015/16

KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP REJONOWY 2015/16 KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP REJONOWY 2015/16 Nr Max ilość zad. punktów 1. 2 pkt Mechanizmy termoregulacyjne 1.Podskórne naczynia krwionośne (rozszerzają się / zwężają się) Prawidłowe odpowiedzi

Bardziej szczegółowo

2. 1 Prawidłowa odpowiedź -C Za zaznaczenie poprawnej odpowiedzi 1 pkt

2. 1 Prawidłowa odpowiedź -C Za zaznaczenie poprawnej odpowiedzi 1 pkt KARTA ODPOWIEDZI KONKURS BIOLOGICZNY - /etap szkolny/ Nr Max Prawidłowe odpowiedzi Punktacja Uwagi zad. punktów 1. 2 U człowieka: - większa mózgoczaszka w stosunku do trzewioczaszki - żuchwa z wystającą

Bardziej szczegółowo

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier.

6. Z pięciowęglowego cukru prostego, zasady azotowej i reszty kwasu fosforowego, jest zbudowany A. nukleotyd. B. aminokwas. C. enzym. D. wielocukier. ID Testu: F5679R8 Imię i nazwisko ucznia Klasa Data 1. Na indywidualne cechy danego osobnika ma (maja) wpływ A. wyłacznie czynniki środowiskowe. B. czynniki środowiskowe i materiał genetyczny. C. wyłacznie

Bardziej szczegółowo

Klucz odpowiedzi do konkursu biologicznego dla gimnazjum

Klucz odpowiedzi do konkursu biologicznego dla gimnazjum Klucz odpowiedzi do konkursu biologicznego dla gimnazjum Nr Max zad. punktów Prawidłowe odpowiedzi Punktacja Uwagi 1. 3 Typ: Strunowce Podtyp: Kręgowce Gromada: Ssaki Podgromada: Łożyskowce Rząd: Naczelne

Bardziej szczegółowo

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II

października 2013: Elementarz biologii molekularnej. Wykład nr 2 BIOINFORMATYKA rok II 10 października 2013: Elementarz biologii molekularnej www.bioalgorithms.info Wykład nr 2 BIOINFORMATYKA rok II Komórka: strukturalna i funkcjonalne jednostka organizmu żywego Jądro komórkowe: chroniona

Bardziej szczegółowo

Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne)

Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne) Joanna Wieczorek Scenariusz lekcji przyrody/biologii (2 jednostki lekcyjne) Strona 1 Temat: Budowa i funkcje kwasów nukleinowych Cel ogólny lekcji: Poznanie budowy i funkcji: DNA i RNA Cele szczegółowe:

Bardziej szczegółowo

Konkurs Biologiczny etap szkolny

Konkurs Biologiczny etap szkolny Konkurs Biologiczny etap szkolny KARTA ODPOWIEDZI Nr Max Prawidłowe odpowiedzi Punktacja Uwagi zad. punktów 1. 3 pkt. 2. są pasożytami; 3. można je zniszczyć wysoką temperaturą; 4. rozmnażają się; 7. ulegają

Bardziej szczegółowo

Imię i nazwisko...kl...

Imię i nazwisko...kl... Gimnazjum nr 4 im. Ojca Świętego Jana Pawła II we Wrocławiu SPRAWDZIAN GENETYKA GR. A Imię i nazwisko...kl.... 1. Nauka o regułach i mechanizmach dziedziczenia to: (0-1pkt) a) cytologia b) biochemia c)

Bardziej szczegółowo

Klucz odpowiedzi i kryteria oceniania etap wojewódzki 2014/2015 Biologia. Przewidywana odpowiedź

Klucz odpowiedzi i kryteria oceniania etap wojewódzki 2014/2015 Biologia. Przewidywana odpowiedź Klucz i kryteria oceniania etap wojewódzki 2014/2015 Biologia Numer 1. A - torebka nefronu (kłębuszka), B kłębuszek nerkowy/kłębuszek naczyń włosowatych, C - kanalik nerkowy nazwy elementu A, B i C Proces

Bardziej szczegółowo

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów.

1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. mrna 1. Na podanej sekwencji przeprowadź proces replikacji, oraz do obu nici proces transkrypcji i translacji, podaj zapis antykodonów. GGA CGC GCT replikacja CCT GCG CGA transkrypcja aminokwasy trna antykodony

Bardziej szczegółowo

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten

Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten Napisz, który z przedstawionych schematycznie rodzajów replikacji (A, B czy C) ilustruje replikację semikonserwatywną. Wyjaśnij, na czym polega ten proces. Na schemacie przedstawiono etapy przekazywania

Bardziej szczegółowo

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP REJONOWY

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP REJONOWY KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP REJONOWY Nr zad. Max punktów 1. 7 pkt. 2. 3 pkt. Prawidłowe odpowiedzi Punktacja Uwagi 1. F R U K T O Z A 2. R Y B O Z A 3. I N S U L I N A 4. F I B R Y N O G

Bardziej szczegółowo

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI Nr Max Prawidłowe odpowiedzi Punktacja Uwagi zad. punktów 1. 2 pkt. Dzięki procesowi koniugacji następuje zwiększenie różnorodności genetycznej bakterii/

Bardziej szczegółowo

... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna.

... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna. Zadanie 1. (2 pkt.) W tabeli przedstawiono kodony kodu genetycznego. Poniżej przedstawiono dwie sekwencje nukleotydów w mrna. Ustal czy koduja takie same czy inne odcinki polipeptydów. Uzasadnij jednym

Bardziej szczegółowo

EGZAMIN MATURALNY 2010 BIOLOGIA

EGZAMIN MATURALNY 2010 BIOLOGIA Centralna Komisja Egzaminacyjna w Warszawie EGZAMIN MATURALNY 2010 BIOLOGIA POZIOM PODSTAWOWY Klucz punktowania odpowiedzi MAJ 2010 2 Zadanie 1. Podanie cech budowy hominidów umożliwiających im wytwarzanie

Bardziej szczegółowo

Wykład 14 Biosynteza białek

Wykład 14 Biosynteza białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 14 Biosynteza białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI I INNOWACYJNYCH MATERIAŁÓW OPAKOWANIOWYCH

Bardziej szczegółowo

KONKURS BIOLOGICZNY ETAP REJONOWY KLUCZ ODPOWIEDZI

KONKURS BIOLOGICZNY ETAP REJONOWY KLUCZ ODPOWIEDZI KONKURS BIOLOGICZNY ETAP REJONOWY KLUCZ ODPOWIEDZI Nr zad. Max ilość punktów Prawidłowe odpowiedzi Punktacja Uwagi 1. 3 pkt Komórki: b i e Mięśnie poprzecznie prążkowane potrzebują dużo energii do wykonywania

Bardziej szczegółowo

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU

SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU SCENARIUSZ LEKCJI BIOLOGII Z WYKORZYSTANIEM FILMU Czy priony zawsze są szkodliwe? SPIS TREŚCI: Wprowadzenie. Części lekcji. 1. Część wstępna. 2. Część realizacji. 3. Część podsumowująca. Karty pracy. 1.

Bardziej szczegółowo

WZÓR RAPORTU WYNIKÓW MATURALNYCH PRZEDMIOTY DODATKOWE

WZÓR RAPORTU WYNIKÓW MATURALNYCH PRZEDMIOTY DODATKOWE WZÓR RAPORTU WYNIKÓW MATURALNYCH PRZEDMIOTY DODATKOWE (Załącznik nr 3 do projektu Szkolna róża wiatrów ) 1. Przedmiot, poziom egzaminu BIOLOGIA, poziom podstawowy 2. uczniów zdających egzamin - 30 3. i

Bardziej szczegółowo

Aby przyznać punkt w poleceniu B i C należy podkreślić wszystkie właściwe pierwiastki.

Aby przyznać punkt w poleceniu B i C należy podkreślić wszystkie właściwe pierwiastki. KARTA ODPOWIEDZI konkurs biologiczny ETAP REJONOWY Nr Max Prawidłowe odpowiedzi Punktacja Uwagi zad. punktów 1. 5 pkt. A. 1. sód 2. magnez 3. krzem 4. jod 5. fosfor 6. siarka 7. chlor B. węgiel, tlen,

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo

Konkurs szkolny Mistrz genetyki etap II

Konkurs szkolny Mistrz genetyki etap II onkurs szkolny istrz genetyki etap II 1.W D pewnego pierwotniaka tymina stanowi 28 % wszystkich zasad azotowych. blicz i zapisz, jaka jest zawartość procentowa każdej z pozostałych zasad w D tego pierwotniaka.

Bardziej szczegółowo

V REGULACJA NERWOWA I ZMYSŁY

V REGULACJA NERWOWA I ZMYSŁY V REGULACJA NERWOWA I ZMYSŁY Zadanie 1. Na rysunku przedstawiającym budowę neuronu zaznacz elementy wymienione poniżej, wpisując odpowiednie symbole literowe. Następnie wskaż za pomocą strzałek kierunek

Bardziej szczegółowo

Numer pytania Numer pytania

Numer pytania Numer pytania KONKURS BIOLOGICZNY ZMAGANIA Z GENETYKĄ 2016/2017 ELIMINACJE SZKOLNE I SESJA GENETYKA MOLEKULARNA KOD UCZNIA. IMIĘ i NAZWISKO. DATA... GODZINA.. Test, który otrzymałeś zawiera 20 pytań zamkniętych. W każdym

Bardziej szczegółowo

WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z BIOLOGII DLA UCZNIÓW GIMNAZJUM WOJEWÓDZTWO POMORSKIE. etap wojewódzki 9 marca 2017 r.

WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z BIOLOGII DLA UCZNIÓW GIMNAZJUM WOJEWÓDZTWO POMORSKIE. etap wojewódzki 9 marca 2017 r. WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z BIOLOGII DLA UCZNIÓW GIMNAZJUM WOJEWÓDZTWO POMORSKIE etap wojewódzki 9 marca 2017 r. Zadanie 1 (0-1) Maksymalna liczba punktów 55 1 F 2 P 3 F 4 P 2 p. za 4 prawidłowe

Bardziej szczegółowo

ODPOWIEDZI I SCHEMAT PUNKTOWANIA POZIOM PODSTAWOWY

ODPOWIEDZI I SCHEMAT PUNKTOWANIA POZIOM PODSTAWOWY Zasady oceniania ODPOWIEDZI I SCHEMAT PUNKTOWANIA POZIOM PODSTAWOWY Za rozwiązanie zadań można uzyskać maksymalnie 50 punktów. Model odpowiedzi uwzględnia jej zakres merytoryczny, ale nie jest ścisłym

Bardziej szczegółowo

Konkurs Przedmiotowy z biologii dla uczniów gimnazjów województwa lubuskiego finał 2013. Model odpowiedzi, kryteria przyznawania punktów.

Konkurs Przedmiotowy z biologii dla uczniów gimnazjów województwa lubuskiego finał 2013. Model odpowiedzi, kryteria przyznawania punktów. Konkurs Przedmiotowy z biologii dla uczniów gimnazjów województwa lubuskiego finał 201 Model odpowiedzi, kryteria przyznawania punktów. Za rozwiązanie zadań z arkusza konkursowego można uzyskać 60 punktów.

Bardziej szczegółowo

KRYTERIA OCENIANIA ODPOWIEDZI Próbna Matura z OPERONEM. Biologia Poziom podstawowy

KRYTERIA OCENIANIA ODPOWIEDZI Próbna Matura z OPERONEM. Biologia Poziom podstawowy KRYTERIA OCENIANIA ODPOWIEDZI Próbna Matura z OPERONEM Biologia Poziom podstawowy Listopad 2013 W niniejszym schemacie oceniania zadań otwartych są prezentowane przykładowe poprawne odpowiedzi. W tego

Bardziej szczegółowo

Geny i działania na nich

Geny i działania na nich Metody bioinformatyki Geny i działania na nich prof. dr hab. Jan Mulawka Trzy królestwa w biologii Prokaryota organizmy, których komórki nie zawierają jądra, np. bakterie Eukaryota - organizmy, których

Bardziej szczegółowo

OCENIANIE ARKUSZA POZIOM PODSTAWOWY

OCENIANIE ARKUSZA POZIOM PODSTAWOWY Próbny egzamin maturalny z biologii OCENIANIE ARKUSZA POZIOM PODSTAWOWY Zasady oceniania Za rozwiązanie zadań z arkusza można uzyskać maksymalnie 50 punktów. Schemat oceniania uwzględnia jego zakres merytoryczny,

Bardziej szczegółowo

Tematy- Biologia zakres rozszerzony, klasa 2TA,2TŻ-1, 2TŻ-2

Tematy- Biologia zakres rozszerzony, klasa 2TA,2TŻ-1, 2TŻ-2 Tematy- Biologia zakres rozszerzony, klasa 2TA,2TŻ-1, 2TŻ-2 Nr lekcji Temat Zakres treści 1 Zapoznanie z PSO, wymaganiami edukacyjnymi i podstawą programową PSO, wymagania edukacyjne i podstawa programowa

Bardziej szczegółowo

I PORUSZAM SIĘ, ODDYCHAM I CZUJĘ

I PORUSZAM SIĘ, ODDYCHAM I CZUJĘ I PORUSZAM SIĘ, ODDYCHAM I CZUJĘ Zadanie 1. Dokończ zdania. A. Serce i wątroba to przykłady.... B. Najmniejszym elementem budującym organizm człowieka jest....... C. Zespół komórek podobnych do siebie

Bardziej szczegółowo

6. Uzupełnij zdanie, wstawiajac w odpowiednie miejsce wyrażenie ujawni się lub nie ujawni się :

6. Uzupełnij zdanie, wstawiajac w odpowiednie miejsce wyrażenie ujawni się lub nie ujawni się : ID Testu: 9S6C1A4 Imię i nazwisko ucznia Klasa Data 1. Allelami nazywamy A. takie same formy jednego genu. B. różne formy różnych genów. C. takie same formy różnych genów. D. różne formy jednego genu.

Bardziej szczegółowo

TEST - BIOLOGIA WERONIKA GMURCZYK

TEST - BIOLOGIA WERONIKA GMURCZYK TEST - BIOLOGIA WERONIKA GMURCZYK Temat: Układ nerwowy i hormonalny Zadanie 1. Zaznacz poprawną odpowiedź. Co to są hormony? a) związki chemiczne wytwarzane w gruczołach łojowych, które regulują pracę

Bardziej szczegółowo

Zaoczne Liceum Ogólnokształcące Pegaz

Zaoczne Liceum Ogólnokształcące Pegaz WYMAGANIA EGZAMINACYJNE ROK SZKOLNY 2015/2016 Semestr jesienny TYP SZKOŁY: liceum ogólnokształcące PRZEDMIOT: biologia SEMESTR: II LICZBA GODZIN W SEMESTRZE: 15 PROGRAM NAUCZANIA: Program nauczania biologii

Bardziej szczegółowo

Model odpowiedzi i schemat punktowania do Arkusza I

Model odpowiedzi i schemat punktowania do Arkusza I Model odpowiedzi i schemat punktowania do Arkusza I Zasady oceniania: Za rozwiązanie zadań z arkusza I można uzyskać maksymalnie 50 punktów. Model odpowiedzi uwzględnia jej zakres merytoryczny, ale nie

Bardziej szczegółowo

Czy żywność GMO jest bezpieczna?

Czy żywność GMO jest bezpieczna? Instytut Żywności i Żywienia dr n. med. Lucjan Szponar Czy żywność GMO jest bezpieczna? Warszawa, 21 marca 2005 r. Od ponad połowy ubiegłego wieku, jedną z rozpoznanych tajemnic życia biologicznego wszystkich

Bardziej szczegółowo

KONKURS PRZEDMIOTOWY BIOLOGICZNY DLA UCZNIÓW SZKÓŁ GIMNAZJALNYCH. ETAP WOJEWÓDZKI - rozwiązania zadań

KONKURS PRZEDMIOTOWY BIOLOGICZNY DLA UCZNIÓW SZKÓŁ GIMNAZJALNYCH. ETAP WOJEWÓDZKI - rozwiązania zadań KONKURS PRZEDMIOTOWY BIOLOGICZNY DLA UCZNIÓW SZKÓŁ GIMNAZJALNYCH ETAP WOJEWÓDZKI - rozwiązania zadań Zadanie 1. (0-10 pkt.) 1 pkt za nazwę i 1 pkt za przyporządkowanie wszystkich funkcji i cech danego

Bardziej szczegółowo

Egzamin maturalny 2013 biologia poziom podstawowy przykładowe odpowiedzi:

Egzamin maturalny 2013 biologia poziom podstawowy przykładowe odpowiedzi: przykładowe odpowiedzi: Zad. 1 Zad. 2 a) Najważniejszą funkcją mitochondriów jest oddychanie tlenowe/zaopatrują komórkę w energię/w organellach tych powstaje użyteczna biologicznie energia(atp/adenozyno-5'-trifosforan)

Bardziej szczegółowo

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej.

Wprowadzenie. DNA i białka. W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Wprowadzenie DNA i białka W uproszczeniu: program działania żywego organizmu zapisany jest w nici DNA i wykonuje się na maszynie białkowej. Białka: łańcuchy złożone z aminokwasów (kilkadziesiąt kilkadziesiąt

Bardziej szczegółowo

I BIOLOGIA JAKO NAUKA

I BIOLOGIA JAKO NAUKA I BIOLOGIA JAKO NAUKA Zadanie. Rozwiąż krzyżówkę, a następnie odczytaj i wyjaśnij hasło. 0. Bada skład chemiczny organizmów i zachodzące w nich reakcje.. Zajmuje się procesami dziedziczenia.. Przedmiotem

Bardziej szczegółowo

grupa a Klasa 7. Zaznacz prawidłowe zakończenie zdania. (0 1)

grupa a Klasa 7. Zaznacz prawidłowe zakończenie zdania. (0 1) grupa a Regulacja nerwowo-hormonalna 37 pkt max... Imię i nazwisko Poniższy test składa się z 20 zadań. Przy każdym poleceniu podano liczbę punktów możliwą do uzyskania za prawidłową odpowiedź.... Za rozwiązanie

Bardziej szczegółowo

dostateczny oraz: wyjaśnia, z czego wynika komplementarność zasad przedstawia graficznie regułę

dostateczny oraz: wyjaśnia, z czego wynika komplementarność zasad przedstawia graficznie regułę WYMAGANIA EDUKACYJNE Z BIOLOGII ZAKRES PODSTAWOWY KLASA I Dział Zakres wymagań na poszczególne oceny szkolne programowy dopuszczający dostateczny dobry bardzo dobry celujący Od genu do cechy określa rolę

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY

WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY WYMAGANIA EDUKACYJNE BIOLOGIA NA CZASIE, ZAKRES PODSTAWOWY Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) 1 Budowa i funkcje

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE BIOLOGIA zakres podstawowy biologia na czasie

WYMAGANIA EDUKACYJNE BIOLOGIA zakres podstawowy biologia na czasie WYMAGANIA EDUKACYJNE BIOLOGIA zakres podstawowy biologia na czasie Dział programu Lp. Temat Poziom wymagań dopuszczający dostateczny dobry bardzo dobry I. Od genu do cechy 1 Budowa i funkcje kwasów nukleinowych

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) I. Od genu do cechy 1 Budowa i funkcje

Bardziej szczegółowo

GIMNAZJUM SPRAWDZIANY SUKCES W NAUCE

GIMNAZJUM SPRAWDZIANY SUKCES W NAUCE GIMNAZJUM SPRAWDZIANY BIOLOGIA klasa III SUKCES W NAUCE II GENETYKA CZŁOWIEKA Zadanie 1. Cechy organizmu są warunkowane przez allele dominujące i recesywne. Uzupełnij tabelę, wykorzystując poniższe określenia,

Bardziej szczegółowo

Wymagania na poszczególne stopnie szkolne dla przedmiotu biologia. Klasa I Liceum Ogólnokształcącego poziom podstawowy

Wymagania na poszczególne stopnie szkolne dla przedmiotu biologia. Klasa I Liceum Ogólnokształcącego poziom podstawowy Wymagania na poszczególne stopnie szkolne dla przedmiotu biologia Klasa I Liceum Ogólnokształcącego poziom podstawowy Dział programu Lp Poziom wymagań na poszczególne stopnie szkolne Temat Ocena dopuszczająca

Bardziej szczegółowo

Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO

Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO Wymagania edukacyjne z biologii- zakres podstawowy: kl 1 ZSZ, 1LO Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań konieczny (K) dopuszczający podstawowy (P) dostateczny rozszerzający (R) dobry

Bardziej szczegółowo

TEST DO DZIAŁU TEMATYCZNEGO: POZNAJEMY SWÓJ ORGANIZM KLASA IV

TEST DO DZIAŁU TEMATYCZNEGO: POZNAJEMY SWÓJ ORGANIZM KLASA IV Sabina Wójcik Katowice, dnia 14.10.2003 r. Szkoła Podstawowa nr21 ul. Malczewskiego 1 40 748 Katowice TEST DO DZIAŁU TEMATYCZNEGO: POZNAJEMY SWÓJ ORGANIZM KLASA IV Instrukcja dla ucznia W górnym prawym

Bardziej szczegółowo

Podstawy mikrobiologii. Wirusy bezkomórkowe formy materii oŝywionej

Podstawy mikrobiologii. Wirusy bezkomórkowe formy materii oŝywionej Podstawy mikrobiologii Wykład 3 Wirusy bezkomórkowe formy materii oŝywionej Budowa wirusów Wirusy nie mają budowy komórkowej, zatem pod względem biologicznym nie są organizmami Ŝywymi! Są to twory nukleinowo

Bardziej szczegółowo

Przykładowe zadania. przygotowujące do egzaminu maturalnego

Przykładowe zadania. przygotowujące do egzaminu maturalnego Przykładowe zadania z BIOLOGii przygotowujące do egzaminu maturalnego Prezentowane zadania są zgodne z podstawą programową kształcenia ogólnego w zakresie rozszerzonym i podstawowym. Prócz zadań, które

Bardziej szczegółowo

Nr zad. Prawidłowe odpowiedzi Punktacja Uwagi

Nr zad. Prawidłowe odpowiedzi Punktacja Uwagi Nr zad. KLUCZ ODPOWIEDZI konkurs biologiczny ETAP SZKOLNY Max punktów 1. 3 pkt. A. Wpływ niedoboru pierwiastków/ N, P, K na wzrost/ rozwój tytoniu w kulturze wodnej. Prawidłowe odpowiedzi Punktacja Uwagi

Bardziej szczegółowo

TEST Z CYTOLOGII GRUPA II

TEST Z CYTOLOGII GRUPA II TEST Z CYTOLOGII GRUPA II Zad. 1 (4p.) Rysunek przedstawia schemat budowy pewnej struktury komórkowej. a/ podaj jej nazwę i określ funkcję w komórce, b/ nazwij elementy oznaczone cyframi 2 i 5 oraz określ

Bardziej szczegółowo

definiuje pojęcia: inżynieria genetyczna, replikacja DNA wyjaśnia regułę komplementarności

definiuje pojęcia: inżynieria genetyczna, replikacja DNA wyjaśnia regułę komplementarności Wymagania programowe na poszczególne stopnie przygotowane w oparciu o podstawę programową oraz treści podręcznika : Biologia na czasie zakres podstawowy (Wydawnictwo Nowa Era) Opracowała: Anna Wojdan Dział

Bardziej szczegółowo

Wojewódzki Konkurs Przedmiotowy z Biologii dla uczniów gimnazjum woj. śląskiego w roku szkolnym 2013/2014 ETAP REJONOWY

Wojewódzki Konkurs Przedmiotowy z Biologii dla uczniów gimnazjum woj. śląskiego w roku szkolnym 2013/2014 ETAP REJONOWY Wojewódzki Konkurs Przedmiotowy z Biologii dla uczniów gimnazjum woj. śląskiego w roku szkolnym 2013/2014 ETP REJONOWY Rozwiązania zadań i schemat punktowania Zadanie 1. D Zadanie 2. tętnica, D lub, D,

Bardziej szczegółowo

Zadania zamknięte wyboru wielokrotnego. Za każdą poprawną odpowiedź uczestnik otrzymuje 1 punkt. D B C C D D A C D D B A C C C B D A D B

Zadania zamknięte wyboru wielokrotnego. Za każdą poprawną odpowiedź uczestnik otrzymuje 1 punkt. D B C C D D A C D D B A C C C B D A D B Nie przyznaje się połówek punktów. WOJEWÓDZKI KONKURS BIOLOGICZNY MODEL ODPOWIEDZI I SCHEMAT PUNKTOWANIA Zadania zamknięte wyboru wielokrotnego. Za każdą poprawną odpowiedź uczestnik otrzymuje 1 punkt.

Bardziej szczegółowo

UKŁAD KRĄŻENIA I UKŁAD ODDECHOWY- N.Olszewska

UKŁAD KRĄŻENIA I UKŁAD ODDECHOWY- N.Olszewska UKŁAD KRĄŻENIA I UKŁAD ODDECHOWY- N.Olszewska 1.Trombocyty (płytki kwi)biorą udział w procesie: A.fagocytozy B.transportu tlenu C.oddychania D.krzepnięcia krwi 2. Której z wymienionych funkcji nie pełni

Bardziej szczegółowo

Praca kontrolna z biologii LO dla dorosłych semestr V

Praca kontrolna z biologii LO dla dorosłych semestr V Praca kontrolna z biologii LO dla dorosłych semestr V Poniższa praca składa się z 15 zadań. Przy każdym poleceniu podano liczbę punktów możliwą do uzyskania za prawidłową odpowiedź. Za rozwiązanie zadań

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy przedmiot biologia nauczana dwujęzycznie poziom podstawowy klasa Ib i Ic

Wymagania edukacyjne Biologia na czasie zakres podstawowy przedmiot biologia nauczana dwujęzycznie poziom podstawowy klasa Ib i Ic Wymagania edukacyjne Biologia na czasie zakres podstawowy przedmiot biologia nauczana dwujęzycznie poziom podstawowy klasa Ib i Ic Dział programu Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający

Bardziej szczegółowo

Rozkład materiału z biologii dla klasy III AD. 7 godz / tyg rok szkolny 2016/17

Rozkład materiału z biologii dla klasy III AD. 7 godz / tyg rok szkolny 2016/17 Rozkład materiału z biologii dla klasy III AD zakres rozszerzony LO 7 godz / tyg rok szkolny 2016/17 Biologia na czasie 2 zakres rozszerzony nr dopuszczenia 564/2/2012 Biologia na czasie 3 zakres rozszerzony

Bardziej szczegółowo

Pobrano ze strony http://biologhelp.com

Pobrano ze strony http://biologhelp.com Pobrano ze strony http://biologhelp.com KLUCZ PUNKTOWANIA ODPOWIEDZI Z BIOLOGII POZIOM PODSTAWOWY SIERPIEŃ 0 Zasady oceniania Model odpowiedzi uwzględnia jej zakres merytoryczny, ale nie jest ścisłym wzorcem

Bardziej szczegółowo

Zadania maturalne z biologii - 2

Zadania maturalne z biologii - 2 Koło Biologiczne Liceum Ogólnokształcące nr II w Gliwicach 2015-2016 Zadania maturalne z biologii - 2 Zadania: Zad. 1(M. Borowiecki, J. Błaszczak 3BL) Na podstawie podanych schematów określ sposób w jaki

Bardziej szczegółowo

KLUCZ ODPOWIEDZI DO ZADAŃ ZAMKNIĘTYCH

KLUCZ ODPOWIEDZI DO ZADAŃ ZAMKNIĘTYCH Konkurs Biologiczny dla gimnazjalistów województwa zachodniopomorskiego w roku szkolnym 2014/2015 Etap wojewódzki KLUCZ ODPOWIEDZI DO ZADAŃ ZAMKNIĘTYCH Za każde z pytań testowych można uzyskać 1 pkt. Nr

Bardziej szczegółowo

G C C A T C A T C C T T A C C

G C C A T C A T C C T T A C C Praca kontrolna z biologii LO dla dorosłych semestr III Poniższa praca składa się z 25 zadań. Przy każdym poleceniu podano liczbę punktów możliwą do uzyskania za prawidłową odpowiedź. Za rozwiązanie zadań

Bardziej szczegółowo

PODSTAWY GENETYKI ... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna.

PODSTAWY GENETYKI ... Zadanie 7 (2 pkt.). Antykodon wskazuje strzałka oznaczona literą... Opisz funkcję pełnioną przez antykodon w trna. Zadanie 1. (2 pkt.) W tabeli przedstawiono kodony kodu genetycznego. Poniżej przedstawiono dwie sekwencje nukleotydów w mrna. Ustal czy koduja takie same czy inne odcinki polipeptydów. Uzasadnij jednym

Bardziej szczegółowo

Wymagania edukacyjne z biologii w klasie pierwszej, zakres podstawowy. Podręcznik Biologia na czasie - Wyd. Nowa Era

Wymagania edukacyjne z biologii w klasie pierwszej, zakres podstawowy. Podręcznik Biologia na czasie - Wyd. Nowa Era Wymagania edukacyjne z biologii w klasie pierwszej, zakres podstawowy. Podręcznik Biologia na czasie - Wyd. Nowa Era Poziom wymagań konieczny ocena dopuszczająca - podstawowy ocena dostateczna - rozszerzający

Bardziej szczegółowo

KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI 2015/16

KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI 2015/16 KARTA ODPOWIEDZI - KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI 2015/16 Nr zad. Max ilość punktów Prawidłowe odpowiedzi Punktacja Uwagi 1. 3 pkt BIAŁKA CUKROWCE LIPIDY Za uzupełnienie kolagen, aktyna, hemoglobina,

Bardziej szczegółowo

MODEL FUNKCJONOWANIA UKŁADU KRĄŻENIA [ BAP_2014969.doc ]

MODEL FUNKCJONOWANIA UKŁADU KRĄŻENIA [ BAP_2014969.doc ] MODEL FUNKCJONOWANIA UKŁADU KRĄŻENIA [ ] Użytkowanie Jak napełnić model układu krążenia? 1. Model ułożyć poziomo, płasko na stole. 2. Odłączyć niebieskie rurki od układu krążenia, łączenie znajduje się

Bardziej szczegółowo

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI D B D C B B B D C D B C A A B A B D C D

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI D B D C B B B D C D B C A A B A B D C D Nr zad. KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI zadanie 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 D B D C B B B D C D B C A A B A B D C D poprawna odpowiedź W zadaniach 1-20 za każdą

Bardziej szczegółowo

Technikum Nr 2 im. gen. Mieczysława Smorawińskiego w Zespole Szkół Ekonomicznych w Kaliszu

Technikum Nr 2 im. gen. Mieczysława Smorawińskiego w Zespole Szkół Ekonomicznych w Kaliszu Technikum Nr 2 im. gen. Mieczysława Smorawińskiego w Zespole Szkół Ekonomicznych w Kaliszu Wymagania edukacyjne niezbędne do uzyskania poszczególnych śródrocznych i rocznych ocen klasyfikacyjnych z obowiązkowych

Bardziej szczegółowo

Mutacje jako źródło różnorodności wewnątrzgatunkowej

Mutacje jako źródło różnorodności wewnątrzgatunkowej Mutacje jako źródło różnorodności wewnątrzgatunkowej Zajęcia terenowe: Zajęcia w klasie: Poziom nauczania oraz odniesienie do podstawy programowej: Liceum IV etap edukacyjny zakres rozszerzony: Różnorodność

Bardziej szczegółowo

I. Genetyka. Dział programu Lp. Temat konieczny podstawowy rozszerzający

I. Genetyka. Dział programu Lp. Temat konieczny podstawowy rozszerzający I. Genetyka 1. Czym jest genetyka? wymienia cechy gatunkowe i indywidualne podanych organizmów wyjaśnia, że jego podobieństwo do rodziców jest wynikiem dziedziczenia cech definiuje pojęcia genetyka oraz

Bardziej szczegółowo

pobrano z www.sqlmedia.pl

pobrano z www.sqlmedia.pl ODPOWIEDZI Zadanie 1. (2 pkt) a) B. Skurcz komórek mięśniowych. b) parathormon Zadanie 2. (1 pkt) Połączenie ze sobą dwóch lub więcej łańcuchów polipeptydowych o ukształtowanej już strukturze trójwymiarowej.

Bardziej szczegółowo

Model odpowiedzi i schemat punktowania do Arkusza II

Model odpowiedzi i schemat punktowania do Arkusza II Model odpowiedzi i schemat punktowania do Arkusza II Zasady oceniania: Za rozwiązanie zadań z arkusza II można uzyskać maksymalnie 50 punktów. Model odpowiedzi uwzględnia jej zakres merytoryczny, ale nie

Bardziej szczegółowo

Dział programu: Funkcjonowanie człowieka Hasło programowe: Krążenie

Dział programu: Funkcjonowanie człowieka Hasło programowe: Krążenie Konspekt lekcji I klasa gimnazjum Autorka: Bogumiła Bąk Dział programu: Funkcjonowanie człowieka Hasło programowe: Krążenie Temat: Na czym polega współpraca małego i dużego obiegu krwi? Dział programu:

Bardziej szczegółowo

Przedmiotowe zasady oceniania:

Przedmiotowe zasady oceniania: Przedmiotowe zasady oceniania: Przedmiotowe Zasady Oceniania z biologii obowiązujący w roku szkolnym 2012/13 r. w VIII LO realizowany przez nauczycieli przedmiotu Justynę Baranowską, Mirosławę Drażniuk,

Bardziej szczegółowo

Budowa i rola DNA. 1. Cele lekcji. a) Wiadomości. b) Umiejętności. 2. Metoda i forma pracy. 3. Środki dydaktyczne. Metadane scenariusza

Budowa i rola DNA. 1. Cele lekcji. a) Wiadomości. b) Umiejętności. 2. Metoda i forma pracy. 3. Środki dydaktyczne. Metadane scenariusza Metadane scenariusza Budowa i rola DNA 1. Cele lekcji a) Wiadomości Uczeń: zna nazwy związków chemicznych budujących cząsteczkę DNA i wie, jak są ze sobą powiązane, wie, jak wygląda model przestrzenny

Bardziej szczegółowo

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów

Zawartość. Wstęp 1. Historia wirusologii. 2. Klasyfikacja wirusów Zawartość 139585 Wstęp 1. Historia wirusologii 2. Klasyfikacja wirusów 3. Struktura cząstek wirusowych 3.1. Metody określania struktury cząstek wirusowych 3.2. Budowa cząstek wirusowych o strukturze helikalnej

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE

WYMAGANIA EDUKACYJNE GIMNAZJUM NR 2 W RYCZOWIE WYMAGANIA EDUKACYJNE niezbędne do uzyskania poszczególnych śródrocznych i rocznych ocen klasyfikacyjnych z BIOLOGII w klasie III gimnazjum str. 1 WYMAGANIA EDUKACYJNE NIEZBĘDNE

Bardziej szczegółowo

Zadanie 4 (0-2p) A.. Powyższy schemat przedstawia: a) łańcuch troficzny b) łańcuch pokarmowy c) obieg materii d) sieć pokarmową D G.

Zadanie 4 (0-2p) A.. Powyższy schemat przedstawia: a) łańcuch troficzny b) łańcuch pokarmowy c) obieg materii d) sieć pokarmową D G. Zadanie 1 (0-1p) Przedmiotem zainteresowania ekologii są a) działania mające na celu właściwe wykorzystanie i odnawianie zasobów przyrody b) relacje między organizmami i zależności między organizmami a

Bardziej szczegółowo

POWTÓRZENIE TREŚCI NAUCZANIA Z BIOLOGII KLASY III ROZPISKA POWTÓRZEŃ ROK 2007/2008 Klasa I Treści programowe Dział powtórzeniowy Przewidziana data

POWTÓRZENIE TREŚCI NAUCZANIA Z BIOLOGII KLASY III ROZPISKA POWTÓRZEŃ ROK 2007/2008 Klasa I Treści programowe Dział powtórzeniowy Przewidziana data POWTÓRZENIE TREŚCI NAUCZANIA Z BIOLOGII KLASY III ROZPISKA POWTÓRZEŃ ROK 2007/2008 Klasa I Treści programowe Dział powtórzeniowy Przewidziana data 1. Struktura organizmu i funkcje, jakim ona służy ( komórki,

Bardziej szczegółowo

Praca klasowa waga 3. Sprawdzian waga 3. Kartkówka waga 2. Odpowiedź waga 1. Aktywność waga 1

Praca klasowa waga 3. Sprawdzian waga 3. Kartkówka waga 2. Odpowiedź waga 1. Aktywność waga 1 1 Przepisy ogólne 2 3 Praca klasowa waga 3 Sprawdzian waga 3 Kartkówka waga 2 Odpowiedź waga 1 Aktywność waga 1 4 Wymagania edukacyjne zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

Żywność. zapewnia prawidłowe funkcjonowanie. poprawia samopoczucie

Żywność. zapewnia prawidłowe funkcjonowanie. poprawia samopoczucie Warsztaty żywieniowe Żywność buduje i regeneruje dostarcza energii zapewnia prawidłowe funkcjonowanie poprawia samopoczucie Żaden pojedynczy produkt nie dostarczy Ci wszystkiego, czego potrzebujesz dlatego

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie klasa 1 LO, poziom podstawowy

Wymagania edukacyjne Biologia na czasie klasa 1 LO, poziom podstawowy SZCZEGÓŁOWE WYMAGANIA EDUKACYJNE klasa 1 PLO Zawierają szczegółowy wykaz wiadomości i umiejętności, które uczeń powinien opanować po omówieniu poszczególnych lekcji z podręcznika Biologia na czasie zakres

Bardziej szczegółowo

Tułów człowieka [ BAP_ doc ]

Tułów człowieka [ BAP_ doc ] Tułów człowieka [ ] Prezentacja Wstep Ciało człowieka jest najpiękniejszym i najbardziej skomplikowanym mechanizmem na świecie. W naszym ciele rozgrywa się bez przerwy tysiące zdarzeń. Nasze płuca pracują,

Bardziej szczegółowo

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI

KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI Nr zad. KARTA ODPOWIEDZI KONKURS BIOLOGICZNY ETAP WOJEWÓDZKI Max punktów 1. 4. 1. Grzyby nie przeprowadzają fotosyntezy/ nie posiadają chloroplastów. 2. Wirusy nie są organizmami / nie mają budowy komórkowej

Bardziej szczegółowo

Zaznacz wykres ilustrujący stałocieplność człowieka. A. B. C. D.

Zaznacz wykres ilustrujący stałocieplność człowieka. A. B. C. D. I. Organizm człowieka. Skóra powłoka organizmu 1. Zadanie Napisz, czym zajmuje się anatomia............................................................................................................................

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

Biotechnologia i inżynieria genetyczna

Biotechnologia i inżynieria genetyczna Wersja A Test podsumowujący rozdział II i inżynieria genetyczna..................................... Imię i nazwisko.............................. Data Klasa oniższy test składa się z 16 zadań. rzy każdym

Bardziej szczegółowo

I. Czynności organizacyjne.

I. Czynności organizacyjne. KONSPEKT ZAJĘĆ mgr Szymon Konkol Klasa:. Data:.. Temat zajęć: Biologiczne środki spulchniające- drożdże Przedmiot: surowce i materiały pomocnicze (ZSZ) Korelacja: technologia, praktyczna nauka zawodu Cele

Bardziej szczegółowo

KARTA ODPOWIEDZI konkurs biologiczny ETAP SZKOLNY

KARTA ODPOWIEDZI konkurs biologiczny ETAP SZKOLNY Nr zad. Max punktów 1. 2 system naturalny 2 system sztuczny 1 KARTA ODPOWIEDZI konkurs biologiczny ETAP SZKOLNY Nazwisko Linneusz należy połączyć z systemem sztucznym. Prawidłowe odpowiedzi Punktacja Uwagi

Bardziej szczegółowo

MODEL ODPOWIEDZI I SCHEMAT PUNKTOWANIA: Konkurs Biologiczny 2014/2015 etap wojewódzki.

MODEL ODPOWIEDZI I SCHEMAT PUNKTOWANIA: Konkurs Biologiczny 2014/2015 etap wojewódzki. MODEL ODPOWIEDZI I SCHEMAT PUNKTOWANIA: Konkurs Biologiczny 2014/2015 etap wojewódzki. - Za rozwiązanie wszystkich zadań można uzyskać maksymalnie 60 punktów. - W zadaniach zamkniętych (jednokrotnego wyboru)

Bardziej szczegółowo

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek

Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek BIOCHEMIA Kierunek: Technologia Żywności i Żywienie Człowieka semestr III Wykład 12 Kwasy nukleinowe: budowa, synteza i ich rola w syntezie białek WYDZIAŁ NAUK O ŻYWNOŚCI I RYBACTWA CENTRUM BIOIMMOBILIZACJI

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Lp. Temat ocena dopuszczająca dostateczna dobra bardzo dobra celująca I. Od genu do cechy 1 Budowa i funkcje kwasów nukleinowych

Bardziej szczegółowo

Układ pokarmowy. Układ pokarmowy

Układ pokarmowy. Układ pokarmowy Układ pokarmowy Układ pokarmowy Układ pokarmowy przekształca pokarm spożywany przez psa, dostarczając jego organizmowi energii i składników odżywczych, których potrzebuje do spełnienia różnorodnych funkcji

Bardziej szczegółowo