BIOINFORMATYKA BIOLOGICZNE BAZY DANYCH

Save this PDF as:
 WORD  PNG  TXT  JPG

Wielkość: px
Rozpocząć pokaz od strony:

Download "BIOINFORMATYKA BIOLOGICZNE BAZY DANYCH"

Transkrypt

1 Podstawy Bioinformatyki II BIOINFORMATYKA BIOLOGICZNE BAZY DANYCH 1

2 Czym jest bioinformatyka? 2

3 Bioinformatyka Bioinformatyka jest interdyscyplinarną dziedziną nauki obejmującą wykorzystanie metod obliczeniowych do badania danych biologicznych Higgs P., Attwood T., Bioinformatyka i ewolucja molekularna Bioinformatyka a biologia obliczeniowa 3

4 Bioinformatyka Interdyscyplinarność : biologia (molekularna) dane biologiczne, biotechnologiczne dane dotyczące kwasów nukleinowych, białek, lipidów, węglowodanów i innych makrocząsteczek Informatyka i matematyka - narzędzia, metody i obliczenia komputerowe nauki i techniki komputerowe, matematyka stosowana, statystyka, teoria prawdopodobieństwa 4

5 Cele bioinformatyki Organizacja i zarządzanie informacjami o danych biologicznych w formie skomputeryzowanych zapisów BAZY DANYCH Analiza danych tworzenie NARZĘDZI (programów, metod, algorytmów) systemy operacyjne (Unix, Linux) języki programowania (C, C++, PERL, Python, Ruby, JAVA, R, FORTRAN, itd.) 5

6 Dane 6

7 Dane (NGS) 7

8 Dane (NGS) Wzrost olbrzymiej ilości i objętości surowych danych potrzeba gromadzenia danych potrzeba stworzenia skomplikowanych procedur komputerowych do zarządzania danymi JAKIEJ WIELKOŚCI MOGĄ BYĆ DANE NGS? 8

9 Dane (NGS) Format tekstowy Cały genom buhaja N =

10 Jednostki pamięci xxx KB xxx MB 1,44 KB 700 MB 4,7 GB 25 GB 10

11 Dane (NGS) Wzrost olbrzymiej ilości i objętości surowych danych potrzeba gromadzenia danych potrzeba stworzenia skomplikowanych procedur komputerowych do zarządzania danymi 1 osobnik (cały genom) Katedra Genetyki: 200 buhajów 32 krowy 11

12 Biologiczne bazy danych Pierwszorzędowe (pierwotne) Surowe dane biologiczne, archiwa sekwencji lub dane strukturalne wprowadzane do baz przez naukowców GenBank, PDB Drugorzędowe (wtórne) Informacje przetworzone komputerowo, lub poprawione ręcznie na podstawie oryginalnych informacji z pierwszorzędowych baz danych SWISS-PROT, PIR Specjalistyczne Specjalistyczne zagadnienia FlyBase, baza danych HIV, Ribosomal Database Project 12

13 Xiong J., 13 Podstawy bioinformatyki

14 Pobieranie informacji tworzenie zapytań Sformułowanie zapytań do baz danych często wymaga skorzystania z operatorów logicznych i konstruowania wyrażeń boolowskich (wskazanie powiązań, relacji pomiędzy słowami) AND, OR, NOT, (), itp. 14

15 Pułapki w bazach danych Dane niekompletne (np. niekompletna adnotacja) Błędy: - błędy technologii (np. sekwenatora), zanieczyszczenia - błędna adnotacja Rozprzestrzenianie błędów Wysoka redundacja informacji (non-redundant RefSeq) 15

16 16

17 FORMATY DANYCH 17

18 Format GenBank Xiong J., 18 Podstawy bioinformatyki

19 Format GenBank Xiong J., 19 Podstawy bioinformatyki

20 Format GenBank Xiong J., 20 Podstawy bioinformatyki

21 Format FASTA Prosty Popularny Czytelny dla wielu programów do analizy bioinformatycznej Zapis sekwencji kwasów nukleinowych oraz białek (jednoliterowe skróty) Identyfikator sekwencji opis >gi dbj AB Neomys fodiens mitochondrial cytb gene for cytochrome b, complete cds ATGACCAACTTTCGAAAAACCCATCCATTAATAAAAATTCTTAACAACTCATTCATCGATCTCCCAGCCC CATCAAACATTTCATCATGATGAAATTTCGGGTCCCTTCTAGGATTGTGCCTAGTAATCCAGATCCTGAC TGGCCTCTTTCTAGCAATACATTACACTTCAGATACCATGACCGCCTTTTCATCAGTAACCCATATTTGT CGAGACGTCAACTATGGATGATTAATTCGATACCTACACGCTAATGGAGCATCTATATTTTTCATCTGCT 21

22 Komputerowy zapis sekwencji nukleotydowej Symbol Description Bases represented Symbol Description Bases represented A Adenine A C Cytosine C B not A (B comes after A) C G T G Guanine G T Thymine T U Uracil U W Weak A T S Strong C G M amino A C K Keto G T R purine A G Y pyrimidine C T 1 2 D H V N or - not C (D comes after C) not G (H comes after G) not T (V comes after T and U) any base (not a gap) A G T 3 A C T A C G A C G T 4 22

23 LISTA ZADAŃ 23

Podstawy bioinformatyki - biologiczne bazy danych

Podstawy bioinformatyki - biologiczne bazy danych Podstawy bioinformatyki - biologiczne bazy danych Czym jest bioinformatyka? Bioinformatyka Bioinformatyka jest interdyscyplinarną dziedziną nauki obejmującą wykorzystanie metod obliczeniowych do badania

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI WYKŁAD 3 BIOLOGICZNE BAZY DANYCH (1)

PODSTAWY BIOINFORMATYKI WYKŁAD 3 BIOLOGICZNE BAZY DANYCH (1) PODSTAWY BIOINFORMATYKI WYKŁAD 3 BIOLOGICZNE BAZY DANYCH (1) BIOINFORMATYKA HISTORIA 1. 1982 utworzenie bazy danych GenBank (NIH) dane ogólnodostępne sekwencje nukleotydów 2. Wprowadzenie sekwencji z projektu

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI ORGANIZACJA ZAJĘĆ BIOINFORMATYKA PRZETWARZANIE I ANALIZA DANYCH

PODSTAWY BIOINFORMATYKI ORGANIZACJA ZAJĘĆ BIOINFORMATYKA PRZETWARZANIE I ANALIZA DANYCH PODSTAWY BIOINFORMATYKI ORGANIZACJA ZAJĘĆ BIOINFORMATYKA PRZETWARZANIE I ANALIZA DANYCH Magda Mielczarek Podstawy Bioinformatyki 1 Organizacja zajęć mgr Magda Mielczarek Katedra Genetyki, pokój nr 14 magda.mielczarek@up.wroc.pl

Bardziej szczegółowo

Bioinformatyczne bazy danych

Bioinformatyczne bazy danych Bioinformatyczne bazy danych Czym jest bioinformatyka? Bioinformatyka jest nauką integrującą różne dziedziny wiedzy Gruca (2010) Czym jest bioinformatyka? Bioinformatyka obejmuje technologie wykorzystujące

Bardziej szczegółowo

Kierunek Informatyka stosowana Studia stacjonarne Studia pierwszego stopnia

Kierunek Informatyka stosowana Studia stacjonarne Studia pierwszego stopnia Studia pierwszego stopnia I rok Matematyka dyskretna 30 30 Egzamin 5 Analiza matematyczna 30 30 Egzamin 5 Algebra liniowa 30 30 Egzamin 5 Statystyka i rachunek prawdopodobieństwa 30 30 Egzamin 5 Opracowywanie

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta

Bioinformatyka Laboratorium, 30h. Michał Bereta Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecność Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

BIOLOGICZNE BAZY DANYCH SYLABUS

BIOLOGICZNE BAZY DANYCH SYLABUS BIOLOGICZNE BAZY DANYCH SYLABUS Elementy składowe sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod Język Rodzaj Rok studiów /semestr

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka Wstęp do obsługi biologicznych baz danych i analizy porównawczej białek i genów Katedra Fizjologii i Biotechnologii Roślin Pok. 113 CB jan.jastrzebski@uwm.edu.pl bioinformatyka@gmail.com www.ebiology.net

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI

PODSTAWY BIOINFORMATYKI PODSTAWY BIOINFORMATYKI Prowadzący: JOANNA SZYDA ADRIAN DROśDś WSTĘP 1. Katedra Genetyki badania bioinformatyczne 2. Tematyka przedmiotu 3. Charakterystyka wykładów 4. Charakterystyka ćwiczeń 5. Informacje

Bardziej szczegółowo

Księgarnia PWN: A.D. Baxevanis, B.F.F. Ouellette Bioinformatyka

Księgarnia PWN: A.D. Baxevanis, B.F.F. Ouellette Bioinformatyka Księgarnia PWN: A.D. Baxevanis, B.F.F. Ouellette Bioinformatyka Słowo wstępne XIII Przedmowa XV 1. Bioinformatyka i Internet Andreas D. Baxevanis 1 1.1. Podstawy Internetu 2 1.2. Połączenie z Internetem

Bardziej szczegółowo

Wprowadzenie do bioinformatyki

Wprowadzenie do bioinformatyki Metody bioinformatyki Wprowadzenie do bioinformatyki prof. dr hab. Jan Mulawka Czym jest bioinformatyka Bioinformatyka to dyscyplina zajmująca się stosowaniem narzędzi matematycznych i informatycznych

Bardziej szczegółowo

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Bioinformatyka Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl 1 Bazy danych biologicznych Bazy danych sekwencji nukleotydowych Pierwotne bazy danych (ang. primary database) Wykorzystywane do zbierania

Bardziej szczegółowo

"Zapisane w genach, czyli Python a tajemnice naszego genomu."

Zapisane w genach, czyli Python a tajemnice naszego genomu. "Zapisane w genach, czyli Python a tajemnice naszego genomu." Dr Kaja Milanowska Instytut Biologii Molekularnej i Biotechnologii UAM VitaInSilica sp. z o.o. Warszawa, 9 lutego 2015 Dane biomedyczne 1)

Bardziej szczegółowo

KARTA PRZEDMIOTU. (pieczęć wydziału)

KARTA PRZEDMIOTU. (pieczęć wydziału) (pieczęć wydziału) KARTA PRZEDMIOTU 1. Nazwa przedmiotu: Eksploracja danych w bioinformatyce 2. Kod przedmiotu: EksDaBio 3. Karta przedmiotu ważna od roku akademickiego: 2017/2018 4. Forma kształcenia:

Bardziej szczegółowo

Field of study: Computer Science Study level: First-cycle studies Form and type of study: Full-time studies. Auditorium classes.

Field of study: Computer Science Study level: First-cycle studies Form and type of study: Full-time studies. Auditorium classes. Faculty of: Computer Science, Electronics and Telecommunications Field of study: Computer Science Study level: First-cycle studies Form and type of study: Full-time studies Annual: 2014/2015 Lecture language:

Bardziej szczegółowo

Pierwsze kroki w świat biznesu

Pierwsze kroki w świat biznesu Pierwsze kroki w świat biznesu Dr Anna Czerwoniec ul. Pracownia Bioinformatyki Instytut Biologii Molekularnej i Biotechnologii Uniwersytet im. Adama Mickiewicza Umultowska 89, 61-641 Poznań Poznań, 22.01.2013

Bardziej szczegółowo

Bioinformatyka. Bazy danych. Wykład 3. E. Banachowicz. Wykład monograficzny Bioinformatyka. Wykład 3, Zakład Biofizyki Molekularnej IF UAM

Bioinformatyka. Bazy danych. Wykład 3. E. Banachowicz. Wykład monograficzny Bioinformatyka. Wykład 3, Zakład Biofizyki Molekularnej IF UAM Bioinformatyka Wykład 3. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas Bazy danych Wykład 3, 2008 1 Niesekwencyjne BazyDanych bibliograficzne kliniczne ścieżek metabolicznych

Bardziej szczegółowo

Informatyka w medycynie Punkt widzenia kardiologa

Informatyka w medycynie Punkt widzenia kardiologa Informatyka w medycynie Punkt widzenia kardiologa Lech Poloński Mariusz Gąsior Informatyka medyczna Dział informatyki zajmujący się jej zastosowaniem w ochronie zdrowia (medycynie) Stymulacja rozwoju informatyki

Bardziej szczegółowo

Przewodnik do planowania programu kształcenia na II roku studiów I stopnia. Kierunek: Bioinformatyka. 17 czerwca 2013 r.

Przewodnik do planowania programu kształcenia na II roku studiów I stopnia. Kierunek: Bioinformatyka. 17 czerwca 2013 r. Przewodnik do planowania programu kształcenia na II roku studiów I stopnia Kierunek: Bioinformatyka Przeznaczony dla studentów, którzy w roku 2012/13 studiują na I roku studiów I stopnia 17 czerwca 2013

Bardziej szczegółowo

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka Laboratorium, 30h. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Laboratorium, 30h Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Zasady zaliczenia przedmiotu Kolokwia (3 4 ) Ocena aktywności i przygotowania Obecnośd Literatura, materiały Bioinformatyka i ewolucja

Bardziej szczegółowo

Bioinformatyczne bazy danych - część 2. -przeszukiwanie baz danych -pobieranie danych

Bioinformatyczne bazy danych - część 2. -przeszukiwanie baz danych -pobieranie danych Bioinformatyczne bazy danych - część 2 -przeszukiwanie baz danych -pobieranie danych Numery dostępowe baz danych (accession number) to ciąg liter i cyfr służących jako etykieta identyfikująca sekwencję

Bardziej szczegółowo

Programowanie. programowania. Klasa 3 Lekcja 9 PASCAL & C++

Programowanie. programowania. Klasa 3 Lekcja 9 PASCAL & C++ Programowanie Wstęp p do programowania Klasa 3 Lekcja 9 PASCAL & C++ Język programowania Do przedstawiania algorytmów w postaci programów służą języki programowania. Tylko algorytm zapisany w postaci programu

Bardziej szczegółowo

Informatyka wspomaga przedmioty ścisłe w szkole

Informatyka wspomaga przedmioty ścisłe w szkole Informatyka wspomaga przedmioty ścisłe w szkole Prezentuje : Dorota Roman - Jurdzińska W arkuszu I na obu poziomach występują dwa zadania związane z algorytmiką: Arkusz I bez komputera analiza algorytmów,

Bardziej szczegółowo

Kierunek:Informatyka- - inż., rok I specjalność: Grafika komputerowa i multimedia

Kierunek:Informatyka- - inż., rok I specjalność: Grafika komputerowa i multimedia :Informatyka- - inż., rok I specjalność: Grafika komputerowa i multimedia Podstawy prawne. 1 15 1 Podstawy ekonomii. 1 15 15 2 Repetytorium z matematyki. 1 30 3 Środowisko programisty. 1 30 3 Komputerowy

Bardziej szczegółowo

ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE Specjalność: Biofizyka molekularna. 3-letnie studia I stopnia (licencjackie)

ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE Specjalność: Biofizyka molekularna. 3-letnie studia I stopnia (licencjackie) ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE Specjalność: Biofizyka molekularna 3-letnie studia I stopnia (licencjackie) 1. OGÓLNA CHARAKTERYSTYKA STUDIÓW Biofizyka to uznana dziedzina nauk przyrodniczych

Bardziej szczegółowo

Wykład V. Rzut okiem na języki programowania. Studia Podyplomowe INFORMATYKA Podstawy Informatyki

Wykład V. Rzut okiem na języki programowania. Studia Podyplomowe INFORMATYKA Podstawy Informatyki Studia Podyplomowe INFORMATYKA Podstawy Informatyki Wykład V Rzut okiem na języki programowania 1 Kompilacja vs. interpretacja KOMPILACJA Proces, który przetwarza program zapisany w języku programowania,

Bardziej szczegółowo

Wstęp do Informatyki dla bioinformatyków

Wstęp do Informatyki dla bioinformatyków Wstęp do Informatyki dla bioinformatyków Wykład 1. Wstęp do Wstępu Bartek Wilczyński bartek@mimuw.edu.pl Po pierwsze - Formalności 2 kolokwia (po 15 pkt) początek XI i koniec XII Dwa programy zaliczeniowe:

Bardziej szczegółowo

Samouczek: Konstruujemy drzewo

Samouczek: Konstruujemy drzewo ROZDZIAŁ 2 Samouczek: Konstruujemy drzewo Po co nam drzewa filogenetyczne? Drzewa filogenetyczne często pojawiają się dzisiaj w pracach z dziedziny biologii molekularnej, które nie mają związku z filogenetyką

Bardziej szczegółowo

SYSTEMY INFORMATYCZNE WSPOMAGAJĄCE HODOWLĘ MAGDALENA FRĄSZCZAK

SYSTEMY INFORMATYCZNE WSPOMAGAJĄCE HODOWLĘ MAGDALENA FRĄSZCZAK SYSTEMY INFORMATYCZNE WSPOMAGAJĄCE HODOWLĘ Prowadzący: JOANNA SZYDA MAGDALENA FRĄSZCZAK WSTĘP 1. Systemy informatyczne w hodowli -??? 2. Katedra Genetyki 3. Pracownia biostatystyki - wykorzystanie narzędzi

Bardziej szczegółowo

Informatyka na UG... Witold Bołt (ja@hope.art.pl)

Informatyka na UG... Witold Bołt (ja@hope.art.pl) Informatyka na UG... Witold Bołt (ja@hope.art.pl) >> Agenda Co to jest informatyka? Czym zajmuje się informatyk? Czego można nauczyć się na UG? Jak wyglądają studia informatyczne na UG? Co po studiach?

Bardziej szczegółowo

3. DZIEDZINY NAUKI I DYSCYPLINY, DO KTÓRYCH ODNOSZĄ SIĘ KIERUNKOWE EFEKTY KSZTAŁCENIA:

3. DZIEDZINY NAUKI I DYSCYPLINY, DO KTÓRYCH ODNOSZĄ SIĘ KIERUNKOWE EFEKTY KSZTAŁCENIA: 1. Nazwa kierunku: BIOINFORMATYKA 2. OBSZARY KSZTAŁCENIA: P nauki przyrodnicze; X nauki ścisłe; T nauki techniczne; Inż. efekty kształcenia prowadzącego do uzyskania kompetencji inżynierskich UMIEJSCOWIENIE

Bardziej szczegółowo

na podstawie artykułu: Modeling Complex RNA Tertiary Folds with Rosetta Clarence Yu Cheng, Fang-Chieh Chou, Rhiju Das

na podstawie artykułu: Modeling Complex RNA Tertiary Folds with Rosetta Clarence Yu Cheng, Fang-Chieh Chou, Rhiju Das na podstawie artykułu: Modeling Complex RNA Tertiary Folds with Rosetta Clarence Yu Cheng, Fang-Chieh Chou, Rhiju Das wykonała: Marta Szynczewska bioinformatyka Uniwersytet Jagielloński Struktura I-rzędowa

Bardziej szczegółowo

Bazy i modele danych

Bazy i modele danych Bazy i modele danych Przełom XX i XXI wieku to okres dynamicznego rozwoju programów sekwencjonowania genomów: 1995 genom Haemophilus influenzae 1997 genom E. coli 1997 genom drożdży S. cerevisiae 1998

Bardziej szczegółowo

Kierunek:Informatyka- - inż., rok I specjalność: Grafika komputerowa

Kierunek:Informatyka- - inż., rok I specjalność: Grafika komputerowa :Informatyka- - inż., rok I specjalność: Grafika komputerowa Metody uczenia się i studiowania. 1 Podstawy prawne. 1 Podstawy ekonomii. 1 Matematyka dyskretna. 1 Wprowadzenie do informatyki. 1 Podstawy

Bardziej szczegółowo

BIOINFORMATYKA. Copyright 2011, Joanna Szyda

BIOINFORMATYKA. Copyright 2011, Joanna Szyda BIOINFORMATYKA 1. Wykład wstępny 2. Struktury danych w badaniach bioinformatycznych 3. Bazy danych: projektowanie i struktura 4. Bazy danych: projektowanie i struktura 5. Powiązania pomiędzy genami: równ.

Bardziej szczegółowo

Kontakt.

Kontakt. BIOINFORMATYKA i BIOLOGIA OBLICZENIOWA Kontakt Małgorzata.Kotulska@pwr.edu.pl Katedra Inżynierii Biomedycznej WPPT http://www.kotulska-lab.pwr.wroc.pl/forstudents/ D1 pok. 115 Konsultacje : czwartek 17.05-18.55

Bardziej szczegółowo

INFORMATYKA POZIOM ROZSZERZONY

INFORMATYKA POZIOM ROZSZERZONY EGZAMIN MATURALNY W ROKU SZKOLNYM 2015/2016 FORMUŁA DO 2014 ( STARA MATURA ) INFORMATYKA POZIOM ROZSZERZONY ZASADY OCENIANIA ROZWIĄZAŃ ZADAŃ ARKUSZ MIN-R1, R2 MAJ 2016 Uwaga: Akceptowane są wszystkie odpowiedzi

Bardziej szczegółowo

Genomika Porównawcza. Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski

Genomika Porównawcza. Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski Genomika Porównawcza Agnieszka Rakowska Instytut Informatyki i Matematyki Komputerowej Uniwersytet Jagiellooski 1 Plan prezentacji 1. Rodzaje i budowa drzew filogenetycznych 2. Metody ukorzeniania drzewa

Bardziej szczegółowo

Wymagania edukacyjne na ocenę z informatyki KLASA III

Wymagania edukacyjne na ocenę z informatyki KLASA III Wymagania edukacyjne na ocenę z informatyki KLASA III 0. Logo [6 godz.] PODSTAWA PROGRAMOWA: Rozwiązywanie problemów i podejmowanie decyzji z wykorzystaniem komputera, stosowanie podejścia algorytmicznego.

Bardziej szczegółowo

TOK STUDIÓW Kierunek: informatyka rok studiów: I studia stacjonarne pierwszego stopnia, rok akademicki 2014/2015. Forma zaliczen ia. egz. lab.

TOK STUDIÓW Kierunek: informatyka rok studiów: I studia stacjonarne pierwszego stopnia, rok akademicki 2014/2015. Forma zaliczen ia. egz. lab. Lp TOK TUDIÓW rok studiów: I studia stacjonarne pierwszego stopnia, rok akademicki 2014/2015 w ć w ko n lab EC T 1 Podstawy prawno-etyczne 15 1 x 2 Podstawy ekonomii 15 1 x 3 Repetytorium z matematyki

Bardziej szczegółowo

Podstawy Programowania Algorytmy i programowanie

Podstawy Programowania Algorytmy i programowanie Podstawy Programowania Algorytmy i programowanie Katedra Analizy Nieliniowej, WMiI UŁ Łódź, 3 października 2013 r. Algorytm Algorytm w matematyce, informatyce, fizyce, itp. lub innej dziedzinie życia,

Bardziej szczegółowo

Ewolucja molekularna człowieka okiem bioinformatyka. Justyna Wojtczak Jarosław Jeleniewicz

Ewolucja molekularna człowieka okiem bioinformatyka. Justyna Wojtczak Jarosław Jeleniewicz Ewolucja molekularna człowieka okiem bioinformatyka Justyna Wojtczak Jarosław Jeleniewicz Informatyka w biologii - bioinformatyka Jest to szeroka dziedzina zajmująca się tworzeniem zaawansowanych baz danych,

Bardziej szczegółowo

BIOTECHNOLOGIA MEDYCZNA

BIOTECHNOLOGIA MEDYCZNA BIOTECHNOLOGIA MEDYCZNA K WBT BT2 101 Genomika funkcjonalna 30 4 WBT BT350 In vivo veritas praktikum pracy ze zwierzętami laboratoryjnymi 60 4 Mechanisms of cell trafficking from leucocyte homing to WBT

Bardziej szczegółowo

Bioinformatyka 2 (BT172) Struktura i organizacja kursu

Bioinformatyka 2 (BT172) Struktura i organizacja kursu Bioinformatyka 2 (BT172) Wykład 1 Struktura i organizacja kursu dr Krzysztof Murzyn adiunkt w Zakładzie Biofizyki WBtUJ pok. B028, tel. 664-6379 10.X.2005 PODSTAWOWE INFORMACJE 9 godz. wykładów (45 min,

Bardziej szczegółowo

Database resources of the National Center for Biotechnology Information. Magdalena Malczyk

Database resources of the National Center for Biotechnology Information. Magdalena Malczyk Database resources of the National Center for Biotechnology Information Magdalena Malczyk NCBI NCBI = National Center for Biotechnology Information Założone w 1998 r. Cel: rozwijanie systemów informatycznych

Bardziej szczegółowo

Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna

Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna Księgarnia PWN: Paul G. Higgs, Teresa K. Attwood - Bioinformatyka i ewolucja molekularna Przedmowa...................................................... 1 1. Rewolucja informatyczna w naukach biomedycznych...........................

Bardziej szczegółowo

INFORMATYKA, TECHNOLOGIA INFORMACYJNA ORAZ INFORMATYKA W LOGISTYCE

INFORMATYKA, TECHNOLOGIA INFORMACYJNA ORAZ INFORMATYKA W LOGISTYCE Studia podyplomowe dla nauczycieli INFORMATYKA, TECHNOLOGIA INFORMACYJNA ORAZ INFORMATYKA W LOGISTYCE Przedmiot JĘZYKI PROGRAMOWANIA DEFINICJE I PODSTAWOWE POJĘCIA Autor mgr Sławomir Ciernicki 1/7 Aby

Bardziej szczegółowo

Bioinformatyka 2 (BT172) Progresywne metody wyznaczania MSA: T-coffee

Bioinformatyka 2 (BT172) Progresywne metody wyznaczania MSA: T-coffee Bioinformatyka 2 (BT172) Wykład 5 Progresywne metody wyznaczania MSA: T-coffee Krzysztof Murzyn 14.XI.2005 PLAN WYKŁADU Ostatnio : definicje, zastosowania MSA, złożoność obliczeniowa algorytmu wyznaczania

Bardziej szczegółowo

Wymagania - informatyka

Wymagania - informatyka Budowa i przeznaczenie komputera osobistego System operacyjny jednostka centralna, dysk twardy, pamięć RAM, płyta główna, procesor system operacyjny, DOS, Windows 95/98, WinXP, Win7 Znajomość podstawowych

Bardziej szczegółowo

Program studiów magisterskich z Bioinformatyki i Biologii Systemów

Program studiów magisterskich z Bioinformatyki i Biologii Systemów Program studiów magisterskich z Bioinformatyki i Biologii Systemów Na program studiów składają się następujące grupy przedmiotów: przedmioty obowiązkowe, przedmioty kierunkowe przedmioty do wyboru bezpośrednio

Bardziej szczegółowo

Analiza danych pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego. - część I -

Analiza danych pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego. - część I - pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego - część I - Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Plan wykładów --------------------------------------------------------

Bardziej szczegółowo

Wymagania edukacyjne na ocenę z informatyki klasa 3

Wymagania edukacyjne na ocenę z informatyki klasa 3 Wymagania edukacyjne na ocenę z informatyki klasa 3 0. Logo [6 godz.] PODSTAWA PROGRAMOWA: Rozwiązywanie problemów i podejmowanie decyzji z wykorzystaniem komputera, stosowanie podejścia algorytmicznego.

Bardziej szczegółowo

Pytania kwiecień, maj

Pytania kwiecień, maj Pytania kwiecień, maj Od czego zależy to czy jakość zasad w technice NGS jest zakodowana w skali phred 33 czy 64? Czy są jakieś kryteria wyboru tego kodowania? Z czego wynika dobór kodowania skali phred

Bardziej szczegółowo

Jak Big Data rewolucjonizuje naukę oraz współpracę centrów badawczych z biznesem?

Jak Big Data rewolucjonizuje naukę oraz współpracę centrów badawczych z biznesem? Jak Big Data rewolucjonizuje naukę oraz współpracę centrów badawczych z biznesem? dr Łukasz Bolikowski ICM, Uniwersytet Warszawski Big Data Summit, 26 listopada 2014 Czwarty paradygmat Cztery paradygmaty

Bardziej szczegółowo

9. Metody dydaktyczne 10. Podstawowe informacje i zaliczone kursy z genetyki i biologii molekularnej oraz dobra znajom angielskiego.

9. Metody dydaktyczne 10. Podstawowe informacje i zaliczone kursy z genetyki i biologii molekularnej oraz dobra znajom angielskiego. Lp. Opis sylabusu 1. Nazwa przedmiotu Bioinformatyka i genomika 3. Kod przedmiotu BioGenom1 5. - - 6. Typ przedmiotu 7. Rok studiów, semestr Studia II stopnia, semestr I 8. 9. Metody dydaktyczne 10. Podstawowe

Bardziej szczegółowo

Informatyka kl. 1. Semestr I

Informatyka kl. 1. Semestr I Informatyka kl. 1 Znajomość roli informatyki we współczesnym świecie. Rozróżnianie zestawu urządzeń w komputerze, rodzajów pamięci komputera, urządzeń wejścia i wyjścia. Umiejętność tworzenia dokumentu

Bardziej szczegółowo

Dopasowywanie sekwencji (ang. sequence alignment) Metody dopasowywania sekwencji. Homologia a podobieństwo sekwencji. Rodzaje dopasowania

Dopasowywanie sekwencji (ang. sequence alignment) Metody dopasowywania sekwencji. Homologia a podobieństwo sekwencji. Rodzaje dopasowania Wprowadzenie do Informatyki Biomedycznej Wykład 2: Metody dopasowywania sekwencji Wydział Informatyki PB Dopasowywanie sekwencji (ang. sequence alignment) Dopasowywanie (przyrównywanie) sekwencji polega

Bardziej szczegółowo

XQTav - reprezentacja diagramów przepływu prac w formacie SCUFL przy pomocy XQuery

XQTav - reprezentacja diagramów przepływu prac w formacie SCUFL przy pomocy XQuery http://xqtav.sourceforge.net XQTav - reprezentacja diagramów przepływu prac w formacie SCUFL przy pomocy XQuery dr hab. Jerzy Tyszkiewicz dr Andrzej Kierzek mgr Jacek Sroka Grzegorz Kaczor praca mgr pod

Bardziej szczegółowo

Baza danych. Baza danych to:

Baza danych. Baza danych to: Baza danych Baza danych to: zbiór danych o określonej strukturze, zapisany na zewnętrznym nośniku (najczęściej dysku twardym komputera), mogący zaspokoić potrzeby wielu użytkowników korzystających z niego

Bardziej szczegółowo

Zalew danych skąd się biorą dane? są generowane przez banki, ubezpieczalnie, sieci handlowe, dane eksperymentalne, Web, tekst, e_handel

Zalew danych skąd się biorą dane? są generowane przez banki, ubezpieczalnie, sieci handlowe, dane eksperymentalne, Web, tekst, e_handel według przewidywań internetowego magazynu ZDNET News z 8 lutego 2001 roku eksploracja danych (ang. data mining ) będzie jednym z najbardziej rewolucyjnych osiągnięć następnej dekady. Rzeczywiście MIT Technology

Bardziej szczegółowo

Bioinformatyka. z sylabusu...

Bioinformatyka. z sylabusu... Bioinformatyka Wykład 1. E. Banachowicz Zakład Biofizyki Molekularnej IF UAM http://www.amu.edu.pl/~ewas z sylabusu... Wykład 1, 2010/2011 1 Orientacyjny plan wykładów 1. Przegląd baz danych, formaty danych

Bardziej szczegółowo

Uniwersytet Przyrodniczy we Wrocławiu nie ponosi żadnych kosztów związanych z odbywaniem praktyk przez studentów.

Uniwersytet Przyrodniczy we Wrocławiu nie ponosi żadnych kosztów związanych z odbywaniem praktyk przez studentów. Regulamin odbywania praktyk studenckich na kierunku Bioinformatyka (studia dzienne pierwszego stopnia) na Wydziale Biologii i Hodowli Zwierząt Uniwersytetu Przyrodniczego we Wrocławiu 1. Obowiązujące praktyki

Bardziej szczegółowo

Program studiów I st. (licencjackich) na kieruneku Biotechnologia

Program studiów I st. (licencjackich) na kieruneku Biotechnologia Program studiów I st. (licencjackich) na kieruneku Biotechnologia ROK I i II Przedmiot Rok pierwszy Rok drugi I semestr II III semestr IV godz. ECTS godz. ECTS godz. ECTS godz. ECTS j. angielski 60 2 60

Bardziej szczegółowo

STUDIA I STOPNIA NA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE. specjalność Projektowanie molekularne i bioinformatyka

STUDIA I STOPNIA NA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE. specjalność Projektowanie molekularne i bioinformatyka STUDIA I STOPNIA NA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE specjalność Projektowanie molekularne i bioinformatyka 1. CELE KSZTAŁCENIA Projektowanie leków, prace projektowe związane z inżynierią

Bardziej szczegółowo

Przyrównanie sekwencji. Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu

Przyrównanie sekwencji. Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Przyrównanie sekwencji Magda Mielczarek Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Sequence alignment - przyrównanie sekwencji Poszukiwanie ciągów znaków (zasad nukleotydowych lub reszt aminokwasowych),

Bardziej szczegółowo

EFEKTY KSZTAŁCENIA DLA KIERUNKU STUDIÓW NAUCZANIE MATEMATYKI I INFORMATYKI

EFEKTY KSZTAŁCENIA DLA KIERUNKU STUDIÓW NAUCZANIE MATEMATYKI I INFORMATYKI EFEKTY KSZTAŁCENIA DLA KIERUNKU STUDIÓW NAUCZANIE MATEMATYKI I INFORMATYKI poziom kształcenia profil kształcenia tytuł zawodowy uzyskiwany przez absolwenta studia drugiego stopnia ogólnoakademicki magister

Bardziej szczegółowo

Liczby losowe i pętla while w języku Python

Liczby losowe i pętla while w języku Python Liczby losowe i pętla while w języku Python Mateusz Miotk 17 stycznia 2017 Instytut Informatyki UG 1 Generowanie liczb losowych Na ogół programy są spójne i prowadzą do przewidywanych wyników. Czasem jednak

Bardziej szczegółowo

Odniesienie do efektów kształcenia w obszarze kształcenia w zakresie nauk przyrodniczych i technicznych

Odniesienie do efektów kształcenia w obszarze kształcenia w zakresie nauk przyrodniczych i technicznych Wydział Biotechnologii i Hodowli Zwierząt Nazwa kierunku studiów: bioinformatyka Poziom kształcenia: studia pierwszego stopnia Profil kształcenia: ogólnoakademicki Obszar kształcenia: w zakresie nauk przyrodniczych

Bardziej szczegółowo

Ćwiczenia nr 5. Wykorzystanie baz danych i narzędzi analitycznych dostępnych online

Ćwiczenia nr 5. Wykorzystanie baz danych i narzędzi analitycznych dostępnych online Techniki molekularne ćw. 5 1 z 13 Ćwiczenia nr 5. Wykorzystanie baz danych i narzędzi analitycznych dostępnych online I. Zasoby NCBI Strona: http://www.ncbi.nlm.nih.gov/ stanowi punkt startowy dla eksploracji

Bardziej szczegółowo

Kierunek:Informatyka- - inż., rok I specjalność: Grafika komputerowa i multimedia

Kierunek:Informatyka- - inż., rok I specjalność: Grafika komputerowa i multimedia :Informatyka- - inż., rok I specjalność: Grafika komputerowa i multimedia Podstawy prawne. 1 15 1 Podstawy ekonomii. 1 15 15 2 Metody uczenia się i studiowania. 1 15 1 Środowisko programisty. 1 30 3 Komputerowy

Bardziej szczegółowo

Generator testów Bioinformatyka wer / 0 Strona: 1

Generator testów Bioinformatyka wer / 0 Strona: 1 Przedmiot: Nazwa przedmiotu Nazwa testu: Bioinformatyka wer. 1.0.6 Nr testu 0 Klasa: V zaoczne WNB UZ Odpowiedzi zaznaczamy TYLKO w tabeli! 1. Analiza porównawcza białek zwykle zaczyna się na badaniach

Bardziej szczegółowo

Państwowa Wyższa Szkoła Techniczno-Ekonomiczna w Jarosławiu

Państwowa Wyższa Szkoła Techniczno-Ekonomiczna w Jarosławiu Załącznik nr 1 do Uchwały nr 9/12 Rady Instytutu Inżynierii Technicznej PWSTE w Jarosławiu z dnia 30 marca 2012r Państwowa Wyższa Szkoła Techniczno-Ekonomiczna w Jarosławiu EFEKTY KSZTAŁCENIA DLA KIERUNKU

Bardziej szczegółowo

Informatyka szkolna z perspektywy uczelni

Informatyka szkolna z perspektywy uczelni Informatyka szkolna z perspektywy uczelni Jacek Cichoń Jacek.Cichon@pwr.wroc.pl Instytut Matematyki i Informatyki Wydział Podstawowych Problemów Techniki Politechnika Wrocławska listopad 2010 Cichoń (IMiI

Bardziej szczegółowo

Fizyka z elementami informatyki

Fizyka z elementami informatyki Fizyka z elementami informatyki 1. Podstawy fizyki 40E 2. Elementy matematyki 15 3. Laboratorium z fizyki I 20 4. Podstawy informatyki 15 5. Konsultacje 10 6. Fizyka 23E 7. Laboratorium z fizyki II 12

Bardziej szczegółowo

dr inż. Jarosław Forenc

dr inż. Jarosław Forenc Informatyka 2 Politechnika Białostocka - Wydział Elektryczny Elektrotechnika, semestr III, studia niestacjonarne I stopnia Rok akademicki 2011/2012 Pracownia nr 1 (14.10.2011) Rok akademicki 2011/2012,

Bardziej szczegółowo

Zatwierdzono na Radzie Wydziału w dniu 11 czerwca 2015 r.

Zatwierdzono na Radzie Wydziału w dniu 11 czerwca 2015 r. PLAN STUDIÓW DLA KIERUNKU INFORMATYKA STUDIA: INŻYNIERSKIE TRYB STUDIÓW: STACJONARNE Zatwierdzono na Radzie Wydziału w dniu 11 czerwca 201 r. Egzamin po semestrze Obowiązuje od naboru na rok akademicki

Bardziej szczegółowo

XI. Wydział Matematyki, Informatyki i Mechaniki

XI. Wydział Matematyki, Informatyki i Mechaniki XI. Wydział Matematyki, Informatyki i Mechaniki 1.1 Kierunek studiów: matematyka Poziom kształcenia: pierwszego stopnia Czas trwania: 3 lata Próg kwalifikacji: 55 pkt. a) Kandydaci z maturą 2005-2017 wyboru

Bardziej szczegółowo

Statystyczna analiza danych

Statystyczna analiza danych Statystyczna analiza danych ukryte modele Markowa, zastosowania Anna Gambin Instytut Informatyki Uniwersytet Warszawski plan na dziś Ukryte modele Markowa w praktyce modelowania rodzin białek multiuliniowienia

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Uniwersytet Śląski. Wydział Informatyki i Nauki o Materiałach PROGRAM KSZTAŁCENIA. Studia III stopnia (doktoranckie) kierunek Informatyka

Uniwersytet Śląski. Wydział Informatyki i Nauki o Materiałach PROGRAM KSZTAŁCENIA. Studia III stopnia (doktoranckie) kierunek Informatyka Uniwersytet Śląski Wydział Informatyki i Nauki o Materiałach PROGRAM KSZTAŁCENIA Studia III stopnia (doktoranckie) kierunek Informatyka (przyjęty przez Radę Wydziału Informatyki i Nauki o Materiałach w

Bardziej szczegółowo

Wyższa Szkoła Technologii Teleinformatycznych w Świdnicy. Dokumentacja specjalności. Sieci komputerowe

Wyższa Szkoła Technologii Teleinformatycznych w Świdnicy. Dokumentacja specjalności. Sieci komputerowe Wyższa Szkoła Technologii Teleinformatycznych w Świdnicy Dokumentacja specjalności Sieci komputerowe prowadzonej w ramach kierunku Informatykana wydziale Informatyki 1. Dane ogólne Nazwa kierunku: Informatyka

Bardziej szczegółowo

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej

Podstawy biologiczne - komórki. Podstawy biologiczne - cząsteczki. Model komórki eukariotycznej. Wprowadzenie do Informatyki Biomedycznej Wprowadzenie do Informatyki Biomedycznej Wykład 1: Podstawy bioinformatyki Wydział Informatyki PB Podstawy biologiczne - komórki Wszystkie organizmy zbudowane są z komórek komórka jest skomplikowanym systemem

Bardziej szczegółowo

Bazy danych i R/Bioconductor

Bazy danych i R/Bioconductor Bazy danych i R/Bioconductor Praca z pakietem biomart Zagadnienia RStudio Oprogramowanie BioMart Pakiet biomart wprowadzenie funkcje biomart przykładowe zastosowania RStudio RStudio http://www.rstudio.com/

Bardziej szczegółowo

STUDIA I STOPNIA NA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE. specjalność Projektowanie molekularne i bioinformatyka

STUDIA I STOPNIA NA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE. specjalność Projektowanie molekularne i bioinformatyka STUDIA I STOPNIA NA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE specjalność Projektowanie molekularne i bioinformatyka 1. CELE KSZTAŁCENIA Projektowanie leków, prace projektowe związane z inżynierią

Bardziej szczegółowo

Bioinformatics for Science. Tomasz Puton

Bioinformatics for Science. Tomasz Puton Tomasz Puton O firmie VitaInSilica to pierwszy w Polsce projekt skupiający specjalistów z bioinformatyki, biologii molekularnej i biotechnologii. Innowacyjne przedsięwzięcie rozwijane przez pracowników

Bardziej szczegółowo

PROGRAM KSZTAŁCENIA dla kierunku Elektronika i Telekomunikacja studiów I stopnia o profilu ogólnoakademickim

PROGRAM KSZTAŁCENIA dla kierunku Elektronika i Telekomunikacja studiów I stopnia o profilu ogólnoakademickim PROGRAM KSZTAŁCENIA dla kierunku Elektronika i Telekomunikacja studiów I stopnia o profilu ogólnoakademickim OPIS ZAKŁADANYCH EFEKTÓW KSZTAŁCENIA 1 Symbol K_W01 K_W02 K_W03 Efekty kształcenia dla kierunku

Bardziej szczegółowo

Od jakiego pułapu startujemy? matematyka

Od jakiego pułapu startujemy? matematyka dla biotechnologów Wykład 2 Definicja bioinformatyki Od jakiego pułapu startujemy? Zakładamy, że te pojęcia są w małym palcu: DNA, RNA struktura, funkcje, rodzaje Genom Białka struktury, funkcje, rodzaje,

Bardziej szczegółowo

Baza danych. Modele danych

Baza danych. Modele danych Rola baz danych Systemy informatyczne stosowane w obsłudze działalności gospodarczej pełnią funkcję polegającą na gromadzeniu i przetwarzaniu danych. Typowe operacje wykonywane na danych w systemach ewidencyjno-sprawozdawczych

Bardziej szczegółowo

SYSTEMY INFORMATYCZNE WSPOMAGAJĄCE HODOWLĘ

SYSTEMY INFORMATYCZNE WSPOMAGAJĄCE HODOWLĘ SYSTEMY INFORMATYCZNE WSPOMAGAJĄCE HODOWLĘ Struktura efektywnej bazy danych Zastosowanie pakietu MS Excel do tworzenia baz danych WSTĘP 1. Dane Przykłady Edycja Zarządzanie 2. Bazy danych Definicje Przykłady

Bardziej szczegółowo

Techniki molekularne w biologii SYLABUS A. Informacje ogólne

Techniki molekularne w biologii SYLABUS A. Informacje ogólne Techniki molekularne w biologii SYLABUS A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod przedmiotu

Bardziej szczegółowo

STUDIA I STOPNIA NA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE. specjalność Projektowanie molekularne i bioinformatyka

STUDIA I STOPNIA NA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE. specjalność Projektowanie molekularne i bioinformatyka STUDIA I STOPNIA NA KIERUNKU ZASTOSOWANIA FIZYKI W BIOLOGII I MEDYCYNIE specjalność Projektowanie molekularne i bioinformatyka 1. CELE KSZTAŁCENIA Projektowanie leków, prace projektowe związane z inżynierią

Bardziej szczegółowo

Wyższa Szkoła Technologii Teleinformatycznych w Świdnicy. Dokumentacja specjalności. Systemy komputerowe administracji

Wyższa Szkoła Technologii Teleinformatycznych w Świdnicy. Dokumentacja specjalności. Systemy komputerowe administracji Wyższa Szkoła Technologii Teleinformatycznych w Świdnicy Dokumentacja specjalności Systemy komputerowe administracji prowadzonej w ramach kierunku Informatykana wydziale Informatyki 1. Dane ogólne Nazwa

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

MultiSETTER: web server for multiple RNA structure comparison. Sandra Sobierajska Uniwersytet Jagielloński

MultiSETTER: web server for multiple RNA structure comparison. Sandra Sobierajska Uniwersytet Jagielloński MultiSETTER: web server for multiple RNA structure comparison Sandra Sobierajska Uniwersytet Jagielloński Wprowadzenie Budowa RNA: - struktura pierwszorzędowa sekwencja nukleotydów w łańcuchu: A, U, G,

Bardziej szczegółowo

Fizyka komputerowa(ii)

Fizyka komputerowa(ii) Instytut Fizyki Fizyka komputerowa(ii) Studia magisterskie Prowadzący kurs: Dr hab. inż. Włodzimierz Salejda, prof. PWr Godziny konsultacji: Poniedziałki i wtorki w godzinach 13.00 15.00 pokój 223 lub

Bardziej szczegółowo

biegle i poprawnie posługuje się terminologią informatyczną,

biegle i poprawnie posługuje się terminologią informatyczną, INFORMATYKA KLASA 1 1. Wymagania na poszczególne oceny: 1) ocenę celującą otrzymuje uczeń, który: samodzielnie wykonuje na komputerze wszystkie zadania z lekcji, wykazuje inicjatywę rozwiązywania konkretnych

Bardziej szczegółowo

Zakładane efekty kształcenia dla kierunku

Zakładane efekty kształcenia dla kierunku Zakładane efekty dla kierunku Jednostka prowadząca kierunek studiów Nazwa kierunku studiów Specjalności Obszar Profil Poziom Tytuł zawodowy uzyskiwany przez absolwenta Dziedziny nauki / sztuki i dyscypliny

Bardziej szczegółowo

1. Administrator baz danych (próba: 110 osób) 2. Administrator serwerów (próba: 88 osób) 3. Administrator sieci informatycznej (próba: 244 osoby) 4.

1. Administrator baz danych (próba: 110 osób) 2. Administrator serwerów (próba: 88 osób) 3. Administrator sieci informatycznej (próba: 244 osoby) 4. Lista stanowisk Stanowiska uwzględnione w raporcie 1. Administrator baz danych (próba: 110 osób) 2. Administrator serwerów (próba: 88 osób) 3. Administrator sieci informatycznej (próba: 244 osoby) 4. Administrator

Bardziej szczegółowo

PLAN REALIZACJI MATERIAŁU NAUCZANIA Z INFORMATYKI II. Uczeń umie: Świadomie stosować się do zasad regulaminów (P).

PLAN REALIZACJI MATERIAŁU NAUCZANIA Z INFORMATYKI II. Uczeń umie: Świadomie stosować się do zasad regulaminów (P). PLAN REALIZACJI MATERIAŁU NAUCZANIA Z INFORMATYKI II DZIAŁ I: KOMPUTER W ŻYCIU CZŁOWIEKA. 1. Lekcja organizacyjna. Zapoznanie uczniów z wymaganiami edukacyjnymi i PSP. 2. Przykłady zastosowań komputerów

Bardziej szczegółowo