GENOMIKA. MAPOWANIE GENOMÓW MAPY GENOMICZNE

Wielkość: px
Rozpocząć pokaz od strony:

Download "GENOMIKA. MAPOWANIE GENOMÓW MAPY GENOMICZNE"

Transkrypt

1 GENOMIKA. MAPOWANIE GENOMÓW MAPY GENOMICZNE Bioinformatyka, wykład 3 (21.X.2008)

2 tydzień temu Gen??? Biologiczne bazy danych historia Biologiczne bazy danych najważniejsze

3 Wykład 3 spis treści Genomika Mapy genomowe Markery genetyczne, mapy genetyczne Mapowanie fizyczne Bazy danych map genomowych

4 GENOMIKA badanie struktury i funkcjonowania genomów GENOMIKA GENOMIKA STRUKTURALNA GENOMIKA PORÓWNAWCZA GENOMIKA FUNKCJONALNA MAPOWANIE GENOMU: Mapy genetyczne Mapy fizyczne SEKWENCJONOWANIE Ewolucja genomów Ewolucja genów Structural genomics Comparative genomics Functional genomics Transkryptom Regulacja tranckrypcji Proteom

5 GENOMIKA badanie struktury i funkcjonowania genomów GENOMIKA STRUKTURALNA MAPOWANIE GENOMU: Mapy II genetyczne znaczenie: Mapy =proteomika fizyczne strukturalna SEKWENCJONOWANIE GENOMIKA GENOMIKA PORÓWNAWCZA Ewolucja genomów Ewolucja genów Structural genomics Comparative genomics Functional genomics Biologia molekularna & bioinformatyka GENOMIKA FUNKCJONALNA Transkryptom Regulacja tranckrypcji Proteom

6 Zmienność genomu ludzkiego Nature, sites of structural variation (> 6kbp) 4 million SNPs small indels (< 100 bp)

7 Zmienność genomu ludzkiego

8 PubMed stats [Oct 2008] Genomics[MAJR] 12,606 Bioinformatics[MAJR] 8,257 Genomics 43,415 Bioinformatics 34,610 Bioinformatics (Google) 12,200,000 Genomics (Google) 12,100,000

9 Mapa genomu graficzna prezentacja położenia markerów/genów na chromosomie MAPY GENETYCZNE MAPY FIZYCZNE cm bp

10 Mapy genomowe MAPY GENETYCZNE powstają w oparciu o analizę częstości rekombinacji między badanymi markerami pokazują rozmieszczenie markerów na chromosomie oraz odległości genetyczne między nimi jednostka: 1cM = 1% rekombinacji (1 crossing over na 100 mejoz) u ludzi to ok.0,7 1 Mb MAPY FIZYCZNE powstają poprzez bezpośrednią lokalizację, technikami biologii molekularnej, badanej sekwencji DNA w genomie jednostka: pary zasad pz (ang. bp, kbp)

11 Mapy genetyczne Rekombinacje Jeżeli markery A i B są na tym samym chromosomie, częstość rekombinacji jest > 0 i < 0.5 Jeżeli markery A i B są na różnych chromosomach, częstość rekombinacji jest = 0.5.

12 Częstość rekombinacji (θ) Ten sam chromosom Różne chromosomy Częstość CROSSING-OVER Bardzo blisko Blisko Daleko Rzadko Kilka Często Często Sprzężenie TAK TAK NIE NIE θ 0% 1-4% 50% 50% From: TISSUE ENGINEERING & HUMAN GENETICS LABORATORY

13 Marker genetyczny polimorficzna sekwencja DNA (specyficzna) z jednego miejsca na chromosomie, używana do mapowania genetycznego, może być związana z fenotypem. Jest to podstawowe narzędzie genetyka Marker genetyczny klasa I (markery fenotypowe) są to geny kodujące cechy jakościowe organizmu np. antygeny erytrocytarne, antygeny głównego układu zgodności tkankowej (Major Histocompatibility Complex - MHC). markery tej klasy indentyfikowane są metodami serologicznymi lub metodami elektroforetycznymi. klasa II (markery DNA) są to sekwencje DNA, niekoniecznie kodujące, np. RFLP, SSLP, SNP markery takie jako markery genetycze muszą mieć przynajmniej dwie alleliczne formy. markery tego typu identyfikowane są przy użyciu technik analizy molekularnej.

14 Markery DNA RFLPs (Restriction Fragment Lenght Polymorphisms) Minisatelity Mikrosatelity SNPs (Single Nucleotide Polymorphisms)

15 Markery genetyczne cd. RFLPs (Restriction Fragment Lenght Polymorphisms) -- polimorfizm długości fragmentów restrykcyjnych Miejsce cięcia enzymu restrykcyjnego HindIII.

16 Markery RFLP: Restriction Fragment Length Polymorphism Żel

17 Markery genetyczne cd. Wady markerów RFLP: - tylko dwie formy alleliczne - dużo miejsc cięcia w dużych genomach

18 Markery genetyczne cd. SSLPs (Simple Sequence Length Polymorphisms) polimorfizm długości prostych sekwencji -minisatelity -mikrosatelity

19 Minisatelitarny DNA VNTRs (Variable Number of Tandem Repeats) zmienna liczba powtórzeń tandemowych sekwencje zawierające zmienną liczbę tandemowych powtórzeń motywu (11 60 pz) z reguły występują przy końcach chromosomów - telomerach liczba powtórzeń motywu: 2 do 1000, w zależności od ilości powtórzeń dany fragment DNA ma charakterystyczną długość (polimorfizm długości widoczny podczas elektroforezy) VNTR może być badane metodą PCR wraz z elektroforezą, połączoną z hybrydyzacją z wyznakowaną sondą. Liczba powtórzeń decyduje o długości fragmentu, co z kolei wpływa na szybkości jego przemieszczania się podczas elektroforezy. w danym locus VNTR występuje znaczna zmienność osobnicza Przykładowy motyw sekwencji minisatelitarnej: AGGGCTGGAGG Allel 1. AGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGG Allel 2. AGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGG Allel 3. AGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGG itd.

20 Przykładowa analiza VNTRs

21 Mikrosatelitarny DNA STRs (Short Tandem Repeats) krótkie sekwencje powtórzone tandemowo sekwencje zawierające zmienną liczbę tandemowych powtórzeń kilkunukleotydowego motywu (1 4 pz) motyw równomiernie rozmieszczony w genomie liczba powtórzeń motywu minisatelitarnego: 10 do 50 i w zależności od ilości powtórzeń dany fragment DNA ma charakterystyczną długość (polimorfizm długości widoczny podczas elektroforezy) często motyw taki może być regularnie przerywany inną sekwencją. ulokowane są zazwyczaj w intronach (czasami również w eksonach [egzonach] w postaci mniejszej liczby powtórzeń).

22 STR (Short Tandem Repeats) a analiza restrykcyjna A1A1 A1A2 A3A4 ACGACGACGACG A1A1 A1A2 A3A4 Zalety: -duża zmienność - często tworzą multi-locus patterns charakterystyczne dla danego osobnika Wady: - nie nadają się do dokładnego mapowania z powodu ich nielosowego rozkładu w genomie

23 Markery genetyczne cd. SNPs (Single Nucleotide Polymorphisms) polimorfizm pojedynczych nukleotydów Genom ludzki: 56 mln SNPs (6,5 mln validated SNPs) - NCBI Analiza SNP umożliwia wykrycie polimorfizmu pojedynczego nukleotydu w obrębie badanej sekwencji. Klasycznie polega to na amplifikacji określonego fragmentu genomu w reakcji PCR i sekwencjonowaniu uzyskanego produktu. Zaletą tej techniki jest wysoka wydajność identyfikacji polimorfizmu w obrębie badanej sekwencji, wadą jest wysoki koszt analizy.

24 Analiza SNP molecular beacons SNP microarrays

25 Analiza sprzężeń zaburzenia w analizach: - gorące miejsca rekombinacji - podwójny crossing over

26 Type of marker No. of loci Features Blood groups ~20 May need fresh blood No easy physical localization Electrophoretic mobility variants of serum proteins ~30 May need fresh serum, specialized assays No easy physical localization Often limited polymorphism HLA tissue types 1 One linked set Can only test for linkage to 6p21.3 DNA RFLPs >10 5 Two allele markers, maximum heterozygosity (potentially) Initially required Southern blotting, now PCR Easy physical localization DNA VNTRs >10 4 Many alleles, highly informative (minisatellites) (potentially) Tend to cluster near ends of chromosomes Easy physical localization DNA VNTRs >10 5 Many alleles, highly informative (microsatellites) (potentially) Can type by automated multiplex PCR Easy physical localization Distributed throughout genome DNA SNPs >10 6 Less informative than microsatellites (single nucleotide polymorphisms) (potentially) Can be typed on a very large scale by automated equipment without gel electrophoresis Markery fenotypowe Markery DNA

27 Niska rozdzielczość Mapowanie Fizyczne Mapa Cytogenetyczna (chromosome bands) rozróżnialne zabarwione fragmenty chromosomów (mikroskop optyczny) Mbps Restriction mapping kolejność i odległości pomiędzy punktami trawienia enzymami DNA. 100s kbp Fluorescence in situ hybridisation hybrydyzacja fluorescencyjnych sond do chromosomów 100s kbp STS sequence mapping kolejność unikalnych w genomie markerów DNA (STS) 100 kbp Sequence map - całkowicie zsekwencjonowany chromosom 1bp. Wysoka rozdzielczość

28 Mapy fizyczne FISH (Fluorescent in situ hybridization) hybrydyzacja fluorescencyjna in situ

29 Mapa fizyczna genomu Medicago truncatula (lucerny) skonstruowana metodą FISH

30 Mapy fizyczne cd. STS (Sequence tagged site) mapping - - mapowanie miejsc znakowanych sekwencją

31 Analiza STS

32 Mapa restrykcyjna A B A B

33 Sekwencjonowanie genomów Clone contig WGS (whole genome shotgun)

34 Przeglądarki genomowe - Genome Browsers NCBI Map Viewer UCSC Genome Browser (University of Calif., Santa Cruz) Ensembl Map View

35 Ensembl Ensembl

36 UCSC

37 NCBI NCBI

38

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

EWOLUCJA GENOMÓW. Bioinformatyka, wykład 6 (22.XI.2010) krzysztof_pawlowski@sggw.pl

EWOLUCJA GENOMÓW. Bioinformatyka, wykład 6 (22.XI.2010) krzysztof_pawlowski@sggw.pl EWOLUCJA GENOMÓW Bioinformatyka, wykład 6 (22.XI.2010) krzysztof_pawlowski@sggw.pl Wykład 6 spis treści genomika mapowanie genomów początki ewolucji świat RNA świat wirusów (?) ewolucja genomów GENOMIKA

Bardziej szczegółowo

MARKERY MOLEKULARNE dr Janusz Piechota dr Magdalena Wołoszyńska Plan wykładów:

MARKERY MOLEKULARNE dr Janusz Piechota dr Magdalena Wołoszyńska Plan wykładów: MARKERY MOLEKULARNE dr Janusz Piechota dr Magdalena Wołoszyńska Plan wykładów: Definicja słowa marker Markery związane z kwasami nukleinowymi rodzaje wykrywanie zastosowanie w diagnostyce medycznej, medycynie

Bardziej szczegółowo

Zmienność genomu. Przyczyny, skutki i sposoby kontroli

Zmienność genomu. Przyczyny, skutki i sposoby kontroli Zmienność genomu Przyczyny, skutki i sposoby kontroli Zmienność genomu Przez zmienność genomu (polimorfizm) rozumiemy różnice w sekwencji DNA genomowego pomiędzy osobnikami jednego gatunku. Wyróżniamy:

Bardziej szczegółowo

MARKERY MIKROSATELITARNE

MARKERY MIKROSATELITARNE MARKERY MIKROSATELITARNE Badania laboratoryjne prowadzone w Katedrze Genetyki i Ogólnej Hodowli Zwierząt SGGW w ramach monitoringu genetycznego wykorzystują analizę genetyczną markerów mikrosatelitarnych.

Bardziej szczegółowo

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego Wk Wykrywanie polimorfizmów i mutacji Badania przesiewowe mutacji Wykrywanie znanych mutacji punktowych dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

Organizacja genomu człowieka i sekwencjonowanie DNA

Organizacja genomu człowieka i sekwencjonowanie DNA Organizacja genomu człowieka i sekwencjonowanie DNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Organizacja genów na ludzkim chromosomie.

Bardziej szczegółowo

POSZUKIWANIE POLIMORFICZNYCH MARKERÓW ZDEFINIOWANYCH SEKWENCYJNIE W POPULACJI GROCHU CARNEVAL X MP1401

POSZUKIWANIE POLIMORFICZNYCH MARKERÓW ZDEFINIOWANYCH SEKWENCYJNIE W POPULACJI GROCHU CARNEVAL X MP1401 Fragm. Agron. 29(4) 2012, 87 94 POSZUKIWANIE POLIMORFICZNYCH MARKERÓW ZDEFINIOWANYCH SEKWENCYJNIE W POPULACJI GROCHU CARNEVAL X Michał Knopkiewicz, Magdalena Gawłowska, Wojciech Święcicki Instytut Genetyki

Bardziej szczegółowo

Dr hab. Beata Krawczyk Katedra Mikrobiologii, Politechnika Gdańska

Dr hab. Beata Krawczyk Katedra Mikrobiologii, Politechnika Gdańska Narzędzia diagnostyki molekularnej w typowaniu genetycznym (genotypowaniu) Dr hab. Beata Krawczyk Katedra Mikrobiologii, Politechnika Gdańska Publikacja współfinansowana ze środków Unii Europejskiej w

Bardziej szczegółowo

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Bioinformatyka Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl 1 Bazy danych biologicznych Bazy danych sekwencji nukleotydowych Pierwotne bazy danych (ang. primary database) Wykorzystywane do zbierania

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

Podstawy genetyki. Genetyka klasyczna, narzędzia badawcze genetyki

Podstawy genetyki. Genetyka klasyczna, narzędzia badawcze genetyki Podstawy genetyki Genetyka klasyczna, narzędzia badawcze genetyki Podręczniki } Podstawy biologii molekularnej L.A. Allison } Genomy TA Brown, wyd. 3 } Genetyka molekularna P Węgleński (red.), wyd. 2 2

Bardziej szczegółowo

Perspektywy zastosowania badań genomicznych w hodowli zwierząt

Perspektywy zastosowania badań genomicznych w hodowli zwierząt Wiadomości Zootechniczne, R. XLIX (2011), 4: 103 108 Perspektywy zastosowania badań genomicznych w hodowli zwierząt W prowadzenie Wobec stałego wzrostu zaludnienia, rolnictwo odgrywa kluczową rolę w globalnym

Bardziej szczegółowo

2016-01-14. Sekwencje mikrosatelitarne. SNP Single Nucleotide Polymorphism (mutacje punktowe, polimorfizm jednonukleotydowy)

2016-01-14. Sekwencje mikrosatelitarne. SNP Single Nucleotide Polymorphism (mutacje punktowe, polimorfizm jednonukleotydowy) Sekwencje mikrosatelitarne Próba nr 1 GGGGGGGGGGGG 4x GG Próba nr 2 GGGGGGGGGGGGGGGG 6x GG Próba nr 1 GGGGGGGGG Próba nr 2 GGG GGGG SNP Single Nucleotide Polymorphism (mutacje punktowe, polimorfizm jednonukleotydowy)

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym mgr Magdalena Brzeskwiniewicz Promotor: Prof. dr hab. n. med. Janusz Limon Katedra i Zakład Biologii i Genetyki Gdański Uniwersytet Medyczny

Bardziej szczegółowo

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie Sekwencyjność występowania zaburzeń molekularnych w niedrobnokomórkowym raku płuca

Bardziej szczegółowo

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP ARCH. MED. SĄD. KRYMINOL., 2010, LX, 243-247 PRACE ORYGINALNE / ORIGINALS Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski Analiza danych populacyjnych loci ministr: D10S1248,

Bardziej szczegółowo

LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA

LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA ANNALES ACADEMIAE MEDICAE STETINENSIS ROCZNIKI POMORSKIEJ AKADEMII MEDYCZNEJ W SZCZECINIE 2007, 53, SUPPL. 2, 170174 LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA Badanie

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

Historia Bioinformatyki

Historia Bioinformatyki Historia Bioinformatyki 1859 Darwin i Wallace opublikowali O powstaniu gatunku 1865 Mendel eksperymentując z grochem, wykazuje, że cechy dziedziczą się w odrębnych jednostkach 1869 Meischer wyizolował

Bardziej szczegółowo

EVALUATION OF (CA)n DINUCLEOTIDE MARKERS IN PATERNITY ANALYSIS

EVALUATION OF (CA)n DINUCLEOTIDE MARKERS IN PATERNITY ANALYSIS EVALUATION OF (CA)n DINUCLEOTIDE MARKERS IN PATERNITY ANALYSIS Anitha A., Moinak BANERJEE Rajiv Gandhi Centre for Biotechnology, Jagathy, Kerala, India ABSTRACT: Developing robust molecular markers for

Bardziej szczegółowo

2014-03-26. Analiza sekwencji promotorów

2014-03-26. Analiza sekwencji promotorów 2014-03-26 Analiza sekwencji promotorów 1 2014-03-26 TFy tworzą zawiły układ regulacyjny, na który składają się różne oddziaływania białko białko poprzez wytworzenie PĘTLI Specyficzne TFy Ogólne TFy Benfey,

Bardziej szczegółowo

Rewolucja genomowa. Wojciech Makałowski Institute of Bioinformatics University of Muenster. w medycynie

Rewolucja genomowa. Wojciech Makałowski Institute of Bioinformatics University of Muenster. w medycynie Rewolucja genomowa Wojciech Makałowski Institute of Bioinformatics University of Muenster w medycynie 60 lat genomiki Kto nastepny? Rekombinacja DNA Metody szybkiego sekwencjonowania DNA PC R Automaty

Bardziej szczegółowo

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS Nowiny Lekarskie 2006, 75, 5, 486 490 ALINA LICZBAŃSKA, ANNA WOŹNIAK, ANNA WAWROCKA, MACIEJ R. KRAWCZYŃSKI TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR

Bardziej szczegółowo

Emilia Wójtowicz. Markery molekularne i ich wykorzystanie w hodowli roślin

Emilia Wójtowicz. Markery molekularne i ich wykorzystanie w hodowli roślin Emilia Wójtowicz Markery molekularne i ich wykorzystanie w hodowli roślin W pracach genetyczno hodowlanych wykorzystuje się różne typy markerów (wyznaczników), pozwalających na szybką identyfikacje genotypów,

Bardziej szczegółowo

Techniki biologii molekularnej przydatne w diagnostyce onkologicznej. Prof. Barbara Pieńkowska-Grela

Techniki biologii molekularnej przydatne w diagnostyce onkologicznej. Prof. Barbara Pieńkowska-Grela Techniki biologii molekularnej przydatne w diagnostyce onkologicznej Prof. Barbara Pieńkowska-Grela Warszawa, 9 czerwca 2015 Badanie genetyczne w nowotworach polega na stwierdzeniu obecności i określeniu

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Zastosowanie Y-SNPs w genetyce sądowej Application of Y-SNPs in forensic genetics

Zastosowanie Y-SNPs w genetyce sądowej Application of Y-SNPs in forensic genetics ARCH. MED. SĄD. KRYMINOL., 2011, LXI, 161-169 PRACE ORYGINALNE / ORIGINAL PAPERS Monica Abreu-Głowacka¹, Małgorzata Koralewska-Kordel¹, Eliza Michalak¹, Czesław Żaba¹, Zygmunt Przybylski² Zastosowanie

Bardziej szczegółowo

Plan wykładu: Budowa chromatyny - nukleosomy. Wpływ nukleosomów na replikację i transkrypcję

Plan wykładu: Budowa chromatyny - nukleosomy. Wpływ nukleosomów na replikację i transkrypcję Nukleosomy 1 Plan wykładu: Budowa chromatyny - nukleosomy Wpływ nukleosomów na replikację i transkrypcję Metody pozwalające na wyznaczanie miejsc wiązania nukleosomów Charakterystyka obsadzenia nukleosomów

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10.

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10. Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016 Ćwiczenie nr 1 (06-07.10.2015) Temat: Wprowadzenie 1. Omówienie regulaminu zajęć Temat: Wprowadzenie

Bardziej szczegółowo

SEQUENCING ANALYSIS OF A NEW ALLELE, D8S1132*15

SEQUENCING ANALYSIS OF A NEW ALLELE, D8S1132*15 SEQUENCING ANALYSIS OF A NEW ALLELE, D8S1132*15 Grzegorz JEZIERSKI 1, Ryszard PAW OWSKI 1, 2 1 Department of Forensic Medicine, Medical University, Gdañsk 2 Institute of Forensic Research, Cracow ABSTRACT:

Bardziej szczegółowo

II WYDZIAŁ LEKARSKI, II ROK

II WYDZIAŁ LEKARSKI, II ROK II WYDZIAŁ LEKARSKI, II ROK PRZEDMIOT: BIOLOGIA MEDYCZNA (CZĘŚĆ 1 GENETYKA) PROGRAM ĆWICZEŃ 2009/2010 L.p. Data zajęć Temat zajęć 1. 15.02 18.02 Podstawy genetyki klasycznej (podstawowe pojęcia i definicje

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937 (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.0 (13) (51) T3 Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

GENETYKA POPULACYJNA LOCUS D19S433 W REGIONIE POLSKI PÓŁNOCNEJ POPULATION GENETICS OF THE D19S433 LOCUS IN THE NORTHERN POLAND

GENETYKA POPULACYJNA LOCUS D19S433 W REGIONIE POLSKI PÓŁNOCNEJ POPULATION GENETICS OF THE D19S433 LOCUS IN THE NORTHERN POLAND Ann. Acad. Med. Gedan., 2005, 35, 181 185 JOANNA WYSOCKA, EWA KAPIŃSKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA, LIDIA CYBULSKA GENETYKA POPULACYJNA LOCUS D19S433 W REGIONIE POLSKI PÓŁNOCNEJ POPULATION GENETICS

Bardziej szczegółowo

w oparciu o markery genetyczne klasy I i II

w oparciu o markery genetyczne klasy I i II Wiadomości Zootechniczne, R. L (2012), 2: 13 20 Kontrola wiarygodności rodowodów owiec Kontrola wiarygodności rodowodów owiec w oparciu o markery genetyczne klasy I i II Anna Radko, Tadeusz Rychlik, Dominika

Bardziej szczegółowo

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Praca wykonana pod kierunkiem dr hab. Tomasza Grzybowskiego w Katedrze Medycyny Sądowej w Zakładzie Genetyki Molekularnej

Bardziej szczegółowo

GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ

GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ ZMIENNOŚĆ - występowanie dziedzicznych i niedziedzicznych różnic między osobnikami należącymi do tej samej

Bardziej szczegółowo

ANNALES UNIVERSITATIS MARIAE CURIE-SKŁ ODOWSKA LUBLIN POLONIA

ANNALES UNIVERSITATIS MARIAE CURIE-SKŁ ODOWSKA LUBLIN POLONIA ANNALES UNIVERSITATIS MARIAE CURIE-SKŁ ODOWSKA LUBLIN POLONIA VOL. LXIII (3) SECTIO DD 2008 Katedra Hodowli Amatorskich i Zwierząt Dzikich Uniwersytetu Przyrodniczego w Lublinie 20-950 Lublin, ul. Akademicka

Bardziej szczegółowo

Od jakiego pułapu startujemy? matematyka

Od jakiego pułapu startujemy? matematyka dla biotechnologów Wykład 2 Definicja bioinformatyki Od jakiego pułapu startujemy? Zakładamy, że te pojęcia są w małym palcu: DNA, RNA struktura, funkcje, rodzaje Genom Białka struktury, funkcje, rodzaje,

Bardziej szczegółowo

Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe

Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe Marcin Kruszewski Centrum Radiobiologii i Dozymetrii Biologicznej Instytut Chemii

Bardziej szczegółowo

Częstość występowania chorób genetycznych (cech) różni się między grupami etnicznymi. Mukowiscydoza pojawia się 1/2000 urodzin u Amerykanów, których

Częstość występowania chorób genetycznych (cech) różni się między grupami etnicznymi. Mukowiscydoza pojawia się 1/2000 urodzin u Amerykanów, których genetyka człowieka choroby genetyczne człowieka: * jednogenowe * wielogenowe * spowodowane aberracjami chromosomowymi * mitochondrialne * spowodowane zaburzeniami piętnowania genów (zespół Pradera-Williego

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

Stowarzyszenie na Rzecz Dzieci z Zaburzeniami Genetycznymi Badania molekularne

Stowarzyszenie na Rzecz Dzieci z Zaburzeniami Genetycznymi Badania molekularne http://www.genetyka-ginekolog.pl/ Techniki molekularne z przykładami Jedną z podstawowych technik wykorzystywanych w genetyce molekularnej jest RFLP (ang. restriction fragments length polymorphism, czyli

Bardziej szczegółowo

SYSTEMY INFORMATYCZNE WSPOMAGAJĄCE HODOWLĘ MAGDALENA FRĄSZCZAK

SYSTEMY INFORMATYCZNE WSPOMAGAJĄCE HODOWLĘ MAGDALENA FRĄSZCZAK SYSTEMY INFORMATYCZNE WSPOMAGAJĄCE HODOWLĘ Prowadzący: JOANNA SZYDA MAGDALENA FRĄSZCZAK WSTĘP 1. Systemy informatyczne w hodowli -??? 2. Katedra Genetyki 3. Pracownia biostatystyki - wykorzystanie narzędzi

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3

Spis treści. Księgarnia PWN: Terry A. Brown - Genomy. Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy 3 Księgarnia PWN: Terry A. Brown - Genomy Przedmowa Przedmowa do drugiego wydania polskiego Wstęp Spis rozdziałów Skróty V VI VII XI XIX Część 1 Jak bada się genomy 1 Rozdział 1 Genomy, transkryptomy i proteomy

Bardziej szczegółowo

Analiza DNA w diagnostyce dystrofii mięśniowej Duchenne'a-Beckera

Analiza DNA w diagnostyce dystrofii mięśniowej Duchenne'a-Beckera Postępy Psychiatrii i Neurologii, 1997, 6, 43-48 Analiza DNA w diagnostyce dystrofii mięśniowej Duchenne'a-Beckera DNA analysis in diagnostics ofthe Duchenne-Becker muscular dystrophy JANUSZ ZIMOWSKI Z

Bardziej szczegółowo

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie

Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3. Kierunek: Inżynieria Biomedyczna Specjalność: Bionanotechnologie Nazwa modułu: Genetyka molekularna Rok akademicki: 2014/2015 Kod: EIB-2-206-BN-s Punkty ECTS: 3 Wydział: Elektrotechniki, Automatyki, Informatyki i Inżynierii Biomedycznej Kierunek: Inżynieria Biomedyczna

Bardziej szczegółowo

Zmienność populacji człowieka. Polimorfizmy i asocjacje

Zmienność populacji człowieka. Polimorfizmy i asocjacje Zmienność populacji człowieka Polimorfizmy i asocjacje Prezentacja } http://wiki.biol.uw.edu.pl/ 2 MONOGENOWE CZYNNIKI GENETYCZNE DZIEDZICZENIE MENDLOWSKIE NIEPEŁNA PENETRACJA GENU DZIEDZICZENIE WIELOCZYNNIKOWE

Bardziej szczegółowo

Poradnie i Pracownie - Zakład Genetyki Medycznej przy IMiDz w Warszawie

Poradnie i Pracownie - Zakład Genetyki Medycznej przy IMiDz w Warszawie Poradnie i Pracownie - Zakład Genetyki Medycznej przy IMiDz w Warszawie Poradnia Genetyczna Kierownik Poradni Genetycznej dr n. med. Ewa Obersztyn Poradnia prowadzi działalność specjalistyczną w zakresie

Bardziej szczegółowo

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014

Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Wymagania edukacyjne z przedmiotu Biologia. Podręcznik Biologia na czasie wyd. Nowa Era, zakres podstawowy Rok szkolny 2013/2014 Dział programu I. Od genu do cechy Lp. Temat Poziom wymagań dopuszczający

Bardziej szczegółowo

Sekwencjonowanie porównawcze genomów: generowanie markerów genetycznych typu INDEL i SNP

Sekwencjonowanie porównawcze genomów: generowanie markerów genetycznych typu INDEL i SNP PRACE PRZEGL DOWE Sekwencjonowanie porównawcze genomów: generowanie markerów genetycznych typu INDEL i SNP Piotr A. Zió³kowski 1, Danuta Babula-Skowroñska 2, Ma³gorzata Kaczmarek 2, Agata Cieœla 2, Jan

Bardziej szczegółowo

Badanie predyspozycji do łysienia androgenowego u kobiet (AGA)

Badanie predyspozycji do łysienia androgenowego u kobiet (AGA) Badanie predyspozycji do łysienia androgenowego u kobiet (AGA) RAPORT GENETYCZNY Wyniki testu dla Pacjent Testowy Pacjent Pacjent Testowy ID pacjenta 0999900004112 Imię i nazwisko pacjenta Pacjent Testowy

Bardziej szczegółowo

Spokrewnienie prawdopodobieństwo, że dwa losowe geny od dwóch osobników są genami IBD. IBD = identical by descent, geny identycznego pochodzenia

Spokrewnienie prawdopodobieństwo, że dwa losowe geny od dwóch osobników są genami IBD. IBD = identical by descent, geny identycznego pochodzenia prawdopodobieństwo, że dwa losowe geny od dwóch osobników są genami ID. Relationship Relatedness Kinship Fraternity ID = identical by descent, geny identycznego pochodzenia jest miarą względną. Przyjmuje

Bardziej szczegółowo

Podstawy genetyki człowieka. Cechy wieloczynnikowe

Podstawy genetyki człowieka. Cechy wieloczynnikowe Podstawy genetyki człowieka Cechy wieloczynnikowe Dziedziczenie Mendlowskie - jeden gen = jedna cecha np. allele jednego genu decydują o barwie kwiatów groszku Bardziej złożone - interakcje kilku genów

Bardziej szczegółowo

Rozprawa doktorska. mgr inż. Karolina Stojowska

Rozprawa doktorska. mgr inż. Karolina Stojowska Politechnika Gdańska Wydział Chemiczny Katedra Mikrobiologii Rozprawa doktorska Opracowanie nowych metod typowania genetycznego bakterii opartych o ligację adaptorów oligonukleotydowych do fragmentów restrykcyjnych

Bardziej szczegółowo

Badania Technologie Innowacje 2005-2009. NZOZ BioTe21. Wiarygodność i certyfikaty. ul. Gronostajowa 7, 30-387 Kraków

Badania Technologie Innowacje 2005-2009. NZOZ BioTe21. Wiarygodność i certyfikaty. ul. Gronostajowa 7, 30-387 Kraków Badania Technologie Innowacje 2005-2009 Wiarygodność i certyfikaty. ul. Gronostajowa 7, 30-387 Kraków SZANOWNI PAŃSTWO! Laboratorium firmy BioTe21 powstało w wyniku realizacji projektu współfinansowanego

Bardziej szczegółowo

Wymagania edukacyjne Biologia na czasie zakres podstawowy

Wymagania edukacyjne Biologia na czasie zakres podstawowy Wymagania edukacyjne Biologia na czasie zakres podstawowy Dział programu Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) I. Od genu do cechy Budowa i funkcje kwasów

Bardziej szczegółowo

Diagnostyka neurofibromatozy typu I,

Diagnostyka neurofibromatozy typu I, Diagnostyka neurofibromatozy typu I, czyli jak to się robi w XXI wieku dr n. biol. Robert Szymańczak Laboratorium NZOZ GENOMED GENOMED S.A. Neurofibromatoza typu I (choroba von Recklinghausena) częstość

Bardziej szczegółowo

XCII LO Z ODDZIAŁAMI INTEGRACYJNYMI I SPORTOWYMI ROZKŁAD MATERIAŁU Z BIOLOGII. Zapis w nowej podstawie programowej

XCII LO Z ODDZIAŁAMI INTEGRACYJNYMI I SPORTOWYMI ROZKŁAD MATERIAŁU Z BIOLOGII. Zapis w nowej podstawie programowej XCII LO Z ODDZIAŁAMI INTEGRACYJNYMI I SPORTOWYMI ROZKŁAD MATERIAŁU Z BIOLOGII Dział programu I. Od genu do cechy Treści nauczania 1. Budowa i funkcje kwasów nukleinowych DNA jako materiał genetyczny budowa

Bardziej szczegółowo

Trzy wielkie działy genetyki:

Trzy wielkie działy genetyki: Trzy wielkie działy genetyki: GENETYKA GENETYKA GENETYKA KLASYCZNA MOLEKULARNA EWOLUCYJNA (Mendel 1866) (Watson & Crick 1953) (Darwin-Wallace 1858) Darwin, C. R. and A. R. Wallace. 1858. On the tendency

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Wykład 5 Droga od genu do

Bardziej szczegółowo

Algorytm Genetyczny. zastosowanie do procesów rozmieszczenia stacji raportujących w sieciach komórkowych

Algorytm Genetyczny. zastosowanie do procesów rozmieszczenia stacji raportujących w sieciach komórkowych Algorytm Genetyczny zastosowanie do procesów rozmieszczenia stacji raportujących w sieciach komórkowych Dlaczego Algorytmy Inspirowane Naturą? Rozwój nowych technologii: złożone problemy obliczeniowe w

Bardziej szczegółowo

Badania cytogenetyczne w ocenie płodności kobiet

Badania cytogenetyczne w ocenie płodności kobiet Badania cytogenetyczne w ocenie Według WHO za niepłodność uważa się niemożność poczęcia po roku regularnego współżycia seksualnego, bez stosowania antykoncepcji [1]. Około 10-15% ciąż rozpoznanych klinicznie

Bardziej szczegółowo

DNA musi współdziałać z białkami!

DNA musi współdziałać z białkami! DNA musi współdziałać z białkami! Specyficzność oddziaływań między DNA a białkami wiążącymi DNA zależy od: zmian konformacyjnych wzdłuż cząsteczki DNA zróżnicowania struktury DNA wynikającego z sekwencji

Bardziej szczegółowo

Zobaczyć gen, chromosom i genom czyli badania cytogenetyki molekularnej

Zobaczyć gen, chromosom i genom czyli badania cytogenetyki molekularnej NAUKA 4/2007 107-115 JOLANTA MAŁUSZYŃSKA Zobaczyć gen, chromosom i genom czyli badania cytogenetyki molekularnej Cytogenetyka Cytogentyka jest to nauka o chromosomach. Przedmiotem badań klasycznej cytogenetyki

Bardziej szczegółowo

Podstawy genetyki. ESPZiWP 2010

Podstawy genetyki. ESPZiWP 2010 Podstawy genetyki ESPZiWP 2010 Genetyka - nauka o dziedziczności i zmienności organizmów, wyjaśniająca prawa rządzące podobieństwami i różnicami pomiędzy osobnikami spokrewnionymi przez wspólnego przodka

Bardziej szczegółowo

Warunki udzielania świadczeń w rodzaju: świadczenia zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE

Warunki udzielania świadczeń w rodzaju: świadczenia zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE Załącznik nr do Zarządzenia.. Warunki udzielania świadczeń w rodzaju: zdrowotne kontraktowane odrębnie 8. BADANIA GENETYCZNE 8.1 WARUNKI WYMAGANE Załącznik nr 2 do rozporządzenia cz. I lit. M Lp 913-916

Bardziej szczegółowo

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków.

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Katarzyna Mazur-Kominek Współautorzy Tomasz Romanowski, Krzysztof P. Bielawski, Bogumiła Kiełbratowska, Magdalena Słomińska-

Bardziej szczegółowo

Bioinformatyka. Wykład 2 (12.X.2010) I r. studiów magisterskich, biologia (SGGW) Krzysztof Pawłowski

Bioinformatyka. Wykład 2 (12.X.2010) I r. studiów magisterskich, biologia (SGGW) Krzysztof Pawłowski Bioinformatyka Wykład 2 (12.X.2010) I r. studiów magisterskich, biologia (SGGW) Krzysztof Pawłowski tydzień temu Co to jest bioinformatyka Sekwencjonowanie genomów historia Metagenomika Wykład 2 spis treści

Bardziej szczegółowo

Diagnostyka molekularna w OIT

Diagnostyka molekularna w OIT Diagnostyka molekularna w OIT B A R B A R A A D A M I K K A T E D R A I K L I N I K A A N E S T E Z J O L O G I I I I N T E N S Y W N E J T E R A P I I U N I W E R S Y T E T M E D Y C Z N Y W E W R O C

Bardziej szczegółowo

ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ

ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ ETYCZNE ASPEKTY INŻYNIERII GENETYCZNEJ Paweł Bortkiewicz UAM bortpa@amu.edu.pl INŻYNIERIA GENETYCZNA (REKOMBINACJA DNA IN VITRO) zespół technik pozwalających na zamierzone, kontrolowane, przewidziane przez

Bardziej szczegółowo

GENOMIKA PROTEOMIKA METABOLOMIKA

GENOMIKA PROTEOMIKA METABOLOMIKA GENOMIKA PROTEOMIKA METABOLOMIKA TRANSKRYPTOMIKA Metody sztucznej rekombinacji DNA nie tylko umożliwiły powstanie nowych niezwykle użytecznych narzędzi do badania podstawowych mechanizmów funkcjonowania

Bardziej szczegółowo

Rocz. Nauk. Zoot., T. 37, z. 2 (2010) 145 149. Identyfikacja sekwencji genu kodującego dehydrogenazę NADH 1 u sarny

Rocz. Nauk. Zoot., T. 37, z. 2 (2010) 145 149. Identyfikacja sekwencji genu kodującego dehydrogenazę NADH 1 u sarny Rocz. Nauk. Zoot., T. 37, z. 2 (2010) 145 149 Identyfikacja sekwencji genu kodującego dehydrogenazę NADH 1 u sarny M a ł g o r z a t a N a t o n e k - W i ś n i e w s k a, E w a S ł o t a Instytut Zootechniki

Bardziej szczegółowo

Wykorzystanie metody MSSCP do analizy markerów genetycznych raka płuc w ramach projektu FP7: CURELUNG

Wykorzystanie metody MSSCP do analizy markerów genetycznych raka płuc w ramach projektu FP7: CURELUNG Wykorzystanie metody MSSCP do analizy markerów genetycznych raka płuc w ramach projektu FP7: CURELUNG Krzysztof Kucharczyk,dr Prezes Zarządu Spółki H2020 Info Day, Warszawa, 11.12.2013 Prezentacja Firma:

Bardziej szczegółowo

Zapis w nowej podstawie programowej. Proponowane procedury osiągania celów. Proponowane środki dydaktyczne. Dział programu.

Zapis w nowej podstawie programowej. Proponowane procedury osiągania celów. Proponowane środki dydaktyczne. Dział programu. Rozkład materiału Dział programu I. Od genu do cechy Treści nauczania 1. Budowa i funkcje kwasów nukleinowych DNA jako materiał genetyczny budowa DNA rodzaje zasad azotowych komplementarność zasad azotowych

Bardziej szczegółowo

Analiza danych pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego. - część I -

Analiza danych pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego. - część I - pochodzących z sekwencjonowania nowej generacji - przyrównanie do genomu referencyjnego - część I - Katedra Genetyki Uniwersytet Przyrodniczy we Wrocławiu Plan wykładów --------------------------------------------------------

Bardziej szczegółowo

Techniki biochemiczne i molekularne w ekologii

Techniki biochemiczne i molekularne w ekologii Techniki biochemiczne i molekularne w ekologii Część slajdów jest autorstwa prof. Mirosława Ratkiewicza z Uniwersytetu w Białymstoku któremu składam SERDECZNE PODZIĘKOWANIA za pozwolenie na wykorzystanie

Bardziej szczegółowo

Sesja sponsorowana przez Olympus Optical Polska SESJA 8 DIAGNOSTYKA GENETYCZNA. TERAPIA GENOWA WYKŁADY

Sesja sponsorowana przez Olympus Optical Polska SESJA 8 DIAGNOSTYKA GENETYCZNA. TERAPIA GENOWA WYKŁADY Sesja sponsorowana przez Olympus Optical Polska SESJA 8 DIAGNOSTYKA GENETYCZNA. TERAPIA GENOWA WYKŁADY 180 SESJA 8 WYKŁADY W08-01 DIAGNOSTYKA MOLEKULARNA-METODY WYKRYWANIA MUTACJI W GENACH Włodzimierz

Bardziej szczegółowo

BioTe21, Pracownia Kryminalistyki i Badań Ojcostwa.

BioTe21, Pracownia Kryminalistyki i Badań Ojcostwa. Bio Kraków, dnia... EKSPERTYZA Z BADAŃ GENETYCZNYCH POKREWIEŃSTWA Nr ekspertyzy:... Badania wykonano w: Bio, Ojcostwa. Na zlecenie:... Typ wybranego testu: TIG3-16 Zlecenie z dnia:... Data otrzymania mat.

Bardziej szczegółowo

Genetyka człowieka II. Cechy wieloczynnikowe, polimorfizmy i asocjacje

Genetyka człowieka II. Cechy wieloczynnikowe, polimorfizmy i asocjacje Genetyka człowieka II Cechy wieloczynnikowe, polimorfizmy i asocjacje MONOGENOWE CZYNNIKI GENETYCZNE DZIEDZICZENIE MENDLOWSKIE NIEPEŁNA PENETRACJA GENU DZIEDZICZENIE WIELOCZYNNIKOWE Z DOMINACJĄ POJEDYNCZEGO

Bardziej szczegółowo

Przydatność markerów SNP do analiz materiału biologicznego o wysokim stopniu degradacji 1

Przydatność markerów SNP do analiz materiału biologicznego o wysokim stopniu degradacji 1 ARCH. MED. SĄD. KRYM., 2009, LIX, 118-123 PRACE ORYGINALNE Katarzyna Bąbol-Pokora, Adam Prośniak, Renata Jacewicz, Jarosław Berent Przydatność markerów SNP do analiz materiału biologicznego o wysokim stopniu

Bardziej szczegółowo

Podstawy genetyki SYLABUS A. Informacje ogólne

Podstawy genetyki SYLABUS A. Informacje ogólne Podstawy genetyki A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Język Rodzaj Rok studiów /semestr Wymagania

Bardziej szczegółowo

Przeglądarki genomowe

Przeglądarki genomowe Przeglądarki genomowe Popularne typy danych w nowoczesnych naukach biologicznych obejmują: sekwencje genomu sekwencje transkryptomu sekwencje proteomu epigenom adnotacje: geny, eksony, introny, izoformy,

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ Choroby genetyczne o złożonym

Bardziej szczegółowo

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt

ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI. Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt ZARZĄDZANIE POPULACJAMI ZWIERZĄT 1. RÓWNOWAGA GENETYCZNA POPULACJI Fot. W. Wołkow Prowadzący: dr Wioleta Drobik Katedra Genetyki i Ogólnej Hodowli Zwierząt POPULACJA Zbiór organizmów żywych, które łączy

Bardziej szczegółowo

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna:

Ćwiczenia 1 Wirtualne Klonowanie Prowadzący: mgr inż. Joanna Tymeck-Mulik i mgr Lidia Gaffke. Część teoretyczna: Uniwersytet Gdański, Wydział Biologii Katedra Biologii Molekularnej Przedmiot: Biologia Molekularna z Biotechnologią Biologia II rok ===============================================================================================

Bardziej szczegółowo

Maria Szczepaniec Badania genetyczne DNA na użytek procesu karnego. Zeszyty Prawnicze 13/1, 171-184

Maria Szczepaniec Badania genetyczne DNA na użytek procesu karnego. Zeszyty Prawnicze 13/1, 171-184 Maria Szczepaniec Badania genetyczne DNA na użytek procesu karnego Zeszyty Prawnicze 13/1, 171-184 2013 Zeszyty Prawnicze 13.1 / 2013 Maria Szczepaniec Uniwersytet Kardynała Stefana Wyszyńskiego BADANIA

Bardziej szczegółowo

Recenzja pracy doktorskiej Mgr Natalii Sawki. gatunków zespołu Paramecium aurelia

Recenzja pracy doktorskiej Mgr Natalii Sawki. gatunków zespołu Paramecium aurelia NENCKI INSTITUTE OF EXPERIMENTAL BIOLOGY POLISH ACADEMY OF SCIENCES 3, Pasteur Str, 02-093 Warsaw, Poland Phone: (48-22) 5892357; Fax: (48-22) 822 53 42 Recenzja pracy doktorskiej Mgr Natalii Sawki pt.

Bardziej szczegółowo

PROGRAM NAUCZANIA PRZEDMIOTU FAKULTATYWNEGO NA WYDZIALE LEKARSKIM I ROK AKADEMICKI 2015/2016 PRZEWODNIK DYDAKTYCZNY

PROGRAM NAUCZANIA PRZEDMIOTU FAKULTATYWNEGO NA WYDZIALE LEKARSKIM I ROK AKADEMICKI 2015/2016 PRZEWODNIK DYDAKTYCZNY PROGRAM NAUCZANIA PRZEDMIOTU FAKULTATYWNEGO NA WYDZIALE LEKARSKIM I ROK AKADEMICKI 2015/2016 PRZEWODNIK DYDAKTYCZNY 1. NAZWA PRZEDMIOTU : Zbadaj się sam, czyli predyspozycje genetyczne do częstych chorób

Bardziej szczegółowo

Dryf genetyczny i jego wpływ na rozkłady próbek z populacji - modele matematyczne. Adam Bobrowski, IM PAN Katowice

Dryf genetyczny i jego wpływ na rozkłady próbek z populacji - modele matematyczne. Adam Bobrowski, IM PAN Katowice Dryf genetyczny i jego wpływ na rozkłady próbek z populacji - modele matematyczne Adam Bobrowski, IM PAN Katowice 1 Tematyka cyklu referatów Dryf genetyczny Matematyczne modele równowagi między mutacja

Bardziej szczegółowo

Polimorfizm genetyczny wybranych alleli cytochromu CYP2D6 u pacjentów z kardiomiopatią rozstrzeniową i zapaleniem mięśnia sercowego* 1

Polimorfizm genetyczny wybranych alleli cytochromu CYP2D6 u pacjentów z kardiomiopatią rozstrzeniową i zapaleniem mięśnia sercowego* 1 PRACA ORYGINALNA Polimorfizm genetyczny wybranych alleli cytochromu CYP2D6 u pacjentów z kardiomiopatią rozstrzeniową i zapaleniem mięśnia sercowego* 1 Genetical polymporphism of chosen CYP2D6 alleles

Bardziej szczegółowo

WYMAGANIA EDUKACYJNE- Biologia w medycynie

WYMAGANIA EDUKACYJNE- Biologia w medycynie WYMAGANIA EDUKACYJNE- Biologia w medycynie Dział programu Lp. Temat Poziom wymagań konieczny (K) podstawowy (P) rozszerzający (R) dopełniający (D) dopuszczający K dostateczny P+K dobry P+K+R bardzo dobry

Bardziej szczegółowo