GENOMIKA. MAPOWANIE GENOMÓW MAPY GENOMICZNE

Wielkość: px
Rozpocząć pokaz od strony:

Download "GENOMIKA. MAPOWANIE GENOMÓW MAPY GENOMICZNE"

Transkrypt

1 GENOMIKA. MAPOWANIE GENOMÓW MAPY GENOMICZNE Bioinformatyka, wykład 3 (21.X.2008)

2 tydzień temu Gen??? Biologiczne bazy danych historia Biologiczne bazy danych najważniejsze

3 Wykład 3 spis treści Genomika Mapy genomowe Markery genetyczne, mapy genetyczne Mapowanie fizyczne Bazy danych map genomowych

4 GENOMIKA badanie struktury i funkcjonowania genomów GENOMIKA GENOMIKA STRUKTURALNA GENOMIKA PORÓWNAWCZA GENOMIKA FUNKCJONALNA MAPOWANIE GENOMU: Mapy genetyczne Mapy fizyczne SEKWENCJONOWANIE Ewolucja genomów Ewolucja genów Structural genomics Comparative genomics Functional genomics Transkryptom Regulacja tranckrypcji Proteom

5 GENOMIKA badanie struktury i funkcjonowania genomów GENOMIKA STRUKTURALNA MAPOWANIE GENOMU: Mapy II genetyczne znaczenie: Mapy =proteomika fizyczne strukturalna SEKWENCJONOWANIE GENOMIKA GENOMIKA PORÓWNAWCZA Ewolucja genomów Ewolucja genów Structural genomics Comparative genomics Functional genomics Biologia molekularna & bioinformatyka GENOMIKA FUNKCJONALNA Transkryptom Regulacja tranckrypcji Proteom

6 Zmienność genomu ludzkiego Nature, sites of structural variation (> 6kbp) 4 million SNPs small indels (< 100 bp)

7 Zmienność genomu ludzkiego

8 PubMed stats [Oct 2008] Genomics[MAJR] 12,606 Bioinformatics[MAJR] 8,257 Genomics 43,415 Bioinformatics 34,610 Bioinformatics (Google) 12,200,000 Genomics (Google) 12,100,000

9 Mapa genomu graficzna prezentacja położenia markerów/genów na chromosomie MAPY GENETYCZNE MAPY FIZYCZNE cm bp

10 Mapy genomowe MAPY GENETYCZNE powstają w oparciu o analizę częstości rekombinacji między badanymi markerami pokazują rozmieszczenie markerów na chromosomie oraz odległości genetyczne między nimi jednostka: 1cM = 1% rekombinacji (1 crossing over na 100 mejoz) u ludzi to ok.0,7 1 Mb MAPY FIZYCZNE powstają poprzez bezpośrednią lokalizację, technikami biologii molekularnej, badanej sekwencji DNA w genomie jednostka: pary zasad pz (ang. bp, kbp)

11 Mapy genetyczne Rekombinacje Jeżeli markery A i B są na tym samym chromosomie, częstość rekombinacji jest > 0 i < 0.5 Jeżeli markery A i B są na różnych chromosomach, częstość rekombinacji jest = 0.5.

12 Częstość rekombinacji (θ) Ten sam chromosom Różne chromosomy Częstość CROSSING-OVER Bardzo blisko Blisko Daleko Rzadko Kilka Często Często Sprzężenie TAK TAK NIE NIE θ 0% 1-4% 50% 50% From: TISSUE ENGINEERING & HUMAN GENETICS LABORATORY

13 Marker genetyczny polimorficzna sekwencja DNA (specyficzna) z jednego miejsca na chromosomie, używana do mapowania genetycznego, może być związana z fenotypem. Jest to podstawowe narzędzie genetyka Marker genetyczny klasa I (markery fenotypowe) są to geny kodujące cechy jakościowe organizmu np. antygeny erytrocytarne, antygeny głównego układu zgodności tkankowej (Major Histocompatibility Complex - MHC). markery tej klasy indentyfikowane są metodami serologicznymi lub metodami elektroforetycznymi. klasa II (markery DNA) są to sekwencje DNA, niekoniecznie kodujące, np. RFLP, SSLP, SNP markery takie jako markery genetycze muszą mieć przynajmniej dwie alleliczne formy. markery tego typu identyfikowane są przy użyciu technik analizy molekularnej.

14 Markery DNA RFLPs (Restriction Fragment Lenght Polymorphisms) Minisatelity Mikrosatelity SNPs (Single Nucleotide Polymorphisms)

15 Markery genetyczne cd. RFLPs (Restriction Fragment Lenght Polymorphisms) -- polimorfizm długości fragmentów restrykcyjnych Miejsce cięcia enzymu restrykcyjnego HindIII.

16 Markery RFLP: Restriction Fragment Length Polymorphism Żel

17 Markery genetyczne cd. Wady markerów RFLP: - tylko dwie formy alleliczne - dużo miejsc cięcia w dużych genomach

18 Markery genetyczne cd. SSLPs (Simple Sequence Length Polymorphisms) polimorfizm długości prostych sekwencji -minisatelity -mikrosatelity

19 Minisatelitarny DNA VNTRs (Variable Number of Tandem Repeats) zmienna liczba powtórzeń tandemowych sekwencje zawierające zmienną liczbę tandemowych powtórzeń motywu (11 60 pz) z reguły występują przy końcach chromosomów - telomerach liczba powtórzeń motywu: 2 do 1000, w zależności od ilości powtórzeń dany fragment DNA ma charakterystyczną długość (polimorfizm długości widoczny podczas elektroforezy) VNTR może być badane metodą PCR wraz z elektroforezą, połączoną z hybrydyzacją z wyznakowaną sondą. Liczba powtórzeń decyduje o długości fragmentu, co z kolei wpływa na szybkości jego przemieszczania się podczas elektroforezy. w danym locus VNTR występuje znaczna zmienność osobnicza Przykładowy motyw sekwencji minisatelitarnej: AGGGCTGGAGG Allel 1. AGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGG Allel 2. AGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGG Allel 3. AGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGG itd.

20 Przykładowa analiza VNTRs

21 Mikrosatelitarny DNA STRs (Short Tandem Repeats) krótkie sekwencje powtórzone tandemowo sekwencje zawierające zmienną liczbę tandemowych powtórzeń kilkunukleotydowego motywu (1 4 pz) motyw równomiernie rozmieszczony w genomie liczba powtórzeń motywu minisatelitarnego: 10 do 50 i w zależności od ilości powtórzeń dany fragment DNA ma charakterystyczną długość (polimorfizm długości widoczny podczas elektroforezy) często motyw taki może być regularnie przerywany inną sekwencją. ulokowane są zazwyczaj w intronach (czasami również w eksonach [egzonach] w postaci mniejszej liczby powtórzeń).

22 STR (Short Tandem Repeats) a analiza restrykcyjna A1A1 A1A2 A3A4 ACGACGACGACG A1A1 A1A2 A3A4 Zalety: -duża zmienność - często tworzą multi-locus patterns charakterystyczne dla danego osobnika Wady: - nie nadają się do dokładnego mapowania z powodu ich nielosowego rozkładu w genomie

23 Markery genetyczne cd. SNPs (Single Nucleotide Polymorphisms) polimorfizm pojedynczych nukleotydów Genom ludzki: 56 mln SNPs (6,5 mln validated SNPs) - NCBI Analiza SNP umożliwia wykrycie polimorfizmu pojedynczego nukleotydu w obrębie badanej sekwencji. Klasycznie polega to na amplifikacji określonego fragmentu genomu w reakcji PCR i sekwencjonowaniu uzyskanego produktu. Zaletą tej techniki jest wysoka wydajność identyfikacji polimorfizmu w obrębie badanej sekwencji, wadą jest wysoki koszt analizy.

24 Analiza SNP molecular beacons SNP microarrays

25 Analiza sprzężeń zaburzenia w analizach: - gorące miejsca rekombinacji - podwójny crossing over

26 Type of marker No. of loci Features Blood groups ~20 May need fresh blood No easy physical localization Electrophoretic mobility variants of serum proteins ~30 May need fresh serum, specialized assays No easy physical localization Often limited polymorphism HLA tissue types 1 One linked set Can only test for linkage to 6p21.3 DNA RFLPs >10 5 Two allele markers, maximum heterozygosity (potentially) Initially required Southern blotting, now PCR Easy physical localization DNA VNTRs >10 4 Many alleles, highly informative (minisatellites) (potentially) Tend to cluster near ends of chromosomes Easy physical localization DNA VNTRs >10 5 Many alleles, highly informative (microsatellites) (potentially) Can type by automated multiplex PCR Easy physical localization Distributed throughout genome DNA SNPs >10 6 Less informative than microsatellites (single nucleotide polymorphisms) (potentially) Can be typed on a very large scale by automated equipment without gel electrophoresis Markery fenotypowe Markery DNA

27 Niska rozdzielczość Mapowanie Fizyczne Mapa Cytogenetyczna (chromosome bands) rozróżnialne zabarwione fragmenty chromosomów (mikroskop optyczny) Mbps Restriction mapping kolejność i odległości pomiędzy punktami trawienia enzymami DNA. 100s kbp Fluorescence in situ hybridisation hybrydyzacja fluorescencyjnych sond do chromosomów 100s kbp STS sequence mapping kolejność unikalnych w genomie markerów DNA (STS) 100 kbp Sequence map - całkowicie zsekwencjonowany chromosom 1bp. Wysoka rozdzielczość

28 Mapy fizyczne FISH (Fluorescent in situ hybridization) hybrydyzacja fluorescencyjna in situ

29 Mapa fizyczna genomu Medicago truncatula (lucerny) skonstruowana metodą FISH

30 Mapy fizyczne cd. STS (Sequence tagged site) mapping - - mapowanie miejsc znakowanych sekwencją

31 Analiza STS

32 Mapa restrykcyjna A B A B

33 Sekwencjonowanie genomów Clone contig WGS (whole genome shotgun)

34 Przeglądarki genomowe - Genome Browsers NCBI Map Viewer UCSC Genome Browser (University of Calif., Santa Cruz) Ensembl Map View

35 Ensembl Ensembl

36 UCSC

37 NCBI NCBI

38

BUDOWA I FUNKCJA GENOMU LUDZKIEGO

BUDOWA I FUNKCJA GENOMU LUDZKIEGO BUDOWA I FUNKCJA GENOMU LUDZKIEGO Magdalena Mayer Katedra i Zakład Genetyki Medycznej UM w Poznaniu 1. Projekt poznania genomu człowieka: Cele programu: - skonstruowanie szczegółowych map fizycznych i

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

Transformacja pośrednia składa się z trzech etapów:

Transformacja pośrednia składa się z trzech etapów: Transformacja pośrednia składa się z trzech etapów: 1. Otrzymanie pożądanego odcinka DNA z materiału genetycznego dawcy 2. Wprowadzenie obcego DNA do wektora 3. Wprowadzenie wektora, niosącego w sobie

Bardziej szczegółowo

Dr hab.n.med. Renata Jacewicz

Dr hab.n.med. Renata Jacewicz GENOM CZŁOWIEKA >99,999% 0,0005% 65% Dr hab.n.med. Renata Jacewicz Kierownik Pracowni Genetyki Medycznej i Sądowej 3% 32% 2013 Pracownia Genetyki Medycznej i Sądowej ZMS Dojrzałe erytrocyty, trzony włosów

Bardziej szczegółowo

Dr hab.n.med. Renata Jacewicz

Dr hab.n.med. Renata Jacewicz GENOM CZŁOWIEKA >99 % 0,05%(100MtDNA) 65% Dr hab.n.med. Renata Jacewicz Kierownik Pracowni Genetyki Medycznej i Sądowej 3% 32% 2013 Pracownia Genetyki Medycznej i Sądowej ZMS Dojrzałe erytrocyty, trzony

Bardziej szczegółowo

EWOLUCJA GENOMÓW. Bioinformatyka, wykład 6 (22.XI.2010) krzysztof_pawlowski@sggw.pl

EWOLUCJA GENOMÓW. Bioinformatyka, wykład 6 (22.XI.2010) krzysztof_pawlowski@sggw.pl EWOLUCJA GENOMÓW Bioinformatyka, wykład 6 (22.XI.2010) krzysztof_pawlowski@sggw.pl Wykład 6 spis treści genomika mapowanie genomów początki ewolucji świat RNA świat wirusów (?) ewolucja genomów GENOMIKA

Bardziej szczegółowo

Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych

Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych Analiza genetyczna w niepowodzeniach ciąży i badaniach prenatalnych Dr n. med. Joanna Walczak- Sztulpa Katedra i Zakład Genetyki Medycznej Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Diagnostyka

Bardziej szczegółowo

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów

Wprowadzenie do genetyki sądowej. Materiały biologiczne. Materiały biologiczne: prawidłowe zabezpieczanie śladów Wprowadzenie do genetyki sądowej 2013 Pracownia Genetyki Sądowej Katedra i Zakład Medycyny Sądowej Materiały biologiczne Inne: włosy z cebulkami, paznokcie możliwa degradacja - tkanki utrwalone w formalinie/parafinie,

Bardziej szczegółowo

Markery klasy II -Polimorfizm fragmentów DNA (na ogół niekodujących): - RFLP - VNTR - RAPD

Markery klasy II -Polimorfizm fragmentów DNA (na ogół niekodujących): - RFLP - VNTR - RAPD Marker genetyczny- polimorficzna cecha jakościowa organizmu, którą charakteryzuje proste dziedziczenie (mendlowskie) oraz którą można dokładnie identyfikować metodami analitycznymi. Markery klasy I - Antygeny

Bardziej szczegółowo

Mitochondrialna Ewa;

Mitochondrialna Ewa; Mitochondrialna Ewa; jej sprzymierzeńcy i wrogowie Lien Dybczyńska Zakład genetyki, Uniwersytet Warszawski 01.05.2004 Milion lat temu Ale co dalej??? I wtedy wkracza biologia molekularna Analiza różnic

Bardziej szczegółowo

MARKERY MOLEKULARNE dr Janusz Piechota dr Magdalena Wołoszyńska Plan wykładów:

MARKERY MOLEKULARNE dr Janusz Piechota dr Magdalena Wołoszyńska Plan wykładów: MARKERY MOLEKULARNE dr Janusz Piechota dr Magdalena Wołoszyńska Plan wykładów: Definicja słowa marker Markery związane z kwasami nukleinowymi rodzaje wykrywanie zastosowanie w diagnostyce medycznej, medycynie

Bardziej szczegółowo

Glimmer umożliwia znalezienie regionów kodujących

Glimmer umożliwia znalezienie regionów kodujących Narzędzia ułatwiające identyfikację właściwych genów GLIMMER TaxPlot Narzędzia ułatwiające amplifikację tych genów techniki PCR Primer3, Primer3plus PrimerBLAST Reverse Complement Narzędzia ułatwiające

Bardziej szczegółowo

WSTĘP. Copyright 2011, Joanna Szyda

WSTĘP. Copyright 2011, Joanna Szyda BIOINFORMATYKA 1. Wykład wstępny 2. Struktury danych w badaniach bioinformatycznych 3. Bazy danych: projektowanie i struktura 4. Bazy danych: projektowanie i struktura 5. Równowaga Hardyego-Weinberga,

Bardziej szczegółowo

MARKERY MIKROSATELITARNE

MARKERY MIKROSATELITARNE MARKERY MIKROSATELITARNE Badania laboratoryjne prowadzone w Katedrze Genetyki i Ogólnej Hodowli Zwierząt SGGW w ramach monitoringu genetycznego wykorzystują analizę genetyczną markerów mikrosatelitarnych.

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI

PODSTAWY BIOINFORMATYKI PODSTAWY BIOINFORMATYKI Prowadzący: JOANNA SZYDA ADRIAN DROśDś WSTĘP 1. Katedra Genetyki badania bioinformatyczne 2. Tematyka przedmiotu 3. Charakterystyka wykładów 4. Charakterystyka ćwiczeń 5. Informacje

Bardziej szczegółowo

Zmienność genomu. Przyczyny, skutki i sposoby kontroli

Zmienność genomu. Przyczyny, skutki i sposoby kontroli Zmienność genomu Przyczyny, skutki i sposoby kontroli Zmienność genomu Przez zmienność genomu (polimorfizm) rozumiemy różnice w sekwencji DNA genomowego pomiędzy osobnikami jednego gatunku. Wyróżniamy:

Bardziej szczegółowo

Mapowanie i markery molekularne

Mapowanie i markery molekularne Szkoła Główna Gospodarstwa Wiejskiego w Warszawie Mapowanie i markery molekularne mgr inż. Waldemar Skowron waldemar_skowron@sggw.pl MAPOWANIE polega na opracowaniu szczegółowych map chromosomów, które

Bardziej szczegółowo

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego

dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego Wk Wykrywanie polimorfizmów i mutacji Badania przesiewowe mutacji Wykrywanie znanych mutacji punktowych dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej

Bardziej szczegółowo

ANALIZA DANYCH POCHODZĄCYCH Z SEKWENCJONOWANIA NASTĘPNEJ GENERACJI

ANALIZA DANYCH POCHODZĄCYCH Z SEKWENCJONOWANIA NASTĘPNEJ GENERACJI ANALIZA DANYCH POCHODZĄCYCH Z SEKWENCJONOWANIA NASTĘPNEJ GENERACJI JOANNA SZYDA MAGDALENA FRĄSZCZAK MAGDA MIELCZAREK WSTĘP 1. Katedra Genetyki 2. Pracownia biostatystyki 3. Projekty NGS 4. Charakterystyka

Bardziej szczegółowo

Plan wykładów z genetyki ogólnej

Plan wykładów z genetyki ogólnej Plan wykładów z genetyki ogólnej 01 Metody genetyki klasycznej 02 Metody analizy DNA 03 Metody analizy genomu 04 Genomy prokariontów 05 Genomy eukariontów 06 Zmienność genomów w populacjach 07 Genomy a

Bardziej szczegółowo

Monitoring genetyczny populacji wilka (Canis lupus) jako nowy element monitoringu stanu populacji dużych drapieżników

Monitoring genetyczny populacji wilka (Canis lupus) jako nowy element monitoringu stanu populacji dużych drapieżników Monitoring genetyczny populacji wilka (Canis lupus) jako nowy element monitoringu stanu populacji dużych drapieżników Wojciech Śmietana Co to jest monitoring genetyczny? Monitoring genetyczny to regularnie

Bardziej szczegółowo

Wprowadzenie do genetyki medycznej i sądowej

Wprowadzenie do genetyki medycznej i sądowej Genetyka medyczno-sądowa Wprowadzenie do genetyki medycznej i sądowej Kierownik Pracowni Genetyki Medycznej i Sądowej Ustalanie tożsamości zwłok Identyfikacja sprawców przestępstw Identyfikacja śladów

Bardziej szczegółowo

Techniki biologii molekularnej Kod przedmiotu

Techniki biologii molekularnej Kod przedmiotu Techniki biologii molekularnej - opis przedmiotu Informacje ogólne Nazwa przedmiotu Techniki biologii molekularnej Kod przedmiotu 13.9-WB-BMD-TBM-W-S14_pNadGenI2Q8V Wydział Kierunek Wydział Nauk Biologicznych

Bardziej szczegółowo

Organizacja genomu człowieka i sekwencjonowanie DNA

Organizacja genomu człowieka i sekwencjonowanie DNA Organizacja genomu człowieka i sekwencjonowanie DNA Materiały dydaktyczne współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego. Organizacja genów na ludzkim chromosomie.

Bardziej szczegółowo

Mikrosatelitarne sekwencje DNA

Mikrosatelitarne sekwencje DNA Mikrosatelitarne sekwencje DNA Małgorzata Pałucka Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym 27.09.2012

Bardziej szczegółowo

POSZUKIWANIE POLIMORFICZNYCH MARKERÓW ZDEFINIOWANYCH SEKWENCYJNIE W POPULACJI GROCHU CARNEVAL X MP1401

POSZUKIWANIE POLIMORFICZNYCH MARKERÓW ZDEFINIOWANYCH SEKWENCYJNIE W POPULACJI GROCHU CARNEVAL X MP1401 Fragm. Agron. 29(4) 2012, 87 94 POSZUKIWANIE POLIMORFICZNYCH MARKERÓW ZDEFINIOWANYCH SEKWENCYJNIE W POPULACJI GROCHU CARNEVAL X Michał Knopkiewicz, Magdalena Gawłowska, Wojciech Święcicki Instytut Genetyki

Bardziej szczegółowo

Dr hab. Beata Krawczyk Katedra Mikrobiologii, Politechnika Gdańska

Dr hab. Beata Krawczyk Katedra Mikrobiologii, Politechnika Gdańska Narzędzia diagnostyki molekularnej w typowaniu genetycznym (genotypowaniu) Dr hab. Beata Krawczyk Katedra Mikrobiologii, Politechnika Gdańska Publikacja współfinansowana ze środków Unii Europejskiej w

Bardziej szczegółowo

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2

Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 ALEKSANDRA ŚWIERCZ Co to jest transkryptom? A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH 2 Ekspresja genów http://genome.wellcome.ac.uk/doc_wtd020757.html A. Świercz ANALIZA DANYCH WYSOKOPRZEPUSTOWYCH

Bardziej szczegółowo

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl

Bioinformatyka. Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl Bioinformatyka Michał Bereta mbereta@pk.edu.pl www.michalbereta.pl 1 Bazy danych biologicznych Bazy danych sekwencji nukleotydowych Pierwotne bazy danych (ang. primary database) Wykorzystywane do zbierania

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

Podstawy genetyki. Genetyka klasyczna, narzędzia badawcze genetyki

Podstawy genetyki. Genetyka klasyczna, narzędzia badawcze genetyki Podstawy genetyki Genetyka klasyczna, narzędzia badawcze genetyki Podręczniki } Podstawy biologii molekularnej L.A. Allison } Genomy TA Brown, wyd. 3 } Genetyka molekularna P Węgleński (red.), wyd. 2 2

Bardziej szczegółowo

Wprowadzenie do genetyki sądowej

Wprowadzenie do genetyki sądowej DNA - kwas deoksyrybonukleinowy Wprowadzenie do genetyki sądowej część 2 odwójna helisa ok. 3,2 miliardy par zasad (base pairs) A=T, G=C ok. 20 000-30 000 genów onad 99% identyczności w populacji; 1% różnic

Bardziej szczegółowo

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej

Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Seminarium 1 część 1 Konspekt do zajęć z przedmiotu Genetyka dla kierunku Położnictwo dr Anna Skorczyk-Werner Katedra i Zakład Genetyki Medycznej Genom człowieka Genomem nazywamy całkowitą ilość DNA jaka

Bardziej szczegółowo

Wybrane techniki badania białek -proteomika funkcjonalna

Wybrane techniki badania białek -proteomika funkcjonalna Wybrane techniki badania białek -proteomika funkcjonalna Proteomika: umożliwia badanie zestawu wszystkich (lub prawie wszystkich) białek komórkowych Zalety analizy proteomu w porównaniu z analizą trankryptomu:

Bardziej szczegółowo

Tematyka zajęć z biologii

Tematyka zajęć z biologii Tematyka zajęć z biologii klasy: I Lp. Temat zajęć Zakres treści 1 Zapoznanie z przedmiotowym systemem oceniania, wymaganiami edukacyjnymi i podstawą programową Podstawowe zagadnienia materiału nauczania

Bardziej szczegółowo

Spis treści. 1 Budowa genomu jądrowego (M.J. Olszewska, J. Małuszyńska) 13. Przedmowa 10

Spis treści. 1 Budowa genomu jądrowego (M.J. Olszewska, J. Małuszyńska) 13. Przedmowa 10 Spis treści Przedmowa 10 1 Budowa genomu jądrowego (M.J. Olszewska, J. Małuszyńska) 13 1.1. Organizacja DNA jądrowego 13 1.1.1. Rodzaje sekwencji powtarzalnych i ich lokalizacja 14 1.1.1.1. Sekwencje rozproszone

Bardziej szczegółowo

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki

wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Genetyka ogólna wykład dla studentów II roku biotechnologii Andrzej Wierzbicki Uniwersytet Warszawski Wydział Biologii andw@ibb.waw.pl http://arete.ibb.waw.pl/private/genetyka/ gamety matczyne Genetyka

Bardziej szczegółowo

2016-01-14. Sekwencje mikrosatelitarne. SNP Single Nucleotide Polymorphism (mutacje punktowe, polimorfizm jednonukleotydowy)

2016-01-14. Sekwencje mikrosatelitarne. SNP Single Nucleotide Polymorphism (mutacje punktowe, polimorfizm jednonukleotydowy) Sekwencje mikrosatelitarne Próba nr 1 GGGGGGGGGGGG 4x GG Próba nr 2 GGGGGGGGGGGGGGGG 6x GG Próba nr 1 GGGGGGGGG Próba nr 2 GGG GGGG SNP Single Nucleotide Polymorphism (mutacje punktowe, polimorfizm jednonukleotydowy)

Bardziej szczegółowo

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych???

Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Analizy DNA in silico - czyli czego można szukać i co można znaleźć w sekwencjach nukleotydowych??? Alfabet kwasów nukleinowych jest stosunkowo ubogi!!! Dla sekwencji DNA (RNA) stosuje się zasadniczo*

Bardziej szczegółowo

Perspektywy zastosowania badań genomicznych w hodowli zwierząt

Perspektywy zastosowania badań genomicznych w hodowli zwierząt Wiadomości Zootechniczne, R. XLIX (2011), 4: 103 108 Perspektywy zastosowania badań genomicznych w hodowli zwierząt W prowadzenie Wobec stałego wzrostu zaludnienia, rolnictwo odgrywa kluczową rolę w globalnym

Bardziej szczegółowo

6.1. Rodzaje i wielkość genomu. Alina Woźniak, Celestyna Mila-Kierzenkowska

6.1. Rodzaje i wielkość genomu. Alina Woźniak, Celestyna Mila-Kierzenkowska 6 GENOM CZŁOWIEKA Alina Woźniak, Celestyna Mila-Kierzenkowska 121 genom budowa i funkcja genom mitochondrialny projekt poznania genomu ludzkiego (HGP) mapowanie genomu pytania piśmiennictwo Termin genom

Bardziej szczegółowo

PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE

PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE PODSTAWY BIOINFORMATYKI 12 MIKROMACIERZE WSTĘP 1. Mikromacierze ekspresyjne tworzenie macierzy przykłady zastosowań 2. Mikromacierze SNP tworzenie macierzy przykłady zastosowań MIKROMACIERZE EKSPRESYJNE

Bardziej szczegółowo

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych...

Spis treści. Przedmowa... XI. Wprowadzenie i biologiczne bazy danych. 1 Wprowadzenie... 3. 2 Wprowadzenie do biologicznych baz danych... Przedmowa... XI Część pierwsza Wprowadzenie i biologiczne bazy danych 1 Wprowadzenie... 3 Czym jest bioinformatyka?... 5 Cele... 5 Zakres zainteresowań... 6 Zastosowania... 7 Ograniczenia... 8 Przyszłe

Bardziej szczegółowo

Lokalizacja genów DNA/RNA. Nukleotydy i ich łańcuchy 11/21/2013. Genom ludzki. Struktura genomu. Pirymidyny i Puryny

Lokalizacja genów DNA/RNA. Nukleotydy i ich łańcuchy 11/21/2013. Genom ludzki. Struktura genomu. Pirymidyny i Puryny Genom ludzki Lokalizacja genów Cała informacja genetyczna wdna. Zawiera sekwencje kodujące i niekodujące Rozpoczęty w 1989 Pierwsza wersja w 2000 Koszt $3 mld 3*10 9 bp(base pairs) 20,000 genów 1 Struktura

Bardziej szczegółowo

Bioinformatyczne bazy danych - część 2. -przeszukiwanie baz danych -pobieranie danych

Bioinformatyczne bazy danych - część 2. -przeszukiwanie baz danych -pobieranie danych Bioinformatyczne bazy danych - część 2 -przeszukiwanie baz danych -pobieranie danych Numery dostępowe baz danych (accession number) to ciąg liter i cyfr służących jako etykieta identyfikująca sekwencję

Bardziej szczegółowo

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne

Techniki molekularne w mikrobiologii SYLABUS A. Informacje ogólne Techniki molekularne w mikrobiologii A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Rodzaj Rok studiów

Bardziej szczegółowo

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie

prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie prof. Joanna Chorostowska-Wynimko Zakład Genetyki i Immunologii Klinicznej Instytut Gruźlicy i Chorób Płuc w Warszawie Sekwencyjność występowania zaburzeń molekularnych w niedrobnokomórkowym raku płuca

Bardziej szczegółowo

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym mgr Magdalena Brzeskwiniewicz Promotor: Prof. dr hab. n. med. Janusz Limon Katedra i Zakład Biologii i Genetyki Gdański Uniwersytet Medyczny

Bardziej szczegółowo

Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan

Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan Ćwiczenie 3 Oznaczenie polimorfizmu genetycznego cytochromu CYP2D6 metodą PCR w czasie rzeczywistym (rtpcr) przy użyciu sond typu TaqMan Klasyczna metoda PCR jest metodą jakościową, nie ilościową co np.

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA

LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA ANNALES ACADEMIAE MEDICAE STETINENSIS ROCZNIKI POMORSKIEJ AKADEMII MEDYCZNEJ W SZCZECINIE 2007, 53, SUPPL. 2, 170174 LIDIA CYBULSKA, EWA KAPIŃSKA, JOANNA WYSOCKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA Badanie

Bardziej szczegółowo

21. Poszukiwanie markerów molekularnych genów przywracania płodności pyłku u żyta ( Secale cereale

21. Poszukiwanie markerów molekularnych genów przywracania płodności pyłku u żyta ( Secale cereale Lp. w zał. do Rozporządzenia MRiRW: 21. Tytuł zadania: Poszukiwanie markerów molekularnych genów przywracania płodności pyłku u żyta (Secale cereale L.) z CMS-Pampa. Kierownik zadania: dr hab. P. Bednarek

Bardziej szczegółowo

Ekologia ogólna. wykład 4. Metody molekularne Genetyka populacji

Ekologia ogólna. wykład 4. Metody molekularne Genetyka populacji Ekologia ogólna wykład 4 Metody molekularne Genetyka populacji Kalosze vs. fartuchy wykład 4/2 Techniki molekularne DNA mitochondrialne / chloroplastowe Konserwowane ewolucyjne, wiele kopii w komórce Wykorzystanie

Bardziej szczegółowo

2014-03-26. Analiza sekwencji promotorów

2014-03-26. Analiza sekwencji promotorów 2014-03-26 Analiza sekwencji promotorów 1 2014-03-26 TFy tworzą zawiły układ regulacyjny, na który składają się różne oddziaływania białko białko poprzez wytworzenie PĘTLI Specyficzne TFy Ogólne TFy Benfey,

Bardziej szczegółowo

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka

Jest to dziedzina biologiczna wywodząca się z biotechnologii. Bioinformatyka Wstęp do obsługi biologicznych baz danych i analizy porównawczej białek i genów Katedra Fizjologii i Biotechnologii Roślin Pok. 113 CB jan.jastrzebski@uwm.edu.pl bioinformatyka@gmail.com www.ebiology.net

Bardziej szczegółowo

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS

TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR DIAGNOSTICS OF MONOGENIC DISORDERS Nowiny Lekarskie 2006, 75, 5, 486 490 ALINA LICZBAŃSKA, ANNA WOŹNIAK, ANNA WAWROCKA, MACIEJ R. KRAWCZYŃSKI TECHNIKI WYKORZYSTYWANE W DIAGNOSTYCE MOLEKULARNEJ CHORÓB JEDNOGENOWYCH TECHNIQUES USED IN MOLECULAR

Bardziej szczegółowo

Historia Bioinformatyki

Historia Bioinformatyki Historia Bioinformatyki 1859 Darwin i Wallace opublikowali O powstaniu gatunku 1865 Mendel eksperymentując z grochem, wykazuje, że cechy dziedziczą się w odrębnych jednostkach 1869 Meischer wyizolował

Bardziej szczegółowo

GENOM I JEGO STRUKTURA

GENOM I JEGO STRUKTURA GENOM I JEGO STRUKTURA GENOM Ogół materiału genetycznego (kwasu nukleinowego niosącego informację genetyczną) zawartego w pojedynczej części składowej (komórce, cząstce wirusa) organizmu 1 Genom eukariotyczny

Bardziej szczegółowo

EVALUATION OF (CA)n DINUCLEOTIDE MARKERS IN PATERNITY ANALYSIS

EVALUATION OF (CA)n DINUCLEOTIDE MARKERS IN PATERNITY ANALYSIS EVALUATION OF (CA)n DINUCLEOTIDE MARKERS IN PATERNITY ANALYSIS Anitha A., Moinak BANERJEE Rajiv Gandhi Centre for Biotechnology, Jagathy, Kerala, India ABSTRACT: Developing robust molecular markers for

Bardziej szczegółowo

Markery molekularne Autor tekstu: Michał Łuczak. Przegląd najbardziej popularnych technik

Markery molekularne Autor tekstu: Michał Łuczak. Przegląd najbardziej popularnych technik Markery molekularne Autor tekstu: Michał Łuczak Przegląd najbardziej popularnych technik W ciągu ostatniego ćwierćwiecza nastąpił olbrzymi postęp w zrozumieniu wielu procesów zachodzących we wszystkich

Bardziej szczegółowo

Techniki molekularne w biologii SYLABUS A. Informacje ogólne

Techniki molekularne w biologii SYLABUS A. Informacje ogólne Techniki molekularne w biologii SYLABUS A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod przedmiotu

Bardziej szczegółowo

Emilia Wójtowicz. Markery molekularne i ich wykorzystanie w hodowli roślin

Emilia Wójtowicz. Markery molekularne i ich wykorzystanie w hodowli roślin Emilia Wójtowicz Markery molekularne i ich wykorzystanie w hodowli roślin W pracach genetyczno hodowlanych wykorzystuje się różne typy markerów (wyznaczników), pozwalających na szybką identyfikacje genotypów,

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Bioinformatyka. Michał Przyłuski

Bioinformatyka. Michał Przyłuski Bioinformatyka Michał Przyłuski Plan prezentacji Wstęp biologiczny Biologia molekularna genetyka Bioinformatyka Przykłady zastosowań: sekwencjonowanie mikromacierze filogenetyka Czemu wstęp biologiczny?

Bardziej szczegółowo

Choroby genetyczne na tle zmian w genomie człowieka rodzaje, fenotyp, diagnostyka genetyczna

Choroby genetyczne na tle zmian w genomie człowieka rodzaje, fenotyp, diagnostyka genetyczna Przedmiot: Genetyka kliniczna V Rok, Wydział Lekarski I Katedra i Zakład Genetyki Medycznej UM w Poznaniu Choroby genetyczne na tle zmian w genomie człowieka rodzaje, fenotyp, diagnostyka genetyczna Opracowanie:

Bardziej szczegółowo

Biologia molekularna z genetyką

Biologia molekularna z genetyką Biologia molekularna z genetyką P. Golik i M. Koper Konwersatorium 2: Analiza genetyczna eukariontów Drosophilla melanogaster Makrokierunek: Bioinformatyka i Biologia Systemów; 2016 Opracowano na podstawie

Bardziej szczegółowo

Genomika funkcjonalna. Wielkoskalowe analizy genetyczne

Genomika funkcjonalna. Wielkoskalowe analizy genetyczne Genomika funkcjonalna Wielkoskalowe analizy genetyczne Materiały z prezentacji http://www.igib.uw.edu.pl/ Genomika funkcjonalna Kolejny po poznaniu sekwencji (struktury) genomu etap Poznanie funkcji wszystkich

Bardziej szczegółowo

Rewolucja genomowa. Wojciech Makałowski Institute of Bioinformatics University of Muenster. w medycynie

Rewolucja genomowa. Wojciech Makałowski Institute of Bioinformatics University of Muenster. w medycynie Rewolucja genomowa Wojciech Makałowski Institute of Bioinformatics University of Muenster w medycynie 60 lat genomiki Kto nastepny? Rekombinacja DNA Metody szybkiego sekwencjonowania DNA PC R Automaty

Bardziej szczegółowo

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP

Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski WSTĘP ARCH. MED. SĄD. KRYMINOL., 2010, LX, 243-247 PRACE ORYGINALNE / ORIGINALS Agata Kodroń, Edyta Rychlicka, Iwona Milewska, Marcin Woźniak, Tomasz Grzybowski Analiza danych populacyjnych loci ministr: D10S1248,

Bardziej szczegółowo

Techniki biologii molekularnej przydatne w diagnostyce onkologicznej. Prof. Barbara Pieńkowska-Grela

Techniki biologii molekularnej przydatne w diagnostyce onkologicznej. Prof. Barbara Pieńkowska-Grela Techniki biologii molekularnej przydatne w diagnostyce onkologicznej Prof. Barbara Pieńkowska-Grela Warszawa, 9 czerwca 2015 Badanie genetyczne w nowotworach polega na stwierdzeniu obecności i określeniu

Bardziej szczegółowo

Elektroforeza. Bioanalizator 2100 jedna platforma, wiele możliwości

Elektroforeza. Bioanalizator 2100 jedna platforma, wiele możliwości www.bio.perlan.com.pl Elektroforeza Bioanalizator 2100 jedna platforma, wiele możliwości Bioanalyzer 2100 firmy Agilent jest pierwszym urządzeniem wykorzystującym technikę mikroprzepływów do analizy ilościowej

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

Plan wykładu: Budowa chromatyny - nukleosomy. Wpływ nukleosomów na replikację i transkrypcję

Plan wykładu: Budowa chromatyny - nukleosomy. Wpływ nukleosomów na replikację i transkrypcję Nukleosomy 1 Plan wykładu: Budowa chromatyny - nukleosomy Wpływ nukleosomów na replikację i transkrypcję Metody pozwalające na wyznaczanie miejsc wiązania nukleosomów Charakterystyka obsadzenia nukleosomów

Bardziej szczegółowo

Zastosowanie markerów mikrosatelitarnych DNA w identyfikacji osobniczej oraz kontroli rodowodów psów

Zastosowanie markerów mikrosatelitarnych DNA w identyfikacji osobniczej oraz kontroli rodowodów psów Markery mikrosatelitarne DNA w identyfikacji osobniczej i kontroli rodowodów psów Wiadomości Zootechniczne, R. LIII (2015), 4: 121 126 Zastosowanie markerów mikrosatelitarnych DNA w identyfikacji osobniczej

Bardziej szczegółowo

Zastosowanie Y-SNPs w genetyce sądowej Application of Y-SNPs in forensic genetics

Zastosowanie Y-SNPs w genetyce sądowej Application of Y-SNPs in forensic genetics ARCH. MED. SĄD. KRYMINOL., 2011, LXI, 161-169 PRACE ORYGINALNE / ORIGINAL PAPERS Monica Abreu-Głowacka¹, Małgorzata Koralewska-Kordel¹, Eliza Michalak¹, Czesław Żaba¹, Zygmunt Przybylski² Zastosowanie

Bardziej szczegółowo

Metody inżynierii genetycznej SYLABUS A. Informacje ogólne

Metody inżynierii genetycznej SYLABUS A. Informacje ogólne Metody inżynierii genetycznej A. Informacje ogólne Elementy sylabusu Nazwa jednostki prowadzącej kierunek Nazwa kierunku studiów Poziom kształcenia Profil studiów Forma studiów Kod Rodzaj Rok studiów /semestr

Bardziej szczegółowo

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10.

Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016. Ćwiczenie nr 1 (06-07.10. Program ćwiczeń z przedmiotu BIOLOGIA MOLEKULARNA I GENETYKA, część I dla kierunku Lekarskiego, rok I 2015/2016 Ćwiczenie nr 1 (06-07.10.2015) Temat: Wprowadzenie 1. Omówienie regulaminu zajęć Temat: Wprowadzenie

Bardziej szczegółowo

Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego

Publikacja współfinansowana ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego Nowoczesne metody diagnostyczne Diagnostyka laboratoryjna a wprowadzanie nowych metod diagnostycznych dr hab. Beata Krawczyk Katedra Mikrobiologii PG Publikacja współfinansowana ze środków Unii Europejskiej

Bardziej szczegółowo

GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ

GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ GENETYCZNE PODSTAWY ZMIENNOŚCI ORGANIZMÓW ZASADY DZIEDZICZENIA CECH PODSTAWY GENETYKI POPULACYJNEJ ZMIENNOŚĆ - występowanie dziedzicznych i niedziedzicznych różnic między osobnikami należącymi do tej samej

Bardziej szczegółowo

II WYDZIAŁ LEKARSKI, II ROK

II WYDZIAŁ LEKARSKI, II ROK II WYDZIAŁ LEKARSKI, II ROK PRZEDMIOT: BIOLOGIA MEDYCZNA (CZĘŚĆ 1 GENETYKA) PROGRAM ĆWICZEŃ 2009/2010 L.p. Data zajęć Temat zajęć 1. 15.02 18.02 Podstawy genetyki klasycznej (podstawowe pojęcia i definicje

Bardziej szczegółowo

SEQUENCING ANALYSIS OF A NEW ALLELE, D8S1132*15

SEQUENCING ANALYSIS OF A NEW ALLELE, D8S1132*15 SEQUENCING ANALYSIS OF A NEW ALLELE, D8S1132*15 Grzegorz JEZIERSKI 1, Ryszard PAW OWSKI 1, 2 1 Department of Forensic Medicine, Medical University, Gdañsk 2 Institute of Forensic Research, Cracow ABSTRACT:

Bardziej szczegółowo

Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe

Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe Rozwój metod dozymetrii biologicznej oraz biofizycznych markerów i indykatorów wpływu promieniowania na organizmy żywe Marcin Kruszewski Centrum Radiobiologii i Dozymetrii Biologicznej Instytut Chemii

Bardziej szczegółowo

Bioinformatyka. wykłady dla I r. studiów magisterskich, biologia (SGGW) 2007/2008. Wykład 1, 4.X.2007 Krzysztof Pawłowski

Bioinformatyka. wykłady dla I r. studiów magisterskich, biologia (SGGW) 2007/2008. Wykład 1, 4.X.2007 Krzysztof Pawłowski Bioinformatyka wykłady dla I r. studiów magisterskich, biologia (SGGW) 2007/2008 Wykład 1, 4.X.2007 Krzysztof Pawłowski Wykład 4.X.2007 Co to jest bioinformatyka? Program wykładów Sekwencjonowanie DNA

Bardziej szczegółowo

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy

Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Polimorfizm genu mitochondrialnej polimerazy gamma (pol γ) w populacjach ludzkich Europy Praca wykonana pod kierunkiem dr hab. Tomasza Grzybowskiego w Katedrze Medycyny Sądowej w Zakładzie Genetyki Molekularnej

Bardziej szczegółowo

GENETYKA POPULACYJNA LOCUS D19S433 W REGIONIE POLSKI PÓŁNOCNEJ POPULATION GENETICS OF THE D19S433 LOCUS IN THE NORTHERN POLAND

GENETYKA POPULACYJNA LOCUS D19S433 W REGIONIE POLSKI PÓŁNOCNEJ POPULATION GENETICS OF THE D19S433 LOCUS IN THE NORTHERN POLAND Ann. Acad. Med. Gedan., 2005, 35, 181 185 JOANNA WYSOCKA, EWA KAPIŃSKA, KRZYSZTOF RĘBAŁA, ZOFIA SZCZERKOWSKA, LIDIA CYBULSKA GENETYKA POPULACYJNA LOCUS D19S433 W REGIONIE POLSKI PÓŁNOCNEJ POPULATION GENETICS

Bardziej szczegółowo

OCENA RÓŻNORODNOŚCI GENETYCZNEJ PRZY POMOCY MARKERÓW MOLEKULARNYCH ZASTOSOWANIE W EKOTOKSYKOLOGII

OCENA RÓŻNORODNOŚCI GENETYCZNEJ PRZY POMOCY MARKERÓW MOLEKULARNYCH ZASTOSOWANIE W EKOTOKSYKOLOGII PISMO POLSKIEGO TOWARZYSTWA PRZYRODNIKÓW IM. KOPERNIKA WYDAWANE PRZY WSPÓŁUDZIALE: AKADEMII GÓRNICZO-HUTNICZEJ, MINISTERSTWA NAUKI I SZKOLNICTWA WYŻSZEGO, POLSKIEJ AKADEMII UMIEJĘTNOŚCI TOM 113 ZESZYT

Bardziej szczegółowo

Częstość występowania chorób genetycznych (cech) różni się między grupami etnicznymi. Mukowiscydoza pojawia się 1/2000 urodzin u Amerykanów, których

Częstość występowania chorób genetycznych (cech) różni się między grupami etnicznymi. Mukowiscydoza pojawia się 1/2000 urodzin u Amerykanów, których genetyka człowieka choroby genetyczne człowieka: * jednogenowe * wielogenowe * spowodowane aberracjami chromosomowymi * mitochondrialne * spowodowane zaburzeniami piętnowania genów (zespół Pradera-Williego

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937. (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1652937 (96) Data i numer zgłoszenia patentu europejskiego: 18.10.2005 05256463.0 (13) (51) T3 Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

Podstawowe strategie i techniki genetyki molekularnej

Podstawowe strategie i techniki genetyki molekularnej Podstawowe strategie i techniki genetyki molekularnej Czym jest inżynieria genetyczna? Ang. recombinant DNA manipulacje DNA in vitro izolacja i amplifikacja DNA i cdna mapowanie i sekwencjonowanie DNA

Bardziej szczegółowo

w oparciu o markery genetyczne klasy I i II

w oparciu o markery genetyczne klasy I i II Wiadomości Zootechniczne, R. L (2012), 2: 13 20 Kontrola wiarygodności rodowodów owiec Kontrola wiarygodności rodowodów owiec w oparciu o markery genetyczne klasy I i II Anna Radko, Tadeusz Rychlik, Dominika

Bardziej szczegółowo

Wykorzystanie mikromacierzy DNA w badaniach dzikich zwierząt

Wykorzystanie mikromacierzy DNA w badaniach dzikich zwierząt Wykorzystanie mikromacierzy DNA w badaniach dzikich zwierząt Marlena Wojciechowska, Wanda Olech ARTYKUŁY / ARTICLES Abstrakt: Współcześnie genetyka molekularna dostarcza wielu narzędzi umożliwiających

Bardziej szczegółowo

Biologia molekularna

Biologia molekularna Biologia molekularna 1. Metryczka Nazwa Wydziału Program kształcenia Wydział Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej Analityka Medyczna, studia jednolite magisterskie, studia stacjonarne i niestacjonarne

Bardziej szczegółowo

ANNALES UNIVERSITATIS MARIAE CURIE-SKŁ ODOWSKA LUBLIN POLONIA

ANNALES UNIVERSITATIS MARIAE CURIE-SKŁ ODOWSKA LUBLIN POLONIA ANNALES UNIVERSITATIS MARIAE CURIE-SKŁ ODOWSKA LUBLIN POLONIA VOL. LXIII (3) SECTIO DD 2008 Katedra Hodowli Amatorskich i Zwierząt Dzikich Uniwersytetu Przyrodniczego w Lublinie 20-950 Lublin, ul. Akademicka

Bardziej szczegółowo

Od jakiego pułapu startujemy? matematyka

Od jakiego pułapu startujemy? matematyka dla biotechnologów Wykład 2 Definicja bioinformatyki Od jakiego pułapu startujemy? Zakładamy, że te pojęcia są w małym palcu: DNA, RNA struktura, funkcje, rodzaje Genom Białka struktury, funkcje, rodzaje,

Bardziej szczegółowo

Genetic aspect of variability in drug response

Genetic aspect of variability in drug response Akademia Medycyny ARTYKUŁ POGLĄDOWY/REVIEW PAPER Wpłynęło: 23.09.2008 Poprawiono: 04.12.2008 Zaakceptowano: 04.12.2008 Aspekt genetyczny różnorodności odpowiedzi na leki Genetic aspect of variability in

Bardziej szczegółowo

Biologia Molekularna Podstawy

Biologia Molekularna Podstawy Biologia Molekularna Podstawy Budowa DNA Budowa DNA Zasady: Purynowe: adenina i guanina Pirymidynowe: cytozyna i tymina 2 -deoksyryboza Grupy fosforanowe Budowa RNA Budowa RNA Zasady: purynowe: adenina

Bardziej szczegółowo

Farmakogenetyka Biotechnologia Medyczna I o

Farmakogenetyka Biotechnologia Medyczna I o ĆWICZENIE 2 Oznaczanie polimorfizmu cytochromu CYP2D6 za pomocą tradycyjnych metod biologii molekularnej: PCR-RFLP I. Łańcuchowa reakcja polimerazy PCR (polymerase chain reaction) Technika PCR rozwinęła

Bardziej szczegółowo

SPRAWOZDANIE Z BADAŃ DNA W KIERUNKU USTALENIA POKREWIEŃSTWA BIOLOGICZNEGO DO CELÓW PRYWATNYCH

SPRAWOZDANIE Z BADAŃ DNA W KIERUNKU USTALENIA POKREWIEŃSTWA BIOLOGICZNEGO DO CELÓW PRYWATNYCH SPRAWOZDANIE Z BADAŃ DNA W KIERUNKU USTALENIA POKREWIEŃSTWA BIOLOGICZNEGO DO CELÓW PRYWATNYCH ul. Bocheńskiego 38 a, 40-859 Katowice REGON: 243413225, NIP: 6342822748, tel. + 48 796 644 115 e-mail: premiumlex@testdna.pl,

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo