(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

Wielkość: px
Rozpocząć pokaz od strony:

Download "(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2121927. (96) Data i numer zgłoszenia patentu europejskiego: 30.07.2007 07793958."

Transkrypt

1 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: (13) (51) T3 Int.Cl. C12N 15/113 ( ) Urząd Patentowy Rzeczypospolitej Polskiej (97) O udzieleniu patentu europejskiego ogłoszono: Europejski Biuletyn Patentowy 2012/41 EP B1 (54) Tytuł wynalazku: Sekwencja dsrna: ATN-RNA, interwencja przy użyciu IRNAI, zastosowanie sekwencji dsrna: ATN-RNA, sposób leczenia i inhibicji guza mózgu, zestaw do inhibicji komórek nowotworowych, które eksprymują tenascynę, sposób otrzymywania zestawu w terapii guzów mózg (30) Pierwszeństwo: PL (43) Zgłoszenie ogłoszono: w Europejskim Biuletynie Patentowym nr 2009/48 (45) O złożeniu tłumaczenia patentu ogłoszono: Wiadomości Urzędu Patentowego 2013/05 (73) Uprawniony z patentu: Uniwersytet Medyczny Im. Karola Marcinkowskiego, Poznań, PL Bioinfobank Sp. Z O.O., Poznań, PL Instytut Chemii Bioorganicznej PAN, Poznań, PL (72) Twórca(y) wynalazku: PL/EP T3 MIROSŁAWA BARCISZEWSKA, Poznań, PL IWONA GAWROŃSKA, Poznań, PL RYSZARD ZUKIEL, Poznań, PL STANISŁAW NOWAK, Poznań, PL JAN BARCISZEWSKI, Poznań, PL LESZEK RYCHLEWSKI, Poznań, PL ELIZA WYSZKO, Poznań, PL KATARZYNA ROLLE, Gadki, PL (74) Pełnomocnik: rzecz. pat. Piotr Godlewski JAN WIERZCHOŃ & PARTNERZY BIURO PATENTÓW I ZNAKÓW TOWAROWYCH SP.J. ul. Żurawia 47/ Warszawa Uwaga: W ciągu dziewięciu miesięcy od publikacji informacji o udzieleniu patentu europejskiego, każda osoba może wnieść do Europejskiego Urzędu Patentowego sprzeciw dotyczący udzielonego patentu europejskiego. Sprzeciw wnosi się w formie uzasadnionego na piśmie oświadczenia. Uważa się go za wniesiony dopiero z chwilą wniesienia opłaty za sprzeciw (Art. 99 (1) Konwencji o udzielaniu patentów europejskich).

2 15661/12/P-RO/PG/KM EP Sekwencja dsrna: ATN-RNA, interwencja przy użyciu IRNAI, zastosowanie sekwencji dsrna: ATN-RNA, sposób leczenia i inhibicji guza mózgu, zestaw do inhibicji komórek nowotworowych, które eksprymują tenascynę, sposób otrzymywania zestawu w terapii guzów mózgu [0001] Przedmiotem wynalazku są sekwencja dwuniciowego ATN-RNA, sekwencja dwuniciowego ATN-RNA do użycia w sposobie medycznej terapii guzów mózgu u ludzi, zestaw do użycia w inhibicji komórki nowotworowej, która eksprymuje tenascynę-c, sposób otrzymywania zestawu w terapii guzów mózgu. Złośliwe glejaki preferencyjnie eksprymują pewną liczbę powierzchniowych markerów, które można wykorzystywać jako cele terapeutyczne, włącznie z tenascyną-c (TN-C), glikoproteiną macierzy zewnątrzkomórkowej, która jest wszechobecnie eksprymowana przez glejaki złośliwe i prawdopodobnie wpływa na adhezję, inwazję, migrację i proliferację komórek guza. W celu inhibicji TN-C, zastosowano podejście poprzez interwencję interferencyjnym RNA (irnai). Wiadomo, że TN-C, glikoproteina macierzy zewnątrzkomórkowej, jest silnie eksprymowana w tkance guza większości złośliwych guzów obejmujących mózg [24,25]. TN-C, której stężenie jest zazwyczaj wysokie w glejakach o wysokim stopniu złośliwości, zwiększa inwazyjność komórek glejaka. Jest to dominujący epitop glejaka wielopostaciowego [26]. Co interesujące, bardzo wysoki poziom metaloproteinazy macierzy 12 (NMP-12) zaobserwowano również w guzach glejaka wielopostaciowego o wysokim stopniu złośliwości i ta TN-C zwiększa ilość NMP- 12 [27]. W tkance guza, TN- C występuje głównie w macierzy zewnątrzkomórkowej zrębu włóknistego silnie złośliwych nowotworów włącznie z rakiem okrężnicy i piersi, włókniakomięsakami, nowotworami płuc, czerniakami, rakiem płaskonabłonkowym, guzem pęcherza, gruczolakolakiem prostaty i wzdłuż obrzeża guza [28]. W homogenatach GBM zaobserwowano wyraźnie wyższe poziomy TN-C niż w prawidłowym mózgu. 4 Stwierdzenie, że TN-C wykazuje dominujący epitop w glejaku niedojrzałym 5,6 zachęciło nas do zbadania potencjału interferencji RNA (RNAi) do blokowania ekspresji TN-C i jej wpływu na rozwój złośliwych nowotworów ludzkiego mózgu. Wysoki poziom ekspresji TN-C w ludzkich glejakach i gwiaździakach koreluje się z wyższym stopniem złośliwości guza i angiogenezą [29; 30]. [0002] Seki et al w Identification of tenascin-c as a key molecule determining stromal cell-dependent erythropoiesis [34] ujawniają sirna tenascyny-c, autorzy wykorzystali dwuniciowy RNA o długości 29 nukleotydów, w liniach komórkowych. Reardon David et al w Phase II trial of murine (131)I-labeled antitenascin monoclonal antibody 81C6 administered into surgically created resection cavities of patients with newly diagnosed malignant gliomas [35] i Grzelinski Mariusz et al w RNA interference-mediated gene silecing of pleiotrophin through polyethylenimine-complexed small interfering RNAs in vivo exerts antitumoral effects in glioblastoma xenografts [36] ujawniają sposób inhibicji

3 2 rozwoju guza glejaka niedojrzałego przy użyciu inhibitora tenascyny-c. Reardon David et al opisali zastosowanie znakowanego monoklonalnego przeciwciała przeciw tenascynie. [0003] Zgłoszenie patentowe WO (opublikowane ) zapewnia sposób projektowania antysensownych oligodeoksynukleotydów (ODN-y) i długich antysensownych wektorów ekspresyjnych, które wytwarzają długie antysensowne sekwencje RNA do inhibicji translacji swoistych izoform białek, lub rodzin izoform białek. Wynalazek zapewnia również sposoby zastosowania ODN-ów i długich antysensownych wektorów ekspresyjnych, które wytwarzają długie antysensowne sekwencje RNA. [0004] W zgłoszeniu patentowym WO (opublikowanym ) opisano wektory adenowirusowe c-met sirna, które hamują rozwój, inwazję i tumorogenność komórek rakowych. Supresję czynnika wzrostu hepatocytów/czynnika rozproszenia (HGF/SF)-szlaku sygnałowego Met poprzez ukierunkowanie kinazy tyrozynowej białka Met przetestowano jako strategię supresji wzrostu guza. Przy użyciu technologii interferencji RNA (RNAi) i adenowirusa z sirna (Ad Met sirna) docelowe sekwencje dramatycznie zmniejszyły ekspresję Met w komórkach guzów u myszy, psów i ludzi. Met poddano supresji przy użyciu Ad Met sirna w komórkach guza sutka (DA3) u myszy i transformowanych przez Met komórkach (NIH3T3 (M114) jak również w ludzkich komórkach nowotworu prostaty, mięsaka, glejaka niedojrzałego, komórkach nowotworu żołądka i jajników. Ponadto, infekcja Ad Met sirna odwróciła morfologię transformowanych komórek. Ad Met sirna zabił komórki nowotworowe poprzez wywołanie apoptozy. RNAi ukierunkowana na Met wywołała supresję zależnego od HGF/SF rozpraszania jak również zależnej od ligandu aktywności inwazyjnej i rozwoju komórek guza. Infekcja Met sirna również zniosła dalszą sygnalizację Met do komórek takich jak Akt i p44/42 MAPK. Co ważne, apoptozę wywołaną przez Met sirna skorelowano z tumorogennością in vivo. Doguzowa infekcja wektorów adenowirusowych c-met sirna wywołała znaczne zmniejszenie rozwoju guza. A zatem Met RNAi jest skuteczną bronią do ukierunkowywania ekspresji Met i celowania w nowotwory c- Met<+>. [0005] Pomimo opisanych rozwiązań i wiedzy odnośnie tenascyny-c, która jest silnie eksprymowana w tkankach nowotworowych większości złośliwych guzów włącznie z guzami mózgu, nadal istnieje zapotrzebowanie na utworzenie nowej technologii, w której wykorzystany zostanie ATN-RNA, dwuniciowy RNA z sekwencją nukleotydową homologiczną do mrna tenascyny-c. Nadal istnieje potrzeba stworzenia technologii, którą będzie można stosować w dziedzinie naciekania nowotworów mózgu, których nie można usunąć chirurgicznie, sposobu, w którym dsrna: ATN-RNA stosuje się do supresji ludzkich guzów mózgu poprzez inhibicję syntezy tenascyny-c z jednoczesnym brakiem wpływu na zależność ciśnienia-objętości śródczaszkowej i bez jakiejkolwiek miejscowej lub ogólnej odpowiedzi zapalnej.

4 3 [0006] Celem wynalazku jest zastosowanie interferencyjnego RNA w celu zablokowania ekspresji TN-C i jej wpływu na rozwój złośliwych nowotworów mózgu u ludzi, i co za tym idzie w celu supresji guzów mózgu u ludzi. [0007] W wynalazku osiągnięto przykład wykonania takiego ustalonego celu i rozwiązanie problemów opisanych w stanie techniki odnośnie leczenia i inhibicji komórek nowotworowych z wysoką selektywnością inhibicji TN-C za pomocą ATN-RNA. [0008] Przedmiotem wynalazku jest sekwencja dwuniciowego ATN-RNA, charakteryzująca się tym, że zawiera fragment sekwencji mrna tenascyny-c z nukleotydami od 406 do 569 i tworzy dwuniciowy ATN-RNA (dsrna) z komplementarną sekwencją RNA, w której fragment z komplementarnym RNA ma długość ponad 150 par zasad i w której sekwencja ATN-RNA powoduje spadek ekspresji genu kodującego tenascynę-c, opóźniając rozwój guza, i w której sekwencja dsrna o 100 do 200 nt jest dodawana, i tym, że z tej części mogą się tworzyć dowolne mniejsze fragmenty o nt. Korzystnie, sekwencję wybrano spośród sekwencji przedstawionych w SEQ. ID Nr 1. [0009] Kolejnym przedmiotem wynalazku jest sekwencja dwuniciowego ATN-RNA zawierająca fragment sekwencji mrna tenascyny-c z nukleotydami od 406 do 569 i tworząca dwuniciowy ATN-RNA (dsrna) z komplementarną sekwencją RNA, w której fragment z komplementarnym RNA ma długość ponad 150 par zasad i w której sekwencja ATN-RNA powoduje spadek ekspresji genu kodującego tenascynę-c, opóźniając rozwój guza, do zastosowania w sposobie medycznego leczenia guzów mózgu u ludzi, wytwarzających tenascynę-c, korzystnie do guzów mózgu. Korzystnie, sekwencję wybrano spośród sekwencji przedstawionych w SEQ. ID Nr. 1 i jest ona wprowadzana do wnęki resekcyjnej w miejscu, z którego usunięto stały guz mózgu. Korzystnie, etap podawania przeprowadza się poprzez iniekcję i korzystnie terapeutycznie skuteczna ilość sekwencji ATN-RNA jest podawana w ilości od 80 do 200 mikrogramów. Korzystnie, guz jest guzem mózgu u człowieka, w szczególności gwiaździakiem mózgu lub glejakiem wielopostaciowym lub gwiaździakiem lub gwiaździakiem anaplastycznym lub skąpodrzewiakogwiaździakiem anaplastycznym lub skąpodrzewiakiem. Korzystnie, sekwencja jest wprowadzana do ograniczonej wnęki resekcyjnej w miejscu, z którego usunięto stały guz mózgu. [0010] Kolejnym przedmiotem wynalazku jest zestaw do zastosowania w inhibicji komórki nowotworowej, która eksprymuje tenascynę-c, zawierający odczynniki i komponenty do zastosowania w leczeniu guza mózgu, charakteryzujący się tym, że zawiera fragment sekwencji mrna tenascyny-c z nukleotydami od 406 do 569 i tworzy dwuniciowy ATN-RNA (dsrna) z komplementarną sekwencją RNA, w którym fragment z komplementarnym RNA ma długość ponad 150 par zasad i w którym sekwencja ATN- RNA powoduje spadek ekspresji genu kodującego tenascynę-c, opóźniając rozwój guza, w którym wiąże się on z tenascyną-c w terapeutycznie skutecznej ilości.

5 4 Korzystnie, sekwencję wybrano spośród sekwencji przedstawionych w SEQ. ID Nr 1, i zestaw stosuje się do guza mózgu u człowieka, w szczególności gwiaździaka mózgu lub glejaka wielopostaciowego lub gwiaździaka lub gwiaździaka anaplastycznego lub skąpodrzewiakogwiaździaka anaplastycznego lub skąpodrzewiaka. [0011] Kolejnym przedmiotem wynalazku jest sposób otrzymywania zestawu, w którym zestaw jest stosowany w inhibicji komórki nowotworowej, która eksprymuje tenascynę, charakteryzujący się tym, że ATN-RNA otrzymuje się poprzez transkrypcję ATN-DNA z polimerazami T7/T3 i dostarcza bezpośrednio do chirurgicznie wykonanej wnęki resekcyjnej pacjentów ze złośliwym guzem mózgu, i w którym plazmid zawierający DNA TN-C jest rozszczepiany przez HindIII lub EcoRI, i ATN-RNA jest syntezowany in vitro z polimerazami RNA T7 i T3, i w którym całe RNA z tkanek mózgu, jajników i jelit jest izolowane i przeprowadzana jest odwrócona transkrypcja, a następnie powstałe cdna amplifikuje się starterami komplementarnymi z tenascyną-c i dehydrogenazą aldehydu 3- fosfoglicerynowego, GAPDH jako kontrolą wewnętrzną w reakcji PCR. Korzystnie, dwie nici RNA otrzymuje się oddzielnie i znakuje [ 32 P-γ] ATP i kinazą T4 RNA w 37 C w ciągu 45 min, następnie po denaturacji i renaturacji (50 mm Tris-HCl ph 7,5, 50 mm NaCl, 95 C przez 3 min., 75 C przez 30 min. i powolne studzenie przez 4 godz. do 25 C) stabilność oznakowanego izotopowo dsrna (2 x 10 4 cpm/reakcję) oznaczono w 90-µl ekstrakcie ludzkiego guza mózgu, który uzyskano poprzez homogenizację tkanki w 10 mm buforze Tris-HCl o ph 7,5, sonikację (3 x 15 sek.) i eliminację szczątek poprzez odwirowywanie z obr./min. przez 3 min. i w którym mieszaninę reakcyjną inkubuje się w 25 C, i 10µl części usuwa się w określonych momentach, następnie reakcje są zatrzymywane poprzez dodanie roztworu obciążającego (30% glicerolu, 0,25% błękitu bromofenolowego, 0,25% cyjanianu ksylenu, 1 x TEB) i zamrożenie w ciekłym azocie, a następnie przeprowadza się analizę za pomocą elektroforezy w 10% żelu poliakryloamidowym z 7 M mocznika, dsrna oznakowane izotopowo jest wykrywane i zliczane za pomocą analizy fosfoimagerem. Korzystnie, powstały cdna jest amplifikowany starterami komplementarnymi z tenascyną-c (TN1: AGAGAACCAGCCAGTGGTGT, TN2: GCCTGCTCCTGCAGTACATT) i dehydrogenazą aldehydu 3-fosfoglicerynowego, GAPDH (G1: GGGTGGAGCCAAACGGGTC, G2: GGAGTTGCTGTTGAAGTCGCA) jako kontrolą wewnętrzną w reakcji PCR, w którym reakcję PCR zainicjowano poprzez denaturację w 94 C przez 2 min., denaturację w 55 przez 1 min., wydłużanie w 72 przez 30 sek., po czym nastąpiło 30 cykli i równe objętości amplifikowanych produktów poddano elektroforezie na 1,5% żelu agarozowym i zabarwiono bromkiem edytyny. [0012] Załączone figury ułatwiają lepsze zrozumienie natury niniejszego wynalazku. Figura 1 przedstawia sekwencje RNA wykorzystywane w terapii - ATN-RNA, przy czym fragment dwuniciowego RNA (dsrna) jest dopasowany do pozycji nukleotydowych w N-C mrna.

6 5 Figura 2 przedstawia obraz tomografii komputerowej (CT) guza ludzkiego mózgu zaznaczonego linią przerywaną (mężczyzna, W.F., 53 lata), (A) przed operacją, z guzem w obszarze czołowo-ciemieniowym (glejak wielopostaciowy) i (B) cztery tygodnie później, całkowita resekcja guza i zmiany ischemiczne. Strzałki wskazują miejsca zastosowania ATN-RNA. Figura 3 przedstawia obraz rezonansu magnetycznego (MRI) guza ludzkiego mózgu zakreślonego linią przerywaną (kobieta, D.M., 28 lat), (A) przed operacją, z guzem w obszarze czołowo-skroniowym (glejak wielopostaciowy) penetrującym do środkowej części mózgu i (B) osiem tygodni później, nawrót guza głównie w różnych miejscach zastosowania ATN-RNA. Strzałki wskazują miejsca iniekcji ATN-RNA. Figura 4 przedstawia obraz tomografii komputerowej (CT) guza ludzkiego mózgu zaznaczonego linią przerywaną (mężczyzna, O.A., 49 lat), (A) przed operacją, z guzem w obszarze ciemieniowo-skroniowym przenikającym do środkowej części mózgu (glejak wielopostaciowy) i (B) pięć tygodni później, nawrót guza, zmiany ischemiczne i obrzęk mózgu. Strzałki wskazują miejsca aplikacji ATN-RNA. Figura 5 przedstawia obraz tomografii komputerowej, CT (A) i obrazowania metodą rezonansu magnetycznego, MRI (B) pacjenta (mężczyzna, G.L., 46 lat) z glejakiem wielopostaciowym ludzkiego mózgu. CT (A) przedstawia GBM przed operacją w lewym czołowo-ciemieniowym obszarze przenikającym do obszaru centralnego (linia kropkowana). MRI (B) zarejestrowany 12 tygodni po operacji przedstawia nawrót guza w dużej odległości od miejsc aplikacji ATN-RNA. Strzałki wskazują miejsca iniekcji ATN- RNA. Figura 6 przedstawia obrazy tomografii komputerowej (CT) gwiaździaka rozlanego o II stopniu złośliwości wg WHO u pacjenta (mężczyzna, K.M., 32 lata) przed (A) i po (B) operacji. Panel (a) przedstawia glejak mózgu z efektem znacznego zajęcia przestrzeni i z przemieszczeniem układu komór w obszarze czołowo-ciemieniowym (linia przerywana). Panel (B) przedstawia CT 10 tygodni po resekcji guza i aplikacji ATN-RNA. Ukazuje on cofnięcie efektu zajęcia przestrzeni i pooperacyjne zmiany ischemiczne (linia przerywana). Obszar gwiaździaka zanikł wokół miejsc iniekcji ATN-RNA. Figura 7 przedstawia analizę RT-PCR RNA wyizolowanego z tkanek ludzkiego glejaka niedojrzałego i hodowanych ex vivo komórek GBM transfekowanych ATN-RNA. cdna amplifikowano przy użyciu starterów komplementarnych z TN-C (fragment DNA o długości 300 pz) i GAPDH (fragment DNA o długości 500 pz) jako kontrolami wewnętrznymi. (a) Produkty PCR oddzielono za pomocą 6% PAGE z 7 M mocznikiem, po czym przeprowadzono barwienie bromkiem etydyny. Pasmo 1: znacznik masy cząsteczkowej. Reakcję RT-PCR przeprowadzono z RNA wyizolowanym z linii granicznej (pasmo 2) i centralnej części tkanki GBM (pasmo 3), hodowanych komórek GBM transfekowanych ATN-RNA (pasmo 4).

7 6 (b) Analiza na żelu agarozowym (1,5%) produktów PCR TN-C zabarwionych bromkiem etydyny komórek GBM ex vivo transfekowanych mieszanymi sirna (kontrola) i ATN- RNA. Pasmo 1: znacznik masy cząsteczkowej. Reakcję RT-PCR przeprowadzono z RNA wyizolowanym z nietransfekowanych komórek GBM (pasmo 2), transfekowanych komórek GBM z mieszanymi sirna (pasmo 3) i komórek GBM transfekowanych ATN- RNA (pasmo 4). (c) Analiza na żelu agarozowym (1,5%) produktów PCR GAPDH zabarwionych bromkiem etydyny komórek GBM ex vivo transfekowanych mieszanymi sirna (kontrola) i ATN-RNA. Pasmo 1: znacznik masy cząsteczkowej. Reakcję RT-PCR przeprowadzono z RNA wyizolowanym z nietransfekowanych komórek GBM (pasmo 2), transfekowanych komórek GBM z mieszanymi sirna (pasmo 3) i komórek GBM transfekowanych ATN- RNA (pasmo 4). Figura 8 przedstawia zależną od czasu stabilność ATN-RNA w ekstrakcie tkanki GBM. A. Autoradiogram elektroforezy z 10%-owym żelem poliakrylamidowym z 7 M mocznikiem oznakowanego 32 P ATN-RNA inkubowanego w ekstrakcie ludzkiego guza mózgu (GBM) w 25 C w różnych momentach. Zliczanie ilościowe dsrna oszacowano za pomocą analizy fosfoimagerem (Image-Quant). Pozostały ATN-RNA, który nie uległ rozpadowi wyrażono w procentach. B. Pozostałe ilości ATN-RNA po inkubacji w ekstrakcie GBM jako funkcja czasu leczenia. Figura 9 przedstawia analizę znakowanych 32 P hydrolizowanych produktów ATN-RNA (163 pz) z ludzkim DICER z elektroforezy na 10%-owym poliakrylamidowym żelu z 7 M mocznikiem. Wśród różnych fragmentów RNA widoczna jest frakcja oligonukleotydu z 20 nt. Figura 10 przedstawia wykres ukazujący różnice w czasach przeżycia w zależności od diagnozy histopatologicznej. Figura 11 przedstawia obrazy rezonansu magnetycznego (MRI) nawracającego glejaka mieszanego w postaci skąpodrzewiakogwiaździaka (WHO II) pacjenta C.R. (mężczyzna, 48 lat) w obszarze czołowo-ciemieniowym A - powracający guz po 32 tygodniach (zakreślony linią przerywaną) po pierwszej operacji. B - 4 tygodnie po ponownej operacji, nie ma widocznych żadnych nawracających tkanek guzowych. Linia przerywana wskazuje pooperacyjną lożę ischemiczną. C - 28 tygodni po ponownej operacji, brak oznak nawrotu guza. D - 56 tygodni po operacji. Zaznaczono ischemiczną lożę pooperacyjną (linia przerywana). Linia przerywana wskazuje) przed ponowną operacją.; B - 8 tygodni po ponownej operacji. Linia przerywana wskazuje pooperacyjną lożę ischemiczną, C - 40 i D - 72 tygodnie po operacji. Nie widać żadnego nawrotu guza. Zastosowanie nawrotu glejaka. Strzałki wskazują miejsce iniekcji ATN-RNA. Figura 12 przedstawia obrazy rezonansu magnetycznego (MRI) nawracającego skąpodrzewiaka mózgu (WHO II) pacjenta T.K. (kobieta, 53 lata) 5 lat po pierwszej operacji. A- guz przenika do ciała modzelowatego (linia przerywana) przed ponowną

8 7 operacją; B - 8 tygodni po ponownej operacji. Linia przerywana wskazuje pooperacyjną lożę ischemiczną, C - 40 i D - 72 tygodnie po operacji. Nie widać żadnego nawrotu guza. Aplikacja ATN-RNA wskazana strzałkami. Figura 13 przedstawia obrazy CT i MR glejaka wielopostaciowego (WHO IV) pacjenta W.G. (mężczyzna, 46 lat) A - CT wykazuje guz mózgu w prawym obszarze skroniowociemieniowym (linia przerywana). Przemieszczenie struktur środkowych w kierunku przeciwnej półkuli wywołane jest wzmożonym ciśnieniem śródczaszkowym.; B - MRI 16 tygodni po usunięciu guza (linia przerywana), C - MRI wykonany 64 tygodnie po operacji. Nie ma objawów nawrotu GBM. Strzałki wskazują obszar aplikacji ATN-RNA. Figura 14 przedstawia obrazy CT i MR glejaka wielopostaciowego (WHO IV) pacjenta W.D. (mężczyzna, 48 lat). A - CT wykazuje guza mózgu w prawym obszarze skroniowym (linia przerywana) i przemieszczenie układu komór w kierunku lewej półkuli i obrzęk mózgu, B- MRI wykonany 16 tygodni po częściowym usunięciu guza przedstawia miejscowy nawrót guza w pobliżu miejsc iniekcji ATN-RNA. Nie ma przemieszczenia struktur środkowych ani układu komór, C - MRI 36 tygodni po operacji ujawnia nawrót guza w obszarze skroniowym. Układ komór nie jest przemieszczony, lecz zaobserwowano niewielki ucisk w prawej półkuli mózgu. Strzałki wskazują miejsca iniekcji ATN-RNA. Figura 15 przedstawia obrazy CT (A) i MR (B, C) anaplastycznego gwiaździaka (WHO III) pacjenta K.B. (mężczyzna, 44 lata). A - CT przed operacją przedstawia mózg w prawym obszarze czołowym z przenikającym lewym płatem czołowym (linia przerywana) i obrzęk mózgu, B - obraz MRI (w rzucie strzałkowym) przedstawia guz w lewym obszarze czołowym przenikający do obszaru środkowego (linia przerywana), C - MRI 40 tygodni po operacji wykazuje zmiany mózgowe po całkowitej resekcji guza (linia przerywana). Nie nastąpił nawrót guza. Strzałki wskazują miejsce iniekcji ATN-RNA. [0013] Poniżej przedstawiono przykłady wykonania wynalazku zdefiniowanego powyżej. PRZYKŁADY Otrzymywanie RNA [0014] ATN-RNA otrzymano poprzez transkrypcję ATN-DNA z polimerazą T7 i dostarczono bezpośrednio do chirurgicznie wykonanej wnęki resekcyjnej pacjentów ze złośliwym guzem mózgu. [0015] Plazmid zawierający DNA TN-C rozszczepiono za pomocą HindIII lub EcoRI. ATN-RNA syntezowano in vitro z polimerazami RNA T7 i T3. Dwie nici RNA otrzymano oddzielnie. Pod kątem stabilizacji nić RNA oznakowano [ 32 P-γ] ATP i kinazą T4 RNA w 37 C w ciągu 45 min. Po denaturacji i renaturacji (50 mm Tris-HCl ph 7,5, 50 mm NaCl, 95 C przez 3 min., 75 C przez 30 min. i powolne studzenie przez 4 godz. do 25 C). Stabilność oznakowanego izotopowo dsrna (2 x 10 4 cpm/reakcję) oznaczono w 90-µl ekstrakcie ludzkiego guza mózgu. Ekstrakt uzyskano poprzez homogenizację tkanki w 10 mm buforze Tris-HCl o ph 7,5, sonikację (3 x 15 sek.) i eliminację szczątek poprzez odwirowywanie z obr./min. przez 3 min. Mieszaninę reakcyjną inkubowano w

9 8 25 C i 10-µl części usunięto w określonych momentach. Reakcje zatrzymano poprzez dodanie roztworu obciążającego (30% glicerolu, 0,25% błękitu bromofenolowego, 0,25% cyjanianu ksylenu, 1 x TEB) i zamrożenie w ciekłym azocie, a następnie przeanalizowano za pomocą elektroforezy w 10% żelu poliakryloamidowym z 7 M mocznika. dsrna oznakowane izotopowo wykryto i zliczono za pomocą analizy fosfoimagerem (Molecular Dynamics, Sunnyvale, Kalifornia) [Fig. 8 i 9]. Inhibicja tenascyny-c w wyhodowanych komórkach GBM [0016] W celu transfekcji i oznaczeń wyciszenia genów ex vivo tkankę guza mózgu (poddaną fragmentacji) ponownie zawieszono w podłożu i przeniesiono na 6-studzienkowe płytki. Komórki hodowano w DMEM (GIBCO BRL) uzupełnionym 10% FCS, penicyliną (100 µg/ml) i streptomycyną (100 mg/ml) (Invitrogen). [0017] Komórki przy 50% konfluencji transfekowano w obecności oligofektaminy (Invitrogen) z ATN-RNA i dwoma kontrolnymi mieszanymi sirna: sirna (I: nić sensowna - 5 GUUGCUCUG GAAAACUCAUTT3, nić antysensowna - 3 TTCAACGAGACCUUUUGAGUA5 ; i II: nić sensowna - 5 UUAUUGUCUGG UAUAGUGCTT3, nić antysensowna - 3 TTAAUAACAGACCAUAUCACG5 ). Po kolejnych 24 godzinach komórki zebrano w celu izolacji RNA. Przeprowadzono analizę RT-PCR. Izolowanie RNA i analiza RT PCR [0018] Całość RNA z tkanek guza mózgu, jajników i jelita wyizolowano za pomocą zestawu Ambion. Odwróconą transkrypcję przeprowadzono przy wykorzystaniu: 2 µg RNA, losowego startera i zestawu do odwrotnej transkryptazy RevertAid H Minus M- MuLV reverse transcriptase (Fermentas) zgodnie z zaleceniami producentów. Powstały cdna amplifikowano starterami komplementarnymi z tenascyną-c (TN1: AGAGAACCAGCCAGTGGTGT, TN2: GCCTGCTCCTGCAGTACATT) i dehydrogenazą aldehydu 3-fosfoglicerynowego, GAPDH (G1: GGGTGGAGCCAAACGGGTC, G2: GGAGTTGCTGTTGAAGTCGCA) jako kontrolą wewnętrzną w reakcji PCR. Reakcję PCR zainicjowano poprzez denaturację w 94 C przez 2 min., denaturację w 55 przez 1 min., wydłużanie w 72 przez 30 sek., po czym nastąpiło 30 cykli. Równe objętości amplifikowanych produktów poddano elektroforezie na 1,5% żelu agarozowym i zabarwiono bromkiem etydyny. Stabilność ATN-RNA in vitro [0019] Plazmid zawierający DNA TN-C rozszczepiono za pomocą HindIII lub EcoRI. ATN-RNA syntezowano in vitro z polimerazami RNA T7 i T3. Dwie nici RNA otrzymano oddzielnie [1]. Nić RNA znakowano [ 32 P-γ] ATP i kinazą T4 RNA w 37 C przez 45 min. Po denaturacji obu nici RNA (oznakowanej i nieoznakowanej) stabilność oznakowanego izotopowo dsrna (2 x 10 4 cpm/próbę) wyznaczono w 90-µl ekstrakcie ludzkiego guza mózgu, który uzyskano poprzez homogenizację 100 mg fragmentu tkanki w 1 ml 10 mm buforu Tris-HCl o ph 7,5, sonikację (3 x 15 sek.) i eliminację szczątek poprzez

10 9 odwirowywanie z obr./min. przez 3 min. Mieszaninę reakcyjną (90 ul) inkubowano w 25 C i 10-µl części usunięto w określonych momentach. Reakcję zatrzymano poprzez dodanie roztworu obciążającego (30% glicerolu, 0,25% błękitu bromofenolowego, 0,25% cyjanianu ksylenu) i zamrożenie w ciekłym azocie, i przeanalizowano za pomocą elektroforezy w 10% żelu poliakryloamidowym z 7 M mocznika. [ 32 P] dsrna wykryto i zliczono za pomocą analizy fosfoimagerem (Image Quant). [0020] W wielu nowotworach zwiększenie ilości niektórych czynników wzrostu lub ich receptorów lub deregulacja wewnątrzkomórkowych szlaków przekazywania sygnałów, reprezentują kluczowe elementy w procesie złośliwej transformacji i progresji zdrowych komórek w komórki guza, co prowadzi do niekontrolowanej proliferacji i spadku apoptozy. Zmienione poziomy ekspresji niektórych genów odgrywają zasadniczą rolę w kilku stanach patologicznych. Złośliwe glejaki selektywnie eksprymują czynniki, które nie występują w zdrowej tkance OUN, między innymi tenascynę-c (TN-C). TN-C jest wszechobecnie eksprymowana przez glejaki silnie złośliwe, lecz nie jest eksprymowana w zdrowym mózgu. Jest to duża glikoproteina macierzy zewnątrzkomórkowej eksprymowana na różnych etapach różnicowania. Poziom TN-C dobrze koreluje się z procesem wzmożenia onkogenezy i wspomaga złośliwą transformację, niekontrolowaną proliferację, przerzuty, angiogenezę i "ucieczkę" immunologiczną guza [32]. [0021] Wzrost całkowitej ilości TN-C może aktywować proliferację komórek poprzez bezpośrednie wiązanie się i aktywację receptora naskórkowego czynnika wzrostu przez powtórzenia TN-C zbliżone do receptora naskórkowego czynnika wzrostu. Bierze ona udział w interakcjach komórka-macierz zewnątrzkomórkowa, które są kluczowym wyznacznikiem onkogenezy, scharakteryzowanej licznymi oddziaływaniami zrębu nowotworu. Ekspresja TN-C i jej wariantów obróbkowych koreluje się z podwyższoną migracją komórek, remodelingiem tkanek, angiogenezą i miejscowym naciekaniem komórek guzów różnych nowotworów na normalne tkanki. Jest to jeden z głównych powodów, dla których wyniki dla pierwotnych guzów ośrodkowego układu nerwowego, włącznie z glejakiem wielopostaciowym (GBM), najpowszechniejszym i najbardziej śmiertelnym pierwotnym złośliwym guzem mózgu u osób dorosłych pozostają nie do przyjęcia. Ponieważ niepowodzenie leczenia jest zazwyczaj spowodowane niewystarczającą miejscową kontrolą miejsca resekcji chirurgicznej, nadal konieczne są nowe terapie miejscowe. Rozwój skuteczniejszych terapii alternatywnych będzie kluczowy dla poprawy czasu przeżycia pacjentów z takimi guzami. Ponieważ wiadomo, że większość złośliwych glejaków jest oporna na chemio i radioterapię z powodu inhibicji szlaków apoptycznych, do ich leczenia odpowiednia może być interferencja RNA (RNAi). [0022] RNAi jest swoistym wobec sekwencji, zachowanym szlakiem, w którym dwuniciowe cząsteczki RNA (dsrna) zidentyfikowano jako mediatory wyciszania swoistych genów funkcjonalnych w różnych organizmach eukariotycznych [33]. dsrna przetwarza się w małe RNA o długości nukleotydów za pomocą enzymu Dicer rybonukleazy III (RNazy III). Małe RNA są determinantami swoistości szlaku, łączącymi

11 10 się w rybonukleinowy kompleks wyciszający (RISC), wielobiałkową jednostkę, która jest naprowadzana do komplementarnego RNA, co skutkuje wyciszeniem komunikatu. [0023] Co interesujące, RNAi nie jest terapią genową, ponieważ wykorzystuje insercję genów do komórek osobnika, które następnie produkują białko w celu leczenia choroby. Wadą terapii genowej jest to, że trudno wyznaczyć, kiedy gen przestaje wytwarzać białko. Terapia RNAi jest jednakże iniekcją kontrolowanej ilości RNA. ATN-RNA jest lekiem na bazie RNA, który jest zbliżony do naturalnego produktu występującego w organizmie człowieka, i ponieważ jest to RNA, jest mało prawdopodobne, by wywołał on alergiczne lub immunogeniczne reakcje u pacjentów. [0024] W celu zmniejszenia ilości TN-C w guzie mózgu zastosowano interwencję interferencyjnym RNA (irnai). Interwencja interferencyjnym RNA (irnai) z ATN-RNA jest obiecującą miejscową wspomagającą terapią po operacji dla pacjentów z glejakami złośliwymi. Obejmuje ona bezpośrednie dostarczanie do wyciętego obszaru tkanki guza terapeutycznego dsrna, które wywołuje skutki interferencji RNA poniżej miejsca aplikacji i swoiście obniża syntezę TN-C. Jest to miejscowa terapia, która może poprawić miejscowe zwalczanie i ogólne wyniki pacjentów z glejakiem złośliwym. Miejscowo podawana terapia zapewnia zdolność uzyskania większego skutecznego stężenia w pustce po guzie poprzez opływanie bariery mózg-krew, jednocześnie ograniczając potencjalną ekspozycję ogólnoustrojową na degradację leku. A zatem inwazyjne komórki guza, które uległy migracji poza obszar penetracji innych miejscowo podawanych terapeutyków takich jak biodegradowalne opłatki lub przeciwciała monoklonalne, można skutecznie leczyć za pomocą irnai. [0025] Przygotowano dsrna dopasowujące się do TN-C mrna, zwane ATN-RNA (Fig. 1). Przyjęto, że ludzkie DICER 13 [17] będzie wiązało i rozszczepiało ATN-RNA na formy dsrna o nukleotydach, które, jako część mechanizmu RISC, mogą celować w wiele miejsc mrna i wzmagać efekt wyciszania mrna. Wybrana sekwencja dsrna jest wystarczająco krótka, by uniknąć działań niepożądanych i jest wystarczająco długa, by była odpowiednim źródłem małych interferujących RNA (sirna). Zasugerowano, że w celu uzyskania działania zbliżonego do działania dsrna wymagane jest ponad 200 razy więcej sirna [18, 19, 31]. [0026] W tych badaniach wykorzystano dwuniciowe interferujące RNA (dsrna) w celu zmniejszenia ekspresji tenascyny-c w komórka guza mózgu. RNAi wstrzykiwano do loży pooperacyjnej 48 pacjentów. Badanie kontrolne za pomocą MRI i CT jasno wskazuje na wydłużony czas przeżycia z lepszą jakością życia. Ta technologia jest zwana interwencją za pomocą RNAi (irnai) (Tabela 1). [0027] Przygotowano dsrna (ATN-RNA) z ok. 160 nt o sekwencji komplementarnej z TN-C i wykazano swoistość sekwencji in vitro i ex vivo względem TN-C mrna. ATN- RNA zastosowano u 48 pacjentów po resekcji guza mózgu.

12 11 Tabela 1. Pacjenci z guzami mózgu (Stopień II-IV) po resekcji i leczeniu ATN-RNA. Pacjentów 23, 27, 35 i 42 (oznaczonych *) leczono dwukrotnie ATN-RNA po kolejnej operacji. AA-Astrocytoma Anaplasticum (gwiaździak anaplastyczny), AF-Astrocytoma fibrylare (gwiaździak włókienkowy), ODG-oligodendrioglioma (skąpodrzewiak), R- nawrót Nr pacjenta Imię pacjenta Płeć Wiek (lata) Stopień złośliwości glejaka Lokalizacja guza mózgu l DM K 28 IV czołowo-skroniowa/naciek w ciało modzelowate Pole (mm) Ф70 2 WJ K 62 IV czołowo-ciemieniowa 46x40 3 WF M 53 IV czołowo-ciemieniowa 47x36 4 SM M 54 IV skroniowa 75x50 guza 5 GE K 48 IV czołowo-ciemieniowoskroniowa 6 OA M 49 IV ciemieniowoskroniowa/naciek w ciało modzelowate 73x52 56x54 7 GL M 46 IV czołowa 60x50 8 KM M 32 II czołowo-ciemieniowoskroniowa 78x64 9 CZ K 53 IIIR czołowa 43x44 10 JR M 36 AF II czołowo-ciemieniowoskroniowa 11 TK K 52 ODG II czołowa/naciek w ciało modzelowate 80x56 72x44 12 RJ M 60 IV czołowa 60x40 13 ZM M 47 III ciemieniowa 70x50 14 MJ M 67 IV czołowo-skroniowa 55x60 15 KM K 49 III/IV czołowa 60x45 16 BZ M 53 IIAF czołowa/naciek w ciało modzelowate 60x70

13 12 Nr pacjenta Imię pacjenta Płeć Wiek (lata) Stopień złośliwości glejaka Lokalizacja guza mózgu 17 WK K 69 IIIAA ciemieniowa/naciek w ciało modzelowate Pole (mm) 34x25 18 WG M 46 IV ciemieniowo-skroniowa 57x47x50 19 WD K 48 IV skroniowa 50x40 guza 20 PS K 43 II czołowo-ciemieniowoskroniowa 100x80x80 21 KJ K 70 IV ciemieniowa 60x42 22 JB K 48 IV czołowo-ciemieniowa 67x69x62 23* CW M 49 IIIR/IV czołowo-ciemieniowa Ф CR M 48 II czołowo-ciemieniowa 80x50 25 BM M 75 IV czołowo-ciemieniowoskroniowa 71x46x64 26 DM K 55 IV ciemieniowo-skroniowa 60x50x60 27* SM M 54 IV czołowa 60x40x50 28 RK M 45 IV ciemieniowo-skroniowa 70x50x40 29 TZ M 49 IV czołowo-ciemieniowoskroniowa 90x50x60 30 WK M 54 IV czołowa 75x50 31 KB K 44 III czołowa 50x60 32 JS M 37 ARIII czołowa 30x50 33 HJ M 65 IV czołowa 60x30x70 34 DA K 40 Oponiak II ciemieniowo-skroniowa 50x40 35* KJ M 66 IV czołowo-skroniowa 60x40 36 KB M 55 IV czołowa 50x40 37 LD K 40 IIIR czołowo-skroniowa 70x40 38 ST K 63 IIIR czołowa 80x60x50 39 JT K 59 IV naciek w ciało modzelowate 40x50x30

14 13 Nr pacjenta Imię pacjenta Płeć Wiek (lata) Stopień złośliwości glejaka Lokalizacja guza mózgu Pole (mm) 40 BK K 54 III ciemieniowa 55x40x55 41 PH K 35 IIIAA czołowo-ciemieniowa 60x40x40 42* KA M 59 IV ciemieniowo-potyliczna 50x40x40 43 KE K 54 IV skroniowa Ф ND K 61 IVR czołowa Ф40 guza 45 TT M 58 IVR czołowa/naciek w ciało modzelowate 72x66x50 46 GL M 51 IV czołowa 69x56x65 47 LB M 64 IV czołowa 85x50x65 48 LL M 29 III ciemieniowa 80x50x50 Tabela 2. Liczba pacjentów z różnymi formami pierwotnych lub nawracających guzów mózgu leczonych przy użyciu ATN-RNA. Guz mózgu Stopień złośliwości Liczba pacjentów leczonych wg WHO Guz pierwotny Guz nawracający Glejak wielopostaciowy IV Gwiaździak anaplastyczny III 3 3 Skąpodrzewiak II - 3 Mieszany II - 3 Anaplastyczny III - 1 Gwiaździak II 2 6 Tabela 3. Średni czas przeżycia (tygodnie) 46 pacjentów z guzem mózgu leczonych ATN- RNA. * liczba przebadanych Guz mózgu Stopień złośliwości wg WHO Nr Pacjenci średni pacjenta (%) przeżycia (tygodnie) czas Zakres średniego czasu Glejak wielopostaciowy IV 25/17* 54,3 55, Gwiaździak anaplastyczny III 6/5* 13,1 74,

15 14 Anaplastyczny III 1/1* 2, skąpodrzewiakogwiaździak Skąpodrzewiak II 3/2* 6, Gwiaździak o niskim stopniu złośliwości Mieszany skąpodrzewiakogwiaździak II 8/4* 17, II 3/1* 6, [0028] Skuteczność leczenia ATN-RNA oceniono na podstawie badań kontrolnych obejmujących ogólny i neurologiczny stan jak również badania polegające na neuroobrazowaniu za pomocą CT i MRI przeprowadzonych w comiesięcznych okresach po leczeniu. Od pacjentów uzyskano zgodę na leczenie. [0029] W przypadku mężczyzny w wieku 53 lat (Nr 3 w Tabeli 1), nie zaobserwowano nawrotu glejaka po leczeniu za pomocą ATN-RNA (Fig. 2). Obraz CT przed operacją (Fig. 2A) wykazuje proces rozwoju nowotworu w obszarze czołowo-ciemieniowym (GBM). Cztery tygodnie później wskazuje on resekcję całkowitej masy guza i pooperacyjne zmiany ischemiczne (Fig. 2B). Badanie kontrolne ujawniło, że pacjent jest w dobrym stanie. Aż do 14 miesięcy po operacji nie nastąpił nawrót guza. W dwóch pozostałych przypadkach (Nr 1 w Tabeli 1: kobieta, 28 lat, Fig. 3 i Nr 6 w Tab. 1: mężczyzna, 49 lat, Fig. 4), wyniki są nieco inne. MRI nawracającego glejaka przed operacją ukazuje guz (GBM) w obszarze czołowo-skroniowym przenikający do obszaru środkowego (Fig. 3A), lecz dwa miesiące po leczeniu za pomocą ATN-RNA nawrót guza jest widoczny tylko w miejscach odległych od aplikacji ATN-RNA (Fig. 3B). Podobny obraz CT uzyskano dla przypadku Nr 6 w Tabeli 1: GBM w obszarze ciemieniowo-skroniowym przenikający do obszaru środkowego (Fig. 4A). Pięć tygodni po operacji zaobserwowano odległy nawrót guza, zmiany ischemiczne i ograniczony obrzęk mózgu (Fig. 4B). Dla wszystkich tych przypadków, widoczne są wyraźne różnice w miejscach ogniskowych i oddalonych od obszaru operacji. W pobliżu punktów iniekcji oznaczonych strzałkami nie ma żadnych dowodów nawrotu guza. Jego rozwój został całkowicie zatrzymany. Jednakże można zauważyć nawrót nowotworu w miejscach odległych od miejsc iniekcji ATN-RNA w loży pooperacyjnej. Jednakże, nawrót GBM po leczeniu ATN-RNA jest dużo wolniejszy w porównaniu z pacjentami, których nie leczono za pomocą dsrna, i czas przeżycia jest w tych przypadkach dłuższy. Bardzo podobne skutki ATN-RNA zaobserwowano dla przypadku mężczyzny, w wieku 46 lat (Nr 7 w Tabeli 1). W sposób wyraźny GBM nie występuje w żyłce, którą wstrzykiwano ATN-RNA, lecz pewien nawrót zaobserwowano w dalszym obszarze (Fig. 5). Połowiczny niedowład jest widoczny tak samo jak przed operacją. Pacjent był w dobrym stanie. Najbardziej spektakularny wynik uzyskano w przypadku pacjenta: mężczyzny, wiek 32 lata (Nr 8 w Tabeli 1) z rozlanym gwiaździakiem (WHO II). Wiadomo, że ponad 70% guzów o II stopniu złośliwości ulega transformacji w guz o III i IV stopniu złośliwości w ciągu 5-10 lat. W tym przypadku gwiaździak nacieka do prawej półkuli mózgu i przenika do obszaru środkowego (Fig. 6). Naciekająca natura

16 15 tego guza nie pozwala na działanie chirurgiczne nawet w obszarach, w których możliwa jest rozległa resekcja. Obraz CT przedstawia glejak mózgu z efektem znacznego zajęcia przestrzeni i widoczne jest przemieszczenie układu komór w obszarze czołowociemieniowym (Fig. 6A). Dziesięć tygodni po aplikacji ATN-RNA, obraz CT wykazał prawie całkowitą recesję efektu zajęcia przestrzeni, zanik glejaka w obszarze iniekcji ATN-RNA. MRI 18 miesięcy po operacji nie wykazał nawrotu guza. (Fig. 6B). Nie zaobserwowano deficytu neurologicznego [31]. [0030] Swoisty wpływ ATN-RNA można zobaczyć poprzez analizę (Fig. 12). U pacjenta TK, kobiety w wieku 53 lat (Nr 11 w Tabeli 1) zdiagnozowano nawracający guz mózgu w płacie czołowym (Fig. 12A). Przeprowadzono tylko częściową resekcję guza z powodu jego nacieku do ciała modzelowatego. A zatem ATN-RNA wstrzyknięto bezpośrednio w pozostałą część guza (patrz strzałki na Fig. 12). Obraz MRI osiem miesięcy po operacji wykazał brak nawrotu nowotworu w obszarze zajętym przez guz przed operacją. Ten pacjent był w dobrym stanie [31]. Tabela 4. Porównanie średniego czasu przeżycia pacjentów z chirurgicznie wyciętymi guzami mózgu o stopniach złośliwości II-IV. Pacjentów leczono bądź to za pomocą ATN- RNA bądź za pomocą brachyterapii. Tabela obejmuje 23 pacjentów Stopień złośliwości guza Średni czas przeżycia (tygodnie) ATN-RNA brachyterapia lat Glejak/II 180,0 176, lat Glejak/II 178,0 176,0 NonGBM/III 72,3 59,0 GBM/IV 66,7 52,8 [0031] Aby udowodnić swoistość działania ATN-RNA wobec mrna tenascyny-c guza ludzkiego mózgu, przeanalizowaliśmy ekspresję natywnego mrna TN-C w komórkach GBM przy użyciu metody RT-PCR (Fig. 7). Można zobaczyć różne ilości produktów PCR mrna tenascyny w dwóch miejscach tkanki glejaka niedojrzałego i jednocześnie stały poziom mrna GAPDH w komórkach GBM transfekowanych ATN-RNA. Jest zupełnie oczywiste, że dsrna swoiście obniża ekspresję genu tenascyny-c i spowalnia rozwój guza (Fig. 7A). W celu potwierdzenia zastosowano również dwa kontrolne mieszane sirna w doświadczeniach transfekcji komórek GBM ex vivo. Widoczna jest wysoka selektywność inhibicji TN-C za pomocą ATN-RNA kontrastująca z sirna o niepowiązanej sekwencji (mieszane sirna) (Fig. 7B, pasma 3 i 4). Ponad 80% degradacji

17 16 mrna TN-C zaobserwowano w komórkach GBM transfekowanych ATN-RNA (Fig. 7A i B, pasma 4). Jako kontrolę pozytywną tego efektu przeanalizowaliśmy poziom ekspresji mrna GAPDH we wszystkich przypadkach (Fig. 7A i C). Wszystkie dane jasno wskazują, że ATN-RNA swoiście zaburza syntezę mrna TN-C w tkance GBM z bardzo dużą skutecznością i znacznie wydłuża czas przeżycia pacjenta. To, że supresję guza zaobserwowano głównie wokół miejsc iniekcji ATN-RNA a nie w odległych miejscach może sugerować albo krótkodystansową migrację ATN-RNA albo krótką żywotność dsrna. [0032] Zależną od czasu stabilność ATN-RNA w ekstrakcie tkanki GBM przedstawiono na Fig. 8 i Analizę znakowanych 32 P hydrolizowanych produktów ATN-RNA (163 pz) z ludzkim DICER z elektroforezy na 10%-owym poliakrylamidowym żelu z 7 M mocznikiem przedstawiono na Fig. 9. [0033] Różnice w zaobserwowanych skutkach ATN-RNA u sześciu osobników przebadanych w tym opracowaniu mogą być spowodowane rozmiarem nieusuwalnych tkanek guza. Nowotwór w przypadku Nr 1, Tab. 1, był większy niż ten z przypadku Nr 3, tab. 1 i jego zasadnicza część nie została usunięta. Otóż ilość dsrna można zrewidować w przyszłości. Można również rozważyć inne sposoby dostarczania dsrna, np. kraniotomię i iniekcje domózgowe [9, 10, 12, 13]. Te podejścia mają jednakże pewne ograniczenia spowodowane rozpraszaniem i trudnością z dostarczaniem RNA bezpośrednio do komórek nowotworowych w mózgu. Uważamy, że aplikacja terapeutycznego dsrna do nowotworowych komórek w mózgu przez układ naczyniowy 20 jest bardzo perspektywicznym podejściem. Otóż, zastosowaliśmy kombinację neurochirurgii w celu usunięcia większości guza i następnie bezpośredniej iniekcji RNA do pozostałych komórek nowotworowych. To podejście nazwaliśmy interwencją za pomocą interferującego RNA (irnai). Tabela 5. Rozkład pacjentów z guzem mózgu i po aplikacji ATN-RNA w oparciu o wiek i płeć. Tabela obejmuje 46 pacjentów. Kobiety Mężczyźni Wszyscy pacjenci (46) Wiek Liczba Pacjenci Liczba Pacjenci Liczba Pacjenci pacjentów (lata) pacjentów (%) pacjentów (%) pacjentów (%) ,8 1 2, , ,5 5 10, , , , , ,3 9 19,6

18 17 Tabela 6. Liczba pacjentów leczonych ATN-RNA, dla których określono klasyfikację TNM guzów. Stopień złośliwości TNMLiczba pacjentówpacjenci (%) T1 M ,1 T2 M ,3 T3 M0 9 19,6 T4 M0 6 13,0 [0034] Różnice czasu przeżycia w zależności od diagnozy histopatologicznej przedstawiono na Fig. 10 w postaci wykresu. [0035] Pacjentów cierpiących na guza mózgu zakwalifikowanych do operacji i interwencji molekularnej przyjęto do Kliniki Neurochirurgii i Neurotraumatologii Uniwersytetu Medycznego w Poznaniu. Precyzyjna lokalizacja guza została wyznaczona za pomocą tomografii komputerowej (CT) lub obrazowania metodą rezonansu magnetycznego (MRI), przed każdym zabiegiem chirurgicznym. Przeanalizowano 48 pacjentów z guzami mózgu i zdiagnozowano ich zgodnie z kryteriami WHO. Wykazali oni 25 guzów pierwotnych o IV stopniu złośliwości wg WHO, 7 o III stopniu wg WHO i 14 o II stopniu wg WHO. Po chirurgicznej resekcji RNAi poddano iniekcji do loży pooperacyjnej. [0036] Skuteczność leczenia ATN-RNA oceniono na podstawie badań kontrolnych obejmujących ogólny i neurologiczny stan jak również badania polegające na neuroobrazowaniu za pomocą CT i MRI przeprowadzonych w okresach co każde dwa miesiące po leczeniu. Zgodę na leczenie uzyskano od pacjentów - te dane przedstawiono na Fig Fig. 15.

19 18 Referencje [0037] 1. Van den Bent MJ, Stupp R, Brandes AA, Lacombe D. Current and future trials of the EORTC brain tumor group. Onkologie 2004; 27: Chiquet-Ehrismann R, Chiquet M. Tenascins: regulation and putative functions during pathological stress. Journal of Pathology 2003; 200: Hicke BJ, Marion C, Chang YF, Gould T, Lynott CK, Parma D, et al. Tenascin-C aptamers are generated using tumor cells and purified protein. Journal of Biological Chemistry 2001; 276: Pas J, Wyszko E, Rolle K, Rychlewski L, Nowak S, Zukiel R, Barciszewski J. Analysis 4 of structure and function of tenascin-c. Int J Biochem Cell Biol. 2006, 38(9): Behrem S, Zarkovic K, Eskinja N, Jonjic N. Distribution pattern of tenascin-c in glioblastoma: correlation with angiogenesis and tumor cell proliferation. Pathology Oncology Research 2005; 11: Prawitt D. RNAi knock-down mice: an emerging technology for post-genomic functional genetics. Cytogenetic Genome Research 2004; 105: Caplen NJ. Gene Therapy Progress and Prospects. Downregulation gene expression: the impact of RNA interference. Gene Therapy 2004; 11: Hall J. Unravelling the general properties of sirnas: strength in numbers and lessons from the past. Nature Reviews Genetics 2004; 5: Soutschek J, Akinc A, Bramlage B, Charisse K, Constien R, Donoghue M, et al. Therapeutic silencing of an endogenous gene by systemic administration of modified sirnas. Nature 2004; 432: Zimmermann TS, Lee AC, Akinc A, Bramlage B, Bumcrot D, Fedoruk MN, et al. RNAi-mediated gene silencing in non-human primates. Nature, published online, March 26, Pardridge WM. Intravenous, non-viral RNAi gene therapy of brain cancer. Expert Opinion on Biological Therapy 2004; 4: Howard K. First Parkinson gene therapy trial launches. Nature Biotechnology 2003;21: Caplen NJ. RNAi quashes polyq. Nature Medicine 2004; 10: Fish RJ, Kruithof EKO. Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors. BMC Molecular Biology 2004; 5: Jallo GI. Tenascin-C expression in the cyst wall and fluid of human brain tumors correlates with angiogenesis. Neurosurgery 1997; 41: Leung RK, Whittaker PA. RNA interference: from gene silencing to gene-specific therapeutics. Pharmacology & Therapeutics 2005; 107:

20 Zhang H, Kolb FA, Jaskiewicz L, Westhof E, Filipowicz W. Single processing center models for human Dicer and bacterial RNase III. Cell 2004; 118: Parrish S, Fleenor J, Xu S, Mello C, Fire A. Functional anatomy of a dsrna trigger: differential requirement for the two trigger strands in RNA interference. Molecular Cell 2000; 6: Bhargava A, Dallman MF, Pearce D, Choi S. Long double-stranded RNA-mediated RNA interference as a tool to achieve site-specific silencing of hypothalamic neuropeptides. Brain Research Protocols 2004; 13: Lage H. Potential applications of RNA interference technology in the treatment of cancer. Future Oncology 2005; 3: Zimmermann TS, Lee ACH, Akinc A, Bramlage B, Bumcrot D, Fedoruk MN, et al. RNAimediated gene silencing in non-human primates. Nature 2006; Mar 26; [Epub ahead of print]. 22. Kang CS, Zhang ZY, Jia ZF, Wang GX, Qiu MZ, Zhou HX, et al. Suppression of EGFR expression by antisense or small interference RNA inhibits U251 glioma cell growth in vitro and in vivo. Cancer Gene Therapy 2006; 13: Dev KK. Using RNAi in the clinic. IDrugs 2006; 9: Kumar P, Wu H, McBride JL, Jung KE, Kim MH, Davidson BL, Lee SK, Shankar P, Manjunath N. Transvascular delivery of small interfering RNA to the central nervous system. Nature. 2007, 448, Cantin EM, Rossi JJ. Molecular medicine: entry granted. Nature. 2007, 448, Daniels DA, Chen H, Hicke BJ, Swiderek KM, Gold L. A tenascin-c aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment. Proc. Natl. Acad. Sci. USA 2003, 100, Sarkar S, Nuttall RK, Liu S, Edwards DR, Yong VW. Tenascin-C stimulates glioma cell invasion through matrix metalloproteinase-12. Cancer Res 2006, 66, Leins A, Riva P, Lindstedt R, Davidoff MS, Mehraein P, Weis S. Expression of tenascin-c in various human brain tumors and its relevance for survival in patients with astrocytoma. Cancer 2003; 98: Pas J, Wyszko E, Rolle K, Rychlewski L, Nowak S, Zukiel R, Barciszewski J. Analysis of structure and function of tenascin-c. Int J Biochem Cell Biol. 2006, 38(9): Behrem S, Zarkovic K, Eskinja N, Jonjic N. Distribution pattern of tenascin-c in glioblastoma: Correlation with angiogenesis and tumor cell proliferation. Pathol Oncol Res 2005; 11: Zukiel R., Nowak S., Wyszko E., Rolle K., Gawronska I., Barciszewska M., Barciszewski J., Cancer Biology & Therapy 5:8, , August 2006]; 2006 Landes Bioscience; Research Paper, Suppression of Human Brain Tumor with Interference RNA Specific for Tenascin-C. 32. Cantin EM, Rossi JJ. Molecular medicine: entry granted. Nature. 2007, 448,

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

Wykorzystanie interferencji RNA w terapii wznów wysoko złośliwych nowotworów mózgu

Wykorzystanie interferencji RNA w terapii wznów wysoko złośliwych nowotworów mózgu Wykorzystanie interferencji RNA w terapii wznów wysoko złośliwych nowotworów mózgu RNA interference in therapy of high-grade cerebral neoplasms regrowth Rafał Piestrzeniewicz 1, Ryszard Żukiel 1, Stanisław

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609. (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609. (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609 (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792.2 (13) (51) T3 Int.Cl. A61K 38/17 (2006.01)

Bardziej szczegółowo

Program dotyczy wyłącznie kontynuacji leczenia pacjentów włączonych do programu do dnia 30.03.2008.

Program dotyczy wyłącznie kontynuacji leczenia pacjentów włączonych do programu do dnia 30.03.2008. załącznik nr 7 do zarządzenia Nr 36/2008/DGL Prezesa NFZ z dnia 19 czerwca 2008 r. Program dotyczy wyłącznie kontynuacji leczenia pacjentów włączonych do programu do dnia 30.03.2008. 1. Nazwa programu:

Bardziej szczegółowo

Terapeutyczne Programy Zdrowotne 2012 Leczenie glejaków mózgu Załącznik nr 6 do Zarządzenia Nr 59/2011/DGL Prezesa NFZ z dnia 10 października 2011 r.

Terapeutyczne Programy Zdrowotne 2012 Leczenie glejaków mózgu Załącznik nr 6 do Zarządzenia Nr 59/2011/DGL Prezesa NFZ z dnia 10 października 2011 r. Załącznik nr 6 do Zarządzenia Nr 59/2011/DGL Prezesa NFZ z dnia 10 października 2011 r. Nazwa programu: LECZENIE GLEJAKÓW MÓZGU ICD-10 C71 nowotwór złośliwy mózgu Dziedzina medycyny: Onkologia kliniczna,

Bardziej szczegółowo

Materiał i metody. Wyniki

Materiał i metody. Wyniki Abstract in Polish Wprowadzenie Selen jest pierwiastkiem śladowym niezbędnym do prawidłowego funkcjonowania organizmu. Selen jest wbudowywany do białek w postaci selenocysteiny tworząc selenobiałka (selenoproteiny).

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.07.2004 04740699.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.07.2004 04740699. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1658064 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.07.2004 04740699.6 (51) Int. Cl. A61K31/37 (2006.01)

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

Czym jest medycyna personalizowana w kontekście wyzwań nowoczesnej onkologii?

Czym jest medycyna personalizowana w kontekście wyzwań nowoczesnej onkologii? Czym jest medycyna personalizowana w kontekście wyzwań nowoczesnej onkologii? Wykorzystanie nowych technik molekularnych w badaniach nad genetycznymi i epigenetycznymi mechanizmami transformacji nowotworowej

Bardziej szczegółowo

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP

Klonowanie molekularne Kurs doskonalący. Zakład Geriatrii i Gerontologii CMKP Klonowanie molekularne Kurs doskonalący Zakład Geriatrii i Gerontologii CMKP Etapy klonowania molekularnego 1. Wybór wektora i organizmu gospodarza Po co klonuję (do namnożenia DNA [czy ma być metylowane

Bardziej szczegółowo

S T R E S Z C Z E N I E

S T R E S Z C Z E N I E STRESZCZENIE Cel pracy: Celem pracy jest ocena wyników leczenia napromienianiem chorych z rozpoznaniem raka szyjki macicy w Świętokrzyskim Centrum Onkologii, porównanie wyników leczenia chorych napromienianych

Bardziej szczegółowo

Warto wiedzieć więcej o swojej chorobie, aby z nią walczyć

Warto wiedzieć więcej o swojej chorobie, aby z nią walczyć Warto wiedzieć więcej o swojej chorobie, aby z nią walczyć Kilka ważnych porad dla kobiet chorych na raka piersi Konsultacja merytoryczna: dr hab. n. med. Lubomir Bodnar Warto wiedzieć więcej o swojej

Bardziej szczegółowo

Rozmnażanie i wzrost komórek sąściśle kontrolowane. Genetyczne podłoże nowotworzenia

Rozmnażanie i wzrost komórek sąściśle kontrolowane. Genetyczne podłoże nowotworzenia Rozmnażanie i wzrost komórek sąściśle kontrolowane Genetyczne podłoże nowotworzenia Rozmnażanie i wzrost komórek sąściśle kontrolowane Rozmnażanie i wzrost komórek sąściśle kontrolowane Połączenia komórek

Bardziej szczegółowo

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska

Dane mikromacierzowe. Mateusz Markowicz Marta Stańska Dane mikromacierzowe Mateusz Markowicz Marta Stańska Mikromacierz Mikromacierz DNA (ang. DNA microarray) to szklana lub plastikowa płytka (o maksymalnych wymiarach 2,5 cm x 7,5 cm) z naniesionymi w regularnych

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

WSTĘP. Skaner PET-CT GE Discovery IQ uruchomiony we Wrocławiu w 2015 roku.

WSTĘP. Skaner PET-CT GE Discovery IQ uruchomiony we Wrocławiu w 2015 roku. WSTĘP Technika PET, obok MRI, jest jedną z najbardziej dynamicznie rozwijających się metod obrazowych w medycynie. Przełomowymi wydarzeniami w rozwoju PET było wprowadzenie wielorzędowych gamma kamer,

Bardziej szczegółowo

PL 212748 B1. GDAŃSKI UNIWERSYTET MEDYCZNY, Gdańsk, PL SKRZYPSKI MARCIN, Sopot, PL JASSEM JACEK, Gdańsk, PL 31.01.2011 BUP 03/11 30.11.

PL 212748 B1. GDAŃSKI UNIWERSYTET MEDYCZNY, Gdańsk, PL SKRZYPSKI MARCIN, Sopot, PL JASSEM JACEK, Gdańsk, PL 31.01.2011 BUP 03/11 30.11. PL 212748 B1 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 212748 (21) Numer zgłoszenia: 388681 (22) Data zgłoszenia: 30.07.2009 (13) B1 (51) Int.Cl.

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 27.10.2004 04791425.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 27.10.2004 04791425. PL/EP 1809944 T3 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1809944 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 27.10.2004 04791425.4 (51) Int. Cl.

Bardziej szczegółowo

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym

Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym Analiza mutacji genów EGFR, PIKCA i PTEN w nerwiaku zarodkowym mgr Magdalena Brzeskwiniewicz Promotor: Prof. dr hab. n. med. Janusz Limon Katedra i Zakład Biologii i Genetyki Gdański Uniwersytet Medyczny

Bardziej szczegółowo

VII. ŚWIADCZENIA MEDYCYNY NUKLEARNEJ. LP. Nazwa świadczenia gwarantowanego Warunki realizacji świadczeń

VII. ŚWIADCZENIA MEDYCYNY NUKLEARNEJ. LP. Nazwa świadczenia gwarantowanego Warunki realizacji świadczeń VII. ŚWIADCZENIA MEDYCYNY NUKLEARNEJ LP. Nazwa świadczenia gwarantowanego Warunki realizacji świadczeń 1. Scyntygrafia i radioizotopowe badanie czynnościowe tarczycy 1) gamma kamera planarna lub scyntygraf;

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1747298 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547.7 (51) Int. Cl. C22C14/00 (2006.01)

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Wydłużenie życia chorych z rakiem płuca - nowe możliwości

Wydłużenie życia chorych z rakiem płuca - nowe możliwości Wydłużenie życia chorych z rakiem płuca - nowe możliwości Pulmonologia 2015, PAP, Warszawa, 26 maja 2015 1 Epidemiologia raka płuca w Polsce Pierwszy nowotwór w Polsce pod względem umieralności. Tendencja

Bardziej szczegółowo

Postępy w Gastroenterologii. Poznań 2013. Janusz Milewski, Klinika Gastroenterologii CSK MSW.

Postępy w Gastroenterologii. Poznań 2013. Janusz Milewski, Klinika Gastroenterologii CSK MSW. Postępy w Gastroenterologii. Poznań 2013. Janusz Milewski, Klinika Gastroenterologii CSK MSW. Rak trzustki na drugim miejscu pośród nowotworów w gastroenterologii. Na 9 miejscu pod względem lokalizacji

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058. (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058. (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058 (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244.7 (13) (51) T3 Int.Cl. C22C 38/40 (2006.01)

Bardziej szczegółowo

Wytyczne postępowania dla lekarzy POZ i lekarzy medycyny pracy w zakresie raka nerki, pęcherza moczowego i prostaty 2011

Wytyczne postępowania dla lekarzy POZ i lekarzy medycyny pracy w zakresie raka nerki, pęcherza moczowego i prostaty 2011 Wytyczne postępowania dla lekarzy POZ i lekarzy medycyny pracy w zakresie raka nerki, pęcherza moczowego i prostaty 2011 Wytyczne postępowania dla lekarzy POZ i lekarzy medycyny pracy w zakresie raka nerki,

Bardziej szczegółowo

WARSZAWSCY LEKARZE ZASTOSOWALI NOWĄ METODĘ LECZENIA RAKA JAJNIKA

WARSZAWSCY LEKARZE ZASTOSOWALI NOWĄ METODĘ LECZENIA RAKA JAJNIKA WARSZAWSCY LEKARZE ZASTOSOWALI NOWĄ METODĘ LECZENIA RAKA JAJNIKA..,WWW.MONEY.PL ( 00:00:00) www.money.pl/archiwum/wiadomosci_agencyjne/pap/artykul/warszawscy;lekarze;zastosowali;nowa;metode;leczenia;raka;j

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: 13.12.1999,PCT/EP99/09864 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: 13.12.1999,PCT/EP99/09864 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 202483 (21) Numer zgłoszenia: 349335 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 13.12.1999 (86) Data i numer zgłoszenia

Bardziej szczegółowo

Ocena ekspresji genu ABCG2 i białka oporności raka piersi (BCRP) jako potencjalnych czynników prognostycznych w raku jelita grubego

Ocena ekspresji genu ABCG2 i białka oporności raka piersi (BCRP) jako potencjalnych czynników prognostycznych w raku jelita grubego Aleksandra Sałagacka Ocena ekspresji genu ABCG2 i białka oporności raka piersi (BCRP) jako potencjalnych czynników prognostycznych w raku jelita grubego Pracownia Biologii Molekularnej i Farmakogenomiki

Bardziej szczegółowo

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208956 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 381219 (22) Data zgłoszenia: 05.12.2006 (51) Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

Ocena czynników rokowniczych w raku płaskonabłonkowym przełyku w materiale Kliniki Chirurgii Onkologicznej AM w Gdańsku doniesienie wstępne

Ocena czynników rokowniczych w raku płaskonabłonkowym przełyku w materiale Kliniki Chirurgii Onkologicznej AM w Gdańsku doniesienie wstępne Ocena czynników rokowniczych w raku płaskonabłonkowym przełyku w materiale Kliniki Chirurgii Onkologicznej AM w Gdańsku doniesienie wstępne Świerblewski M. 1, Kopacz A. 1, Jastrzębski T. 1 1 Katedra i

Bardziej szczegółowo

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi

Metody badania polimorfizmu/mutacji DNA. Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Metody badania polimorfizmu/mutacji DNA Aleksandra Sałagacka Pracownia Diagnostyki Molekularnej i Farmakogenomiki Uniwersytet Medyczny w Łodzi Mutacja Mutacja (łac. mutatio zmiana) - zmiana materialnego

Bardziej szczegółowo

Agencja Oceny Technologii Medycznych

Agencja Oceny Technologii Medycznych Agencja Oceny Technologii Medycznych Rada Przejrzystości Opinia Rady Przejrzystości nr 181/2012 z dnia 13 sierpnia 2012 r. w sprawie objęcia refundacją produktów leczniczych zawierających temozolomid,

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1700812 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.03.2006 06004461.7 (51) Int. Cl. B66B9/08 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2468142. (96) Data i numer zgłoszenia patentu europejskiego: 21.12.2011 11194996.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2468142. (96) Data i numer zgłoszenia patentu europejskiego: 21.12.2011 11194996. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2468142 (96) Data i numer zgłoszenia patentu europejskiego: 21.12.2011 11194996.2 (13) (51) T3 Int.Cl. A47C 23/00 (2006.01)

Bardziej szczegółowo

Agencja Oceny Technologii Medycznych

Agencja Oceny Technologii Medycznych Agencja Oceny Technologii Medycznych Rada Przejrzystości Stanowisko Rady Przejrzystości nr 182/2013 z dnia 9 września 2013 r. w sprawie oceny leku Iressa (gefitynib) we wskazaniu leczenie niedrobnokomórkowego

Bardziej szczegółowo

Onkogeneza i zjawisko przejścia nabłonkowomezenchymalnego. Gabriel Wcisło Klinika Onkologii Wojskowego Instytutu Medycznego, CSK MON, Warszawa

Onkogeneza i zjawisko przejścia nabłonkowomezenchymalnego. Gabriel Wcisło Klinika Onkologii Wojskowego Instytutu Medycznego, CSK MON, Warszawa Onkogeneza i zjawisko przejścia nabłonkowomezenchymalnego raka jajnika Gabriel Wcisło Klinika Onkologii Wojskowego Instytutu Medycznego, CSK MON, Warszawa Sześć diabelskich mocy a komórka rakowa (Gibbs

Bardziej szczegółowo

Dr hab. med. Mirosław Dziuk, prof. nadzw. Kierownik Zakładu Medycyny Nuklearnej WIM Warszawa

Dr hab. med. Mirosław Dziuk, prof. nadzw. Kierownik Zakładu Medycyny Nuklearnej WIM Warszawa Dr hab. med. Mirosław Dziuk, prof. nadzw. Kierownik Zakładu Medycyny Nuklearnej WIM Warszawa ROZPOZNAWANIE: PET - CT W ONKOLOGII poszukiwanie ognisk choroby - wczesne wykrywanie różnicowanie zmian łagodnych

Bardziej szczegółowo

Nowe terapie choroby Huntingtona. Grzegorz Witkowski Katowice 2014

Nowe terapie choroby Huntingtona. Grzegorz Witkowski Katowice 2014 Nowe terapie choroby Huntingtona Grzegorz Witkowski Katowice 2014 Terapie modyfikujące przebieg choroby Zahamowanie produkcji nieprawidłowej huntingtyny Leki oparte o palce cynkowe Małe interferujące RNA

Bardziej szczegółowo

Personalizacja leczenia w hematoonkologii dziecięcej

Personalizacja leczenia w hematoonkologii dziecięcej MedTrends 2016 Europejskie Forum Nowoczesnej Ochrony Zdrowia Zabrze, 18-19 marca 2016 r. Personalizacja leczenia w hematoonkologii dziecięcej Prof. dr hab. n. med. Tomasz Szczepański Katedra i Klinika

Bardziej szczegółowo

Radioterapia w leczeniu raka pęcherza moczowego - zalecenia

Radioterapia w leczeniu raka pęcherza moczowego - zalecenia Radioterapia w leczeniu raka pęcherza moczowego - zalecenia Radioterapia w leczeniu raka pęcherza moczowego może być stosowana łącznie z leczeniem operacyjnym chemioterapią. Na podstawie literatury anglojęzycznej

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1505553. (96) Data i numer zgłoszenia patentu europejskiego: 05.08.2004 04018511.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1505553. (96) Data i numer zgłoszenia patentu europejskiego: 05.08.2004 04018511. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 3 (96) Data i numer zgłoszenia patentu europejskiego: 0.08.04 0401811.8 (13) (1) T3 Int.Cl. G08C 17/00 (06.01) Urząd Patentowy

Bardziej szczegółowo

OGÓLNE WARUNKI UBEZPIECZENIA UMOWA DODATKOWA NA WYPADEK NOWOTWORU - ONA NR OWU/ONA1/1/2012

OGÓLNE WARUNKI UBEZPIECZENIA UMOWA DODATKOWA NA WYPADEK NOWOTWORU - ONA NR OWU/ONA1/1/2012 OGÓLNE WARUNKI UBEZPIECZENIA UMOWA DODATKOWA NA WYPADEK NOWOTWORU - ONA NR OWU/ONA1/1/2012 Umowa dodatkowa ONA jest zawierana na podstawie Warunków Sposób na przyszłość (kod TUL0) oraz Ogólnych warunków

Bardziej szczegółowo

Przerzuty raka płuca do mózgu - postępowanie multidyscyplinarne.

Przerzuty raka płuca do mózgu - postępowanie multidyscyplinarne. Przerzuty raka płuca do mózgu - postępowanie multidyscyplinarne. Rak płuca jest najczęściej spotykanym nowotworem złośliwym u mężczyzn, powodującym około 1/3 zachorowań i zgonów z przyczyn nowotworowych.

Bardziej szczegółowo

PL 204536 B1. Szczepanik Marian,Kraków,PL Selmaj Krzysztof,Łódź,PL 29.12.2003 BUP 26/03 29.01.2010 WUP 01/10

PL 204536 B1. Szczepanik Marian,Kraków,PL Selmaj Krzysztof,Łódź,PL 29.12.2003 BUP 26/03 29.01.2010 WUP 01/10 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 204536 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 354698 (22) Data zgłoszenia: 24.06.2002 (51) Int.Cl. A61K 38/38 (2006.01)

Bardziej szczegółowo

Pakiet onkologiczny. w podstawowej opiece zdrowotnej

Pakiet onkologiczny. w podstawowej opiece zdrowotnej Pakiet onkologiczny w podstawowej opiece zdrowotnej Agnieszka Jankowska-Zduńczyk Specjalista medycyny rodzinnej Konsultant krajowy w dziedzinie medycyny rodzinnej Profilaktyka chorób nowotworowych Pakiet

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2300459. (96) Data i numer zgłoszenia patentu europejskiego: 22.06.2009 09772333.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2300459. (96) Data i numer zgłoszenia patentu europejskiego: 22.06.2009 09772333. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2049 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 22.06.09 09772333.2 (97)

Bardziej szczegółowo

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych

Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Proteomika: umożliwia badanie zestawu wszystkich lub prawie wszystkich białek komórkowych Zalety w porównaniu z analizą trankryptomu: analiza transkryptomu komórki identyfikacja mrna nie musi jeszcze oznaczać

Bardziej szczegółowo

Część A Programy lekowe

Część A Programy lekowe Wymagania wobec świadczeniodawców udzielających z zakresu programów zdrowotnych (lekowych) Część A Programy lekowe 1.1 WARUNKI 1. LECZENIE PRZEWLEKŁEGO WZW TYPU B 1.1.1 wymagania formalne Wpis w rejestrze

Bardziej szczegółowo

Terapeutyczne Programy Zdrowotne 2009 Leczenie nowotworów podścieliska przewodu pokarmowego (GIST) Załącznik nr 9

Terapeutyczne Programy Zdrowotne 2009 Leczenie nowotworów podścieliska przewodu pokarmowego (GIST) Załącznik nr 9 Załącznik nr 9 Nazwa programu: do Zarządzenia Nr 41/2009 Prezesa NFZ z dnia 15 września 2009 roku LECZENIE NOWOTWORÓW PODŚCIELISKA PRZEWODU POKARMOWEGO (GIST) ICD 10 grupa rozpoznań obejmująca nowotwory

Bardziej szczegółowo

Nowotwory pierwotne i przerzutowe ośrodkowego układu nerwowego - diagnostyka różnicowa

Nowotwory pierwotne i przerzutowe ośrodkowego układu nerwowego - diagnostyka różnicowa Nowotwory pierwotne i przerzutowe ośrodkowego układu nerwowego - diagnostyka różnicowa Nowotwory ośrodkowego układu nerwowego (OUN) rozwijają się w tkankach mózgowia i rdzenia kręgowego. Mogą być pierwotne

Bardziej szczegółowo

Gdzie chirurg nie może - - tam wirusy pośle. czyli o przeciwnowotworowych terapiach wirusowych

Gdzie chirurg nie może - - tam wirusy pośle. czyli o przeciwnowotworowych terapiach wirusowych Gdzie chirurg nie może - - tam wirusy pośle czyli o przeciwnowotworowych terapiach wirusowych Wirusy zwiększające ryzyko rozwoju nowotworów HBV EBV HCV HTLV HPV HHV-8 Zmniejszenie liczby zgonów spowodowanych

Bardziej szczegółowo

Typ histopatologiczny

Typ histopatologiczny Typ histopatologiczny Wiek Stopieo zróżnicowania nowotworu Typ I (hormonozależny) Adenocarcinoma Adenoacanthoma Naciekanie przestrzeni naczyniowych Wielkośd guza Typ II (hormononiezależny) Serous papillary

Bardziej szczegółowo

Agenda: Wynalazek jako własnośd intelektualna. Co może byd wynalazkiem. Wynalazek biotechnologiczny. Ochrona patentowa

Agenda: Wynalazek jako własnośd intelektualna. Co może byd wynalazkiem. Wynalazek biotechnologiczny. Ochrona patentowa dr Bartosz Walter Agenda: Wynalazek jako własnośd intelektualna Co może byd wynalazkiem Wynalazek biotechnologiczny Ochrona patentowa Procedura zgłoszenia patentowego Gdzie, kiedy i jak warto patentowad

Bardziej szczegółowo

Terapeutyczne Programy Zdrowotne 2012 Leczenie nowotworów podścieliska przewodu pokarmowego (GIST) Załącznik nr 8

Terapeutyczne Programy Zdrowotne 2012 Leczenie nowotworów podścieliska przewodu pokarmowego (GIST) Załącznik nr 8 Załącznik nr 8 Nazwa programu: do Zarządzenia 59/2011/DGL Prezesa NFZ z dnia 10 października 2011 roku LECZENIE NOWOTWORÓW PODŚCIELISKA PRZEWODU POKARMOWEGO (GIST) ICD 10 grupa rozpoznań obejmująca nowotwory

Bardziej szczegółowo

Urologiczne leczenie paliatywne zaawansowanych raków nerki. Dr n. med. Roman Sosnowski Klinika Nowotworów Układu Moczowego, COI, Warszawa

Urologiczne leczenie paliatywne zaawansowanych raków nerki. Dr n. med. Roman Sosnowski Klinika Nowotworów Układu Moczowego, COI, Warszawa Urologiczne leczenie paliatywne zaawansowanych raków nerki Dr n. med. Roman Sosnowski Klinika Nowotworów Układu Moczowego, COI, Warszawa Nefrektomia Nefrektomia jest metodą umożliwiającą całkowite wyleczenie

Bardziej szczegółowo

Program. 10.00 10.15 Powitanie 10.15 10.45 Otwarcie Sympozjum Czego dokonaliśmy- dokąd zmierzamy Prof. D.Perek

Program. 10.00 10.15 Powitanie 10.15 10.45 Otwarcie Sympozjum Czego dokonaliśmy- dokąd zmierzamy Prof. D.Perek Czwartek, 05 listopada 2009 Program 10.00 10.15 Powitanie 10.15 10.45 Otwarcie Sympozjum Czego dokonaliśmy- dokąd zmierzamy Prof. D.Perek 10.45 11.00 Przerwa na kawę Sesja I 11.00 14.00 Przewodniczą: E.

Bardziej szczegółowo

RADIOTERAPIA NOWOTWORÓW UKŁADU MOCZOWO PŁCIOWEGO U MĘŻCZYZN DOSTĘPNOŚĆ W POLSCE

RADIOTERAPIA NOWOTWORÓW UKŁADU MOCZOWO PŁCIOWEGO U MĘŻCZYZN DOSTĘPNOŚĆ W POLSCE RADIOTERAPIA NOWOTWORÓW UKŁADU MOCZOWO PŁCIOWEGO U MĘŻCZYZN DOSTĘPNOŚĆ W POLSCE Marcin Hetnał Centrum Onkologii Instytut im. MSC; Kraków Ośrodek Radioterapii Amethyst RTCP w Krakowie Radioterapia Radioterapia

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 09.12.2005 05077837.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 09.12.2005 05077837. RZECZPSPLITA PLSKA (12) TŁUMACZENIE PATENTU EURPEJSKIEG (19) PL (11) PL/EP 1671547 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 09.12.2005 05077837.2 (51) Int. Cl. A23B7/154 (2006.01) (97)

Bardziej szczegółowo

Recenzja rozprawy doktorskiej mgr inż. Artura Zajkowicza

Recenzja rozprawy doktorskiej mgr inż. Artura Zajkowicza dr hab. Beata Schlichtholz Gdańsk, 20 października 2015 r. Katedra i Zakład Biochemii Gdański Uniwersytet Medyczny ul. Dębinki 1 80-211 Gdańsk Recenzja rozprawy doktorskiej mgr inż. Artura Zajkowicza pt.

Bardziej szczegółowo

Załącznik do OPZ nr 8

Załącznik do OPZ nr 8 Załącznik do OPZ nr 8 Lista raportów predefiniowanych Lp. Tytuł raportu Potencjalny użytkownik raportu 1. Lista chorych na raka stercza w zależności od poziomu antygenu PSA (w momencie stwierdzenia choroby)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1571844. (96) Data i numer zgłoszenia patentu europejskiego: 04.03.2005 05251326.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1571844. (96) Data i numer zgłoszenia patentu europejskiego: 04.03.2005 05251326. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1571844 (96) Data i numer zgłoszenia patentu europejskiego: 04.03.2005 05251326.4 (13) (51) T3 Int.Cl. H04W 84/12 (2009.01)

Bardziej szczegółowo

ĆWICZENIA Z BIOCHEMII

ĆWICZENIA Z BIOCHEMII ĆWICZENIA Z BIOCHEMII D U STUDENTfiW WYDZIAŁU LEKARSKIEGO Pod redakcją Piotra Laidlera, Barbary Piekarskiej, Marii Wróbel WYDAWNICTWO UNIWERSYTETU JAGIELLOŃSKIEGO ĆWICZENIA Z BIOCHEMII DLA STUDENTÓW WYDZIAŁU

Bardziej szczegółowo

Umowa dodatkowa na wypadek nowotworu ON NR OWU/ON12/1/2014

Umowa dodatkowa na wypadek nowotworu ON NR OWU/ON12/1/2014 Umowa dodatkowa na wypadek nowotworu ON Umowa dodatkowa ON jest zawierana na podstawie Warunków oraz Ogólnych warunków ubezpieczenia umowy dodatkowej na wypadek nowotworu ON. Przeczytaj uważnie poniższe

Bardziej szczegółowo

BADANIA LABORATORYJNE WYKONYWANE W PRZYPADKU NIEDOKRWIENNEGO UDARU MÓZGU

BADANIA LABORATORYJNE WYKONYWANE W PRZYPADKU NIEDOKRWIENNEGO UDARU MÓZGU 442 Część II. Neurologia kliniczna BADANIA LABORATORYJNE WYKONYWANE W PRZYPADKU NIEDOKRWIENNEGO UDARU MÓZGU Badania neuroobrazowe Badanie tomografii komputerowej głowy Zasadniczym rozróżnieniem wydaje

Bardziej szczegółowo

Leczenie i przeżycia 5-letnie dolnośląskich kobiet chorych na nowotwory złośliwe piersi z lat 2004-2008

Leczenie i przeżycia 5-letnie dolnośląskich kobiet chorych na nowotwory złośliwe piersi z lat 2004-2008 Leczenie i przeżycia 5-letnie dolnośląskich kobiet chorych na nowotwory złośliwe piersi z lat 2004-2008 W latach 2004-2008 w Dolnośląskim Rejestrze Nowotworów zarejestrowaliśmy 6.125 zachorowań na inwazyjne

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 18.05.2005 05010800.0

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 18.05.2005 05010800.0 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1600805 (96) Data i numer zgłoszenia patentu europejskiego: 18.05.2005 05010800.0 (13) T3 (51) Int. Cl. G02C7/04 A01K13/00

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2242492. (96) Data i numer zgłoszenia patentu europejskiego: 16.02.2009 09712902.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2242492. (96) Data i numer zgłoszenia patentu europejskiego: 16.02.2009 09712902. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2242492 (96) Data i numer zgłoszenia patentu europejskiego: 16.02.09 09712902.7 (13) (1) T3 Int.Cl. A61K 31/473 (06.01) A61P

Bardziej szczegółowo

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 100 ml, 250 ml, 500 ml Nr kat. 038-100, 038-250, 038-500 Nietosyczny roztwór wodny do przechowywania i zabezpieczania różnego rodzaju tkanek

Bardziej szczegółowo

Spis treści. Przedmowa Barbara Czerska... 11 Autorzy... 17 Wykaz skrótów... 19

Spis treści. Przedmowa Barbara Czerska... 11 Autorzy... 17 Wykaz skrótów... 19 Przedmowa Barbara Czerska.................................. 11 Autorzy.................................................... 17 Wykaz skrótów.............................................. 19 Rozdział I.

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1678194. (96) Data i numer zgłoszenia patentu europejskiego: 11.10.2004 04789575.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1678194. (96) Data i numer zgłoszenia patentu europejskiego: 11.10.2004 04789575. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1678194 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 11.10.2004 04789575.0

Bardziej szczegółowo

Analizy wielkoskalowe w badaniach chromatyny

Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe w badaniach chromatyny Analizy wielkoskalowe wykorzystujące mikromacierze DNA Genotypowanie: zróżnicowane wewnątrz genów RNA Komórka eukariotyczna Ekspresja genów: Które geny? Poziom

Bardziej szczegółowo

WTÓRNE OPERACJE CYTOREDUKCYJNE - ZASADY KWALIFIKACJI

WTÓRNE OPERACJE CYTOREDUKCYJNE - ZASADY KWALIFIKACJI WTÓRNE OPERACJE CYTOREDUKCYJNE - ZASADY KWALIFIKACJI Paweł Basta Klinika Ginekologii i Onkologii Szpitala Uniwersyteckiego w Krakowie Uniwersyteckie Centrum Leczenia Chorób Piersi I Katedra Chirurgii Ogólnej

Bardziej szczegółowo

Limfadenektomia w leczeniu raka jajnika pro? czy KONTRA! Jan Kornafel

Limfadenektomia w leczeniu raka jajnika pro? czy KONTRA! Jan Kornafel Limfadenektomia w leczeniu raka jajnika pro? czy KONTRA! Jan Kornafel PO CO?? PO CO?? Znaczenie diagnostyczne Cel terapeutyczny Wartość rokownicza Nieoperacyjne metody oceny węzłów chłonnych Ultrasonografia

Bardziej szczegółowo

Gamma Knife bezinwazyjna alternatywa dla leczenia operacyjnego guzów wewnątrzczaszkowych oraz innych patologii mózgu

Gamma Knife bezinwazyjna alternatywa dla leczenia operacyjnego guzów wewnątrzczaszkowych oraz innych patologii mózgu Gamma Knife bezinwazyjna alternatywa dla leczenia operacyjnego guzów wewnątrzczaszkowych oraz innych patologii mózgu Leszek Lombarski Klinika Neurochirurgii i Urazów Układu Nerwowego CMKP, Warszawa Stereotaksja

Bardziej szczegółowo

Przykładowe zadania. przygotowujące do egzaminu maturalnego

Przykładowe zadania. przygotowujące do egzaminu maturalnego Przykładowe zadania z BIOLOGii przygotowujące do egzaminu maturalnego Prezentowane zadania są zgodne z podstawą programową kształcenia ogólnego w zakresie rozszerzonym i podstawowym. Prócz zadań, które

Bardziej szczegółowo

(96) Data i numer zgłoszenia patentu europejskiego: 18.03.2004 04006485.9

(96) Data i numer zgłoszenia patentu europejskiego: 18.03.2004 04006485.9 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1464787 (96) Data i numer zgłoszenia patentu europejskiego: 18.03.2004 04006485.9 (13) T3 (51) Int. Cl. E06B1/60 (2006.01)

Bardziej szczegółowo

Problemy kostne u chorych ze szpiczakiem mnogim doświadczenia własne

Problemy kostne u chorych ze szpiczakiem mnogim doświadczenia własne Problemy kostne u chorych ze szpiczakiem mnogim doświadczenia własne dr n.med. Piotr Wojciechowski Szpiczak Mnogi Szpiczak Mnogi (MM) jest najczęstszą przyczyną pierwotnych nowotworów kości u dorosłych.

Bardziej szczegółowo

LECZENIE NIEDROBNOKOMÓRKOWEGO RAKA PŁUCA Z ZASTOSOWANIEM AFATYNIBU (ICD-10 C 34)

LECZENIE NIEDROBNOKOMÓRKOWEGO RAKA PŁUCA Z ZASTOSOWANIEM AFATYNIBU (ICD-10 C 34) Dziennik Urzędowy Ministra Zdrowia 731 Poz. 48 Załącznik B.63. LECZENIE NIEDROBNOKOMÓRKOWEGO RAKA PŁUCA Z ZASTOSOWANIEM AFATYNIBU (ICD-10 C 34) ŚWIADCZENIOBIORCY 1. Kryteria kwalifikacji 1) rozpoznanie

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1859720. (96) Data i numer zgłoszenia patentu europejskiego: 15.02.2007 07003173.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1859720. (96) Data i numer zgłoszenia patentu europejskiego: 15.02.2007 07003173. PL/EP 1859720 T3 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1859720 (96) Data i numer zgłoszenia patentu europejskiego: 15.02.2007 07003173.7 (13) (51) T3 Int.Cl. A47L

Bardziej szczegółowo

Pracownia Patologii Ogólnej i Neuropatologii, Katedra Pielęgniarstwa, Gdański Uniwersytet Medyczny

Pracownia Patologii Ogólnej i Neuropatologii, Katedra Pielęgniarstwa, Gdański Uniwersytet Medyczny POZAGONADALNE I POZACZASZKOWE GUZY GERMINALNE (EXTRAGONADAL GERM CELL TUMOR) Ewa IŜycka-Świeszewska Pracownia Patologii Ogólnej i Neuropatologii, Katedra Pielęgniarstwa, Gdański Uniwersytet Medyczny 1.

Bardziej szczegółowo

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO Ćwiczenie numer 6 Analiza próbek spożywczych na obecność markerów GMO 1. Informacje wstępne -screening GMO -metoda CTAB -qpcr 2. Izolacja DNA z soi metodą CTAB 3. Oznaczenie ilościowe i jakościowe DNA

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2695694. (96) Data i numer zgłoszenia patentu europejskiego: 28.08.2012 12460056.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2695694. (96) Data i numer zgłoszenia patentu europejskiego: 28.08.2012 12460056. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2695694 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 28.08.2012 12460056.0

Bardziej szczegółowo

Terapie dla kobiet z zaawansowanym rakiem piersi w Polsce

Terapie dla kobiet z zaawansowanym rakiem piersi w Polsce Warszawa, 27.01.2016 Seminarium naukowe: Terapie przełomowe w onkologii i hematoonkologii a dostępność do leczenia w Polsce na tle Europy Terapie dla kobiet z zaawansowanym rakiem piersi w Polsce Dr n.

Bardziej szczegółowo

Profilaktyka i leczenie czerniaka. Dr n. med. Jacek Calik

Profilaktyka i leczenie czerniaka. Dr n. med. Jacek Calik Profilaktyka i leczenie czerniaka Dr n. med. Jacek Calik Czerniaki Czerniaki są grupą nowotworów o bardzo zróżnicowanej biologii, przebiegu i rokowaniu. Nowotwory wywodzące się z melanocytów. Pochodzenie

Bardziej szczegółowo

RAK PŁUCA A CHOROBY WSPÓŁISTNIEJĄCE

RAK PŁUCA A CHOROBY WSPÓŁISTNIEJĄCE Beata Brajer-Luftmann Katedra i Klinika Pulmonologii, Alergologii i Onkologii Pulmonologicznej UM w Poznaniu TPT 30.11.2013r. Najczęstszy nowotwór na świecie (ok. 1,2 mln zachorowań i ok. 1,1ml zgonów)

Bardziej szczegółowo

BADANIA RADIOLOGICZNE, TOMOGRAFIA KOMPUTEROWA, REZONANS MAGNETYCZNY W DIAGNOSTYCE

BADANIA RADIOLOGICZNE, TOMOGRAFIA KOMPUTEROWA, REZONANS MAGNETYCZNY W DIAGNOSTYCE BADANIA RADIOLOGICZNE, TOMOGRAFIA KOMPUTEROWA, REZONANS MAGNETYCZNY W DIAGNOSTYCE SZPICZAKA MNOGIEGO Bartosz Białczyk Ośrodek Diagnostyki, Terapii i Telemedycyny KSS im. Jana Pawła II Szpiczak mnogi multiple

Bardziej szczegółowo

Wyzwania wynikające z rozwoju metod obrazowania

Wyzwania wynikające z rozwoju metod obrazowania Wyzwania wynikające z rozwoju metod obrazowania Konferencja w ramach projektu Wykorzystywanie nowych metod i narzędzi w kształceniu studentów UMB w zakresie ochrony radiologicznej Uniwersytet Medyczny

Bardziej szczegółowo

IMMUNOHISTOCHEMICZNA OCENA MERKERÓW PROLIFERACJI KOMÓRKOWEJ W RAKU JELITA GRUBEGO

IMMUNOHISTOCHEMICZNA OCENA MERKERÓW PROLIFERACJI KOMÓRKOWEJ W RAKU JELITA GRUBEGO IMMUNOHISTOCHEMICZNA OCENA MERKERÓW PROLIFERACJI KOMÓRKOWEJ W RAKU JELITA GRUBEGO EWA STĘPIEŃ ZAKŁAD PATOMORFOLOGII OGÓLNEJ AKADEMII MEDYCZNEJ W BIAŁYMSTOKU KIEROWNIK I OPIEKUN PRACY: Dr KATARZYNA GUZIŃSKA-USTYMOWICZ

Bardziej szczegółowo

Dr hab. n. med. Paweł Blecharz

Dr hab. n. med. Paweł Blecharz BRCA1 zależny rak piersi i jajnika odmienności diagnostyczne i kliniczne (BRCA1 dependent breast and ovarian cancer clinical and diagnostic diversities) Paweł Blecharz Dr hab. n. med. Paweł Blecharz Dr

Bardziej szczegółowo

Radioterapia protonowa w leczeniu nowotworów oka. Klinika Okulistyki i Onkologii Okulistycznej Katedra Okulistyki UJ CM

Radioterapia protonowa w leczeniu nowotworów oka. Klinika Okulistyki i Onkologii Okulistycznej Katedra Okulistyki UJ CM Radioterapia protonowa w leczeniu nowotworów oka Klinika Okulistyki i Onkologii Okulistycznej Katedra Okulistyki UJ CM Epidemiologia czerniaka błony naczyniowej Częstość występowania zależy od rasy (u

Bardziej szczegółowo

Ruch zwiększa recykling komórkowy Natura i wychowanie

Ruch zwiększa recykling komórkowy Natura i wychowanie Wiadomości naukowe o chorobie Huntingtona. Prostym językiem. Napisane przez naukowców. Dla globalnej społeczności HD. Ruch zwiększa recykling komórkowy Ćwiczenia potęgują recykling komórkowy u myszy. Czy

Bardziej szczegółowo

Podstawy diagnostyki onkologicznej. Podstawy diagnostyki onkologicznej. Marcin Stępie. pień

Podstawy diagnostyki onkologicznej. Podstawy diagnostyki onkologicznej. Marcin Stępie. pień Marcin Stępie pień Katedra Onkologii i Klinika Onkologii Ginekologicznej AM Wrocław, Dolnośląskie Centrum Onkologii we Wrocławiu. Cele diagnostyki rozpoznanie choroby nowotworowej; ocena zaawansowania

Bardziej szczegółowo

Rak pęcherza moczowego - chemioterapia jako element leczenia skojarzonego

Rak pęcherza moczowego - chemioterapia jako element leczenia skojarzonego Rak pęcherza moczowego - chemioterapia jako element leczenia skojarzonego Elżbieta Senkus-Konefka Klinika Onkologii i Radioterapii Gdański Uniwersytet Medyczny Kliknij ikonę, aby dodać obraz 888 cystektomii

Bardziej szczegółowo

Inwestycja w przyszłość czyli znaczenie ochrony własności przemysłowej dla współczesnej biotechnologii

Inwestycja w przyszłość czyli znaczenie ochrony własności przemysłowej dla współczesnej biotechnologii Inwestycja w przyszłość czyli znaczenie ochrony własności przemysłowej dla współczesnej biotechnologii Zdolność patentowa wynalazków biotechnologicznych dr Małgorzata Kozłowska Ekspert w UPRP dr Ewa Waszkowska

Bardziej szczegółowo