PL B1. Nowe pochodne epirubicyny, ich nowe zastosowanie medyczne oraz farmaceutycznie akceptowalna postać leku

Wielkość: px
Rozpocząć pokaz od strony:

Download "PL 212279 B1. Nowe pochodne epirubicyny, ich nowe zastosowanie medyczne oraz farmaceutycznie akceptowalna postać leku"

Transkrypt

1 PL B1 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) (21) Numer zgłoszenia: (22) Data zgłoszenia: (13) B1 (51) Int.Cl. C07H 15/252 ( ) A61K 31/704 ( ) A61P 31/12 ( ) (54) Nowe pochodne epirubicyny, ich nowe zastosowanie medyczne oraz farmaceutycznie akceptowalna postać leku (43) Zgłoszenie ogłoszono: BUP 08/08 (45) O udzieleniu patentu ogłoszono: WUP 09/12 (73) Uprawniony z patentu: INSTYTUT BIOCHEMII I BIOFIZYKI POLSKA AKADEMIA NAUK, Warszawa, PL Institut National de la Sante et de la Recherche Medicale, INSERM, Paris, FR INSTYTUT MEDYCYNY DOŚWIADCZALNEJ I KLINICZNEJ IM. M. MOSSAKOWSKIEGO POLSKIEJ AKADEMII NAUK, Warszawa, PL (72) Twórca(y) wynalazku: TADEUSZ KULIKOWSKI, Warszawa, PL MARIA BRETNER, Wołomin, PL ANDŻELIKA NAJDA, Lubartów, PL LUCYNA COVA, Lyon, FR CHRISTIAN TREPO, Bron, FR RAMAMURTHY NARAYAN, Headington, GB ANDRZEJ PIASEK, Warszawa, PL ANDRZEJ LIPNIACKI, Warszawa, PL WŁODZIMIERZ ZAGÓRSKI-OSTOJA, Warszawa, PL (74) Pełnomocnik: rzecz. pat. Iwona Brodowska

2 2 PL B1 Opis wynalazku Przedmiotem wynalazku są nowe pochodne 7-O-(3 -amino-2,3,6 -trideoksy-α,β-l-arabinohekso-piranozylo)-adriamycynonu (epirubicyna, 4 -epidoksorubicyna) o wzorze 1, w którym co najwyżej dwa z czterech podstawników R 1, R 2, R 3 i R 4 są takie same lub różne i oznaczają atom wodoru, a co najmniej dwa z tych czterech podstawników oznaczają grupę alkilową, grupę alkenową lub alkinową, o 1 do 5 atomach węgla, grupę alkilokarbonylową o łańcuchu alkilowym od 1 do 3 atomów węgla, zwłaszcza acetylową przy czym jeśli R 1 i R 4 oznaczają jednocześnie atom wodoru, to R 2 i R 3 razem z atomem azotu, do którego są przyłączone, oznaczają grupę, dimetyloformamidylową. Przedmiotem wynalazku jest także nowe zastosowanie medyczne tych pochodnych do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV) oraz farmaceutycznie akceptowalna forma leku. Wirus zapalenia wątroby typu C (HCV) posiada szczególne znaczenie: jest to wysoce patogenny wirus należący do rodziny Flaviviridae (genus hepaciwirus), bardzo szeroko rozpowszechnionej w świecie (według danych WHO, c.a. 300 milionów zakażonych ludzi). Chroniczne aktywne zapalenie wątroby występuje/rozwija się u ok. 85% silnie zakażonych nosicieli i prowadzi do marskości wątroby, oraz do nowotworu wątrobiaka (hepatocellular carcinoma) (Hagedorn i Rice, red. The Hepatitis C Viruses, Springer, Heidelberg 2000). Nieoczekiwanie zgłaszający stwierdził, że chlorowodorek epirubicyny znany lek przeciwnowotworowy, jest nadzwyczaj silnym środkiem działającym przeciwko wirusowi zapalenia wątroby typu C (HCV). Chlorowodorek epirubicyny jest toksyczny w stosunku do hemopoetycznych komórek ssaków i komórek tkanki sercowej, jednak powoduje mniejszą hematologiczną i sercową toksyczność niż odpowiednie dawki innego szeroko stosowanego leku przeciwnowotworowego - doksorubicyny (adriamycyny). W dodatku prawdopodobieństwo wystąpienia zatoru serca u człowieka przy całkowitej skumulowanej dawce nie przekraczającej 150 mg na m 2 powierzchni ciała człowieka wg wykresu Kaplana-Meiera (Launchbury and Habooubit, Cancer Treatment Reviews 1993, 19, ) jest znikome. W dniu 7 lipca 2005 zgłaszający złożył wniosek patentowy do polskiego i europejskiego Urzędu Patentowego (odpowiednio PL i EP ). Obecnie, nieoczekiwanie stwierdzono, że pochodne epirubicyny o wzorze 1, jak to poniżej opisano, wykazują silną aktywność hamującą replikację wirusa zapalenia wątroby typu C (HCV) przy znacznie niższej niż epirubicyna cytotoksyczności w stosunku do komórek Huh7 oraz PBMC, lepszym in vitro indeksie terapeutycznym (TI) (Tabela 1) oraz niższej in vivo toksyczności u myszy. W związku z powyższym nowe pochodne epirubicyny mogą być korzystnie stosowane do leczenia zakażeń wirusem HCV. Niniejszy wynalazek dotyczy również farmaceutycznie akceptowalnych form leku zawierających wymienione pochodne o wzorze 1. Nowe pochodne 7-O-(3 -amino-2,3,6 -trideoksy-α,β-l-arabinoheksopiranozylo)-adriamycynonu (epirubicyny) przedstawione są wzorem 1, w którym co najwyżej dwa z czterech podstawników R 1, R 2, R 3 i R 4 są takie same lub różne i oznaczają atom wodoru, a co najmniej dwa z tych czterech podstawników oznaczają grupę alkilową, grupę alkenową lub alkinową, o 1 do 5 atomach węgla, grupę alkilokarbonylową o łańcuchu alkilowym od 1 do 3 atomów węgla, zwłaszcza grupę acetylową, przy czym jeśli R 1 i R 4 oznaczają jednocześnie atom wodoru, to R 2 i R 3 razem z atomem azotu, do którego są przyłaczone, oznaczają grupę dimetyloformamidylową. Zastosowanie medyczne nowych pochodnych epirubicyny, przedstawionych wzorem 1, do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV). Zastosowanie medyczne nowych pochodnych epirubicyny według wynalazku do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV) i zapewniających niską toksyczność w stosunku do komórek Huh7 i PBMC, oraz indeks terapeutyczny (TI) wyższy niż samej epirubicyny oraz mniejszą niż dla epirubicyny toksyczność in vivo. Inaczej, nowe pochodne epirubicyny mogą być stosowane do leczenia zakażeń wirusem HCV. Farmaceutycznie akceptowalna postać leku przeciwko zakażeniom HCV, zawierająca znane nośniki i dodatki, według wynalazku, charakteryzuje się tym, że jako substancję aktywną zawiera pochodne epirubicyny przedstawione wzorem 1, w którym R 1, R 2, R 3 i R 4 mają wyżej podane znaczenie. W przedstawionych poniżej badaniach wykazano po raz pierwszy, że nowe pochodne epirubicyny przedstawione wzorem 1 wywierają silny efekt hamujący replikację HCV przy nanomolowych stężeniach i mogą być stosowane jako efektywne leki przeciwko zakażeniom HCV.

3 PL B1 3 Poniżej przedstawiono przykłady wykonania wynalazku nie ograniczające w żadnym stopniu zakresu wynalazku. P r z y k ł a d I N 3 -acetylo-4 -epidoksyrubicyna (1, BNE01) Chlorowodorek 4 -epidoksyrubicyny (58 mg, 0.1 mmola) rozpuszczono w acetonie (6.8 ml) i dodano 18 μl, diizopropyloetyloaminy. Roztwór oziębiono do 0 C na łaźni lodowej i dodano przy stałym mieszaniu 10 μl (0.11 mmola) bezwodnika octowego. Mieszaninę reakcyjną pozostawiono do ogrzania się do temperatury pokojowej i mieszano jeszcze przez 2 godz. Roztwór zatężono pod próżnią do sucha, pozostałość rozpuszczono w ca 13 ml CHCI 3 a roztwór przemyto trzy razy 0.1 M buforem fosforanowym ph 7.0 i dwa razy wodą. Warstwę organiczną suszono nad bezwodnym siarczanem sodu i odparowano pod próżnią do sucha. Pozostałość chromatografowano na kolumnie z żelem krzemowym (CHCI 3 do CHCl 3 :MeOH 1:1). Otrzymano związek o wzorze 1, (R 1 : H, R 2 : CH 3 CO,R 3 : H, R 4 : H) Temp. topn. 180 C. MS (ES+) ; NMR (CDCl 3 ) δ 1.36 (d, 3, 5 -CH 3 ), 2.01 (s, 3, 3 -N-COCH 3 ), 2.06 (m, 2, 2 -H 2 ), 2.19 (d, 1, 8A-H), 2.41 (d, 1, 8B-H), (m, 3, 3 -H i 4 -H/4 -OH), 3.28 (d, 1, 10A-H), 3.32 (d, 1, 10B-H), (m, 1, 5 -H), 4.09 (s, 3, 4-OCH 3 ), 4.80 (dd, 3, 14-H 2 / 14-OH), 5.30 (br s, 1, 9-OH), 5.43 (d, 1, 1 -H), 5.51 (d, 1, 7-H), 7.41 (d, 1, 3-H), 7.80 (t, 1, 2-H), 8.05 (d, 1, 1-H), (s, 1, 11-OH), (s, 1, 6-OH). P r z y k ł a d II N 3', O 4, O 14 -triacetylo-4 -epidoksyrubicyna (2, BNE02) Chlorowodorek 4 -epidoksyrubicyny (100 mg, 0.17 mmola) rozpuszczono w 10 ml suchego chloroformu i dodano 20 mg dimetyloaminopirydyny. Roztwór oziębiono do 0 C na łaźni lodowej i dodano, stale mieszając 400 μl (4.24 mmola) bezwodnika octowego. Mieszaninę pozostawiono do ogrzania się do temperatury pokojowej i dalej mieszano. Postęp reakcji badano przy użyciu TLC (CHCl 3 : MeOH 9:1). Otrzymany roztwór przemyto 3 razy 0.1 M buforem fosforanowym o ph 7.0 oraz 2 razy wodą. Warstwę organiczną wysuszono nad bezwodnym siarczanem sodu i odparowano pod próżnią. Pozostałość chromatografowano na kolumnie z żelem krzemionkowym (CHCl 3 do CHCl 3 :MeOH 1:1). Otrzymano związek o wzorze 1, (R 1 : CH 3 CO, R 2 : CH 3 CO, R 3 : H, R 4 : CH 3 CO) Temp. topn. 178 C. MS (ES+) NMR (DMSO-d 6 ) δ 1.09 (d, 3, 5 -CH 3 ), 1.69 (s, 3, 14-O-COCH 3 ), 1.97 (s, 3, 4 -O-COCH 3 ), (m, 5, 3 -N-COCH 3, 8H 2 ), 2.94/3.08(d/d, 1/1, 2 -H 2 ), 4.05 (s, 3, 4-OCH 3 ), (m, 1, 5 -H), 4.43 (t, 1, 1 -H), (m, 1, 7-H), 5.22 (d, 2, 14-H 2 ), 5.79 (s, 1, 9-OH), 7.66 (t, 1, 2-H), 7.72 (d, 1, 3-H), 7.92 (d, 1, 1-H), (s, 1, 11-OH), (s, 1, 6-OH). P r z y k ł a d III 3 -N,N-dimetylo-4 -epidoksyrubicyna (3, BNE06) Do roztworu chlorowodorku 4 -epidoksyrubicyny (100 mg, 0.17 mmola) w 630 μl H 2 O dodano mieszając 1.3 ml acetonitrylu i mieszaninę ogrzano do 30 C. Dodano 130 μl (1.31 mmola) 37% wodnego roztworu formaldehydu i roztwór mieszano przez 20 minut w Następnie dodano kroplami w ciągu 15 minut 23 mg (0.37 mmola) NaCNBH 3 w 1.3 ml acetonitrylu i mieszano w 24 C przez 20 minut. Mieszaninę reakcyjną rozcieńczono wodą (4 ml) i ekstrahowano 2 razy 4 ml chloroformu. Ekstrakty chloroformowe połączono, suszono nad bezwodnym siarczanem sodu i odparowano pod próżnią. Pozostałość chromatografowano na preparatywnych płytkach z żelem (Merck No ) PLC plates stosując CHCl 3 :MeOH:H 2 O 40:10:1. Otrzymano związek o wzorze 1, (R 1 : H, R 2 : CH 3, R 3 : CH 3, R 4 : H) Temp. topn. 220 C. MS (ES+) , (ES-) NMR (DMSO-d 6 ) δ 1.20 (d, 3, 5 - CH 3 ), 1.56 (dt, 1, 2 -H), 1,72 (dd, 1, 2 -H), 2.17 (br s, 8, 3 -N(CH 3 ) 3, 8-H 2 ) (m, 4, 10-H, 4 -OH, 4 -H, 3 -H), (m, 1, 5 -H), 3.99 (s, 3, 4-OCH 3 ), 4.55 (br s, 2, 14-H 2 ), 4.85 (br s, 1, 14-OH), 4.97 (t, 1, 1 -H), 5.32 (d, 1, 7-H), 5.45 (s, 1, 9-OH), 7.62 (d, 1, 3-H), 7.89 (t, 1, 2-H), 7.94 (d, 1, 1-H), (br s, 1, 11-OH), (br s, 1, 6-OH). P r z y k ł a d IV 3 -N-(N,N -dimetyloformamidynylo)-4 -epidoksyrubicyna (4, BNE06) Do roztworu chlorowodorku 4 -epidoksyrubicyny (150 mg, 0.26 mmola) w 7.5 ml suchego metanolu dodano kroplami, w atmosferze argonu N,N-dimetyloformamidodimetyloacetal (182 μl, 1.30 mmola). Mieszaninę reakcyjną mieszano przez 4 godz., a następnie rozpuszczalnik odparowano pod próżnią. Pozostałość chromatografowano na kolumnie z żelem krzemionkowym (CHCl 3 do CHCl 3 :MeOH 9:1). Otrzymano związek o wzorze 1, (R 1 : H, R 2 : =CH-N(CH 3 ) 2, R 4 : H) Temp. topn. 206 C. MS (ES+) , (ES-) ; NMR (DMSO-d 6 ) δ 1.24 (d, 3, 5 -CH 3 ), 1.99 (d, 2, 8H 2 ), 2.19 (m, 2, 2 -H 2 ), (m i m, 11, 10-H 2, 4 -OH, 4 -H, 3 -H, N -Me 2 ), 3.93 (m, 1, 5-H), 4.00 (s, 3, 4-

4 4 PL B1 OCH 3 ), 4.57 (d, 2, 14-H 2 ), 4.87 (t, 1, 14-OH), 4.99 (t, 1, 1-H), 5.29 (t, 1, 7-H), 5.48 (s, 1, 9-OH), 7.68 (t, 1, 2-H), 7.94 (d, 2, 1-H i 3-H), 8.08 (s, 1, 3 -NC -H), (s, 1, 11-OH), (s, 1, 6-OH). Badanie aktywności przeciwwirusowej i cytotoksyczności Potencjalną aktywność przeciwwirusową (anty-hcv) pochodnych epirubicyny przedstawionych wzorem 1 zbadano in vitro w hodowli komórkowej przy użyciu układu zawierającego subgenomowy replikon HCV stabilnie transfekowany do komórek Huh7 (klon BM 4.5) (Ju-Tao Gao et al., J Virol. 2001). Komórki Huh7 zawierające replikon HCV hodowano w medium hodowlanym przy różnych stężeniach pochodnej epirubicyny. Media i lek zmieniano każdego dnia przez 5 dni. Po 5-ciu dniach traktowania lekiem komórki zostały poddane lizie i całkowitej ekstrakcji RNA. Następnie wyizolowany RNA zbadano na obecność replikacji HCV drogą analizy Northern Blot, stosując próbkę HCV noszącą region NS5B HCV. Ponadto, hybrydyzacja znakowaną próbką β-aktyny pozwoliła na znormalizowanie tych wyników, tj. na przypisanie wpływu leku na wewnątrzkomórkową ekspresję genu (housekeeping). Linie komórkowe traktowano codziennie odpowiednią pochodną epirubicyny w zakresie stężeń nm przez 5 dni i pod koniec traktowania izolowano RNA z traktowanych komórek. Całkowity RNA zbadano przy użyciu próbki specyficznego HCV, stosując do oznaczenia HCV RNA analizę Northern blot. Uzyskany chromatogram poddano następnie densytometrii stosując Phosfor Imager i oznaczono ilościowo wirusową replikację. Wyniki analizy prowadzonej w zależności od czasu traktowania wykazały, że pochodne epirubicyny w stężeniach μμ efektywnie inhibują in vitro replikację HCV w układzie subgenomowego replikonu (Tabela 1). W Tabeli 1 wykazano również, że 50% stężenia (IC 50 ) pochodnych epirubicyny z uwzględnieniem aktywności przeciwko HCV mierzonej w układzie replikonu HCV są niskie i leżą w zakresie μμ, podczas gdy ich stężenia powodujące 50% inhibicję (CC 50 ) komórek Huh7 wynoszą μμ, korzystnie w przypadku N 3,O 4, O 14 -triacetyloepirubicyny (BNE02), gdzie indeks terapeutyczny wynosił 10. Inhibicję replikacji HCV przez epirubicynę (BNE00), N3 -acetyloepirubicynę (BNE01) oraz N 3,O 4,O 14 -triacetyloepirubicynę (BNE02) (fig. 1, Tabela 2) oznaczano jak następuje. Limfocyty hodowano w medium wzbogaconym znanymi stężeniami BNE00, BNE01 i BNE02. Piątego i czternastego dnia hodowli komórki zebrano i po ekstrakcji oznaczono jakościowo HCV RNA stosując pomiar rzeczywistego czasu reakcji polimeryzacji łańcuchowej (Real Time Polymerase Chain Reaction, RT PCR). Ilościowe oznaczanie HCV RNA również przeprowadzono przy użyciu RT PCR (fig. 2). RNA wyizolowano przy użyciu Total RNA extraction kit (A&A Biotechnology, Gdynia, Poland, Amplifikację HCV RNA przeprowadzono jak następuje: RT-PCR przeprowadzono w jednym etapie przez 60 minut w 42 C i przez 15 min w 75 C. Do pierwszego PCR, które obejmowało 30 cyklów amplifikacji (10 s w 65 C i 20 s w 72 C) użyto 3 μl cdna. 2 μl produktu z pierwszego procesu użyto do drugiej amplifikacji (35 cyklów, każdy cykl 10 s w 94 C, 10 s w 65 C i 20 s w 72 C a następnie przedłużono o 7 min w 72 C. W pierwszym procesie użyto 10 pmoli primerów NTR 1 LOW (GGTGCACGGTCTACGAGACCT) oraz NTR 1 UP (CGACACTCCACCATAGAT) a do drugiego procesu użyto NTR 2 LOW (CACTCGCAAGCACCCTAT CAGGCAGT) oraz NTR 2 UP (CCACCATA- GATCACTCCCCTGT). Produkty uzyskane z PCR analizowano przy pomocy elektroforezy stosując 1% Nusieve agarose gel (FMC) wybarwiając bromkiem etydyny. Cytotoksyczność (CC 50 ) pochodnych epirubicyny w komórkach PBMC była bardzo mała i wynosiła μμ (fig. 3). Oznaczenie toksyczności ostrej u myszy (LD 50 ) wykonano wg. Wskazówek OECD dla testowania chemikaliów (wskazówka No 401). (OECD Guidelines for Testing of Chemicals, Guideline No 401). Związek 2 (BNE02) korzystnie wykazuje bardzo niską toksyczność ostrą in vivo (LD 50 = 1300 mg/kg wagi ciała myszy), podczas gdy wartość ta dla chlorowodorku epirubicyny (BNE00) wynosi 37 mg/kg. W niniejszych badaniach wykazano po raz pierwszy, że pochodne epirubicyny wywierają efekt hamujący replikację HCV przy nanomolowych stężeniach i mogą być stosowane jako efektywne leki przeciwko zakażeniom HCV przy znikomej toksyczności in vitro i in vivo.

5 PL B1 5 T a b e l a 1 Aktywność anty-hcv w układzie replikonu HCV 1 oraz cytotoksyczność epirubicyny i jej pochodnych wobec komórek Huh-7 i PBMC. Związek Chlorowodorek epirubicyny (BNE00) 1. N 3 -acetyloepirubicyna (BNE01) 2. N 3,O 4,O 14 -triacetyloepirubi cyna (BNE02) N,N-Dimetylo-4 -epidoxorubicyna (BNE06) N-(N,N -Dimetyloformamidinylo)-4-epidoxorubicyna (BNE04) Cytotoksyczność wobec komórek PBMC CC 50 (μμ) Cytotoksyczność wobec komórek Huh7 CC 50 (μμ) 2 Aktywność anty-hcv IC 50 (μμ) 3 Indeks terapeutyczny CC 50 / IC >0.9 > >0.05 >0.05 >1 1 subgenomowy replikon HCV stabilnie transfekowany do komórek Huh7 (klon BM4.5) (Ju-Tao Gao et al., J. Virol. 2001, ) 2 cytotoksyczność (CC 50 ) - 50% stężenie cytotoksyczne 3 aktywność przeciwwirusowa (IC 50 ) - stężenie wymagane do zahamowania replikacji wirusa w 50% W tabeli nr 2 zamieszczono dane dotyczące cytotoksyczności (CC 50 i CC 90 ), aktywności anty-hcv (IC 50 i IC 90 ) oraz indeksu terapeutycznego (TI 50 i TI 90 ) epirubicyny i jej pochodnych w hodowli limfocytowej. T a b e l a 2 Związek CC 50 CC 90 IC 50 IC 90 Tl 50 Tl 90 BNE BNE BNE > > Zastrzeżenia patentowe 1. Nowe pochodne epirubicyny czyli 7-O-(3 -amino-2,3,6 -trideoksy-α,β-l-arabinohekso-piranozylo)-adriamycynonu przedstawione wzorem 1, w którym co najwyżej dwa z czterech podstawników R 1, R 2, R 3 i R 4 są takie same lub różne i oznaczają atom wodoru, a co najmniej dwa z tych czterech podstawników oznaczają grupę alkilową, grupę alkenową lub alkinową, o 1 do 5 atomach węgla, grupę alkilokarbonylową o łańcuchu alkilowym od 1 do 3 atomów węgla, zwłaszcza grupę acetylową, przy czym jeśli R 1 i R 4 oznaczają jednocześnie atom wodoru, to R 2 i R 3 razem z atomem azotu, do którego są przyłączone, oznaczają grupę dimetyloformamidylową. 2. Zastosowanie medyczne nowych pochodnych epirubicyny, określonych w zastrzeżeniu 1, do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV). 3. Zastosowanie pochodnych, według zastrz. 2, do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV), zapewniających niską toksyczność w stosunku do komórek Huh7 i PBMC, wyższy indeks terapeutyczny (TI) niż sama epirubicyna oraz mniejszą niż epirubicyna toksyczność in vivo. 4. Farmaceutycznie akceptowalna forma leku przeciwko zakażeniom HCV, zawierająca znane nośniki i dodatki, znamienna tym, że jako substancję aktywną zawiera pochodne epirubicyny przedstawione wzorem 1, w którym co najwyżej dwa z czterech podstawników R 1, R 2, R 3 i R 4 są takie same lub różne i oznaczają atom wodoru, a co najmniej dwa z tych czterech podstawników oznaczają grupę alkilową, grupę alkenową lub alkinową, o 1 do 5 atomach węgla, grupę alkilokarbonylową o łańcuchu alkilowym od 1 do 3 atomów węgla, zwłaszcza acetylową, przy czym jeśli R 1 i R 4 oznaczają jednocześnie atom wodoru, to R 2 i R 3 razem z atomem azotu, do którego są przyłączone, oznaczają grupę dimetyloformamidylową.

6 6 PL B1 Rysunki

7 PL B1 7

8 8 PL B1 Departament Wydawnictw UP RP Cena 2,46 zł (w tym 23% VAT)

PL 198188 B1. Instytut Chemii Przemysłowej im.prof.ignacego Mościckiego,Warszawa,PL 03.04.2006 BUP 07/06

PL 198188 B1. Instytut Chemii Przemysłowej im.prof.ignacego Mościckiego,Warszawa,PL 03.04.2006 BUP 07/06 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 198188 (13) B1 (21) Numer zgłoszenia: 370289 (51) Int.Cl. C01B 33/00 (2006.01) C01B 33/18 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

PL 218025 B1. POLITECHNIKA POZNAŃSKA, Poznań, PL 19.12.2011 BUP 26/11. JULIUSZ PERNAK, Poznań, PL BEATA CZARNECKA, Poznań, PL ANNA PERNAK, Poznań, PL

PL 218025 B1. POLITECHNIKA POZNAŃSKA, Poznań, PL 19.12.2011 BUP 26/11. JULIUSZ PERNAK, Poznań, PL BEATA CZARNECKA, Poznań, PL ANNA PERNAK, Poznań, PL PL 218025 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 218025 (13) B1 (21) Numer zgłoszenia: 391493 (51) Int.Cl. A61K 6/027 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 26.05.2004 04739355.8

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 26.05.2004 04739355.8 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 163174 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 26.0.04 047393.8 (97)

Bardziej szczegółowo

... ...J CD CD. N "f"'" Sposób i filtr do usuwania amoniaku z powietrza. POLITECHNIKA LUBELSKA, Lublin, PL 09.11.2009 BUP 23/09

... ...J CD CD. N f' Sposób i filtr do usuwania amoniaku z powietrza. POLITECHNIKA LUBELSKA, Lublin, PL 09.11.2009 BUP 23/09 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19)PL (11)212766 (13) 81 (21) Numer zgłoszenia 385072 (51) Int.CI 801D 53/04 (2006.01) C01C 1/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo

PL 204536 B1. Szczepanik Marian,Kraków,PL Selmaj Krzysztof,Łódź,PL 29.12.2003 BUP 26/03 29.01.2010 WUP 01/10

PL 204536 B1. Szczepanik Marian,Kraków,PL Selmaj Krzysztof,Łódź,PL 29.12.2003 BUP 26/03 29.01.2010 WUP 01/10 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 204536 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 354698 (22) Data zgłoszenia: 24.06.2002 (51) Int.Cl. A61K 38/38 (2006.01)

Bardziej szczegółowo

PL 203790 B1. Uniwersytet Śląski w Katowicach,Katowice,PL 03.10.2005 BUP 20/05. Andrzej Posmyk,Katowice,PL 30.11.2009 WUP 11/09 RZECZPOSPOLITA POLSKA

PL 203790 B1. Uniwersytet Śląski w Katowicach,Katowice,PL 03.10.2005 BUP 20/05. Andrzej Posmyk,Katowice,PL 30.11.2009 WUP 11/09 RZECZPOSPOLITA POLSKA RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 203790 (13) B1 (21) Numer zgłoszenia: 366689 (51) Int.Cl. C25D 5/18 (2006.01) C25D 11/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2131847. (96) Data i numer zgłoszenia patentu europejskiego: 27.02.2008 08716068.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2131847. (96) Data i numer zgłoszenia patentu europejskiego: 27.02.2008 08716068. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2131847 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 27.02.2008 08716068.5

Bardziej szczegółowo

(13) B1 (12) OPIS PATENTOWY (19) PL (11) 172690 PL 172690 B1 C07F 9/572 C 07F 9/38. (43) Zgłoszenie ogłoszono:

(13) B1 (12) OPIS PATENTOWY (19) PL (11) 172690 PL 172690 B1 C07F 9/572 C 07F 9/38. (43) Zgłoszenie ogłoszono: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 172690 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21 ) Numer zgłoszenia. 299116 (22) Data zgłoszenia 28.05.1993 (51) IntCl 6: C07F 9/572 C

Bardziej szczegółowo

PL 215396 B1. Urządzenie do wymuszonego chłodzenia łożysk, zwłaszcza poziomej pompy do hydrotransportu ciężkiego

PL 215396 B1. Urządzenie do wymuszonego chłodzenia łożysk, zwłaszcza poziomej pompy do hydrotransportu ciężkiego PL 215396 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215396 (13) B1 (21) Numer zgłoszenia: 389424 (51) Int.Cl. F16C 37/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

PL 215770 B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL 23.05.2011 BUP 11/11

PL 215770 B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL 23.05.2011 BUP 11/11 PL 215770 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215770 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 389528 (22) Data zgłoszenia: 10.11.2009 (51) Int.Cl.

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

Nowe estry nukleozydów adenozynowych i kwasu karboksylowego, sposób ich otrzymywania oraz zawierająca je kompozycja farmaceutyczna.

Nowe estry nukleozydów adenozynowych i kwasu karboksylowego, sposób ich otrzymywania oraz zawierająca je kompozycja farmaceutyczna. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 201571 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 368093 (22) Data zgłoszenia: 19.05.2004 (51) Int.Cl. C07H 19/173 (2006.01)

Bardziej szczegółowo

PL B1. W.C. Heraeus GmbH,Hanau,DE ,DE, Martin Weigert,Hanau,DE Josef Heindel,Hainburg,DE Uwe Konietzka,Gieselbach,DE

PL B1. W.C. Heraeus GmbH,Hanau,DE ,DE, Martin Weigert,Hanau,DE Josef Heindel,Hainburg,DE Uwe Konietzka,Gieselbach,DE RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 204234 (13) B1 (21) Numer zgłoszenia: 363401 (51) Int.Cl. C23C 14/34 (2006.01) B22D 23/06 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

Ocena. wykonanej pod kierunkiem prof. dr hab. med. Małgorzaty Polz-Docewicz

Ocena. wykonanej pod kierunkiem prof. dr hab. med. Małgorzaty Polz-Docewicz UNIWERSYTET MEDYCZNY IM. KAROLA MARCINKOWSKIEGO W POZNANIU KATEDRA I ZAKŁAD MIKROBIOLOGII LEKARSKIEJ Kierownik: prof. dr hab. Andrzej Szkaradkiewicz ul. Wieniawskiego 3 tel. 61 8546 138 61-712 Poznań fax

Bardziej szczegółowo

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208956 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 381219 (22) Data zgłoszenia: 05.12.2006 (51) Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 19.11.2004 04819605.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 19.11.2004 04819605. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1687319 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 19.11.04 0481960.9 (1) Int. Cl. C07F9/30 (06.01) (97)

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

PL 207979 B1. POLITECHNIKA RZESZOWSKA IM. IGNACEGO ŁUKASIEWICZA, Rzeszów, PL 21.01.2008 BUP 02/08

PL 207979 B1. POLITECHNIKA RZESZOWSKA IM. IGNACEGO ŁUKASIEWICZA, Rzeszów, PL 21.01.2008 BUP 02/08 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 207979 (13) B1 (21) Numer zgłoszenia: 380220 (51) Int.Cl. C07D 209/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 17.07.2006

Bardziej szczegółowo

ĆWICZENIA Z BIOCHEMII

ĆWICZENIA Z BIOCHEMII ĆWICZENIA Z BIOCHEMII D U STUDENTfiW WYDZIAŁU LEKARSKIEGO Pod redakcją Piotra Laidlera, Barbary Piekarskiej, Marii Wróbel WYDAWNICTWO UNIWERSYTETU JAGIELLOŃSKIEGO ĆWICZENIA Z BIOCHEMII DLA STUDENTÓW WYDZIAŁU

Bardziej szczegółowo

PL 208802 B1. NYK BOGUSŁAW, Warszawa, PL 13.10.2008 BUP 21/08. BOGUSŁAW NYK, Warszawa, PL 30.06.2011 WUP 06/11. rzecz. pat.

PL 208802 B1. NYK BOGUSŁAW, Warszawa, PL 13.10.2008 BUP 21/08. BOGUSŁAW NYK, Warszawa, PL 30.06.2011 WUP 06/11. rzecz. pat. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208802 (13) B1 (21) Numer zgłoszenia: 382138 (51) Int.Cl. A47H 1/02 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 04.04.2007

Bardziej szczegółowo

PL 213132 B1. POLITECHNIKA WROCŁAWSKA, Wrocław, PL 14.11.2005 BUP 23/05

PL 213132 B1. POLITECHNIKA WROCŁAWSKA, Wrocław, PL 14.11.2005 BUP 23/05 PL 213132 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 213132 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 367760 (22) Data zgłoszenia: 06.05.2004 (51) Int.Cl.

Bardziej szczegółowo

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika Spis treści 1. Zawartość 2 1.1 Składniki zestawu 2 2. Opis produktu 2 2.1 Założenia metody 2 2.2 Instrukcja 2 2.3 Specyfikacja

Bardziej szczegółowo

PL 175707 B1 (12) OPIS PATENTOWY (19) PL (11) 175707 (13) B1 C07C 235/66

PL 175707 B1 (12) OPIS PATENTOWY (19) PL (11) 175707 (13) B1 C07C 235/66 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 175707 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 304406 (22) Data zgłoszenia: 22.07.1994 IntCl6: C07C 203/04 C07C 235/66

Bardziej szczegółowo

Instrukcja do ćwiczeń laboratoryjnych

Instrukcja do ćwiczeń laboratoryjnych UNIWERSYTET GDAŃSKI Pracownia studencka Zakład Analizy Środowiska Instrukcja do ćwiczeń laboratoryjnych Ćwiczenie nr 3 Oznaczanie witaminy E w oleju metodą HPLC ANALIZA PRODUKTÓW POCHODZENIA NATURALNEGO

Bardziej szczegółowo

Instrukcja do ćwiczeń laboratoryjnych

Instrukcja do ćwiczeń laboratoryjnych UNIWERSYTET GDAŃSKI WYDZIAŁ CHEMII Pracownia studencka Katedra Analizy Środowiska Instrukcja do ćwiczeń laboratoryjnych Ćwiczenie nr 2 OPTYMALIZACJA ROZDZIELANIA MIESZANINY WYBRANYCH FARMACEUTYKÓW METODĄ

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058. (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058. (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058 (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244.7 (13) (51) T3 Int.Cl. C22C 38/40 (2006.01)

Bardziej szczegółowo

PL 212814 B1. WONAM SERWIS SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Żory, PL 27.02.2012 BUP 05/12

PL 212814 B1. WONAM SERWIS SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Żory, PL 27.02.2012 BUP 05/12 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 212814 (13) B1 (21) Numer zgłoszenia: 392196 (51) Int.Cl. E21F 3/00 (2006.01) F24F 3/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo

(54) Sorbent do pozaustrojowego usuwania lipoprotein o niskiej gęstości z krwi lub osocza

(54) Sorbent do pozaustrojowego usuwania lipoprotein o niskiej gęstości z krwi lub osocza RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 167750 (13) B1 (21) Numer zgłoszenia: 293642 Urząd Patentowy (22) Data z głoszenia: 28.02.1992 Rzeczypospolitej Polskiej (51) IntCl6: B01J 20/24 B01J

Bardziej szczegółowo

do leczenia zakażenia Helicobacter pylori i związanych z nim chorób (74) Pełnomocnik:

do leczenia zakażenia Helicobacter pylori i związanych z nim chorób (74) Pełnomocnik: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 187704 (21) Numer zgłoszenia: 323305 (13) B1 (22) Data zgłoszenia: 05.07.1996 (86) Data i numer zgłoszenia

Bardziej szczegółowo

BIONORICA Polska Sp z o.o. CHARAKTERYSTYKA PRODUKTU LECZNICZEGO. Cyclodynon 1

BIONORICA Polska Sp z o.o. CHARAKTERYSTYKA PRODUKTU LECZNICZEGO. Cyclodynon 1 CHARAKTERYSTYKA PRODUKTU LECZNICZEGO Cyclodynon 1 1. NAZWA PRODUKTU LECZNICZEGO Cyclodynon 2. SKŁAD JAKOŚCIOWY I ILOŚCIOWY SUBSTANCJI CZYNNEJ 1 tabletka powlekana zawiera 40 mg suchego wyciągu etanolowego

Bardziej szczegółowo

PL 214401 B1. Kontener zawierający co najmniej jeden wzmacniający profil oraz sposób wytwarzania takiego profilu

PL 214401 B1. Kontener zawierający co najmniej jeden wzmacniający profil oraz sposób wytwarzania takiego profilu PL 214401 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214401 (13) B1 (21) Numer zgłoszenia: 378396 (51) Int.Cl. B65F 1/00 (2006.01) B65D 88/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

PL 177676 B1 C07C 401/00 A61K 31/59 A 6 1 K 7/40

PL 177676 B1 C07C 401/00 A61K 31/59 A 6 1 K 7/40 RZECZPOSPOLITA POLSKA (1 2 ) OPIS PATENTOWY ( 1 9 ) PL (1 1 ) 177676 (1 3 ) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 308427 (22) Data zgłoszenia: 29.04.1995 ( 5 1 ) IntCl6: C07C

Bardziej szczegółowo

PL 213904 B1. Elektrolityczna, nanostrukturalna powłoka kompozytowa o małym współczynniku tarcia, zużyciu ściernym i korozji

PL 213904 B1. Elektrolityczna, nanostrukturalna powłoka kompozytowa o małym współczynniku tarcia, zużyciu ściernym i korozji PL 213904 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 213904 (13) B1 (21) Numer zgłoszenia: 390004 (51) Int.Cl. C25D 3/12 (2006.01) C25D 15/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609. (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609. (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609 (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792.2 (13) (51) T3 Int.Cl. A61K 38/17 (2006.01)

Bardziej szczegółowo

Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII "

Kurs pt.  MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII Warszawa, 6 lutego 2011 r. Szanowna Pani! Szanowny Panie! Niniejszym uprzejmie informuję, że organizowany jest Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII " Kurs odbędzie się w dniach

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

( 5 4 ) Kompozycja farmaceutyczna do leczenia chorób, w których mediatorem jest

( 5 4 ) Kompozycja farmaceutyczna do leczenia chorób, w których mediatorem jest RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (21) Numer zgłoszenia: 329940 (22) Data zgłoszenia: 13.05.1997 (86) Data i numer zgłoszenia międzynarodowego: 13.05.1997,

Bardziej szczegółowo

PL 203461 B1. Politechnika Warszawska,Warszawa,PL 15.12.2003 BUP 25/03. Mateusz Turkowski,Warszawa,PL Tadeusz Strzałkowski,Warszawa,PL

PL 203461 B1. Politechnika Warszawska,Warszawa,PL 15.12.2003 BUP 25/03. Mateusz Turkowski,Warszawa,PL Tadeusz Strzałkowski,Warszawa,PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 203461 (13) B1 (21) Numer zgłoszenia: 354438 (51) Int.Cl. G01F 1/32 (2006.01) G01P 5/01 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo

PL 208214 B1. DZIŻA SŁAWOMIR-PRACOWNIA PLASTYCZNA REKLAMA, Szadkowice, PL 12.12.2005 BUP 25/05. SŁAWOMIR DZIŻA, Szadkowice, PL 31.03.

PL 208214 B1. DZIŻA SŁAWOMIR-PRACOWNIA PLASTYCZNA REKLAMA, Szadkowice, PL 12.12.2005 BUP 25/05. SŁAWOMIR DZIŻA, Szadkowice, PL 31.03. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208214 (13) B1 (21) Numer zgłoszenia: 368426 (51) Int.Cl. G09F 13/22 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 07.06.2004

Bardziej szczegółowo

ARKUSZ 1 POWTÓRZENIE DO EGZAMINU Z CHEMII

ARKUSZ 1 POWTÓRZENIE DO EGZAMINU Z CHEMII ARKUSZ 1 POWTÓRZENIE DO EGZAMINU Z CHEMII Zadanie 1. Na rysunku przedstawiono fragment układu okresowego pierwiastków. Dokoocz zdania tak aby były prawdziwe. Wiązanie jonowe występuje w związku chemicznym

Bardziej szczegółowo

Sposób otrzymywania białek o właściwościach immunoregulatorowych. Przedmiotem wynalazku jest sposób otrzymywania fragmentów witellogeniny.

Sposób otrzymywania białek o właściwościach immunoregulatorowych. Przedmiotem wynalazku jest sposób otrzymywania fragmentów witellogeniny. 1 Sposób otrzymywania białek o właściwościach immunoregulatorowych Przedmiotem wynalazku jest sposób otrzymywania fragmentów witellogeniny. Wynalazek może znaleźć zastosowanie w przemyśle spożywczym i

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: 10.11.2003, PCT/FI03/000850 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: 10.11.2003, PCT/FI03/000850 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 211756 (21) Numer zgłoszenia: 376772 (22) Data zgłoszenia: 10.11.2003 (86) Data i numer zgłoszenia międzynarodowego:

Bardziej szczegółowo

(12) OPIS PATENTOWY (19)PL (11)190412 (13) B1 PL 190412 B1 B65G 57/28 B65H 29/38 B65B 35/22 RZECZPOSPOLITA POLSKA. (21 ) Numer zgłoszenia: 336192

(12) OPIS PATENTOWY (19)PL (11)190412 (13) B1 PL 190412 B1 B65G 57/28 B65H 29/38 B65B 35/22 RZECZPOSPOLITA POLSKA. (21 ) Numer zgłoszenia: 336192 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19)PL (11)190412 (21 ) Numer zgłoszenia: 336192 (22) Data zgłoszenia: 2 3.10.1999 (13) B1 (51) IntCl7 B65G 57/28 B65H

Bardziej szczegółowo

Biochemia: Ćw. 11 Metoda RT-PCR

Biochemia: Ćw. 11 Metoda RT-PCR Ćwiczenie 11 METODA RT-PCR Wyciąg z kart charakterystyki substancji niebezpiecznych: bromek etydyny T+ EDTA Xi etanol, 96% F kwas octowy, 96% C -merkaptoetanol N, T Tris Xi UWAGI WSTĘPNE Praca z kwasami

Bardziej szczegółowo

PL 210507 B1. PAC ALEKSANDER, Lublewo, PL. 02.09.2003, XI Międzynarodowy Salon Przemysłu Obronnego Kielce

PL 210507 B1. PAC ALEKSANDER, Lublewo, PL. 02.09.2003, XI Międzynarodowy Salon Przemysłu Obronnego Kielce RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 210507 (13) B1 (21) Numer zgłoszenia: 365767 (51) Int.Cl. H01Q 3/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 02.03.2004

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 185228

(12) OPIS PATENTOWY (19) PL (11) 185228 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 185228 (21) Numer zgłoszenia: 331212 ( 13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 04.07.1997 (86) Data i numer zgłoszenia

Bardziej szczegółowo

(73) Uprawniony z patentu: (72) (74) Pełnomocnik:

(73) Uprawniony z patentu: (72) (74) Pełnomocnik: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 165947 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 292707 (22) Data zgłoszenia: 09.12.1991 (51) IntCl5: B01D 53/04 (54)

Bardziej szczegółowo

Raport z badania Działanie wirusobójcze środka dezynfekującego wobec Feline calicivirus. 25 października 2006

Raport z badania Działanie wirusobójcze środka dezynfekującego wobec Feline calicivirus. 25 października 2006 Raport z badania Działanie wirusobójcze środka dezynfekującego wobec Feline calicivirus 25 października 2006 Dr Tobias J. Tuthill Wydział Nauk Biologicznych Uniwersytet Leeds Leeds LS2 9JT www.fbs.leeds.ac.uk

Bardziej szczegółowo

(13) B1 (12) OPIS PATENTOWY (19) PL (11) 183565 PL 183565 B1. (54) Mechanizm przekładni w maszynie do ćwiczeń z obciążeniem narządów ruchu

(13) B1 (12) OPIS PATENTOWY (19) PL (11) 183565 PL 183565 B1. (54) Mechanizm przekładni w maszynie do ćwiczeń z obciążeniem narządów ruchu RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 183565 (13) B1 (21) Numer zgłoszenia: 3 1 9 9 1 6 (22) Data zgłoszenia: 09.05.1997 (5 1) IntCl7: A63B 21/06

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2526977. (96) Data i numer zgłoszenia patentu europejskiego: 31.01.2012 12153261.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2526977. (96) Data i numer zgłoszenia patentu europejskiego: 31.01.2012 12153261. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2526977 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 31.01.2012 12153261.8

Bardziej szczegółowo

PL 209211 B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA, Kraków, PL 24.07.2006 BUP 15/06

PL 209211 B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA, Kraków, PL 24.07.2006 BUP 15/06 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 209211 (13) B1 (21) Numer zgłoszenia: 372150 (51) Int.Cl. G01N 27/87 (2006.01) B66B 7/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

PL 201250 B1. Balcer Józef Zakład Wielobranżowy RETRO,Nakło n/notecią,pl 13.12.2004 BUP 25/04. Józef Balcer,Nakło n/notecią,pl 31.03.

PL 201250 B1. Balcer Józef Zakład Wielobranżowy RETRO,Nakło n/notecią,pl 13.12.2004 BUP 25/04. Józef Balcer,Nakło n/notecią,pl 31.03. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 201250 (13) B1 (21) Numer zgłoszenia: 360458 (51) Int.Cl. E04G 1/32 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 02.06.2003

Bardziej szczegółowo

(73) Uprawniony z patentu: (75) Pełnomocnik:

(73) Uprawniony z patentu: (75) Pełnomocnik: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 187703 (57) Numer zgłoszenia: 323204 (22) Data zgłoszenia: 17.11.1997 (13) B1 (51) IntCl7: A01K 53/00 A23K

Bardziej szczegółowo

PL 175488 B1 (12) OPIS PATENTOWY (19) PL (11) 175488 (13) B1. (22) Data zgłoszenia: 08.12.1994

PL 175488 B1 (12) OPIS PATENTOWY (19) PL (11) 175488 (13) B1. (22) Data zgłoszenia: 08.12.1994 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 175488 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 306167 (22) Data zgłoszenia: 08.12.1994 (51) IntCl6: G01K 13/00 G01C

Bardziej szczegółowo

PL 214592 B1. POLITECHNIKA CZĘSTOCHOWSKA, Częstochowa, PL 14.03.2011 BUP 06/11

PL 214592 B1. POLITECHNIKA CZĘSTOCHOWSKA, Częstochowa, PL 14.03.2011 BUP 06/11 PL 214592 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214592 (13) B1 (21) Numer zgłoszenia: 388915 (51) Int.Cl. G01B 5/28 (2006.01) G01C 7/04 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925

TaqNovaHS. Polimeraza DNA RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 RP902A, RP905A, RP910A, RP925A RP902, RP905, RP910, RP925 TaqNovaHS Polimeraza TaqNovaHS jest mieszaniną termostabilnej polimerazy DNA

Bardziej szczegółowo

PL 207433 B1. PRZEMYSŁOWY INSTYTUT AUTOMATYKI I POMIARÓW PIAP, Warszawa, PL 26.06.2006 BUP 13/06. ZBIGNIEW BORKOWICZ, Wrocław, PL 31.12.

PL 207433 B1. PRZEMYSŁOWY INSTYTUT AUTOMATYKI I POMIARÓW PIAP, Warszawa, PL 26.06.2006 BUP 13/06. ZBIGNIEW BORKOWICZ, Wrocław, PL 31.12. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 207433 (13) B1 (21) Numer zgłoszenia: 371716 (51) Int.Cl. G01N 27/82 (2006.01) B25J 15/06 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

PL 211723 B1. HUTA STALOWA WOLA SPÓŁKA AKCYJNA, Stalowa Wola, PL 12.04.2010 BUP 08/10

PL 211723 B1. HUTA STALOWA WOLA SPÓŁKA AKCYJNA, Stalowa Wola, PL 12.04.2010 BUP 08/10 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 211723 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 386838 (22) Data zgłoszenia: 07.10.2008 (51) Int.Cl. F41H 5/20 (2006.01)

Bardziej szczegółowo

PL 219521 B1. Układ do justowania osi manipulatora, zwłaszcza do pomiarów akustycznych w komorze bezechowej

PL 219521 B1. Układ do justowania osi manipulatora, zwłaszcza do pomiarów akustycznych w komorze bezechowej RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 219521 (13) B1 (21) Numer zgłoszenia: 391350 (51) Int.Cl. B25J 21/00 (2006.01) B25J 1/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2124961. (96) Data i numer zgłoszenia patentu europejskiego: 26.03.2008 08787851.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2124961. (96) Data i numer zgłoszenia patentu europejskiego: 26.03.2008 08787851. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2124961 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 26.03.08 0878781.8

Bardziej szczegółowo

PL 219451 B1. UNIWERSYTET WARSZAWSKI, Warszawa, PL 30.09.2013 BUP 20/13 30.04.2015 WUP 04/15. PIOTR WASYLCZYK, Warszawa, PL RZECZPOSPOLITA POLSKA

PL 219451 B1. UNIWERSYTET WARSZAWSKI, Warszawa, PL 30.09.2013 BUP 20/13 30.04.2015 WUP 04/15. PIOTR WASYLCZYK, Warszawa, PL RZECZPOSPOLITA POLSKA PL 219451 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 219451 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 398538 (22) Data zgłoszenia: 21.03.2012 (51) Int.Cl.

Bardziej szczegółowo

Ochronne okrycie dla zwierząt kopytnych i udomowionych oraz sposób wytwarzania ochronnego okrycia dla zwierząt kopytnych i udomowionych

Ochronne okrycie dla zwierząt kopytnych i udomowionych oraz sposób wytwarzania ochronnego okrycia dla zwierząt kopytnych i udomowionych PL 216694 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 216694 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 397194 (22) Data zgłoszenia: 30.11.2011 (51) Int.Cl.

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1747298 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 02.05.2005 05747547.7 (51) Int. Cl. C22C14/00 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 27.08.2004 04764563.5

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 27.08.2004 04764563.5 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1660449 (13) T3 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 27.08.2004

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: 03.11.2000, PCT/EP00/010871 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: 03.11.2000, PCT/EP00/010871 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 212132 (21) Numer zgłoszenia: 356240 (22) Data zgłoszenia: 03.11.2000 (86) Data i numer zgłoszenia międzynarodowego:

Bardziej szczegółowo

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16

Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Genetyczne modyfikowanie organizmów Kierunek OCHRONA ŚRODOWISKA, II rok semestr letni 2015/16 Ćwiczenie 3 Identyfikacja genetycznie modyfikowanych roślin w produktach spożywczych - jakościowe badanie obecności

Bardziej szczegółowo

PL 196881 B1. Trójfazowy licznik indukcyjny do pomiaru nadwyżki energii biernej powyżej zadanego tg ϕ

PL 196881 B1. Trójfazowy licznik indukcyjny do pomiaru nadwyżki energii biernej powyżej zadanego tg ϕ RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 196881 (13) B1 (21) Numer zgłoszenia: 340516 (51) Int.Cl. G01R 11/40 (2006.01) G01R 21/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

PL 208164 B1. Nowe peptydowe kompleksy platyny, sposób ich otrzymywania, kompozycja farmaceutyczna i zastosowanie

PL 208164 B1. Nowe peptydowe kompleksy platyny, sposób ich otrzymywania, kompozycja farmaceutyczna i zastosowanie RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208164 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 383412 (22) Data zgłoszenia: 24.09.2007 (51) Int.Cl. C07K 7/02 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 09.12.2005 05077837.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 09.12.2005 05077837. RZECZPSPLITA PLSKA (12) TŁUMACZENIE PATENTU EURPEJSKIEG (19) PL (11) PL/EP 1671547 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 09.12.2005 05077837.2 (51) Int. Cl. A23B7/154 (2006.01) (97)

Bardziej szczegółowo

PL 214324 B1. SMAY SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Kraków, PL 02.08.2010 BUP 16/10. JAROSŁAW WICHE, Kraków, PL 31.07.

PL 214324 B1. SMAY SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Kraków, PL 02.08.2010 BUP 16/10. JAROSŁAW WICHE, Kraków, PL 31.07. PL 214324 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214324 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 387102 (22) Data zgłoszenia: 23.01.2009 (51) Int.Cl.

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.07.2004 04740699.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.07.2004 04740699. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1658064 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 06.07.2004 04740699.6 (51) Int. Cl. A61K31/37 (2006.01)

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 187464

(12) OPIS PATENTOWY (19) PL (11) 187464 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 187464 (21 ) Numer zgłoszenia: 331012 (22) Data zgłoszenia. 29.04.1998 (86) Data i numer zgłoszenia międzynarodowego

Bardziej szczegółowo

PL 189448 B1 (12) OPIS PATENTOWY (19) PL (11) 189448 (13) B1. (51) IntCl7 A63F 9/08. (54) Łamigłówka. (73) Uprawniony z patentu:

PL 189448 B1 (12) OPIS PATENTOWY (19) PL (11) 189448 (13) B1. (51) IntCl7 A63F 9/08. (54) Łamigłówka. (73) Uprawniony z patentu: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 189448 (21) Numer zgłoszenia: 338426 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 14.07.1998 (86) Data i numer zgłoszenia

Bardziej szczegółowo

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO

Ćwiczenie numer 6. Analiza próbek spożywczych na obecność markerów GMO Ćwiczenie numer 6 Analiza próbek spożywczych na obecność markerów GMO 1. Informacje wstępne -screening GMO -metoda CTAB -qpcr 2. Izolacja DNA z soi metodą CTAB 3. Oznaczenie ilościowe i jakościowe DNA

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: 09.08.2001, PCT/DE01/02954 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: 09.08.2001, PCT/DE01/02954 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 199888 (21) Numer zgłoszenia: 360082 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 09.08.2001 (86) Data i numer zgłoszenia

Bardziej szczegółowo

PL 217293 B1. SAVEX SPÓŁKA AKCYJNA, Zgorzelec, PL

PL 217293 B1. SAVEX SPÓŁKA AKCYJNA, Zgorzelec, PL PL 217293 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217293 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 383052 (22) Data zgłoszenia: 31.07.2007 (51) Int.Cl.

Bardziej szczegółowo

PL 187505 B1 (12) OPIS PATENTOWY (19) PL (11) 187505 (13) B1. (21) Numer zgłoszenia: 324415. (51) IntCl7 A61F 5/34

PL 187505 B1 (12) OPIS PATENTOWY (19) PL (11) 187505 (13) B1. (21) Numer zgłoszenia: 324415. (51) IntCl7 A61F 5/34 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 187505 (21) Numer zgłoszenia: 324415 (22) Data zgłoszenia: 22.01.1998 (13) B1 (51) IntCl7 A61F 5/34 (54)Urządzenie

Bardziej szczegółowo

Sposób i urządzenie do odzysku materiałów krzemowych z ogniw fotowoltaicznych

Sposób i urządzenie do odzysku materiałów krzemowych z ogniw fotowoltaicznych Sposób i urządzenie do odzysku materiałów krzemowych z ogniw fotowoltaicznych 5 30 Przedmiotem wynalazku jest sposób i urządzenie do kontrolowanego i automatycznego odzysku materiałów krzemowych z ogniw

Bardziej szczegółowo

PL 207758 B1. KOBA HENRYK, Jelcz-Laskowice, PL KORNICKI MARIAN, Jelcz-Laskowice, PL 20.02.2006 BUP 04/06

PL 207758 B1. KOBA HENRYK, Jelcz-Laskowice, PL KORNICKI MARIAN, Jelcz-Laskowice, PL 20.02.2006 BUP 04/06 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 207758 (13) B1 (21) Numer zgłoszenia: 369589 (51) Int.Cl. E01C 23/01 (2006.01) E01C 23/07 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2300459. (96) Data i numer zgłoszenia patentu europejskiego: 22.06.2009 09772333.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2300459. (96) Data i numer zgłoszenia patentu europejskiego: 22.06.2009 09772333. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2049 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 22.06.09 09772333.2 (97)

Bardziej szczegółowo

ENERBIO SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ,

ENERBIO SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, PL 215280 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215280 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 388828 (22) Data zgłoszenia: 21.09.2009 (51) Int.Cl.

Bardziej szczegółowo

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215

StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 StayRNA bufor zabezpieczający RNA przed degradacją wersja 0215 100 ml, 250 ml, 500 ml Nr kat. 038-100, 038-250, 038-500 Nietosyczny roztwór wodny do przechowywania i zabezpieczania różnego rodzaju tkanek

Bardziej szczegółowo

PL 216311 B1. Sposób kształtowania plastycznego uzębień wewnętrznych kół zębatych metodą walcowania poprzecznego. POLITECHNIKA LUBELSKA, Lublin, PL

PL 216311 B1. Sposób kształtowania plastycznego uzębień wewnętrznych kół zębatych metodą walcowania poprzecznego. POLITECHNIKA LUBELSKA, Lublin, PL PL 216311 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 216311 (13) B1 (21) Numer zgłoszenia: 392273 (51) Int.Cl. B23P 15/14 (2006.01) B21D 53/28 (2006.01) Urząd Patentowy Rzeczypospolitej

Bardziej szczegółowo

AmpliTest TBEV (Real Time PCR)

AmpliTest TBEV (Real Time PCR) AmpliTest TBEV (Real Time PCR) Zestaw do wykrywania sekwencji RNA specyficznych dla TBEV (Tick-borne encephalitis virus) techniką Real Time PCR Nr kat.: RV03-50 Wielkość zestawu: 50 oznaczeń Objętość pojedynczej

Bardziej szczegółowo

WZORU UŻYTKOWEGO PL 64968 Y1 G09F 1/06 (2006.01) G09F 15/00 (2006.01) PAW-DRUK Sp. z o.o., Poznań, PL 31.08.2009 BUP 18/09. Andrzej Saegner, Kicin, PL

WZORU UŻYTKOWEGO PL 64968 Y1 G09F 1/06 (2006.01) G09F 15/00 (2006.01) PAW-DRUK Sp. z o.o., Poznań, PL 31.08.2009 BUP 18/09. Andrzej Saegner, Kicin, PL RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS OCHRONNY WZORU UŻYTKOWEGO (21) Numer zgłoszenia: 117313 (22) Data zgłoszenia: 29.02.2008 (19) PL (11) 64968 (13) Y1 (51) Int.Cl.

Bardziej szczegółowo

(13) B1 (12) OPIS PATENTOW Y (19)PL (11)182539 PL 182539 B1 B03C 1/025 B03C 1/18

(13) B1 (12) OPIS PATENTOW Y (19)PL (11)182539 PL 182539 B1 B03C 1/025 B03C 1/18 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOW Y (19)PL (11)182539 (21) Numer zgłoszenia: 319932 (22) Data zgłoszenia: 13.05.1997 (13) B1 (51) IntCl7 B03C 1/025 B03C

Bardziej szczegółowo

CHARAKTERYSTYKA PRODUKTU LECZNICZEGO. Gaviscon o smaku mięty Saszetki, (500 mg + 267 mg + 160 mg)/10 ml, zawiesina doustna

CHARAKTERYSTYKA PRODUKTU LECZNICZEGO. Gaviscon o smaku mięty Saszetki, (500 mg + 267 mg + 160 mg)/10 ml, zawiesina doustna CHARAKTERYSTYKA PRODUKTU LECZNICZEGO 1. NAZWA PRODUKTU LECZNICZEGO Gaviscon o smaku mięty Saszetki, (500 mg + 267 mg + 160 mg)/10 ml, zawiesina doustna 2. SKŁAD JAKOŚCIOWY I ILOŚCIOWY Gaviscon o smaku

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 173902

(12) OPIS PATENTOWY (19) PL (11) 173902 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 173902 (13) B1 Urząd Patentowy Rzeczypospolite] Polskiej (21) Numer zgłoszenia: 2 9 7 7 1 2 (22) Data zgłoszenia: 12.02.1993 (51) IntCl6: A41H3/00

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 176197 (51) B1

(12) OPIS PATENTOWY (19) PL (11) 176197 (51) B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 176197 (51) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 304274 (2)Data zgłoszenia: 13.07.1994 (51) IntCl6: A61K 31/135 C07C

Bardziej szczegółowo

Tabela potwierdzenia informacji rejestracyjnych przedsiębiorstwa produkcji importowanego mleka pasteryzowanego

Tabela potwierdzenia informacji rejestracyjnych przedsiębiorstwa produkcji importowanego mleka pasteryzowanego Tabela potwierdzenia informacji rejestracyjnych przedsiębiorstwa produkcji importowanego mleka pasteryzowanego 1. Podstawowe informacje na temat przedsiębiorstwa (wypełnia przedsiębiorstwo ubiegające się)

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: 13.12.1999,PCT/EP99/09864 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: 13.12.1999,PCT/EP99/09864 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 202483 (21) Numer zgłoszenia: 349335 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 13.12.1999 (86) Data i numer zgłoszenia

Bardziej szczegółowo

PL 217369 B1. INSTYTUT TECHNOLOGICZNO- PRZYRODNICZY, Falenty, PL 15.04.2013 BUP 08/13

PL 217369 B1. INSTYTUT TECHNOLOGICZNO- PRZYRODNICZY, Falenty, PL 15.04.2013 BUP 08/13 PL 217369 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217369 (13) B1 (21) Numer zgłoszenia: 396507 (51) Int.Cl. F23G 5/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 181615

(12) OPIS PATENTOWY (19) PL (11) 181615 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 181615 (21) Numer zgłoszenia: 319386 (22) Data zgłoszenia: 25.09.1995 (86) Data i numer zgłoszenia międzynarodowego:

Bardziej szczegółowo

2. Procenty i stężenia procentowe

2. Procenty i stężenia procentowe 2. PROCENTY I STĘŻENIA PROCENTOWE 11 2. Procenty i stężenia procentowe 2.1. Oblicz 15 % od liczb: a. 360, b. 2,8 10 5, c. 0.024, d. 1,8 10 6, e. 10 Odp. a. 54, b. 4,2 10 4, c. 3,6 10 3, d. 2,7 10 7, e.

Bardziej szczegółowo

PL 210006 B1. POLITECHNIKA WARSZAWSKA, Warszawa, PL

PL 210006 B1. POLITECHNIKA WARSZAWSKA, Warszawa, PL RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 210006 (21) Numer zgłoszenia: 380722 (22) Data zgłoszenia: 01.10.2006 (13) B1 (51) Int.Cl. A61G 5/02 (2006.01)

Bardziej szczegółowo

PL 218203 B1. R&D PROJECT SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Łódź, PL 17.12.2012 BUP 26/12

PL 218203 B1. R&D PROJECT SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Łódź, PL 17.12.2012 BUP 26/12 PL 218203 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 218203 (13) B1 (21) Numer zgłoszenia: 395134 (51) Int.Cl. B23B 3/16 (2006.01) B23B 3/18 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

PL 208814 B1. UNIWERSYTET IM. ADAMA MICKIEWICZA, Poznań, PL 17.03.2008 BUP 06/08

PL 208814 B1. UNIWERSYTET IM. ADAMA MICKIEWICZA, Poznań, PL 17.03.2008 BUP 06/08 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208814 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 380621 (22) Data zgłoszenia: 16.09.2006 (51) Int.Cl. C07F 15/00 (2006.01)

Bardziej szczegółowo

(57) 1. Układ ham ulcowy dla pojazdów szynowych z w y- (12) OPIS PATENTOWY (19) PL (11) 188123 (13) B1 PL 188123 B1 B61H 13/00 B60T 13/26 B 6 1 F 7/00

(57) 1. Układ ham ulcowy dla pojazdów szynowych z w y- (12) OPIS PATENTOWY (19) PL (11) 188123 (13) B1 PL 188123 B1 B61H 13/00 B60T 13/26 B 6 1 F 7/00 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 188123 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 325944 (22) Data zgłoszenia: 23.04.1998 (51) IntCl7 B61H 13/00 B60T

Bardziej szczegółowo

(12) OPIS PATENTOWY (19)PL (11)182858

(12) OPIS PATENTOWY (19)PL (11)182858 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19)PL (11)182858 (21) Numer zgłoszenia. 319132 Urząd Patentowy zgłoszenia. 2 0.0 3.1 9 9 7 Rzeczypospolitej Polskiej (51) IntCl7 B62K 5/02 (54) Rower trójkołowy

Bardziej szczegółowo