PL B1. Nowe pochodne epirubicyny, ich nowe zastosowanie medyczne oraz farmaceutycznie akceptowalna postać leku

Wielkość: px
Rozpocząć pokaz od strony:

Download "PL 212279 B1. Nowe pochodne epirubicyny, ich nowe zastosowanie medyczne oraz farmaceutycznie akceptowalna postać leku"


1 PL B1 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) (21) Numer zgłoszenia: (22) Data zgłoszenia: (13) B1 (51) Int.Cl. C07H 15/252 ( ) A61K 31/704 ( ) A61P 31/12 ( ) (54) Nowe pochodne epirubicyny, ich nowe zastosowanie medyczne oraz farmaceutycznie akceptowalna postać leku (43) Zgłoszenie ogłoszono: BUP 08/08 (45) O udzieleniu patentu ogłoszono: WUP 09/12 (73) Uprawniony z patentu: INSTYTUT BIOCHEMII I BIOFIZYKI POLSKA AKADEMIA NAUK, Warszawa, PL Institut National de la Sante et de la Recherche Medicale, INSERM, Paris, FR INSTYTUT MEDYCYNY DOŚWIADCZALNEJ I KLINICZNEJ IM. M. MOSSAKOWSKIEGO POLSKIEJ AKADEMII NAUK, Warszawa, PL (72) Twórca(y) wynalazku: TADEUSZ KULIKOWSKI, Warszawa, PL MARIA BRETNER, Wołomin, PL ANDŻELIKA NAJDA, Lubartów, PL LUCYNA COVA, Lyon, FR CHRISTIAN TREPO, Bron, FR RAMAMURTHY NARAYAN, Headington, GB ANDRZEJ PIASEK, Warszawa, PL ANDRZEJ LIPNIACKI, Warszawa, PL WŁODZIMIERZ ZAGÓRSKI-OSTOJA, Warszawa, PL (74) Pełnomocnik: rzecz. pat. Iwona Brodowska

2 2 PL B1 Opis wynalazku Przedmiotem wynalazku są nowe pochodne 7-O-(3 -amino-2,3,6 -trideoksy-α,β-l-arabinohekso-piranozylo)-adriamycynonu (epirubicyna, 4 -epidoksorubicyna) o wzorze 1, w którym co najwyżej dwa z czterech podstawników R 1, R 2, R 3 i R 4 są takie same lub różne i oznaczają atom wodoru, a co najmniej dwa z tych czterech podstawników oznaczają grupę alkilową, grupę alkenową lub alkinową, o 1 do 5 atomach węgla, grupę alkilokarbonylową o łańcuchu alkilowym od 1 do 3 atomów węgla, zwłaszcza acetylową przy czym jeśli R 1 i R 4 oznaczają jednocześnie atom wodoru, to R 2 i R 3 razem z atomem azotu, do którego są przyłączone, oznaczają grupę, dimetyloformamidylową. Przedmiotem wynalazku jest także nowe zastosowanie medyczne tych pochodnych do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV) oraz farmaceutycznie akceptowalna forma leku. Wirus zapalenia wątroby typu C (HCV) posiada szczególne znaczenie: jest to wysoce patogenny wirus należący do rodziny Flaviviridae (genus hepaciwirus), bardzo szeroko rozpowszechnionej w świecie (według danych WHO, c.a. 300 milionów zakażonych ludzi). Chroniczne aktywne zapalenie wątroby występuje/rozwija się u ok. 85% silnie zakażonych nosicieli i prowadzi do marskości wątroby, oraz do nowotworu wątrobiaka (hepatocellular carcinoma) (Hagedorn i Rice, red. The Hepatitis C Viruses, Springer, Heidelberg 2000). Nieoczekiwanie zgłaszający stwierdził, że chlorowodorek epirubicyny znany lek przeciwnowotworowy, jest nadzwyczaj silnym środkiem działającym przeciwko wirusowi zapalenia wątroby typu C (HCV). Chlorowodorek epirubicyny jest toksyczny w stosunku do hemopoetycznych komórek ssaków i komórek tkanki sercowej, jednak powoduje mniejszą hematologiczną i sercową toksyczność niż odpowiednie dawki innego szeroko stosowanego leku przeciwnowotworowego - doksorubicyny (adriamycyny). W dodatku prawdopodobieństwo wystąpienia zatoru serca u człowieka przy całkowitej skumulowanej dawce nie przekraczającej 150 mg na m 2 powierzchni ciała człowieka wg wykresu Kaplana-Meiera (Launchbury and Habooubit, Cancer Treatment Reviews 1993, 19, ) jest znikome. W dniu 7 lipca 2005 zgłaszający złożył wniosek patentowy do polskiego i europejskiego Urzędu Patentowego (odpowiednio PL i EP ). Obecnie, nieoczekiwanie stwierdzono, że pochodne epirubicyny o wzorze 1, jak to poniżej opisano, wykazują silną aktywność hamującą replikację wirusa zapalenia wątroby typu C (HCV) przy znacznie niższej niż epirubicyna cytotoksyczności w stosunku do komórek Huh7 oraz PBMC, lepszym in vitro indeksie terapeutycznym (TI) (Tabela 1) oraz niższej in vivo toksyczności u myszy. W związku z powyższym nowe pochodne epirubicyny mogą być korzystnie stosowane do leczenia zakażeń wirusem HCV. Niniejszy wynalazek dotyczy również farmaceutycznie akceptowalnych form leku zawierających wymienione pochodne o wzorze 1. Nowe pochodne 7-O-(3 -amino-2,3,6 -trideoksy-α,β-l-arabinoheksopiranozylo)-adriamycynonu (epirubicyny) przedstawione są wzorem 1, w którym co najwyżej dwa z czterech podstawników R 1, R 2, R 3 i R 4 są takie same lub różne i oznaczają atom wodoru, a co najmniej dwa z tych czterech podstawników oznaczają grupę alkilową, grupę alkenową lub alkinową, o 1 do 5 atomach węgla, grupę alkilokarbonylową o łańcuchu alkilowym od 1 do 3 atomów węgla, zwłaszcza grupę acetylową, przy czym jeśli R 1 i R 4 oznaczają jednocześnie atom wodoru, to R 2 i R 3 razem z atomem azotu, do którego są przyłaczone, oznaczają grupę dimetyloformamidylową. Zastosowanie medyczne nowych pochodnych epirubicyny, przedstawionych wzorem 1, do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV). Zastosowanie medyczne nowych pochodnych epirubicyny według wynalazku do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV) i zapewniających niską toksyczność w stosunku do komórek Huh7 i PBMC, oraz indeks terapeutyczny (TI) wyższy niż samej epirubicyny oraz mniejszą niż dla epirubicyny toksyczność in vivo. Inaczej, nowe pochodne epirubicyny mogą być stosowane do leczenia zakażeń wirusem HCV. Farmaceutycznie akceptowalna postać leku przeciwko zakażeniom HCV, zawierająca znane nośniki i dodatki, według wynalazku, charakteryzuje się tym, że jako substancję aktywną zawiera pochodne epirubicyny przedstawione wzorem 1, w którym R 1, R 2, R 3 i R 4 mają wyżej podane znaczenie. W przedstawionych poniżej badaniach wykazano po raz pierwszy, że nowe pochodne epirubicyny przedstawione wzorem 1 wywierają silny efekt hamujący replikację HCV przy nanomolowych stężeniach i mogą być stosowane jako efektywne leki przeciwko zakażeniom HCV.

3 PL B1 3 Poniżej przedstawiono przykłady wykonania wynalazku nie ograniczające w żadnym stopniu zakresu wynalazku. P r z y k ł a d I N 3 -acetylo-4 -epidoksyrubicyna (1, BNE01) Chlorowodorek 4 -epidoksyrubicyny (58 mg, 0.1 mmola) rozpuszczono w acetonie (6.8 ml) i dodano 18 μl, diizopropyloetyloaminy. Roztwór oziębiono do 0 C na łaźni lodowej i dodano przy stałym mieszaniu 10 μl (0.11 mmola) bezwodnika octowego. Mieszaninę reakcyjną pozostawiono do ogrzania się do temperatury pokojowej i mieszano jeszcze przez 2 godz. Roztwór zatężono pod próżnią do sucha, pozostałość rozpuszczono w ca 13 ml CHCI 3 a roztwór przemyto trzy razy 0.1 M buforem fosforanowym ph 7.0 i dwa razy wodą. Warstwę organiczną suszono nad bezwodnym siarczanem sodu i odparowano pod próżnią do sucha. Pozostałość chromatografowano na kolumnie z żelem krzemowym (CHCI 3 do CHCl 3 :MeOH 1:1). Otrzymano związek o wzorze 1, (R 1 : H, R 2 : CH 3 CO,R 3 : H, R 4 : H) Temp. topn. 180 C. MS (ES+) ; NMR (CDCl 3 ) δ 1.36 (d, 3, 5 -CH 3 ), 2.01 (s, 3, 3 -N-COCH 3 ), 2.06 (m, 2, 2 -H 2 ), 2.19 (d, 1, 8A-H), 2.41 (d, 1, 8B-H), (m, 3, 3 -H i 4 -H/4 -OH), 3.28 (d, 1, 10A-H), 3.32 (d, 1, 10B-H), (m, 1, 5 -H), 4.09 (s, 3, 4-OCH 3 ), 4.80 (dd, 3, 14-H 2 / 14-OH), 5.30 (br s, 1, 9-OH), 5.43 (d, 1, 1 -H), 5.51 (d, 1, 7-H), 7.41 (d, 1, 3-H), 7.80 (t, 1, 2-H), 8.05 (d, 1, 1-H), (s, 1, 11-OH), (s, 1, 6-OH). P r z y k ł a d II N 3', O 4, O 14 -triacetylo-4 -epidoksyrubicyna (2, BNE02) Chlorowodorek 4 -epidoksyrubicyny (100 mg, 0.17 mmola) rozpuszczono w 10 ml suchego chloroformu i dodano 20 mg dimetyloaminopirydyny. Roztwór oziębiono do 0 C na łaźni lodowej i dodano, stale mieszając 400 μl (4.24 mmola) bezwodnika octowego. Mieszaninę pozostawiono do ogrzania się do temperatury pokojowej i dalej mieszano. Postęp reakcji badano przy użyciu TLC (CHCl 3 : MeOH 9:1). Otrzymany roztwór przemyto 3 razy 0.1 M buforem fosforanowym o ph 7.0 oraz 2 razy wodą. Warstwę organiczną wysuszono nad bezwodnym siarczanem sodu i odparowano pod próżnią. Pozostałość chromatografowano na kolumnie z żelem krzemionkowym (CHCl 3 do CHCl 3 :MeOH 1:1). Otrzymano związek o wzorze 1, (R 1 : CH 3 CO, R 2 : CH 3 CO, R 3 : H, R 4 : CH 3 CO) Temp. topn. 178 C. MS (ES+) NMR (DMSO-d 6 ) δ 1.09 (d, 3, 5 -CH 3 ), 1.69 (s, 3, 14-O-COCH 3 ), 1.97 (s, 3, 4 -O-COCH 3 ), (m, 5, 3 -N-COCH 3, 8H 2 ), 2.94/3.08(d/d, 1/1, 2 -H 2 ), 4.05 (s, 3, 4-OCH 3 ), (m, 1, 5 -H), 4.43 (t, 1, 1 -H), (m, 1, 7-H), 5.22 (d, 2, 14-H 2 ), 5.79 (s, 1, 9-OH), 7.66 (t, 1, 2-H), 7.72 (d, 1, 3-H), 7.92 (d, 1, 1-H), (s, 1, 11-OH), (s, 1, 6-OH). P r z y k ł a d III 3 -N,N-dimetylo-4 -epidoksyrubicyna (3, BNE06) Do roztworu chlorowodorku 4 -epidoksyrubicyny (100 mg, 0.17 mmola) w 630 μl H 2 O dodano mieszając 1.3 ml acetonitrylu i mieszaninę ogrzano do 30 C. Dodano 130 μl (1.31 mmola) 37% wodnego roztworu formaldehydu i roztwór mieszano przez 20 minut w Następnie dodano kroplami w ciągu 15 minut 23 mg (0.37 mmola) NaCNBH 3 w 1.3 ml acetonitrylu i mieszano w 24 C przez 20 minut. Mieszaninę reakcyjną rozcieńczono wodą (4 ml) i ekstrahowano 2 razy 4 ml chloroformu. Ekstrakty chloroformowe połączono, suszono nad bezwodnym siarczanem sodu i odparowano pod próżnią. Pozostałość chromatografowano na preparatywnych płytkach z żelem (Merck No ) PLC plates stosując CHCl 3 :MeOH:H 2 O 40:10:1. Otrzymano związek o wzorze 1, (R 1 : H, R 2 : CH 3, R 3 : CH 3, R 4 : H) Temp. topn. 220 C. MS (ES+) , (ES-) NMR (DMSO-d 6 ) δ 1.20 (d, 3, 5 - CH 3 ), 1.56 (dt, 1, 2 -H), 1,72 (dd, 1, 2 -H), 2.17 (br s, 8, 3 -N(CH 3 ) 3, 8-H 2 ) (m, 4, 10-H, 4 -OH, 4 -H, 3 -H), (m, 1, 5 -H), 3.99 (s, 3, 4-OCH 3 ), 4.55 (br s, 2, 14-H 2 ), 4.85 (br s, 1, 14-OH), 4.97 (t, 1, 1 -H), 5.32 (d, 1, 7-H), 5.45 (s, 1, 9-OH), 7.62 (d, 1, 3-H), 7.89 (t, 1, 2-H), 7.94 (d, 1, 1-H), (br s, 1, 11-OH), (br s, 1, 6-OH). P r z y k ł a d IV 3 -N-(N,N -dimetyloformamidynylo)-4 -epidoksyrubicyna (4, BNE06) Do roztworu chlorowodorku 4 -epidoksyrubicyny (150 mg, 0.26 mmola) w 7.5 ml suchego metanolu dodano kroplami, w atmosferze argonu N,N-dimetyloformamidodimetyloacetal (182 μl, 1.30 mmola). Mieszaninę reakcyjną mieszano przez 4 godz., a następnie rozpuszczalnik odparowano pod próżnią. Pozostałość chromatografowano na kolumnie z żelem krzemionkowym (CHCl 3 do CHCl 3 :MeOH 9:1). Otrzymano związek o wzorze 1, (R 1 : H, R 2 : =CH-N(CH 3 ) 2, R 4 : H) Temp. topn. 206 C. MS (ES+) , (ES-) ; NMR (DMSO-d 6 ) δ 1.24 (d, 3, 5 -CH 3 ), 1.99 (d, 2, 8H 2 ), 2.19 (m, 2, 2 -H 2 ), (m i m, 11, 10-H 2, 4 -OH, 4 -H, 3 -H, N -Me 2 ), 3.93 (m, 1, 5-H), 4.00 (s, 3, 4-

4 4 PL B1 OCH 3 ), 4.57 (d, 2, 14-H 2 ), 4.87 (t, 1, 14-OH), 4.99 (t, 1, 1-H), 5.29 (t, 1, 7-H), 5.48 (s, 1, 9-OH), 7.68 (t, 1, 2-H), 7.94 (d, 2, 1-H i 3-H), 8.08 (s, 1, 3 -NC -H), (s, 1, 11-OH), (s, 1, 6-OH). Badanie aktywności przeciwwirusowej i cytotoksyczności Potencjalną aktywność przeciwwirusową (anty-hcv) pochodnych epirubicyny przedstawionych wzorem 1 zbadano in vitro w hodowli komórkowej przy użyciu układu zawierającego subgenomowy replikon HCV stabilnie transfekowany do komórek Huh7 (klon BM 4.5) (Ju-Tao Gao et al., J Virol. 2001). Komórki Huh7 zawierające replikon HCV hodowano w medium hodowlanym przy różnych stężeniach pochodnej epirubicyny. Media i lek zmieniano każdego dnia przez 5 dni. Po 5-ciu dniach traktowania lekiem komórki zostały poddane lizie i całkowitej ekstrakcji RNA. Następnie wyizolowany RNA zbadano na obecność replikacji HCV drogą analizy Northern Blot, stosując próbkę HCV noszącą region NS5B HCV. Ponadto, hybrydyzacja znakowaną próbką β-aktyny pozwoliła na znormalizowanie tych wyników, tj. na przypisanie wpływu leku na wewnątrzkomórkową ekspresję genu (housekeeping). Linie komórkowe traktowano codziennie odpowiednią pochodną epirubicyny w zakresie stężeń nm przez 5 dni i pod koniec traktowania izolowano RNA z traktowanych komórek. Całkowity RNA zbadano przy użyciu próbki specyficznego HCV, stosując do oznaczenia HCV RNA analizę Northern blot. Uzyskany chromatogram poddano następnie densytometrii stosując Phosfor Imager i oznaczono ilościowo wirusową replikację. Wyniki analizy prowadzonej w zależności od czasu traktowania wykazały, że pochodne epirubicyny w stężeniach μμ efektywnie inhibują in vitro replikację HCV w układzie subgenomowego replikonu (Tabela 1). W Tabeli 1 wykazano również, że 50% stężenia (IC 50 ) pochodnych epirubicyny z uwzględnieniem aktywności przeciwko HCV mierzonej w układzie replikonu HCV są niskie i leżą w zakresie μμ, podczas gdy ich stężenia powodujące 50% inhibicję (CC 50 ) komórek Huh7 wynoszą μμ, korzystnie w przypadku N 3,O 4, O 14 -triacetyloepirubicyny (BNE02), gdzie indeks terapeutyczny wynosił 10. Inhibicję replikacji HCV przez epirubicynę (BNE00), N3 -acetyloepirubicynę (BNE01) oraz N 3,O 4,O 14 -triacetyloepirubicynę (BNE02) (fig. 1, Tabela 2) oznaczano jak następuje. Limfocyty hodowano w medium wzbogaconym znanymi stężeniami BNE00, BNE01 i BNE02. Piątego i czternastego dnia hodowli komórki zebrano i po ekstrakcji oznaczono jakościowo HCV RNA stosując pomiar rzeczywistego czasu reakcji polimeryzacji łańcuchowej (Real Time Polymerase Chain Reaction, RT PCR). Ilościowe oznaczanie HCV RNA również przeprowadzono przy użyciu RT PCR (fig. 2). RNA wyizolowano przy użyciu Total RNA extraction kit (A&A Biotechnology, Gdynia, Poland, Amplifikację HCV RNA przeprowadzono jak następuje: RT-PCR przeprowadzono w jednym etapie przez 60 minut w 42 C i przez 15 min w 75 C. Do pierwszego PCR, które obejmowało 30 cyklów amplifikacji (10 s w 65 C i 20 s w 72 C) użyto 3 μl cdna. 2 μl produktu z pierwszego procesu użyto do drugiej amplifikacji (35 cyklów, każdy cykl 10 s w 94 C, 10 s w 65 C i 20 s w 72 C a następnie przedłużono o 7 min w 72 C. W pierwszym procesie użyto 10 pmoli primerów NTR 1 LOW (GGTGCACGGTCTACGAGACCT) oraz NTR 1 UP (CGACACTCCACCATAGAT) a do drugiego procesu użyto NTR 2 LOW (CACTCGCAAGCACCCTAT CAGGCAGT) oraz NTR 2 UP (CCACCATA- GATCACTCCCCTGT). Produkty uzyskane z PCR analizowano przy pomocy elektroforezy stosując 1% Nusieve agarose gel (FMC) wybarwiając bromkiem etydyny. Cytotoksyczność (CC 50 ) pochodnych epirubicyny w komórkach PBMC była bardzo mała i wynosiła μμ (fig. 3). Oznaczenie toksyczności ostrej u myszy (LD 50 ) wykonano wg. Wskazówek OECD dla testowania chemikaliów (wskazówka No 401). (OECD Guidelines for Testing of Chemicals, Guideline No 401). Związek 2 (BNE02) korzystnie wykazuje bardzo niską toksyczność ostrą in vivo (LD 50 = 1300 mg/kg wagi ciała myszy), podczas gdy wartość ta dla chlorowodorku epirubicyny (BNE00) wynosi 37 mg/kg. W niniejszych badaniach wykazano po raz pierwszy, że pochodne epirubicyny wywierają efekt hamujący replikację HCV przy nanomolowych stężeniach i mogą być stosowane jako efektywne leki przeciwko zakażeniom HCV przy znikomej toksyczności in vitro i in vivo.

5 PL B1 5 T a b e l a 1 Aktywność anty-hcv w układzie replikonu HCV 1 oraz cytotoksyczność epirubicyny i jej pochodnych wobec komórek Huh-7 i PBMC. Związek Chlorowodorek epirubicyny (BNE00) 1. N 3 -acetyloepirubicyna (BNE01) 2. N 3,O 4,O 14 -triacetyloepirubi cyna (BNE02) N,N-Dimetylo-4 -epidoxorubicyna (BNE06) N-(N,N -Dimetyloformamidinylo)-4-epidoxorubicyna (BNE04) Cytotoksyczność wobec komórek PBMC CC 50 (μμ) Cytotoksyczność wobec komórek Huh7 CC 50 (μμ) 2 Aktywność anty-hcv IC 50 (μμ) 3 Indeks terapeutyczny CC 50 / IC >0.9 > >0.05 >0.05 >1 1 subgenomowy replikon HCV stabilnie transfekowany do komórek Huh7 (klon BM4.5) (Ju-Tao Gao et al., J. Virol. 2001, ) 2 cytotoksyczność (CC 50 ) - 50% stężenie cytotoksyczne 3 aktywność przeciwwirusowa (IC 50 ) - stężenie wymagane do zahamowania replikacji wirusa w 50% W tabeli nr 2 zamieszczono dane dotyczące cytotoksyczności (CC 50 i CC 90 ), aktywności anty-hcv (IC 50 i IC 90 ) oraz indeksu terapeutycznego (TI 50 i TI 90 ) epirubicyny i jej pochodnych w hodowli limfocytowej. T a b e l a 2 Związek CC 50 CC 90 IC 50 IC 90 Tl 50 Tl 90 BNE BNE BNE > > Zastrzeżenia patentowe 1. Nowe pochodne epirubicyny czyli 7-O-(3 -amino-2,3,6 -trideoksy-α,β-l-arabinohekso-piranozylo)-adriamycynonu przedstawione wzorem 1, w którym co najwyżej dwa z czterech podstawników R 1, R 2, R 3 i R 4 są takie same lub różne i oznaczają atom wodoru, a co najmniej dwa z tych czterech podstawników oznaczają grupę alkilową, grupę alkenową lub alkinową, o 1 do 5 atomach węgla, grupę alkilokarbonylową o łańcuchu alkilowym od 1 do 3 atomów węgla, zwłaszcza grupę acetylową, przy czym jeśli R 1 i R 4 oznaczają jednocześnie atom wodoru, to R 2 i R 3 razem z atomem azotu, do którego są przyłączone, oznaczają grupę dimetyloformamidylową. 2. Zastosowanie medyczne nowych pochodnych epirubicyny, określonych w zastrzeżeniu 1, do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV). 3. Zastosowanie pochodnych, według zastrz. 2, do wytwarzania leków aktywnie hamujących replikację wirusa zapalenia wątroby typu C (HCV), zapewniających niską toksyczność w stosunku do komórek Huh7 i PBMC, wyższy indeks terapeutyczny (TI) niż sama epirubicyna oraz mniejszą niż epirubicyna toksyczność in vivo. 4. Farmaceutycznie akceptowalna forma leku przeciwko zakażeniom HCV, zawierająca znane nośniki i dodatki, znamienna tym, że jako substancję aktywną zawiera pochodne epirubicyny przedstawione wzorem 1, w którym co najwyżej dwa z czterech podstawników R 1, R 2, R 3 i R 4 są takie same lub różne i oznaczają atom wodoru, a co najmniej dwa z tych czterech podstawników oznaczają grupę alkilową, grupę alkenową lub alkinową, o 1 do 5 atomach węgla, grupę alkilokarbonylową o łańcuchu alkilowym od 1 do 3 atomów węgla, zwłaszcza acetylową, przy czym jeśli R 1 i R 4 oznaczają jednocześnie atom wodoru, to R 2 i R 3 razem z atomem azotu, do którego są przyłączone, oznaczają grupę dimetyloformamidylową.

6 6 PL B1 Rysunki

7 PL B1 7

8 8 PL B1 Departament Wydawnictw UP RP Cena 2,46 zł (w tym 23% VAT)

PL 198188 B1. Instytut Chemii Przemysłowej Mościckiego,Warszawa,PL 03.04.2006 BUP 07/06

PL 198188 B1. Instytut Chemii Przemysłowej Mościckiego,Warszawa,PL 03.04.2006 BUP 07/06 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 198188 (13) B1 (21) Numer zgłoszenia: 370289 (51) Int.Cl. C01B 33/00 (2006.01) C01B 33/18 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: , PCT/DE03/ (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: , PCT/DE03/ (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 207732 (21) Numer zgłoszenia: 378818 (22) Data zgłoszenia: 18.12.2003 (86) Data i numer zgłoszenia międzynarodowego:

Bardziej szczegółowo


PL B1. PRZEDSIĘBIORSTWO PRODUKCJI FARMACEUTYCZNEJ HASCO-LEK SPÓŁKA AKCYJNA, Wrocław, PL BUP 09/13 PL 222738 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 222738 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 396706 (22) Data zgłoszenia: 19.10.2011 (51) Int.Cl.

Bardziej szczegółowo

PL B1. Preparat o właściwościach przeciwutleniających oraz sposób otrzymywania tego preparatu. POLITECHNIKA ŁÓDZKA, Łódź, PL

PL B1. Preparat o właściwościach przeciwutleniających oraz sposób otrzymywania tego preparatu. POLITECHNIKA ŁÓDZKA, Łódź, PL PL 217050 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217050 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 388203 (22) Data zgłoszenia: 08.06.2009 (51) Int.Cl.

Bardziej szczegółowo

PL B1. POLITECHNIKA ŁÓDZKA, Łódź, PL BUP 17/11. RADOSŁAW ROSIK, Łódź, PL WUP 08/12. rzecz. pat. Ewa Kaczur-Kaczyńska

PL B1. POLITECHNIKA ŁÓDZKA, Łódź, PL BUP 17/11. RADOSŁAW ROSIK, Łódź, PL WUP 08/12. rzecz. pat. Ewa Kaczur-Kaczyńska PL 212206 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 212206 (13) B1 (21) Numer zgłoszenia: 390424 (51) Int.Cl. C07C 31/20 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo


PL 218025 B1. POLITECHNIKA POZNAŃSKA, Poznań, PL 19.12.2011 BUP 26/11. JULIUSZ PERNAK, Poznań, PL BEATA CZARNECKA, Poznań, PL ANNA PERNAK, Poznań, PL PL 218025 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 218025 (13) B1 (21) Numer zgłoszenia: 391493 (51) Int.Cl. A61K 6/027 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo


(12) OPIS PATENTOWY (19) PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 178449 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 306282 (22) Data zgłoszenia: 13.12.1994 (51) IntCl6 C07F 9/06 (54)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1773451 (96) Data i numer zgłoszenia patentu europejskiego: 08.06.2005 05761294.7 (13) (51) T3 Int.Cl. A61K 31/4745 (2006.01)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 187318 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 06.04.06 06731279.3

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) (13) B1

(12) OPIS PATENTOWY (19) PL (11) (13) B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 162013 (13) B1 (21) Numer zgłoszenia: 28 3 8 2 5 (51) IntCl5: C 07D 499/76 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 16.02.1990

Bardziej szczegółowo

PL B1 (12) O P I S P A T E N T O W Y (19) P L (11) (13) B 1 A61K 9/20. (22) Data zgłoszenia:

PL B1 (12) O P I S P A T E N T O W Y (19) P L (11) (13) B 1 A61K 9/20. (22) Data zgłoszenia: R Z E C Z PO SPO L IT A PO LSK A (12) O P I S P A T E N T O W Y (19) P L (11) 1 7 7 6 0 7 (21) Numer zgłoszenia: 316196 (13) B 1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 13.03.1995

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 26.05.2004 04739355.8

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: 26.05.2004 04739355.8 RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 163174 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 26.0.04 047393.8 (97)

Bardziej szczegółowo

... ...J CD CD. N "f"'" Sposób i filtr do usuwania amoniaku z powietrza. POLITECHNIKA LUBELSKA, Lublin, PL 09.11.2009 BUP 23/09

... ...J CD CD. N f' Sposób i filtr do usuwania amoniaku z powietrza. POLITECHNIKA LUBELSKA, Lublin, PL 09.11.2009 BUP 23/09 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19)PL (11)212766 (13) 81 (21) Numer zgłoszenia 385072 (51) Int.CI 801D 53/04 (2006.01) C01C 1/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11)

(12) OPIS PATENTOWY (19) PL (11) RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 190161 (21) Numer zgłoszenia: 329994 (22) Data zgłoszenia: 30.11.1998 (13) B1 (51 ) IntCl7 C01B 15/023 (54)

Bardziej szczegółowo

PL B1. Trzeciorzędowe słodkie sole imidazoliowe oraz sposób wytwarzania trzeciorzędowych słodkich soli imidazoliowych

PL B1. Trzeciorzędowe słodkie sole imidazoliowe oraz sposób wytwarzania trzeciorzędowych słodkich soli imidazoliowych PL 214086 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214086 (13) B1 (21) Numer zgłoszenia: 396008 (51) Int.Cl. C07D 233/60 (2006.01) C07C 31/135 (2006.01) Urząd Patentowy Rzeczypospolitej

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 28647 (96) Data i numer zgłoszenia patentu europejskiego: 30.03.09 091662.2 (13) (1) T3 Int.Cl. C07D 333/28 (06.01) Urząd

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2131847. (96) Data i numer zgłoszenia patentu europejskiego: 27.02.2008 08716068.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2131847. (96) Data i numer zgłoszenia patentu europejskiego: 27.02.2008 08716068. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2131847 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 27.02.2008 08716068.5

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: , PCT/IL02/ (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: , PCT/IL02/ (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 208263 (21) Numer zgłoszenia: 361734 (22) Data zgłoszenia: 21.01.2002 (86) Data i numer zgłoszenia międzynarodowego:

Bardziej szczegółowo

PL B1. Instytut Przemysłu Organicznego, Warszawa,PL BUP 13/03

PL B1. Instytut Przemysłu Organicznego, Warszawa,PL BUP 13/03 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 204151 (13) B1 (21) Numer zgłoszenia: 351372 (51) Int.Cl. A61K 31/4196 (2006.01) A61P 31/10 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF

Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Agnieszka Gładysz Ocena ekspresji genów proangiogennych w komórkach nowotworowych OVP-10 oraz transfektantach OVP-10/SHH i OVP-10/VEGF Katedra i Zakład Biochemii i Chemii Klinicznej Akademia Medyczna Prof.

Bardziej szczegółowo

PL 203790 B1. Uniwersytet Śląski w Katowicach,Katowice,PL 03.10.2005 BUP 20/05. Andrzej Posmyk,Katowice,PL 30.11.2009 WUP 11/09 RZECZPOSPOLITA POLSKA

PL 203790 B1. Uniwersytet Śląski w Katowicach,Katowice,PL 03.10.2005 BUP 20/05. Andrzej Posmyk,Katowice,PL 30.11.2009 WUP 11/09 RZECZPOSPOLITA POLSKA RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 203790 (13) B1 (21) Numer zgłoszenia: 366689 (51) Int.Cl. C25D 5/18 (2006.01) C25D 11/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

PL 204536 B1. Szczepanik Marian,Kraków,PL Selmaj Krzysztof,Łódź,PL 29.12.2003 BUP 26/03 29.01.2010 WUP 01/10

PL 204536 B1. Szczepanik Marian,Kraków,PL Selmaj Krzysztof,Łódź,PL 29.12.2003 BUP 26/03 29.01.2010 WUP 01/10 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 204536 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 354698 (22) Data zgłoszenia: 24.06.2002 (51) Int.Cl. A61K 38/38 (2006.01)

Bardziej szczegółowo

PL 215770 B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL 23.05.2011 BUP 11/11

PL 215770 B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL 23.05.2011 BUP 11/11 PL 215770 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215770 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 389528 (22) Data zgłoszenia: 10.11.2009 (51) Int.Cl.

Bardziej szczegółowo

PL 215396 B1. Urządzenie do wymuszonego chłodzenia łożysk, zwłaszcza poziomej pompy do hydrotransportu ciężkiego

PL 215396 B1. Urządzenie do wymuszonego chłodzenia łożysk, zwłaszcza poziomej pompy do hydrotransportu ciężkiego PL 215396 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215396 (13) B1 (21) Numer zgłoszenia: 389424 (51) Int.Cl. F16C 37/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo


PL B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA, Kraków, PL BUP 03/06 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 205845 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 369320 (22) Data zgłoszenia: 28.07.2004 (51) Int.Cl. C25B 1/00 (2006.01)

Bardziej szczegółowo

PL B1 (12) OPIS PATENTOWY (19) PL (11) (13) B1

PL B1 (12) OPIS PATENTOWY (19) PL (11) (13) B1 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 188279 ( 2 1) Numer zgłoszenia: 320904 (22) Data zgłoszenia: 30.06.1997 (13) B1 (51) IntCl7: C07D 219/08

Bardziej szczegółowo


PL B1. UNIWERSYTET GDAŃSKI, Gdańsk, PL BUP 05/09 PL 211948 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 211948 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 383162 (22) Data zgłoszenia: 17.08.2007 (51) Int.Cl.

Bardziej szczegółowo

Ocena. wykonanej pod kierunkiem prof. dr hab. med. Małgorzaty Polz-Docewicz

Ocena. wykonanej pod kierunkiem prof. dr hab. med. Małgorzaty Polz-Docewicz UNIWERSYTET MEDYCZNY IM. KAROLA MARCINKOWSKIEGO W POZNANIU KATEDRA I ZAKŁAD MIKROBIOLOGII LEKARSKIEJ Kierownik: prof. dr hab. Andrzej Szkaradkiewicz ul. Wieniawskiego 3 tel. 61 8546 138 61-712 Poznań fax

Bardziej szczegółowo

(13) B1 (12) OPIS PATENTOWY (19) PL (11) 172690 PL 172690 B1 C07F 9/572 C 07F 9/38. (43) Zgłoszenie ogłoszono:

(13) B1 (12) OPIS PATENTOWY (19) PL (11) 172690 PL 172690 B1 C07F 9/572 C 07F 9/38. (43) Zgłoszenie ogłoszono: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 172690 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21 ) Numer zgłoszenia. 299116 (22) Data zgłoszenia 28.05.1993 (51) IntCl 6: C07F 9/572 C

Bardziej szczegółowo

Metody badania ekspresji genów

Metody badania ekspresji genów Metody badania ekspresji genów dr Katarzyna Knapczyk-Stwora Warunki wstępne: Proszę zapoznać się z tematem Metody badania ekspresji genów zamieszczonym w skrypcie pod reakcją A. Lityńskiej i M. Lewandowskiego

Bardziej szczegółowo

PL B1. W.C. Heraeus GmbH,Hanau,DE ,DE, Martin Weigert,Hanau,DE Josef Heindel,Hainburg,DE Uwe Konietzka,Gieselbach,DE

PL B1. W.C. Heraeus GmbH,Hanau,DE ,DE, Martin Weigert,Hanau,DE Josef Heindel,Hainburg,DE Uwe Konietzka,Gieselbach,DE RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 204234 (13) B1 (21) Numer zgłoszenia: 363401 (51) Int.Cl. C23C 14/34 (2006.01) B22D 23/06 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

Nowe estry nukleozydów adenozynowych i kwasu karboksylowego, sposób ich otrzymywania oraz zawierająca je kompozycja farmaceutyczna.

Nowe estry nukleozydów adenozynowych i kwasu karboksylowego, sposób ich otrzymywania oraz zawierająca je kompozycja farmaceutyczna. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 201571 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 368093 (22) Data zgłoszenia: 19.05.2004 (51) Int.Cl. C07H 19/173 (2006.01)

Bardziej szczegółowo

(54) Sposób wydzielania zanieczyszczeń organicznych z wody

(54) Sposób wydzielania zanieczyszczeń organicznych z wody RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 175992 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 305151 (22) Data zgłoszenia: 23.09.1994 (51) IntCl6: C02F 1/26 (54)

Bardziej szczegółowo

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA

Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Materiały do ćwiczeń z przedmiotu: BIOLOGIA MOLEKULARNA Zakład Biologii Molekularnej Wydział Farmaceutyczny, WUM ul. Banacha 1, 02-097 Warszawa IZOLACJA DNA Z HODOWLI KOMÓRKOWEJ.

Bardziej szczegółowo

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii

PL 208956 B1. Sposób wykrywania i różnicowania chorób należących do grupy hemoglobinopatii, zwłaszcza talasemii RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208956 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 381219 (22) Data zgłoszenia: 05.12.2006 (51) Int.Cl. C12Q 1/68 (2006.01)

Bardziej szczegółowo

PL B1. Sposób wytwarzania produktu mlecznego, zawierającego żelatynę, mleko odtłuszczone i śmietanę

PL B1. Sposób wytwarzania produktu mlecznego, zawierającego żelatynę, mleko odtłuszczone i śmietanę PL 212118 B1 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 212118 (21) Numer zgłoszenia: 365023 (22) Data zgłoszenia: 22.01.2001 (86) Data i numer zgłoszenia

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1648484 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 01.06.04 047366.4 (97)

Bardziej szczegółowo


PL B1. AKADEMIA GÓRNICZO-HUTNICZA IM. STANISŁAWA STASZICA W KRAKOWIE, Kraków, PL BUP 08/13 PL 223497 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 223497 (13) B1 (21) Numer zgłoszenia: 399322 (51) Int.Cl. B23P 17/00 (2006.01) C21D 8/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

PL 213132 B1. POLITECHNIKA WROCŁAWSKA, Wrocław, PL 14.11.2005 BUP 23/05

PL 213132 B1. POLITECHNIKA WROCŁAWSKA, Wrocław, PL 14.11.2005 BUP 23/05 PL 213132 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 213132 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 367760 (22) Data zgłoszenia: 06.05.2004 (51) Int.Cl.

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1711158 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 16.11.2004 04806793.8

Bardziej szczegółowo


PL B1. SZOSTEK WACŁAW, Warszawa, PL TYZNER TADEUSZ, Warszawa, PL SZOSTEK RADOSŁAW, Warszawa, PL BUP 03/09 PL 216064 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 216064 (13) B1 (21) Numer zgłoszenia: 383011 (51) Int.Cl. A47C 7/16 (2006.01) A47C 9/02 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

PL B1. PĘKACKI PAWEŁ, Skarżysko-Kamienna, PL BUP 02/06. PAWEŁ PĘKACKI, Skarżysko-Kamienna, PL

PL B1. PĘKACKI PAWEŁ, Skarżysko-Kamienna, PL BUP 02/06. PAWEŁ PĘKACKI, Skarżysko-Kamienna, PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208199 (13) B1 (21) Numer zgłoszenia: 369112 (51) Int.Cl. A61C 5/02 (2006.01) A61B 5/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo


PL B1. POLWAX SPÓŁKA AKCYJNA, Jasło, PL BUP 21/12. IZABELA ROBAK, Chorzów, PL GRZEGORZ KUBOSZ, Czechowice-Dziedzice, PL PL 214177 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214177 (13) B1 (21) Numer zgłoszenia: 394360 (51) Int.Cl. B22C 1/02 (2006.01) C08L 91/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11)

(12) OPIS PATENTOWY (19) PL (11) RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 188998 (21 ) Numer zgłoszenia: 333174 (22) Data zgłoszenia: 23.10.1997 (86) Data i numer zgłoszenia międzynarodowego:

Bardziej szczegółowo



Bardziej szczegółowo

PL 208802 B1. NYK BOGUSŁAW, Warszawa, PL 13.10.2008 BUP 21/08. BOGUSŁAW NYK, Warszawa, PL 30.06.2011 WUP 06/11. rzecz. pat.

PL 208802 B1. NYK BOGUSŁAW, Warszawa, PL 13.10.2008 BUP 21/08. BOGUSŁAW NYK, Warszawa, PL 30.06.2011 WUP 06/11. rzecz. pat. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208802 (13) B1 (21) Numer zgłoszenia: 382138 (51) Int.Cl. A47H 1/02 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 04.04.2007

Bardziej szczegółowo


Kurs pt.  MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII Warszawa, 6 lutego 2011 r. Szanowna Pani! Szanowny Panie! Niniejszym uprzejmie informuję, że organizowany jest Kurs pt. " MOLEKULARNE METODY BADAŃ W MIKROBIOLOGII I WIRUSOLOGII " Kurs odbędzie się w dniach

Bardziej szczegółowo


PL 207979 B1. POLITECHNIKA RZESZOWSKA IM. IGNACEGO ŁUKASIEWICZA, Rzeszów, PL 21.01.2008 BUP 02/08 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 207979 (13) B1 (21) Numer zgłoszenia: 380220 (51) Int.Cl. C07D 209/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 17.07.2006

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1968711 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 05.01.2007 07712641.5

Bardziej szczegółowo

(21) Numer zgłoszenia: (54) Sposób wytwarzania preparatu barwników czerwonych buraka ćwikłowego

(21) Numer zgłoszenia: (54) Sposób wytwarzania preparatu barwników czerwonych buraka ćwikłowego RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19)PL (11)167526 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 292733 (22) Data zgłoszenia: 10.12.1991 (51) IntCl6: C12P 1/00 C12N

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 19.11.2004 04819605.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 19.11.2004 04819605. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1687319 (13) T3 (96) Data i numer zgłoszenia patentu europejskiego: 19.11.04 0481960.9 (1) Int. Cl. C07F9/30 (06.01) (97)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1890558 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 18.05.2006 06755505.2

Bardziej szczegółowo

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika

PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika PathogenFree DNA Isolation Kit Zestaw do izolacji DNA Instrukcja użytkownika Spis treści 1. Zawartość 2 1.1 Składniki zestawu 2 2. Opis produktu 2 2.1 Założenia metody 2 2.2 Instrukcja 2 2.3 Specyfikacja

Bardziej szczegółowo

Biopaliwo do silników z zapłonem samoczynnym i sposób otrzymywania biopaliwa do silników z zapłonem samoczynnym. (74) Pełnomocnik:

Biopaliwo do silników z zapłonem samoczynnym i sposób otrzymywania biopaliwa do silników z zapłonem samoczynnym. (74) Pełnomocnik: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 197375 (21) Numer zgłoszenia: 356573 (22) Data zgłoszenia: 10.10.2002 (13) B1 (51) Int.Cl. C10L 1/14 (2006.01)

Bardziej szczegółowo


PL B1. POLITECHNIKA WROCŁAWSKA, Wrocław, PL BUP 06/14 PL 223622 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 223622 (13) B1 (21) Numer zgłoszenia: 403511 (51) Int.Cl. G01T 1/04 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia:

Bardziej szczegółowo


PL B1. INSTYTUT METALURGII I INŻYNIERII MATERIAŁOWEJ IM. ALEKSANDRA KRUPKOWSKIEGO POLSKIEJ AKADEMII NAUK, Kraków, PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 211075 (13) B1 (21) Numer zgłoszenia: 382853 (51) Int.Cl. C22C 5/08 (2006.01) B21D 26/02 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

(19) PL (11) (13)B1 (12) OPIS PATENTOWY PL B1 FIG. 2 F28F 1/32 B60H 3/00. (57) 1. Wymiennik ciepła dla układu klimatyzacji

(19) PL (11) (13)B1 (12) OPIS PATENTOWY PL B1 FIG. 2 F28F 1/32 B60H 3/00. (57) 1. Wymiennik ciepła dla układu klimatyzacji RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (21 ) Numer zgłoszenia: 318582 (22) Data zgłoszenia: 20.02.1997 (19) PL (11)182506 (13)B1 (51) IntCl7 F28F 1/32 B60H

Bardziej szczegółowo

Instrukcja do ćwiczeń laboratoryjnych

Instrukcja do ćwiczeń laboratoryjnych UNIWERSYTET GDAŃSKI Pracownia studencka Zakład Analizy Środowiska Instrukcja do ćwiczeń laboratoryjnych Ćwiczenie nr 3 Oznaczanie witaminy E w oleju metodą HPLC ANALIZA PRODUKTÓW POCHODZENIA NATURALNEGO

Bardziej szczegółowo

PL B1. AKZO NOBEL COATINGS Sp. z o.o., Włocławek,PL BUP 11/ WUP 07/08. Marek Pawlicki,Włocławek,PL

PL B1. AKZO NOBEL COATINGS Sp. z o.o., Włocławek,PL BUP 11/ WUP 07/08. Marek Pawlicki,Włocławek,PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 198634 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 363728 (22) Data zgłoszenia: 26.11.2003 (51) Int.Cl. C09D 167/00 (2006.01)

Bardziej szczegółowo

(13) B1 (12) OPIS PATENTOWY (19) PL (11) PL B1

(13) B1 (12) OPIS PATENTOWY (19) PL (11) PL B1 RZECZPO SPOLITA POLSKA U rząd Patentow y Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 184404 (21) N um er zgłoszenia: 315319 (22) D ata zgłoszenia: 17.07.1996 (13) B1 (51) IntCl7 C07C 279/14

Bardziej szczegółowo

PL B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL BUP 19/09. MACIEJ KOKOT, Gdynia, PL WUP 03/14. rzecz. pat.

PL B1. POLITECHNIKA GDAŃSKA, Gdańsk, PL BUP 19/09. MACIEJ KOKOT, Gdynia, PL WUP 03/14. rzecz. pat. PL 216395 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 216395 (13) B1 (21) Numer zgłoszenia: 384627 (51) Int.Cl. G01N 27/00 (2006.01) H01L 21/00 (2006.01) Urząd Patentowy Rzeczypospolitej

Bardziej szczegółowo

Instrukcja do ćwiczeń laboratoryjnych

Instrukcja do ćwiczeń laboratoryjnych UNIWERSYTET GDAŃSKI WYDZIAŁ CHEMII Pracownia studencka Katedra Analizy Środowiska Instrukcja do ćwiczeń laboratoryjnych Ćwiczenie nr 2 OPTYMALIZACJA ROZDZIELANIA MIESZANINY WYBRANYCH FARMACEUTYKÓW METODĄ

Bardziej szczegółowo


PL 212814 B1. WONAM SERWIS SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Żory, PL 27.02.2012 BUP 05/12 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 212814 (13) B1 (21) Numer zgłoszenia: 392196 (51) Int.Cl. E21F 3/00 (2006.01) F24F 3/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo



Bardziej szczegółowo

do leczenia zakażenia Helicobacter pylori i związanych z nim chorób (74) Pełnomocnik:

do leczenia zakażenia Helicobacter pylori i związanych z nim chorób (74) Pełnomocnik: RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19) PL (11) 187704 (21) Numer zgłoszenia: 323305 (13) B1 (22) Data zgłoszenia: 05.07.1996 (86) Data i numer zgłoszenia

Bardziej szczegółowo


PL B1. INSTYTUT TECHNOLOGII DREWNA, Poznań, PL BUP 22/11 PL 215857 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 215857 (13) B1 (21) Numer zgłoszenia: 390962 (51) Int.Cl. C09B 29/16 (2006.01) C07D 213/20 (2006.01) Urząd Patentowy Rzeczypospolitej

Bardziej szczegółowo

PL 175707 B1 (12) OPIS PATENTOWY (19) PL (11) 175707 (13) B1 C07C 235/66

PL 175707 B1 (12) OPIS PATENTOWY (19) PL (11) 175707 (13) B1 C07C 235/66 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 175707 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 304406 (22) Data zgłoszenia: 22.07.1994 IntCl6: C07C 203/04 C07C 235/66

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1886669 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 02.08.2007 07113670.9

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1711507 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 04.02.2005 05700509.2

Bardziej szczegółowo

PL 203461 B1. Politechnika Warszawska,Warszawa,PL 15.12.2003 BUP 25/03. Mateusz Turkowski,Warszawa,PL Tadeusz Strzałkowski,Warszawa,PL

PL 203461 B1. Politechnika Warszawska,Warszawa,PL 15.12.2003 BUP 25/03. Mateusz Turkowski,Warszawa,PL Tadeusz Strzałkowski,Warszawa,PL RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 203461 (13) B1 (21) Numer zgłoszenia: 354438 (51) Int.Cl. G01F 1/32 (2006.01) G01P 5/01 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data

Bardziej szczegółowo

PL B1. Sposób i układ pomiaru całkowitego współczynnika odkształcenia THD sygnałów elektrycznych w systemach zasilających

PL B1. Sposób i układ pomiaru całkowitego współczynnika odkształcenia THD sygnałów elektrycznych w systemach zasilających RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 210969 (13) B1 (21) Numer zgłoszenia: 383047 (51) Int.Cl. G01R 23/16 (2006.01) G01R 23/20 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

(73) Uprawniony z patentu: (72) (74) Pełnomocnik:

(73) Uprawniony z patentu: (72) (74) Pełnomocnik: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 165947 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 292707 (22) Data zgłoszenia: 09.12.1991 (51) IntCl5: B01D 53/04 (54)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058. (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058. (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2584058 (96) Data i numer zgłoszenia patentu europejskiego: 21.10.2011 11186244.7 (13) (51) T3 Int.Cl. C22C 38/40 (2006.01)

Bardziej szczegółowo

(54) Sorbent do pozaustrojowego usuwania lipoprotein o niskiej gęstości z krwi lub osocza

(54) Sorbent do pozaustrojowego usuwania lipoprotein o niskiej gęstości z krwi lub osocza RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 167750 (13) B1 (21) Numer zgłoszenia: 293642 Urząd Patentowy (22) Data z głoszenia: 28.02.1992 Rzeczypospolitej Polskiej (51) IntCl6: B01J 20/24 B01J

Bardziej szczegółowo


PL B1. PRZEDSIĘBIORSTWO HAK SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ, Wrocław, PL BUP 20/14. JACEK RADOMSKI, Wrocław, PL PL 224252 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 224252 (13) B1 (21) Numer zgłoszenia: 403166 (51) Int.Cl. B66C 13/08 (2006.01) H02K 7/14 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

PL 208214 B1. DZIŻA SŁAWOMIR-PRACOWNIA PLASTYCZNA REKLAMA, Szadkowice, PL 12.12.2005 BUP 25/05. SŁAWOMIR DZIŻA, Szadkowice, PL 31.03.

PL 208214 B1. DZIŻA SŁAWOMIR-PRACOWNIA PLASTYCZNA REKLAMA, Szadkowice, PL 12.12.2005 BUP 25/05. SŁAWOMIR DZIŻA, Szadkowice, PL 31.03. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208214 (13) B1 (21) Numer zgłoszenia: 368426 (51) Int.Cl. G09F 13/22 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 07.06.2004

Bardziej szczegółowo


PL B1. BRIDGESTONE/FIRESTONE TECHNICAL CENTER EUROPE S.p.A., Rzym, IT , IT, TO2001A001155 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 208257 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 357658 (22) Data zgłoszenia: 10.12.2002 (51) Int.Cl. B60C 3/06 (2006.01)

Bardziej szczegółowo

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego

PL 217144 B1. Sposób amplifikacji DNA w łańcuchowej reakcji polimerazy za pomocą starterów specyficznych dla genu receptora 2-adrenergicznego PL 217144 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 217144 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 391926 (22) Data zgłoszenia: 23.07.2010 (51) Int.Cl.

Bardziej szczegółowo

PL 214401 B1. Kontener zawierający co najmniej jeden wzmacniający profil oraz sposób wytwarzania takiego profilu

PL 214401 B1. Kontener zawierający co najmniej jeden wzmacniający profil oraz sposób wytwarzania takiego profilu PL 214401 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 214401 (13) B1 (21) Numer zgłoszenia: 378396 (51) Int.Cl. B65F 1/00 (2006.01) B65D 88/12 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo


ARKUSZ 1 POWTÓRZENIE DO EGZAMINU Z CHEMII ARKUSZ 1 POWTÓRZENIE DO EGZAMINU Z CHEMII Zadanie 1. Na rysunku przedstawiono fragment układu okresowego pierwiastków. Dokoocz zdania tak aby były prawdziwe. Wiązanie jonowe występuje w związku chemicznym

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2526977. (96) Data i numer zgłoszenia patentu europejskiego: 31.01.2012 12153261.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2526977. (96) Data i numer zgłoszenia patentu europejskiego: 31.01.2012 12153261. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2526977 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 31.01.2012 12153261.8

Bardziej szczegółowo

Raport z badania Działanie wirusobójcze środka dezynfekującego wobec Feline calicivirus. 25 października 2006

Raport z badania Działanie wirusobójcze środka dezynfekującego wobec Feline calicivirus. 25 października 2006 Raport z badania Działanie wirusobójcze środka dezynfekującego wobec Feline calicivirus 25 października 2006 Dr Tobias J. Tuthill Wydział Nauk Biologicznych Uniwersytet Leeds Leeds LS2 9JT

Bardziej szczegółowo

PL 213904 B1. Elektrolityczna, nanostrukturalna powłoka kompozytowa o małym współczynniku tarcia, zużyciu ściernym i korozji

PL 213904 B1. Elektrolityczna, nanostrukturalna powłoka kompozytowa o małym współczynniku tarcia, zużyciu ściernym i korozji PL 213904 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 213904 (13) B1 (21) Numer zgłoszenia: 390004 (51) Int.Cl. C25D 3/12 (2006.01) C25D 15/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: , PCT/EP01/12982 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: , PCT/EP01/12982 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 202590 (21) Numer zgłoszenia: 355683 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 09.11.2001 (86) Data i numer zgłoszenia

Bardziej szczegółowo


WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z CHEMII KOD UCZNIA... WOJEWÓDZKI KONKURS PRZEDMIOTOWY Z CHEMII Termin: 12 marzec 2008 r. godz. 10 00 Czas pracy: 90 minut ETAP III Ilość punktów za rozwiązanie zadań Część I Część II Część III Numer zadania 1

Bardziej szczegółowo

( 5 4 ) Kompozycja farmaceutyczna do leczenia chorób, w których mediatorem jest

( 5 4 ) Kompozycja farmaceutyczna do leczenia chorób, w których mediatorem jest RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (21) Numer zgłoszenia: 329940 (22) Data zgłoszenia: 13.05.1997 (86) Data i numer zgłoszenia międzynarodowego: 13.05.1997,

Bardziej szczegółowo

(12) OPIS PATENTOWY (19)PL (11)190412 (13) B1 PL 190412 B1 B65G 57/28 B65H 29/38 B65B 35/22 RZECZPOSPOLITA POLSKA. (21 ) Numer zgłoszenia: 336192

(12) OPIS PATENTOWY (19)PL (11)190412 (13) B1 PL 190412 B1 B65G 57/28 B65H 29/38 B65B 35/22 RZECZPOSPOLITA POLSKA. (21 ) Numer zgłoszenia: 336192 RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12) OPIS PATENTOWY (19)PL (11)190412 (21 ) Numer zgłoszenia: 336192 (22) Data zgłoszenia: 2 3.10.1999 (13) B1 (51) IntCl7 B65G 57/28 B65H

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609. (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792.

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609. (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792. RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 1879609 (96) Data i numer zgłoszenia patentu europejskiego: 04.05.2006 06742792.2 (13) (51) T3 Int.Cl. A61K 38/17 (2006.01)

Bardziej szczegółowo

PL 210507 B1. PAC ALEKSANDER, Lublewo, PL. 02.09.2003, XI Międzynarodowy Salon Przemysłu Obronnego Kielce

PL 210507 B1. PAC ALEKSANDER, Lublewo, PL. 02.09.2003, XI Międzynarodowy Salon Przemysłu Obronnego Kielce RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 210507 (13) B1 (21) Numer zgłoszenia: 365767 (51) Int.Cl. H01Q 3/08 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 02.03.2004

Bardziej szczegółowo

PL B1. Urządzenie do badania nieciągłości struktury detali ferromagnetycznych na małej przestrzeni badawczej. POLITECHNIKA LUBELSKA, Lublin, PL

PL B1. Urządzenie do badania nieciągłości struktury detali ferromagnetycznych na małej przestrzeni badawczej. POLITECHNIKA LUBELSKA, Lublin, PL PL 212769 B1 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 212769 (13) B1 (21) Numer zgłoszenia: 381653 (51) Int.Cl. G01N 27/82 (2006.01) G01R 33/12 (2006.01) Urząd Patentowy Rzeczypospolitej

Bardziej szczegółowo

(12) OPIS PATENTOWY (19) PL (11) 185228

(12) OPIS PATENTOWY (19) PL (11) 185228 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 185228 (21) Numer zgłoszenia: 331212 ( 13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 04.07.1997 (86) Data i numer zgłoszenia

Bardziej szczegółowo

PL B1. Układ do zasilania silnika elektrycznego w pojazdach i urządzeniach z napędem hybrydowym spalinowo-elektrycznym

PL B1. Układ do zasilania silnika elektrycznego w pojazdach i urządzeniach z napędem hybrydowym spalinowo-elektrycznym RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 211702 (13) B1 (21) Numer zgłoszenia: 382097 (51) Int.Cl. B60K 6/00 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 30.03.2007

Bardziej szczegółowo

Biochemia: Ćw. 11 Metoda RT-PCR

Biochemia: Ćw. 11 Metoda RT-PCR Ćwiczenie 11 METODA RT-PCR Wyciąg z kart charakterystyki substancji niebezpiecznych: bromek etydyny T+ EDTA Xi etanol, 96% F kwas octowy, 96% C -merkaptoetanol N, T Tris Xi UWAGI WSTĘPNE Praca z kwasami

Bardziej szczegółowo


PL 207433 B1. PRZEMYSŁOWY INSTYTUT AUTOMATYKI I POMIARÓW PIAP, Warszawa, PL 26.06.2006 BUP 13/06. ZBIGNIEW BORKOWICZ, Wrocław, PL 31.12. RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 207433 (13) B1 (21) Numer zgłoszenia: 371716 (51) Int.Cl. G01N 27/82 (2006.01) B25J 15/06 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego:

(12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP (96) Data i numer zgłoszenia patentu europejskiego: RZECZPOSPOLITA POLSKA (12) TŁUMACZENIE PATENTU EUROPEJSKIEGO (19) PL (11) PL/EP 2047071 Urząd Patentowy Rzeczypospolitej Polskiej (96) Data i numer zgłoszenia patentu europejskiego: 21.07.2007 07786251.4

Bardziej szczegółowo

PL 211723 B1. HUTA STALOWA WOLA SPÓŁKA AKCYJNA, Stalowa Wola, PL 12.04.2010 BUP 08/10

PL 211723 B1. HUTA STALOWA WOLA SPÓŁKA AKCYJNA, Stalowa Wola, PL 12.04.2010 BUP 08/10 RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 211723 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 386838 (22) Data zgłoszenia: 07.10.2008 (51) Int.Cl. F41H 5/20 (2006.01)

Bardziej szczegółowo

TaqNova-RED. Polimeraza DNA RP20R, RP100R

TaqNova-RED. Polimeraza DNA RP20R, RP100R TaqNova-RED Polimeraza DNA RP20R, RP100R RP20R, RP100R TaqNova-RED Polimeraza DNA Rekombinowana termostabilna polimeraza DNA Taq zawierająca czerwony barwnik, izolowana z Thermus aquaticus, o przybliżonej

Bardziej szczegółowo

Kompozycja przyprawowa do wyrobów mięsnych, zwłaszcza pasztetu i sposób wytwarzania kompozycji przyprawowej do wyrobów mięsnych, zwłaszcza pasztetu

Kompozycja przyprawowa do wyrobów mięsnych, zwłaszcza pasztetu i sposób wytwarzania kompozycji przyprawowej do wyrobów mięsnych, zwłaszcza pasztetu RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 206451 (13) B1 (21) Numer zgłoszenia: 371452 (51) Int.Cl. A23L 1/221 (2006.01) A23L 1/0522 (2006.01) Urząd Patentowy Rzeczypospolitej Polskiej (22)

Bardziej szczegółowo

(86) Data i numer zgłoszenia międzynarodowego: , PCT/FR02/02519 (87) Data i numer publikacji zgłoszenia międzynarodowego:

(86) Data i numer zgłoszenia międzynarodowego: , PCT/FR02/02519 (87) Data i numer publikacji zgłoszenia międzynarodowego: RZECZPOSPOLITA POLSKA (12) OPIS PATENTOWY (19) PL (11) 202567 (21) Numer zgłoszenia: 367089 (13) B1 Urząd Patentowy Rzeczypospolitej Polskiej (22) Data zgłoszenia: 16.07.2002 (86) Data i numer zgłoszenia

Bardziej szczegółowo

PL 177676 B1 C07C 401/00 A61K 31/59 A 6 1 K 7/40

PL 177676 B1 C07C 401/00 A61K 31/59 A 6 1 K 7/40 RZECZPOSPOLITA POLSKA (1 2 ) OPIS PATENTOWY ( 1 9 ) PL (1 1 ) 177676 (1 3 ) B1 Urząd Patentowy Rzeczypospolitej Polskiej (21) Numer zgłoszenia: 308427 (22) Data zgłoszenia: 29.04.1995 ( 5 1 ) IntCl6: C07C

Bardziej szczegółowo