science Histological lesions in expanded criteria renal allografts 1st December Issue 4/2014

Transkrypt

1 science 1st December Issue 4/2014 Histological lesions in expanded criteria renal allografts also The diversity of aminoglycoside -modifying enzymes among ESBL- positive Proteus mirabilis clinical strains Abstract Book - Ogólnopolska Konferencja Studentów i Doktorantów. Kierunki przyrodnicze i medyczne Treatment of dyspnea in the elderly when social care gains the advantage Eating behavior among patients with hypertension Neoplasms the state of knowledge among high school students The use of stimulants among patients with diagnosed hypertension

2

3 EDITORIAL OFFICE EDITORS-IN CHIEF Michal Wszola MD, PhD Prof. Artur Kwiatkowski MD, PhD ASSOCIATE EDITORS Piotr Domagala MD, PhD Rafal Kieszek MD, PhD Karolina Kłoda MD, PhD Monika Bieniasz MD, PhD Jerzy Bednarski MD Jeffrey Eakin MD EDITORIAL BOARD MEMBERS Stanislav Czudek MD, PhD (Ostrava, Czech Republic) Mohan Desarda MD, PhD (Poona, India) Takuji Gotoda MD, PhD (Tokyo, Japan) Atsushi Irisawa MD, PhD (Fukushima, Japan) Shekhar Kumta MD, PhD (Hong Kong, China) Milan Profant MD, PhD (Bratislava, Slovak Republic) Shomei Ryozawa MD, PhD (Saitama, Japan) José Pedro da Silva MD, PhD (Sao Paulo, Brasil) Pinghong Zhou MD, PhD (Shanghai, China) Maciej Banach MD, PhD (Lodz, Poland) Piotr Chłosta MD, PhD (Krakow, Poland) Piotr Czauderna MD, PhD (Gdansk, Poland) Adam Dziki MD, PhD (Lodz, Poland) Ireneusz Krasnodębski MD, PhD (Warszawa, Poland) Maciej Michalik MD, PhD (Olsztyn, Poland) Anna Nasierowska Guttmejer MD, PhD (Warszawa, Poland) Krzysztof Paśnik MD, PhD (Warszawa, Poland) Dariusz Patkowski MD, PhD (Wroclaw, Poland) Piotr Richter MD, PhD (Krakow, Poland) Witold Rużyłło MD, PhD (Warszawa, Poland) Teresa Starzyńska MD, PhD (Szczecin, Poland) Wiesław Tarnowski MD, PhD (Warszawa, Poland) Janusz Trzebicki MD, PhD (Warszawa, Poland) Grzegorz Wallner MD, PhD (Lublin, Poland) Marian Zembala MD, PhD (Zabrze, Poland) Krzysztof Zieniewicz MD, PhD (Warszawa, Poland) PUBLISHER MEDtube Ltd. Złota 59 street; Warsaw, Poland Tel Fax US OFFICE 55 Tiemann Place Suite 29; New York, NY 10027, United States WEBMASTERING AND IT Adrian Fester COPYRIGHT MEDtube Ltd. DISCLAIMER Publisher and the Editorial Board accept no liability whatsoever for the consequences of any inaccurate or misleading data, opinions or statements contained in the articles. Every effort is made to ensure that all data and techniques are presented accurately. PRINT RUN 500 CONTACT WEBSITE t

4

5 Dear Colleagues, MICHAŁ WSZOŁA MD, PhD Editor in Chief We are pleased to present another issue of MEDtube Science - an open access publication distributed online. ARTUR KWIATKOWSKI MD, PhD Editor in Chief MEDtube Science is addressed to all medical professionals physicians, researchers who are interested in achievements in basic and clinical medical science. MEDtube Science is supposed to satisfy the demand for combining different formats - video and written science in particular. The journal has international scope. It will be published quarterly and exclusively in English. Original articles, reviews, case reports, rapid communications, special articles and letters to the Editor in both basic and clinical medical research are accepted for publication with particular stress on manuscripts enriched with multimedia such as videos or pictures. We have strong confidence that this new project will be quickly recognized in Medline and other medical bases and will become an indexed journal with impact factor. At the end of our journal you will find information and instructions for authors on how to submit articles. We are also pleased to inform you that in 2014 there will be no fee for accepted articles so do not waste time send us your paper. Kindest Regards, Michal Wszola MD, PhD Editor-in Chief Artur Kwiatkowski MD, PhD Editor-in Chief

6

7 TABLE OF CONTENTS Histological lesions in expanded criteria renal allografts Domagala Piotr, Wszola Michal, Perkowska-Ptasinska Agnieszka et al PAGES 8-14 The diversity of aminoglycoside-modifying enzymes among ESBL - positive Proteus mirabilis clinical strains Anna Diana Michalska, Paweł Tomasz Sacha, Katarzyna Kaczyńska, Elżbieta Anna Tryniszewska PAGES Treatment of dyspnea in the elderly when social care gains the advantage Sayed S Syleem PAGES Eating behavior among patients with hypertension Dorota Nalepa, Marta Czekirda, Wojciech Załuska, Sylwia Lalik PAGES Neoplasms the state of knowledge among high school students Potempa Magdalena, Jonczyk Paweł, Janerka Michał, Kucharzewski Marek PAGES The use of stimulants among patients with diagnosed hypertension Dorota Nalepa, Marta Czekirda, Wojciech Załuska, Sylwia Lalik PAGES Abstract Book - Ogólnopolska Konferencja Studentów i Doktorantów. Kierunki przyrodnicze i medyczne PAGES

8 science 8 The shortage of organs for transplantation has forced the transplant community to create another donors subgroup expanded criteria donors (ECD). ECD kidneys are more likely to contain chronic histological lesions on biopsy. Histological lesions in expanded criteria renal allografts Domagala Piotr 1 *, Wszola Michal 1, Perkowska-Ptasinska Agnieszka 2, Durlik Magdalena 2, Paczek Leszek 3, Kwiatkowski Artur 1, Chmura Andrzej 1 1. Department of General Surgery and Transplantology, The Medical University of Warsaw, Warsaw, Poland 2. Department of Transplant Medicine and Nephrology, The Medical University of Warsaw, Warsaw, Poland 3. Department of Immunology, Transplantology and Internal Medicine, The Medical University of Warsaw, Warsaw, Poland #Corresponding author: Piotr Domagała, Department of General Surgery and Transplantology, The Medical University of Warsaw Warsaw, Poland, Nowogrodzka 59 street, e mail: piotr.domagala@wum.edu.pl, phone: , fax: RUNNING TITLE KEYWORDS WORD COUNT CONFLICT OF INTERESTS Histological lesions of ecd kidneys chronic histological lesions, expanded criteria donors, kidney graft survival, kidney transplantation, histological scores no conflicts of interest ABSTRACT Backgrounds: The shortage of organs for transplantation has forced the transplant community to create another donors subgroup expanded criteria donors (ECD). The aim of this study was to establish the relationship between expanded criteria donors parameters and chronic histopathological lesions and then histopathological lesions in relation to transplant kidney graft function and survival. Material and methods: One hundred and seventy two patients received renal transplants from deceased donors. The data on donors and recipients were collected. The patient and graft survival rates were noted. The delayed, slow graft function and creatinine concentration were analysed. The chronic lesions in kidney biopsies were evaluated according to Banff criteria (2007). Results: Kidneys procured from ECD (n=43) display chronic histological lesions like interstitial fibrosis (IF), tubular atrophy (TA), arteriosclerosis(as), arteriolar hyalinization (AH) and glomerulosclerosis (GS) significantly more frequently than standard criteria donor kidneys (n=128). TA was associated with higher creatinine concentration. Popular histological score systems (BANFF, Pirani, CADI) did not have correlate with kidney graft survival and function. Conclusions: ECD kidneys are more likely to contain chronic histological lesions on biopsy. There is a correlation between chronic histological lesions and kidney graft function.

9 9 science BACKGROUND Kidney transplantation is established as the optimal method of treatment for patients with end-stage kidney diseases. Among many benefits of kidney transplantation is a better control of cardiovascular disease in comparison to dialysed patients (1). Cardiovascular incidents are the main cause of death among dialyzed patients (2) and this should be the strongest motivation for kidney transplantation as soon as possible. Unfortunately, the number of patients on waiting lists is much higher than the number of kidney transplantation procedures worldwide (3). The shortage of organs has forced the transplant community to accept kidneys not only from ideal donors (4). It has lead to the creation of another donors subgroup expanded criteria donors (ECD). ECD kidneys have been defined as kidneys from donors aged 60 years and older, or from donors aged years with at least two of the following: cerebrovascular accident (CVA) as cause of death, serum creatinine above 1.5 mg/dl or a history of hypertension (5). The major problem and concern about ECD are the long-term results of transplantation. Nevertheless, it is certain that for some recipients on the waiting list it is valuable and beneficial to receive a kidney procured from ECD (6). It is obvious that a greater effort should be placed on the problem of analyzing factors that could help in discard a certain group of kidneys procured from ECD. The aim of this study was to establish the relationship between expanded criteria kidney donor parameters and chronic histopathological lesions and to investigate the correlation between histopathological lesions and transplant kidney graft function and survival. MATERIAL AND METHODS One hundred and seventy two patients received renal transplants from deceased donors between January 2006 and August The data on donors and recipients as well as method of kidney preservation were collected. The patient and graft survival as well as the immediate, delayed and slow graft function were analysed. The kidney transplant function was assessed by serum creatinine concentration 12 months post transplantation. Delayed graft function (DGF) was defined as a necessity for dialysis treatment in the first week post transplantation. Slow graft function (SGF) was defined as a serum creatinine concentration higher than 3.5 mg/dl at seven days post transplantation for patients that did not require dialysis treatment in the posttransplant course. Donors There were 98 deceased donors diagnosed with brain-death, aged from 8 to 75 years (mean age 42 ± 16.5), predominantly male (61.2% males), hospitalized in ICU for 1-17 days (mean ICU stay 4 days). The mean donor serum creatinine concentration was 1.1 mg/dl and the mean serum creatinine clearance was 87.1 ml/min/1.73 m2. Causes of death included CNS trauma (n=43), cerebrovascular accidents (n=43) and others (n=12). Vasopressors, most commonly dopamine, were administered in 88.8% of donors. Other organs, beside kidneys, were procured in 45% of donors. Donors were classified according to UNOS criteria. There were 23 donors classified as expanded criteria donors (23.5 %) and 75 donors classified as standard criteria donors (76.5 %) (Tab. 1). Kidney recipients There were 172 recipients with end-stage renal disease, aged from 17 to 72 years (mean age 44 ± 13.3), predominantly male (66% males), with mean body mass index 23 kg/m2. A case of primary non-function was excluded from further analysis (0.6%). Most of the recipients underwent kidney transplantation for the first time (72%). The mean duration of dialysis therapy prior to transplantation (hemodialysis in 88%) was over 4 years. Most recipients suffered from hypertension (88.8%), 20% of recipients had lipid disorders and 19.4% of them suffered from chronic coronary disease (Tab. 2). The most frequent causes of end-stage renal disease were as follows: chronic glomerulonephritis (38.6%), nephropathy caused by reflux or congenital urinary tract defects (15.2%), diabetic nephropathy (12.3%), polycystic kidney disease (7.6%), systemic disease (5.3%), nephropathy secondary to hypertension (4.1%). Among other causes (7.0%), the following were encountered: rheumatic disease, Henoch-Schoenlein disease, Alport syndrome, Rendu-Osler-Weber syndrome and toxicity. In 9.9% cases the cause of end-stage renal disease was unknown. Kidney procurement, preservation and transplantation Between January 2006 and August kidneys were procured. Immediately prior to surgery, the donors were given heparin IU and broad -spectrum antibiotic as a prophylaxis. Procurement of kidneys was typical and in situ perfusion was carried out with University of Wisconsin solution. Immediately following organ recovery and cooling to 4ºC, the kidney was placed in a thermally stable container filled with preservation solution (cold storage CS). 83 kidneys were stored by CS (48.5%) until transplantation and 88 kidneys were stored by machine perfusion (MP, Waters Instruments Inc. Rochester). The decision which type of storage was used was made depending on cassette and perfusion fluid availability. Eleven kidneys were discarded: two organs because of poor perfusion parameters, six due to malignant

10 science 10 lesions on pathology, two because of elevated prostate specific antigen and in one case because of lack of available recipient for the HCV positive kidney. 172 kidneys were transplanted with mean cold ischemia time of over 27 hours. There was no significant difference in cold ischemia time between standard criteria donor kidneys group and expanded criteria donor kidneys group (25.1±6.2 h vs 27.9±6.7 h, p=ns). The mean warm ischemia time was 35 minutes. Kidney biopsy In one hundred and forty seven cases renal biopsy specimens obtained in the perioperative period (bench surgery) were available. The biopsy was fixated with formalin and then stained by typical H&E technique. The chronic lesions, inherited from the donor, in kidney biopsies were evaluated by the same pathologist according to Banff criteria Cortical intestitial fibrosis (IF), cortical tubular atrophy (TA), arteriosclerosis (AS), total inflammation (TI), arteriolar hyalinization (AH), glomerulosclerosis (GS) and thrombotic changes (TC) in kidneys biopsies were evaluated. The presence of chronic lesions was defined as Banff score 1. Arteriosclerosis was the most frequent chronic lesion observed (35.5%). The presence of glomerulosclerosis was defined as the existence of more than 20% of glomeruli with sclerosis and was found in 11% of cases. Additionally, according to Banff criteria 2007, three histological scores were calculated. The BANFF score exploited the degree of arteriosclerosis, tubular atrophy, interstitial fibrosis and arteriolar hyalinization. The Pirani score, described by Remuzzi (7), was based on the degree of arteriosclerosis, tubular atrophy, interstitial fibrosis and glomerulosclerosis. The CADI score (chronic allograft damage index) was calculated as a sum of degree of five histological parameters: arteriosclerosis, tubular atrophy, interstitial fibrosis, inflammation and glomerulosclerosis (8). Recipients follow-up The recipients were followed-up from three to thirty five months. The incidence of delayed graft function (DGF) was 30.4% and slow graft function (SGF) was 52.5%. Average 1-year graft survival was 86.9% for the whole group and mean creatinine concentration was 1.58 mg/dl. Average 1-year patient survival was 92.9% for the whole group. Most patients received triple drug immunosuppressive therapy: steroids (100%), cyclosporine (51.8%) or tacrolimus (48.2%) and mycophenolate (90.6%). In case of highly immunized recipients, induction immunosuppression was added (26.9%). Statistical analysis Comparisons between variables in two groups were assessed Chi-square or Cochrane-Mantel-Haenszel test. Student-t test or Wilcoxon test were applied for differences between means and medians, respectively. Risk factors of kidney survival and kidney function one year post-transplant were analysed by multivariate logistic regression and Cox regression analysis. In multivariate analysis graft loss during 12 months and serum creatinine concentration higher than 2 mg/dl at 12 months post transplantation were used as the end-points. Receiver operating characteristic (ROC) curves were used to compare predictive value of three calculated scores. Within the survey, a critical level for hypothesis testing was set at The SAS software version 8.2 (SAS Institute Inc., Cary, NY, USA) was used for statistical analysis. RESULTS ECD kidneys presented chronic histological lesions like cortical interstitial fibrosis, cortical tubular atrophy, arteriosclerosis, arteriolar hyalinization and glomerulosclerosis significantly more frequently than standard criteria donor kidneys [Tab. 3]. The incidence of arteriosclerosis was 22.7% in SCD group and 62.9% in ECD group (p < 0.001) and the incidence of glomerulosclerosis ( 20%) was 2.2% and 36.4% respectively (p < 0.001). There were no differences in total inflammation and thrombotic changes between ECD and SCD group. A correlation was observed between chronic histological changes inherited from the donor and graft survival/function. Cortical tubular atrophy, arteriosclerosis, arteriolar hyalinization and glomerulosclerosis found in biopsies were associated with higher serum creatinine concentration. Cortical interstitial fibrosis and arteriosclerosis were associated with higher incidence of graft loss. Additionally, the recipients of kidneys with arteriosclerosis and glomerulosclerosis had a higher rate of slow graft function and the recipients of kidneys with arteriolar hyalinization had a higher rate of delayed graft function. The recipients of kidneys with cortical interstitial fibrosis had a higher incidence of graft loss in comparison to recipients of kidneys without these findings one year post transplantation (33.3% vs 82.4%, p = 0.035). The recipients of kidneys with the tubular atrophy had higher serum creatinine concentration in comparison to recipients of kidneys without these changes one year post transplantation (2.13 mg/dl vs 1.53 mg/dl, p = 0.048) [Tab. 4]. The recipients of kidneys with inherited arteriosclerosis had a higher incidence of slow graft function, higher serum creatinine concentration and lower graft survival one year post transplantation in comparison to recipients of kidneys without inherited arterioscle-

11 11 science rosis (respectively 69.4% vs 48.6%, p = 0.040; 1.92 mg/dl vs 1.42 mg/dl, p = 0.006; 63.2% vs 85.1%, p = 0.048). The recipients of kidneys with presence of arteriolar hyalinization had a higher rate of delayed graft function (43.6% vs 25.5%, p = 0.035) and higher serum creatinine concentration one year post transplantation (1.89 mg/dl vs 1.47 mg/dl, p = 0.001) [Tab. 5]. In the group of kidneys with inherited glomerulosclerosis a higher incidence of slow graft function and higher serum creatinine concentration was presentone year post transplantation in comparison to kidneys without inherited glomerulosclerosis (respectively 78.6% vs 48.0%, p = 0.032; 1.95 mg/dl vs 1.51 mg/ dl, p = 0.021) [Tab. 5]. No influence of total inflammation and thrombotic changes on kidney graft survival and function was found. The predictive value of combination of donor clinical parameters (ECD) and chronic kidney lesions (whose influence was found in univariate analysis) for graft survival and kidney function at one year post transplantation were estimated by multivariate analysis. Cortical tubular atrophy was proved to have negative influence on serum creatinine concentration at one year post transplantation. Additionally, ECD kidney recipients were more likely to have a creatinine concentration higher than 2mg/dl at one year post transplantation [Tab. 6]. The influence of BANFF, Pirani and CADI scores on graft function and survival one year post transplantation were estimated. None of those scores reached significance [Tab. 7]. The areas under the curves (AUCs) of three scoring systems were compared [Fig. 1] DISCUSSION Despite many papers dealing with transplantation of kidneys procured from expanded criteria donors (9), the correlation between clinical parameters of expanded criteria donors and chronic histological lesions, inherited from the donor, has not been found until now. Our results proved for the first time that there is a strong correlation between expanded criteria donor definition, according to clinical parameters given by UNOS (United Network for Organ Sharing), and appearance of chronic histological lesions like cortical interstitial fibrosis, cortical tubular atrophy, arteriosclerosis, arteriolar hyalinization and glomerulosclerosis. In our analysis, a correlation between chronic histological changes and graft survival and function was proved. We found a relationship between cortical tubular atrophy, arteriosclerosis, arteriolar hyalini- zation and glomerulosclerosis estimated in biopsies and higher serum creatinine concentration. Cortical interstitial fibrosis and arteriosclerosis were associated with higher incidence of graft loss. Only cortical tubular atrophy reached significance in multivariate analysis, probably due to the size of the studied group. Similar findings were described by other authors. Numerous papers have indicated the influence of chronic histological lesions on transplanted kidney survival and function. Snoeijs proved lower graft survival of kidneys with glomerulosclerosis in biopsy (10). Lopes showed a correlation between glomerulosclerosis, arteriosclerosis and cortical interstitial fibrosis and kidney function three months post transplantation (11). The data published by Matignon confirmed the negative influence of arteriolar hyalinization on episodes of delayed graft function (12). Also Arias found that there is a lower graft survival of kidneys with glomerulosclerosis, cortical interstitial fibrosis, cortical tubular atrophy and arteriolar hyalinization (13). There are few papers where influence of donor parameters and histological findings on kidney allograft outcome are considered together (14). Karpinski described a histological score system to find how chronic histological lesions influence results of kidneys transplantation which seems to be more accurate than donor parameters alone (15). On the other hand, there are few papers which do not confirm the correlation between chronic histological lesions and kidney allograft function (16, 17). The differences in methodology of kidney biopsy collecting and its evaluation may explain variations in the data published. Nevertheless, most authors underline the negative impact of chronic histological changes on kidney allograft function and survival. Some data show that the degree of glomerulosclerosis could be a powerful parameter to define severity of renal damage. According to these results, some centres recommend the transplantation of two kidneys from one donor ( en bloc ) if the degree of glomerulosclerosis is greater than 20% (18). Our study did not confirm the effectiveness of the histological scoring systems like BANFF, Pirani or CADI. These scores are based on quantification of the severity of histological lesions. Our findings differ from other papers probably due to the fact that the analysed population was not sufficient. An interesting composite scoring system based on clinical data (donor serum creatinine concentration, donor hypertension) and one histological lesion (glomerulosclerosis) was proposed by Anglicheau (19). Many authors emphasize the necessity of routine kidney biopsy in the perioperative period, even though

12 science 12 the kidney is procured from a standard criteria donor (20). The aim of the biopsy is to evaluate kidney and to find a pre-existing morphological lesion, inherited from the donor that may limit the functional level and vitality of the graft. Secondly, this can be crucial for protocol biopsies in the post transplant period when chronic changes may overlap new histological changes associated with acute rejection, chronic nephropathy or drug toxicity. Moreover, histological examination during graft procurement and storage enables to qualify kidney for transplantation or not. Based on our experience we recommend to collect kidney biopsy from every graft during perioperative period and during storage in every case there are doubts as to possible kidney damage and vitality. CONCLUSIONS Kidneys procured from expanded criteria donors are more likely to contain chronic histological lesions on biopsy. There is a strong correlation between chronic histological lesions and kidney graft function and survival. DISCLOSURE This work was not supported by any grants or industry donations. The manuscript was not prepared or supported by any commercial organization. The authors of this manuscript have no conflicts of interest to disclose. CITE THIS AS MEDtube Science Dec. 2014; 2(4), LIST OF THE TABLES Tab. 1. Donors characteristics Tab. 2. Recipients characteristics Tab. 3. Chronic histological lesions in kidney biopsies Tab. 4. Influence of chronic histological lesions (IF and TA) on kidney graft function and survival in univariate analysis Tab. 5. Influence of chronic histological lesions (AS, HA and GS) on kidney graft function and survival in univariate analysis Tab. 6. Multivariate Cox regression model evaluating histological lesions for the prediction of graft loss and kidney function at one year post transplantation Tab. 7. Multivariate logistic regression model evalu ating histological score system (BANFF, Pi rani, CADI) for the prediction of graft loss and kidney function at one year post transplanta tion TAB. 1. DONORS CHARACTERISTICS Donors (n=98) AGE (Y) 42 ± 16.5 CAUSE OF DEATH (N): CNS TRAUMA 43 CEREBROVASCULAR DISEASE 43 OTHER 12 HYPERTENSION (%) 18.4 SERUM CREATININE CONCENTRATION (MG/DL) 1.1 ECD / SCD ACCORDING TO UNOS (N) 23/75 DONOR TYPE HEMODYNAMIC CLASSIFICATION (N) A 11 LIST OF THE FIGURES FIG. 1. RECEIVER OPERATING CHARACTERISTIC (ROC) CURVES FOR HISTOLOGICAL SCORING SYSTEMS AS PREDICTORS OF HIGH ( 2 MG/DL) CREATININE CONCENTRATION ONE YEAR POST TRANSPLANTA TION B 8 C 79 FEMALE / MALE 38/60 MULTIORGAN DONORS (%) 45 WEIGHT (KG) 72 HEIGHT (M) 1.7 BMI (KG/M2) 24.3 HYPOTENSION (%) 51 CARDIAC AREST (%) 28.6 ICU STAY (DAYS) 4 VASOPRESSORS (%) 88.8 URINE PER DAY (ML) 4298 SERUM CREATININE CLEARANCE (ML/MIN) 87.1 SERUM UREA CONCENTRATION (MG/DL) 36 HBV INFECTION (N) 6 HCV INFECTION (N) 8

13 13 science TAB. 2. RECIPIENTS CHARACTERISTICS Recipients (n=171) TAB. 3. CHRONIC HISTOLOGICAL LESIONS IN KIDNEY BIOPSIES AGE (Y) 44 ± 13.3 MALE / FEMALE (%) 66 / 34 WEIGHT (KG) 67 HEIGHT (M) 1.7 BMI (KG/M2) 23 HCV INFECTION (%) 27.1 HBV INFECTION (%) 16.6 CMV INFECTION (%) 67.9 HEMODIALYSIS (%) 88 DIABETES MELITUS (%) 13.5 HYPERTENSION (%) 88.8 CHRONIC CORONARY DISEASE (%) 19.4 ACUTE CORONARY SYNDROME (%) 3.5 ARYTHMIA (%) 5.3 LIPID DISORDERS (%) 20 IMMUNOLOGICAL CHARACTERISTIC HIGHEST PRA 15.2 LAST PRA 5.9 SCD (n=128) ECD (n=43) P INTERSTITIAL FIBROSIS 0.9% 12.5% CORTICAL TUBULAR ATROPHY 3.7% 22.5% < ARTERIOSCLEROSIS 22.7% 62.9% < TOTAL INFLAMMATION 1.0% 5.4% NS ARTERIOLAR HYALINIZATION 17.8% 52.5% < GLOMERULOSCLEROSIS 20% TAB % 36.4% < INFLUENCE OF CHRONIC HISTOLOGICAL LESIONS (IF AND TA) ON KIDNEY GRAFT FUNCTION AND SURVIVAL IN UNIVARIATE ANALYSIS IF (-) (n=141) IF (+) (n=6) P TA (-) (n=134) TA (+) (n=13) DGF (%) NS NS SGF (%) NS NS SERUM CREATI- NINE CONCEN- TRATION (MG/ DL) AT 1 YEAR GRAFT SURVIVAL (%) AT 1 YEAR NS NS P TAB. 5. INFLUENCE OF CHRONIC HISTOLOGICAL LESIONS (AS, HA AND GS) ON KIDNEY GRAFT FUNCTION AND SURVIVAL IN UNIVARIATE ANALYSIS AS (-) (n=71) AS (+) (n=39) P HA (-) (n=107) HA (+) (n=40) P GS<20% (n=109) GS 20% (n=14) P DGF (%) NS NS SGF (%) NS SERUM CREATI- NINE CONCEN- TRATION (MG/ DL) AT 1 YEAR GRAFT SURVIVAL (%) AT 1 YEAR NS NS TAB. 6. MULTIVARIATE COX REGRESSION MODEL EVALU ATING HISTOLOGICAL LESIONS FOR THE PREDIC TION OF GRAFT LOSS AND KIDNEY FUNCTION AT ONE YEAR POST TRANSPLANTATION Graft loss Serum creatinine 2 mg/dl OR p OR p ECD 1.7 NS INTERSTITIAL FIBROSIS 4.0 NS 1.57 NS CORTICAL TUBULAR ATROPHY 1.33 NS TAB. 7. MULTIVARIATE LOGISTIC REGRESSION MODEL EVALUATING HISTOLOGICAL SCORE SYSTEMS (BANFF, PIRANI, CADI) FOR THE PREDICTION OF GRAFT LOSS AND KIDNEY FUNCTION AT ONE YEAR POST TRANSPLANTATION Graft loss Serum creatinine 2 mg/dl OR p OR p ECD 1.33 NS INTERSTITIAL FIBROSIS 1.39 NS 1.64 NS ARTERIOSCLEROSIS 1.91 NS 1.87 NS ARTERIOLAR HYALINIZATION GLOMERULOSCLEROSIS 20% 1.35 NS 1.64 NS 2.35 NS 1.68 NS

14 science BIBLIOGRAPHY Meier-Kriesche H.U., Schold J.D., Srinivas T.R., Reed A., Kaplan B. Kidney transplantation halts cardiovascular disease progression in patients with end-stage renal disease. Am J Transplant. 2004; 4 (10): Locatelli F., Del Vecchio L., Manzoni C. Morbidity and mortality on maintenance haemodialysis. Nephron. 1998; 80 (4): Treviño-Becerra A. Substitute treatment and replacement in chronic kidney disease: peritoneal dialysis, hemodialysis and transplant. Cir Cir. 2009; 77 (5): Domagala P., Kwiatkowski A., Wszola M., Czerwinski J., Cybula K., Trzebicki J., Chmura A. Complications of transplantation of kidneys from expanded-criteria donors. Transplant Proc. 2009; 41 (8): Port F.K., Bragg J.L., Metzger R.A. Dykstra D.M., Gillespie B.W., Young E.W., Delmonico F.L., Wynn J.J., Merion R.M., Wolfe R.A., Held P.J. Donor characteristics associated with reduced graft survival: an approach to expanding the pool of kidney donors. Transplantation. 2002; 74 (9): Schold J.D., Meier-Kriesche H.U. Which Renal Transplant Candidates Should Accept Marginal Kidneys in Exchange for a Shorter Waiting Time on Dialysis? Clin J Am Soc Nephrol. 2006; 1 (3): Remuzzi G., Cravedi P. Perna A. et al. Long-term outcome of renal transplantation form older donors. NEJM. 2006; 354: Isoniemi H., Taskinen E., Hayry P. Histological chronic allograft damage index accurately predicts chronic renal allograft rejection. Transplantaion. 1994; 58: Stratta R.J., Rohr M.S., Sundberg A.K., Armstrong G., Hairston G., Hartmann E., Farney A., Roskopf J., Iskandar S.S., Adams P.L. Increased kidney transplantation utilizing expanded criteria deceased organ donors with results comparable to standard criteria donor transplant. Ann Surg. 2004; 239 (5): Snoeijs M.G., Buurman W.A., Christiaans M.H., van Hooff J.P., Goldschmeding R., van Suylen R.J., Peutz-Koostra C.J., van Heum L.W.E. Histological assessment of preimplantation biopsies may improve selection of kidneys from old donors after cardiac death. Am J Transplant. 2008; 8: Lopes J.A., Moreso F., Riera L., Carrera M., Ibernon M., Fulladosa X., Grinyó J.M., Serón D. Evaluation of pre-implantation kidney biopsies: comparison of Banff criteria to a morphometric approach. Kidney Int. 2005; 67 (4): Matignon M., Desvaux D., Noël L.H., Roudot-Thoraval F., Thervet E., Audard V., Dahan K., Lang P., Grimbert P. Arteriolar hyalinization predicts delayed graft function in deceased donor renal transplantation. Transplantation. 2008; 86 (7): Arias L.F., Blanco J., Sanchez-Fructuoso A., Prats D., Duque E., Sáiz-Pardo M., Ruiz J., Barrientos A. Histologic assessment of donor kidneys and graft outcome: multivariate analyses. Transplant Proc. 2007; 39 (5): Kayler L., Mohanka R., Basu A., Shapiro R., Randhawa P. Correlation of histologic findings on preimplant biopsy with kidney graft survival. Transplant International. 2008; 21: Karpinski J., Lajoie G., Cattran D., Fenton S., Zaltzman J., Cardella C., Cole E. Outcome of kidney transplantation from high-risk donors is determined by both structure and function. Transplantation. 1999; 67 (8): Pokorna E., Vitko S., Chadimova M., Schuck O. Morphologic changes in renal procurement biopsy and onset of graft function. Transplant Proc. 2001; 33: Sung R.S., Christensen L.L., Leichtman A.B., Greenstein S.M., Distant D.A., Wynn J.J., Stegall M.D., Delmonico F.L., Port F.K. Determinants of discard of expanded criteria donor kidneys: impact of biopsy and machine perfusion. Am J Transplant. 2008; 8 (4): Morales J., Andres A., Pallardo L., Capdevila L., Campistol J., Gil Vernet J. et al. Trasplante renal en pacientes de edad avanzada con un rinon de donate anoso. Nefrologia. 1998; 18, s5: Anglicheau D., Loupy A., Lefaucher C. et al. A simple clinic -histopathological composite scoring system is highly predic- 14 tive of graft outcomes in marginal donors. Am J Transplant. 2008; 8: Seron D., Anaya F., Marcen R., Garcia del Moral R. et al. Guidelines for indicating, obtaining, processing, and evaluating kidney transplant biopsies. Nefrologia. 2008; 4:

15 mykofenolan mofetylu

16 science 16 Proteus mirabilis, a Gram-negative rod from family Enterobacteriaceae, is one of the key pathogen associated with complicated urinary tract infections: acute pyelonephritis, bladder infections or urolithiasis. The diversity of aminoglycoside-modifying enzymes among ESBL - positive Proteus mirabilis clinical strains Anna Diana Michalska, Paweł Tomasz Sacha*, Katarzyna Kaczyńska, Elżbieta Anna Tryniszewska Department of Microbiological Diagnostics and Infectious Immunology, Medical University of Bialystok, Bialystok, Poland #Corresponding author: Paweł T. Sacha address: sachpt@umb.edu.pl RUNNING TITLE KEYWORDS Aminoglycoside-modifying enzymes among Proteus mirabilis aminoglycoside-modifying enzymes, Proteus mirabilis, ESBL, plasmid-mediated resistance WORD COUNT CONFLICT OF INTERESTS This study was supported by internal funding sources from Medical University of Bialystok ( F). ABSTRACT no conflicts of interest Background: Nowadays, the spreading of multi-drug resistant bacteria poses a serious threat, which significantly reduces therapeutic options. P. mirabilis is a common etiological factor of complicated urinary tract infections. Moreover, this species can acquire resistance genes through mobile genetic elements. The most prevalent resistance mechanism among P. mirabilis strains is the production of ESBL, which may occur along with other resistance determinants. Among them, AME creates the menace of aminoglycosides effectiveness. This study was designed to investigate the co-production of AME and ESBL in clinical isolates of P. mirabilis. Material and Methods: A total of 228 P. mirabilis strains were tested for the production of ESBL by DDST. Then, PCR with specific primer pairs was used to detect genes encoding AME among 75 ESBL-positive P. mirabilis strains. Results: The co-production of AME along with ESBL was reported in 88% of ESBL strains. The revealed AME genes were: ant(2 )-Ia (n=53), aph(3 )-Ib (n=14), aac(6 )-Ib (n=9), and aac(3)-ia (n=1). Nine strains showed the presence of more than one AME gene. The most frequent combination was ant(2 )-Ia+aph(3 )-Ib (5 strains), followed by aac(6 )-Ib+aph(3 )-Ib (2 strains), and aac(6 )-Ib+ant(2 )-Ia+aph(3 )-Ib (2 strains). Isolates co-producing AME and ESBL showed high resistance rates to 3rd generation cephalosporins, aminoglycosides, and fluoroquinolones. Carbapenems were the only antibiotics active against all tested strains. Conclusion: In this study we observed high prevalence of AME among P. mirabilis strains producing ESBL. The rapid dissemination of strains carrying genes for resistance to several groups of antibiotics creates the need for effective surveillance and appropriate antibiotic policy.

17 17 science BACKGROUND Proteus mirabilis, a Gram-negative rod from family Enterobacteriaceae, is one of the key pathogen associated with complicated urinary tract infections: acute pyelonephritis, bladder infections or urolithiasis [1]. This genus carries numerous virulence factors that promote colonization of the urinary tract [2]. Moreover, P. mirabilis strains can acquire various genes for antibiotic resistance via mobile genetic elements: plasmids, integrons, gene cassettes, and transposons [3]. The production of extended spectrum beta-lactamases (ESBL) is considered as one of the most important resistance mechanism. These enzymes have the ability to hydrolyze the molecules of beta-lactam antibiotics, like 3rd generation cephalosporins (eg. cefotaxime, ceftazidime) and monobactams [4]. There are several antimicrobial options recommended for the treatment of ESBL-producing P. mirabilis like aminoglycosides, fluoroquinolones, or carbapenems [5]. Aminoglycosides are very important group of antibiotics with activity against many Gram-negative rods [6]. Nevertheless, Gram-negative rods producing ESBLs frequently show cross-resistance with other groups of antimicrobials [7]. The most common mechanism of aminoglycoside resistance is enzymatic modification of antibiotic molecule [8]. After modification, the aminoglycoside is not able to bind to the aminoacyl site of 16S rrna within the bacterial 30S ribosomal subunits and inhibit protein synthesis [5,9]. Aminoglycoside-modifying enzymes (AME) have been assigned to three classes: aminoglycoside acetyltransferases (AAC), aminoglycoside phosphotransferases (APH), and aminoglycoside nucleotidyltransferases (ANT) [10]. A more specific classification includes the division into subclasses according to the regiospecificities for aminoglycoside modifications and spectrum of aminoglycoside resistance [11]. To the subclasses with clinical significance among Enterobacteriaceae rods belong following groups: AAC(3)-I, AAC(6 )-I, ANT(4 )-II, ANT(2 )-I, and APH(3 )-I. The subclass AAC(3)-I contributes to the resistance to gentamicin, sisomicin, and astromicin, while AAC(6 )-I shows activity against amikacin and gentamicin. Enzymes from ANT(4 )-II subclass confer resistance to amikacin, isepamicin, and tobramycin, and AME belonging to ANT(2 )-I mediate resistance to dibekacin, gentamicin, kanamycin, sisomicin, and tobramycin. The subclass of APH(3 )-I enzymes shows activity against streptomycin [8]. The other mechanisms, which also contributes in resistance to aminoglycosides, can coexist in one bacterial cell along with AME [12]. These mechanisms include methylation of 16S rrna [13], reduced outer membrane permeability [14], efflux pumps [15], and mutations of the ribosomal proteins or 16S rrna [13]. In this study we screened for various subclasses of AME among ESBL-positive P. mirabilis strains obtained from patients in University Clinical Hospital of Bialystok, Poland. MATERIAL AND METHODS From June 2013 to June 2014, a total of 228 nonduplicated P. mirabilis strains were collected from patients hospitalized in University Clinical Hospital in Bialystok, Poland. Isolates were initially identified on the basis of colony morphology on Columbia Agar and MacConkey Agar (both from Oxoid Thermo Fisher Scientific Inc, Waltham, USA). Species identification was confirmed using the Vitek 2 Automated System with GN ID cards (biomerieux, Marcy l Etoile, France). All isolates were susceptibility tested by Vitek 2 System with AST cards (biomerieux). Minimal inhibitory concentrations (MIC) of amikacin, gentamicin, and tobramycin were tested by E-tests (biomerieux). Interpretation of susceptibility testing results was according to the newest EUCAST criteria [16]. Strains with value of MIC for cefotaxime and ceftazidime higher than 1 mg/l were selected for phenotypic ESBL confirmation [17]. Double-disk synergy test (DDST) with disks containing amoxicillin/clavulanic acid (20/10 μg), ceftazidime (30 μg), and cefepime (30 μg) (all from Oxoid) was used as phenotypic test for ESBL detection [17]. ESBL-positive strains were then selected for molecular investigation towards AME genes. Plasmid material was extracted from overnight P. mirabilis cultures by Plasmid Mini Kit (A&A Biotechnology, Gdynia, Poland) according to the manufacturer s protocol. PCR assays were performed to detect following AME genes: aac(6 )-Ib, aac(3)-ia, ant(4 )-IIa, ant(2 )-Ia, and aph(3 )-Ib. Primers for amplification were selected from the literature (Table 1). All PCR surveys were performed in the LabCycler Gradient (SensoQuest GmbH, Goettingen, Germany) under following conditions: predenaturation step at 94 C for 5 min, 30 cycles of denaturation at 94 C for 45 s, annealing at 52 C for 45 s and elongation at 72 C for 1 min, and a final elongation step at 72 C for 10 min. The PCR products were separated by gel electrophoresis at 5 V/cm for 110 min on a 1.5% agarose gel (Sigma-Aldrich, St. Louis, USA) containing 0.5 μg/ml of ethidium bromide (MP Biomedicals, Santa Ana, USA) in 1xTBE buffer. The analyses were performed on Sub Cell GT apparatus (Bio-Rad, Hercules, USA). After electrophoresis amplicons were visualized under UV light and photographed using a ChemiDoc XR System (Bio-Rad, Hercules, USA). The sizes of the DNA fragments were calculated from their positions relative to the position of the molecular weight marker: Perfect bp DNA Ladder (EURx, Gdańsk, Poland). To identify the variants of resistance genes, sequencing was performed with primers listed in Table 1 using 3500 Genetic Analyzer (Applied Biosystems, Foster City, USA). The obtained sequences were compared with sequences stored in GenBank database using the nucleotide BLAST

18 science 18 algorithm. Descriptive statistics for epidemiological purposes was performed by StataSE 12 (StataCorp LP, USA). RESULTS Among the 228 isolates tested by DDST, 75 (32.89%) showed the production of ESBL. These strains were selected for further investigations. The genes encoding AME were detected in 66 P. mirabilis isolates, which represents 88.0% of ESBL-positive strains. A variety of AME genes was observed: ant(2 )-Ia in fifty-three, aph(3 )-Ib in fourteen, aac(6 )-Ib in nine strains, and aac(3)-ia in one strain. In nine strains the presence of more than one AME gene was revealed. Coexistence of ant(2 )-Ia and aph(3 )-Ib was detected in five strains, while the presence of aac(6 )-Ib and aph(3 )-Ib was revealed in two strains, and aac(6 )-Ib with ant(2 )-Ia and aph(3 )-Ib also in two strains. The presence of ant(4 )-IIa gene was not detected in any of tested isolates. Sixty-six products of PCR amplification were sequenced, and obtained sequences were compared with those stored in GenBank database. All sequences showed 100% similarity with sequences deposited under following accession numbers: NC_ for aac(3)-ia, NC_ for aac(6 )-Ib, M98270 for ant(4 )-IIa, X04555 for ant(2 )-Ia, and M28829 for aph(3 )-Ib. We analyzed resistance to eight antibiotics belonging to three groups: beta-lactams, aminoglycosides, and fluoroquinolones. All isolates showed microbiological resistance to ampicillin, amoxicillin with clavulanic acid, ceftazidime, and cefotaxime. Among aminoglycosides, MIC range of amikacin was from 4 to 256 μg/ml, gentamicin from 16 to 256 μg/ ml, and tobramycin from 24 to μg/ml. According to the EUCAST interpretation tables of MIC, all strains co-producing ESBL and AME were resistant to gentamicin and tobramycin, and 53.03% of isolates was resistant to amikacin. Moreover, all strains ESBL and AME-positive were resistant to ciprofloxacin. The only antimicrobial agent, which showed 100% activity against multi-drug resistant P. mirabilis was meropenem. The results of antimicrobial susceptibility testing combined with detected genes encoding AME are presented in Table 2. Strains harboring genes encoding AME showed differentiated values of MIC50 of amikacin. The highest value of MIC50 was detected among strains carrying combination of aac(6 )-Ib and aph(3 )-Ib, while the lowest value showed isolates with single aph(3 )-Ib gene. Strains without detected genes encoding AME were susceptible to all aminoglycosides used in this study. Strains were obtained from various clinical specimens and from numerous hospital wards. Most strains were isolated from Intensive Care Unit (32.0%), and Urology Unit (28.79%). The dominant specimen, from which strains were obtained, was urine (62.12%), followed by wound swabs (24.24%). Among patients infected by ESBL- and AME-pro- ducing P. mirabilis strains, 66.67% were males, and 33.33% were females. Patients mean age was with standard deviation 8.67 years. DISCUSSION The present study focused on detection of plasmidmediated AME among ESBL-positive P. mirabilis strains. In this research we observed a high rates of AME among isolates producing ESBL (88.0%). As well, Iranian survey conducted currently revealed a high frequency of AME among rods from family Enterobacteriaceae (71.0%) [21]. Data obtained from recent American assay showed that even 98.0% of K. pneumoniae resistant to carbapenems produces AME [22]. Acquisition of new resistance mechanisms by strains already resistant to particular antimicrobials creates serious concern, due to the propagation of multidrug-resistant isolates. In our survey, the most prevalent gene encoding AME was ant(2 )-Ia, present in 80.30% of AME-positive isolates. This a very interesting result, because AAC(6 )-Ib is considered as the most common variant of AME among Gram-negatives, as well as Gram-positives [8,22,23]. In our previous studies conducted on P. mirabilis, and P. aeruginosa isolates, the aac(6 ) -Ib gene was detected in 71.43%, and 58.3% of strains, respectively [24,19]. Although, the latest research conducted in our hospital revealed the presence of ant(2 )-Ia in 36.0% of strains, while the aac(6 )-Ib gene was detected in smaller amount in 28.0% of strains [18]. The resistance of clinical strains to aminoglycosides can vary with the genus of bacteria, geographic location, and many different factors. In the United States, where gentamicin is the most frequently used aminoglycoside, the gene encoding ANT(2 )-Ia was detected in 81.0% of all aminoglycoside-resistant Enterobacteriaceae rods [25]. Antimicrobial susceptibility testing indicated that carbapenems were the only drugs with full activity against all ESBL- and AME-positive strains. Other beta-lactams, like amoxicillin with clavulanic acid, cefotaxime, and ceftazidime, were inactivated by bacterial mechanisms of resistance. Also gentamicin and tobramycin showed lack of activity. Although, amikacin remained effective against 46.97% of isolates producing AME. Various level of resistance and different values of MIC50 of amikacin to AME-positive strains may be due to different levels of expression in particular isolates, and various AME substrate spectrum. In therapy of infections caused by strains producing ESBL, amikacin is usually the most active antimicrobial among aminoglycosides [26]. In the case of urinary tract sepsis caused by ESBL-positive strains susceptible to aminoglycosides, amikacin could be administered to avoid the excessive use of carbapenems [5]. Antimicrobial susceptibility testing revealed the significant share of AME in resistance to aminoglycosides among P. mirabilis strains. Results obtained in this study are consistent with the pre-

19 19 science vious statements that together with the increasing prevalence of ESBL-positive strains resistant to beta -lactams, the rate of isolates resistant to aminoglycosides is also growing [27]. Infections caused by multidrug-resistant rods are associated with increased mortality than diseases caused by susceptible strains [28]. Rational management of targeted antimicrobial therapy and appropriate methods of surveillance are essential for maintaining the antibiotics activity. CONCLUSIONS In conclusion, a high frequency of simultaneous occurrence of genes encoding ESBL and AME was observed in P. mirabilis isolates. This coexistence of various mechanisms of resistance among bacterial strains significantly reduces therapeutic options. There is an urgent need for larger, multicentric survey to assess the prevalence of AME in Poland. ACKNOWLEDGEMENTS This study was supported by internal funding sources from Medical University of Bialystok ( F). TAB. 1. SEQUENCES OF OLIGONUCLEOTIDE PRIMERS USED IN PCR ASSAYS FOR AMPLIFICATION OF GENES ENCODING AME Target Primer Oligenucleotide sequence aac(3)-ia aac(6 )-Ib ant(4 )-IIa ant(2 )-Ia a aph(3 )-Ib aac3-f aac3-r aaca4-f aaca4-r ant4pr-f ant4pr-r ant2bi-f ant2bi-r aph3bi-f aph3bi-r 5 GGCTCAAGTATGGGCATCAT 5 TCACCGTAATCTGCTTGCAC 5 GCTCTTGGAAGCGGGGACGG 5 TCGCTCGAATGCCTGGCGTG 5 ATCGTCTGCGAGAAGCGTAT 5 TAAAACGCCTATCCGTCACC 5 GACACAACGCAGGTCACATT 5 CGCAAGACCTCAACCTTTTC 5 CTTGGTGATAACGGCAATTCC 5 CCAATCGCAGATAGAAGGCAA Size (bp) Reference 389 [18] 300 [19] 839 [18] 500 [18] 548 [20] CITE THIS AS MEDtube Science Dec. 2014; 2(4), LIST OF THE TABLES Tab. 1. Sequences of oligonucleotide primers used in PCR assays for amplification of genes encoding AME Tab. 2. Distribution of antimicrobials MIC among P. mirabilis strains carrying combinations of genes encoding AME and without these ge nes TAB. 2. DISTRIBUTION OF ANTIMICROBIALS MIC AMONG P. MIRABILIS STRAINS CARRYING COMBINATIONS OF GENES ENCODING AME AND WITHOUT THESE GENES MIC (μg/ml) Genes for AME n AMK GEN TOB AMC CTX CTZ MEM CIP MIC50 %R MIC50 %R MIC50 %R MIC50 %R MIC50 %R MIC50 %R MIC50 %R MIC50 %R aac(3)-ia % % % % % % % % aac(3)-ia % % % % % % % % aac(3)-ia % % % % % % % % aac(3)-ia 1 8 0% % % % % % % % aac(3)-ia % % % % % % % % aac(3)-ia % % % % % % % % aac(3)-ia % % % % % % % % aac(3)-ia 9 2 0% 1 0% % % % % % %

20 science 20 BIBLIOGRAPHY 1. Jacobsen S, Stickler D, Mobley H, Shirtli M. Complicated catheter-associated urinary tract infections due to Escherichia coli and Proteus mirabilis. Clin Microbiol Rev 2008; 21: Armbruster CE, Mobley HLT. Merging mythology and morphology: the multifaceted lifestyle of Proteus mirabilis. Nat Rev Microbiol 2012; 10: Bistue AJCS, Birshan D, Tomaras AP, et al. Klebsiella pneumoniae multiresistance plasmid pmet1: similarity with the Yersinia pestis plasmid pcry and integrative conjugative elements. PLoS One 2008; 3:e Bradford PA. Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev 2001; 14: Delgado-Valverde M, Sojo-Dorado J, Pascual A, Rodríguez-Baño J. Clinical management of infections caused by multidrug-resistant Enterobacteriaceae. Ther Adv Infect Dis. 2013; 1 (2): Vakulenko SB, Mobashery S. Versatility of aminoglycosides and prospects for their future. Clin Microbiol Rev 2003; 16 (3): Luzzaro F, Perilli M, Amicosante G, et al. Properties of multidrug-resistant, ESBL-producing Proteus mirabilis isolates and possible role of beta-lactam/beta-lactamase inhibitor combinations. Int J Antimicrob Agents. 2001; 17 (2): Ramirez MS, Tolmasky ME Aminoglycoside Modifying Enzymes. Drug Resist Updat 2010; 13 (6): Magnet S, Blanchard JS. Molecular insights into aminoglycoside action and resistance. Chem Rev 2005; 105: Houghton JL, Green KD, Chen W, Garneau-Tsodikova S. The future of aminoglycosides: the end or renaissance? Chembiochem 2010; 11 (7): Doi Y, Arakawa Y. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clin Infect Dis 2007; 45 (1): Alekshun MN, Levy SB. Molecular mechanisms of antibacterial multidrug resistance. Cell 2007; 128: Galimand M, Sabtcheva S, Courvalin P, Lambert T. Worldwide disseminated arma aminoglycoside resistance methylase gene is borne by composite transposon Tn1548. Antimicrob Agents Chemother 2005; 49: Over U, Gur D, Unal S, Miller GH. The changing nature of aminoglycoside resistance mechanisms and prevalence of newly recognized resistance mechanisms in Turkey. Clin Microbiol Infect 2001; 7: Rosenberg EY, Ma D, Nikaido H. AcrD of Escherichia coli is an aminoglycoside efflux pump. J Bacteriol 2000; 182: Breakpoint tables for interpretation of MICs and zone diameters, version 4.0, valid from ( org/fileadmin/src/media/pdfs/eucast_files/breakpoint_tables/breakpoint_table_v_4.0.pdf; accessed 31st October 2014) 17. EUCAST guidelines for detection of resistance mechanisms and specific resistances of clinical and/or epidemiological importance. Version 1.0 December 2013 ( org/fileadmin/src/media/pdfs/eucast_files/resistance_mechanisms/eucast_detection_of_resistance_mechanisms_ v1.0_ pdf; accessed 31st October 2014) 18. Michalska AD, Sacha PT, Ojdana D, Wieczorek A, Tryniszewska E. Prevalence of resistance to aminoglycosides and fluoroquinolones among Pseudomonas aeruginosa strains in a University Hospital in Northeastern Poland. Brazilian Journal of Microbiology 45, 4, in press Sacha P, Jaworowska J, Ojdana D, Wieczorek P, Czaban S, Tryniszewska E. Occurrence of the aaca4 gene among multidrug resistant strains of Pseudomonas aeruginosa isolated from bronchial secretions obtained from the Intensive Therapy Unit at University Hospital in Bialystok, Poland. Folia Histochem Cytobiol 2012; 50: Madsen L, Aarestrup FM, Olsen JE. Characterization of streptomycin resistance determinants in Danish isolates of Salmonella Typhimurium. Vet Microbiol 2000; 75: Peerayeh SN, Rostami E, Siadat SD, Derakhshan S. High rate of aminoglycoside resistance in CTX-M-15 producing Klebsiella pneumoniae isolates in Tehran, Iran. Lab Med 2014; 45 (3): Almaghrabi R, Clancy CJ, Doi Y, et al. Carbapenem-resistant Klebsiella pneumoniae strains exhibit diversity in aminoglycoside-modifying enzymes, which exert differing effects on plazomicin and other agents. Antimicrob Agents Chemother. 2014; 58 (8): Wen JT, Zhou Y, Yang L, Xu Y. Multidrug-resistant genes of aminoglycoside-modifying enzymes and 16S rrna methylases in Acinetobacter baumannii strains. Genet Mol Res 2014; 16; 13 (2): Wieczorek P, Sacha P, Hauschild T, et al. The aac(6 )Ib gene in Proteus mirabilis strains resistant to aminoglycosides. Folia Histochem Cytobiol 2008; 46 (4): Miller GH, Sabatelli FJ, Hare RS, et al. The most frequent aminoglycoside resistance mechanisms changes with time and geographic area: a reflection of aminoglycoside usage patterns? Aminoglycoside Resistance Study Groups. Clin Infect Dis 1997; 24 (Suppl. 1): S46-S Pitout J, Le P, Church D, Gregson D, Laupland K. Antimicrobial susceptibility of well-characterised multiresistant CTX-M -producing Escherichia coli: failure of automated systems to detect resistance to piperacillin/tazobactam. Int J Antimicrob Agents 2008; 32: Brigante G, Migliavacca R, Bramati S, et al. Emergence and spread of a multidrug-resistant Acinetobacter baumannii clone producing both the carbapenemase OXA-23 and the 16S rrna methylase ArmA. J Med Microbiol 2012; 61: Rottier W, Ammerlaan H, Bonten, M. Effects of confounders and intermediates on the association of bacteraemia caused by extended-spectrum beta-lactamase-producing Enterobacteriaceae and patient outcome: a meta-analysis. J Antimicrob Chemother 2012; 67:

21 21 science Dyspnea is more prevalent in aging persons. It is more common, and often more severe in the last few weeks before death. Treatment of dyspnea in the elderly when social care gains the advantage Sayed S Syleem* Intensive Care Unit, Kafr Saad Central Hospital, Damietta Egypt #Corresponding author: Sayed S Syleem MSc,Intensive Care Unit, Kafr Saad Central Hospital, Damietta Egypt, sayedsileem@yahoo.com RUNNING TITLE KEYWORDS WORD COUNT CONFLICT OF INTERESTS Treatment of dyspnea in the elderly lonely, elder, psychosomatic, dyspnea, social care no conflicts of interest ABSTRACT Dyspnea is more prevalent in aging persons. It is more common, and often more severe in the last few weeks before death. Despite dyspnea being a highly prevalent symptom in older adults and increasesmore frequent with age regardless of the type of illness or community which patients live in, research indicates that dyspnea is inadequately assessed at the end of life. It can be noticed that a valuable considerable number of elder people come to ER with dyspnea but investigations reveal no relevant organic disease. Studying their social life might bring information which helps to understand the reasons. The aim of the study: To characterize patients suffering from dyspnea that need social care rather than medical care (with special attention to patients living alone) and to evaluate whether there is a relationship between dyspnea and lonelinessliving alone in elder people. Methods: Every patient 60 years that presented to ER or clinic with dyspnea and was seen by the author was included to the study. The whole group was divided according to age (from 60 to <70, from 70 to <80, 80 years old), gender, education level, and marital status. Data on frequency of attacks and living circumstances were also collected. To exclude organic causes of dyspnea, patients underwent clinical examination, laboratory investigations, and radiological examination. Patients were divided into subgroups according to mode of successful treatment: medical care including drugs and/or manoeuvres and social care. Results: First aim of the study was to characterize which patients suffering from dyspnea need social care rather than medical care. Social care is a successful way of treatment for patients who live alone, complain of dyspnea frequently, are older and are less educated. As for the diseases, patients with chronic heart disease or chronic diseases other than chest and heart are more likely to profit from social care. However, the most important aspect of the research is the relationship between living alone and dyspnea, especially its frequency and effective treatment. Patients living alone suffered from frequent attacks of dyspnea in 81,7% (364/445) compared to 33,6% (80/238) of patients living with someone. 90,3% (402/445) patients who lived alone were

22 science 22 successfully treated with social care and sedatives. Conclusions: Every patient aged more than 60 years who comes to ER with dyspnea with/without suffocation must undergo investigations to exclude organic causes of dyspnea. However, we should pay special attention to patients that will possibly benefit more from social care rather than medical care. INTRODUCTION Dyspnea is a multifactoral experience with multiple layers of meaning, including medical, social and psychological dimension1. It is more prevalent in aging persons and often more common and more severe in the last few weeks before death2, 3, 4. Despite dyspnea being a highly prevalent symptom in older adults and more frequent with age regardless of the type of illness or community in which they live5, research indicates dyspnea is inadequately assessed at the end of life6. Dyspnea in the elderly is often associated with organic diseases, most common of which are heart failure, chronic obstructive pulmonary disease and asthma7. Neverthless, it can also be the result of or correlate with psychological disorders like anxiety, depression or panic disorders8, 9, 10. While organic dyspnea can be treated with medical care successfully, social care seems to be optimal way of treatment when psychological disorders are present. The aim of the study is to characterize which patients suffering from dyspnea need social care rather than medical care with special attention to patients living alone and to evaluate a possible relationship between dyspnea and loneliness in elder people. MATERIAL AND METHODS 683 patients over 60 years of age, who presented with dyspnea at Kafr Saad Central Hospital between 1999 to 2010 were included in the study. Patients were divided into 3 groups: (1) from 60 to <70, (2) from 70 to <80, (3) 80 years old. Data on gender, educational status and marital status (married, widow, single divorced or never married) were collected. Data on possible chronic chest diseases (present or absent), chronic heart diseases (present or absent), and chronic diseases other than pulmonary and cardiac (present or absent) were collected. Information on frequency of seeking medical advice due to dyspnea (frequent >1 attack every 2 months, infrequent 1 attack every 2 months ) were collected. Information on social status werewas included into the analysis (lives alone, lives with others at night). All patients were divided into subgroups according to treatment options: medical care including drugs and/ or manoeuvres and social care including sedatives in severe cases. To exclude acute organic causes of dyspnea, all patients underwent clinical examination, laboratory investigations, and radiologic examination as follows: CBC to exclude anemia, pulse oximetry to determine the hemoglobin oxygen saturation, ABG to exclude altered ph, BNP to exclude heart failure, cardiac enzymes and ECG to exclude acute ischemia and myocardial infarction, chest-x-ray and pulmonary functions to exclude pulmonary disease. STATISTICAL ANALYSIS All information fulfilled master table in Microsoft Excel 2010 program and were transferred to SPSS-16.0 for Windows program to analyse the data. Descriptive statistical analysis crosstabs and Chi-square methods to detect the significance of the analysis results were used. The result is significant when its p-value is LIMITATIONS 1. Some patients may suffer from mixed dyspnea (caused by medical and psychological factors), so it cannot be assumed that dyspnea successfully treated by social care is only psychogenic. 2. Locality of the studied patients as they were from one governorate, were administered to one hospital and examined and treated only by the author of the article. 3. Majority of the study was conducted during the recent unrest/revolution, when emotional elements were dominant. RESULTS Group of 683 patients consisted of 308 females and 375 males. 445 patients lived alone and 238 lived with others. First aim of the study was to characterize which patients suffering from dyspnea need social care rather than medical care. Social care is a successful way of treatment for patients who live alone, complain of dyspnea frequently, are older and less educated. As for the diseases, patients with chronic heart disease or chronic diseases other than chest and heart are more likely to gain a profit from social care. Data are shown in Figure. 1. The second aim of the study was to evaluate is there a relation between dyspnea and loneliness in elder people. Patients living alone are significantly older. There was also a link between dyspnea (whether organic or psychogenic) and living alone. Patients living alone suffered from frequent attacks of dyspnea in 81,7% (364/445) compared to 33,6% (80/238) of patients living with someone. 90,3% (402/445) patients who lived alone were successfully treated with social care and sedatives. In the group of patients who lived with relatives only 6% (15/238) were successfully treated with sedatives and social care (p =0.0001). Cross

23 23 science relation between way of living (alone or with family) is shown in the table 1. CONCLUSION AND DISCUSSION Every patient aged more than 60 years presenting to ER with dyspnea should undergo investigations to exclude organic causes of dyspnea. Author suggests that following investigations should be performed at the beginning: ABG to exclude altered ph, BNP to exclude HF, pulse oximetry to determine the hemoglobin oxygen saturation, chest-x-ray and pulmonary functions to exclude pulmonary disease, CBC to exclude anemia, cardiac enzymes and ECG to exclude acute ischemia and myocardial infarction. However, we should pay special attention to patients that will be possibly better maintained with social care rather than medical care. Such patients were characterized above. However, there is one feature that particularly justifies the effectiveness of non-medical care, that is, living circumstances. There could be several reasons of this situation. Patients living alone may be afraid of death especially at night when others are far away and no one can save them. Therefore they seek attention through involuntary dyspnea, trying to keep their relatives around them or to achieve continuous medical care. Once they are admitted to ICU, they sleep deeply. Such fear is not only extremely stressful for the patient, but it can also contribute to sleeping problems, that not only lower the quality of life, but may also result in increased risk of falls and injuries, anxiety, depression, nervous problems and other conditions11, 12, 13, 14. If such a situation exists, the role of the social care is to provide a caregiver who stays wakeful all over the night and does not leave the patient alone especially at night and during sleeping time. The caregiver should also be chatty, provide regular medical reassurance and administer sedatives in severe cases. The last activity can be also effective even if patient does not need increased attention, but is not able to administer medications himself. Further studies are recommended to define the exact influence of social care on dyspnea treatment. LIST OF THE FIGURES FIG. 1. INFLUENCE OF TREATMENT OPTIONS IN DIFFE RENT GROUPS OF PATIENTS LIST OF THE TABLES TAB. 1. CROSS RELATIONS OF LIVING CIRCUMSTANCES WITH ALL OTHER ITEMS Target Primer Lives alone Not alone P value Education Gender Age Relieved by Frequency Chronic chest diseases Chronic heart diseases High educated 18% (83/445) 46,6% (111/238) Less educated 82% (362/445) 53,4% (127/238) Female Male 47,4% (211/445) 52,6% (234/445) 40,7% (97/238) 59,3% (141/238) 60s 21,5% (96/445) 54,2% (129/238) 70s 80 36,1% (161/445) 42,4% (188/445) 37,3% (89/238) 8,5% (20/238) Medical care 9,6% (43/445) 93,7% (223/238) Social care Frequent 90,4% (402/445) 81,7% (364/445) 6,3% (15/238) 33,6% (80/238) Infrequent 18,3% (81/445) 66,4% (158/238) Present 0,6% (3/445) 27,3% (65/238) Absent Present 99,4% (442/445) 89,4% (398/445) 72,7% (173/238) 61,7% (147/238) Absent 10,6% (47/445) 38,3% (64/238) CITE THIS AS MEDtube Science Dec. 2014; 2(4), Other chronic diseases Present 52,3% (233/445) 47,7% (212/445) 12,2% (29/238) 88,8% (209/238)

24 science 24 BIBLIOGRAPHY 1. Tanaka K, Akechi T, Okuyama T et al. Factors correlated with dyspnea in advanced lung cancer patients. J Pain Symptom Manage Jun;23(6): World Health Organization (WHO). Definition of Palliative Care Accessed 10/27/05 at 3. Berraho M, Nejjari C, El Rhazi K. Dyspnea: a strong independent factor for long-term mortality in the elderly. J Nutr Health Aging. 2013;17(10): Ahmed T, Steward JA, O Mahony MS. Dyspnoea and mortality in older people in the community: a 10-year follow-up. Age Ageing Jul;41(4): Bednash G. & Ferrell B. End-of-Life Nursing Education Consortium (ELNEC). Association of Colleges of Nursing. Washington DC, Sykes, N.P. (1997). A volunteer model for the comparison of laxatives in opioid-induces constipation. J Pain Symptom Manage.1996 Jun;11(6): Dickerson D, Benedetti C, Davis, M et al. Palliative Care Pocket Consultant. Kendall-Hunt Publishing Company Bruera E, Schmitz B, Pither J, et al. The frequency and correlates of dyspnea in patients with advanced cancer. J Pain Symptom Manage May;19(5): Dales RE, Spitzer WO, Schechter MT et al. The influence of psychological status on respiratory symptom reporting. Am Rev Respir Dis Jun;139(6): Kaufman KR, Endres JK, Kaufman ND. Psychogenic dyspnea and therapeutic chest radiograph. Death Stud Apr;31(4): Grundstrom AC, Guse CE, Layde PM. Risk factors for falls and fall-related injuries in adults 85 years of age and older. Arch Gerontol Geriatr May-Jun;54(3): Brassington GS, King AC, Bliwise DL. Sleep problems as a risk factor for falls in a sample of community-dwelling adults aged years. J Am Geriatr Soc Oct;48(10): Alvaro PK, Roberts RM, Harris JK. A systematic review assessing bidirectionality between sleep disturbances, anxiety, and depression. Sleep Jul 1;36(7): Jaussent I, Bouyer J, Ancelin ML, Insomnia and daytime sleepiness are risk factors for depressive symptoms in the elderly. Sleep Aug 1;34(8):

25 25 science The concept of hypertension is associated with various diseases. It provides one of the most important risk factors for coronary heart disease, stroke and peripheral vascular atherosclerosis. Eating behavior among patients with hypertension Dorota Nalepa 1 *, Marta Czekirda 2, Wojciech Załuska 3, Sylwia Lalik 1 1. Department of Neurology, The Regional Specialist Hospital in Lublin 2. Chair of Development in Nursing, Medical University of Lublin 3. Department of Nephrology, Medical University of Lublin #Corresponding author: Dorota Nalepa, nalepad1@wp.pl RUNNING TITLE KEYWORDS WORD COUNT CONFLICT OF INTERESTS Eating behavior among patients with hypertension hypertension, high blood pressure, eating habits behavior no conflicts of interest ABSTRACT Purpose of the study. The purpose of this research was to show the healthy and non-healthy dietary behaviors among patients with high blood pressure. Material and methods. The research was conducted in The Independent Public Clinical Hospital No. 4 on Jaczewskiego Street in Lublin, from December 2012 until February The interviewers completed one hundred questionnaires, all of which were classified for a statistical analysis. The study used an auditorium survey technique. Surveys were distributed personally among randomly selected people diagnosed with a hypertension. Results. Analyzing the research material collected from respondents of all ages group, it can be concluded that it is characterized by a very high rate of salt intake, white bread, salted and smoked fish, and moderate intake of meat. However, there are not enough vegetables, fruits, marine fish, dairy, and multigrain products in the diet of the respondents. Conclusions. The majority of surveyed patients with hypertension in all age groups tested (up to 40 yr.; from 41 to 60 yr.; over 60 yr.) exhibits moderate eating habits. Respondents to 40 years of age reveal the most negative eating behaviors, compared with an other age groups. However, in the respondents above 60 years of age the most positive eating behaviors were observed.

26 science 26 INTRODUCTION Hypertension is a cardiovascular disease. It is classified as a chronic diseases requiring long-term treatment [1]. The concept of hypertension is associated with various disease states and means a common symptom, which is elevated blood pressure. It provides one of the most important risk factors for coronary heart disease, stroke and peripheral vascular atherosclerosis. It also causes an increase in the frequency of incidence of ventricular arrhythmias and cardiac death. Currently, the WHO Expert Committee criteria are accepted and used: the upper limit of normal blood pressure is 139/89 mmhg [2]. In addition to pharmacological treatment, adequate nutrition plays an important role in the treatment of hypertension. Rational nutrition, adapted to the age, sex, and activity is not the main element of the pharmacological treatment of hypertension. Scientific research confirms that Mediterranean Diet and Diet DASH [3] are the most effective in prevention and treatment of hypertension, as well as improving the lipid profile. The Mediterranean Diet is an alternative to low-carbohydrate diets. It lowers blood pressure by affecting a significant reduction in body weight and improves blood lipid profile. Similarly, the DASH Diet lowers blood pressure and reduces total cholesterol and LDL-cholesterol [3]. The most common nutritional mistakes include: excessive consumption of fats, simple sugars and table salt, consuming more energy than the body needs, uneven distribution of meals during the day, drinking too much coffee and strong tea [4]. Purpose of the study. The purpose of this research was to show the healthy and non-healthy dietary behaviors among patients with high blood pressure. MATERIAL AND METHODS The research was conducted in The Independent Public Clinical Hospital No. 4 on Jaczewskiego Street in Lublin, from December 2012 until February Respondents completed a questionnaire survey in the presence of the interviewer (in this way they could get more information when in doubt). They were able to see the exact instructions provided in the questionnaire, as well as the object and purpose of the study and the method of includeing the answers. Interviewers responded to 100 questionnaires, all of which were accepted for statistical analysis. More than half of the respondents (55%) were over 60 years old. 36% of the respondents was from 41 to 60 years old, 9% of the surveyed group was under 40 years old. Age of the patients ranged between 24 to 90 years; average age age - 61 years. The group characterized by predominance of women, which accounted for just over half of the respondents (55%). Surveys were distributed personally among randomly selected people diagnosed with hypertension. The collected research material was analyzed using the statistical package STATISTICA for Windows 9.0. RESULTS In the analysis of eating behavior in the aspect quality of the most consumed products, 44% of respondents reported consumption of white bread at least once a day, the rarest answer was once a week (2%). Whole grain bread is eaten several times a day by 22% of respondents, only 7% of them consumed it a couple of times a month. These results indicate a very high intake of white bread and still too low wholemeal intake, in relation to current dietary recommendations. 25% of respondents consume low fat dairy several times a week, a little less 23% a few times a month, just 6% of respondents several times a day. In contrast, 28% of respondents do not include in the diet fat dairy products, and only 2% eats these kind of products several times a day. These results indicate a low intake of lean dairy, which is negative. 41% of the respondents eat cooked eggs several times a month, no one replied at least once a day and several times a day. 38% of the respondents eat egg yolks and fried eggs a few times a month, no one replied at least once a day and several times a day. From these results, it can be concluded, that among the surveyed patients, some continue to eat fried eggs, which is not recommended in hypertensive disease. Lean meats are eaten several times a week by 36% of respondents, while 2% do not include lean meat in the diet. 36% of respondents answered that they do not include fatty meat in the diet. The rarest response was several times a day (2%). These results indicate that the majority of respondents moderately eat meat, which is a positive eating habit. More than a half of the respondents, that is 54%, eats lean marine fish, freshwater fish and oily sea fish several times a month. None of the respondents eat fish at least once a day and several times a day. Similarly, respondents declared their consumption of salted, smoked, and canned fish. 51% consume these products several times a month, while none of the respondents eat fish at least once a day and several times a day. From those results we can see that fish is very rarely included in the diet of the respondents, which is a negative phenomenon, in relation to marine and freshwater fish, and positive when it comes to salted and preserved fish. Soft margarine, fresh butter and vegetable oils are consumed at least once a day by 43% of respondents, only 1% does not include this type of product in the diet. 35% of the respondents do not include saturated fat in the diet, and 4% eats saturated fat several times a day. These results relating to fat intake, both unsaturated and saturated, are preferred nutritional behavior. Boiled and roasted potatoes are consumed several times a week by 42% of respondents, while none of the respondents eats potatoes several times a day. Fried potatoes and chips are eaten by 39% of respondents a few times a month, the same number of people, that is 39%, answered that they do not include these products in the diet. The rarest answers were at least once a day (2%), and se-

27 27 science veral times a day (2%). Regarding the results of the consumption of boiled potatoes, they are beneficial to the health of the respondents, while the percentage of people consuming fried potatoes, should be much lower. Fresh vegetables are consumed by 40% of respondents several times a week, only 5% of the respondents eat vegetables several times a day. 52% of people consume canned and pickled legumes and vegetables a few times a month. None of the respondents consume these products several times a day. Most (28%) of respondents answered that they eat fresh fruits, fruit and low-sugar jams several times a month, and only 2% of people answered several times a day. The study group is characterized by very low consumption of fruit and vegetables. When it comes to eating canned legumes and vegetables, they are consumed in the standard. 44% of respondents do not include compotes and highly sweetened jams in the diet, while 2% consume these products several times a day. It is still a very low percentage. Most respondents (38%) answered they eat vegetable soups, broths, and milk soups several times a week, none of the respondents eat soup several times a day. 38% of respondents do include bouillon, fatty chicken soup, and instant soup in the diet. None of these people eat this type of food several times a week. These results show that the patients properly include soup in their diets. The majority of the respondents (41%) said they used vegetable sauces a few times a month, none of the respondents eat sauces several times a day. 42% of the respondents said they do not include fat sauces in the diet, none of the respondents eat fat sauces several times a day. These results can be considered as a proper eating behavior. Chocolate, chocolate bars and cocoa is consumed a few times a month by 41% of the respondents. Almost none of the respondents eat sweets several times a day (2%). More than a half (52%) of the respondents eats baked cakes, pastries with custard or whipped cream, and donuts several times a month. The rarest answers were at least once a day (3%) and several times a day (3%). Analyzing these results, we can conclude that the respondents do not eat sweets too often, which is a positive phenomenon. 27% of the respondents said they eat magnesium salt, potassium salt, spices, herbs, garlic, and lemon juice a couple of times a week, while only 7% of the respondents marked the answer several times a day. 37% of the respondents declared the consumption of salt, spices and savory sauces at least once a day and 6% once a week. These results confirm the extensive use of salt in the diet and still not sufficient use of recommended products, as magnesium salt, potassium or herbal spices. Detailed results on Figure 1. derate eating habits. However, there are many areas in which the results still unsatisfactory. There was a high intake of white bread - up to 83% of the respondents declared the daily intake, and only 41% of the respondents eat with whole grain bread daily. The rates of fruit and vegetable intake are also low - 27% of people eat vegetables, and 22% eat fruit daily. The situation is similar when it comes to lean freshwater fish and saltwater fish - only 5% of the respondents eat these products several times a week, and 36% once a week. Only 1/4 of the respondents consumed low-fat dairy products daily. It has been found that up to 74% people use too much salt in the diet. More than a half of the respondents declared eating fatty meat a few times a month or never. The vast majority (86%) of the respondents consume unsaturated fats with the recommended frequency, the majority (66%) use saturated fats in their diet a few times a month or never. 63% of the respondents rarely eats sweets - a few times a month or never. Similar results were obtained while evaluating the consciousness of the lifestyle change need among the inhabitants in Szczecin, both persons with and without hypertension. This study also demonstrated low intake of fish, brown bread and vegetables. However, it found a much higher consumption of fruit among respondents, both in patients with hypertension as well as in people without diabetes [5]. In a study of health behaviors among the residents of Warsaw, rare intake of fish and dairy products was also found, as well as frequent consumption of meat, saturated fats and sweets. Less than a half (49.6%) of the people eat fruit and vegetables several times a week [6]. CONCLUSIONS Most of the surveyed patients with hypertension in all age groups tested (up to 40 years of age, from 41 to 60 years of age; over 60 years) show moderately adequate eating habits. Respondents up to 40 years old have the most negative eating behaviors, as compared with other age groups. However, the respondents above 60 years old show the most positive eating behaviors. Analyzing all age groups studied, we can conclude that they are characterized by excessive salt, white bread, salted and smoked fish intake frequency, as well as a moderate intake of meat. The diet is poor in vegetable, fruit, marine fish, dairy products, and lean multi-grain products. In the vast majority of the respondents positive habits, such as frequent use of dietary unsaturated fat and low intake of sweets were found. CITE THIS AS MEDtube Science Dec. 2014; 2(4), DISCUSSION Adequate nutrition plays an important role in the treatment of hypertension. Our study found that the vast majority of respondents in all age groups shows mo-

28 science 28 LIST OF THE FIGURES FIG. 1. DISTRIBUTION OF ANSWERS ON FOOD CONSUMPTION DURING LAST MONTH BIBLIOGRAPHY 1. Sawicki P, Szczęch R, Krupa-Wojciechowska B, Jak radzić sobie z nadciśnieniem tętniczym?, Wydawnictwo Medyczne MAKmed, Gdańsk 2000, page Jarosz M, Nadciśnienie tętnicze..., dz. cyt., page Hajduk A, Kaszuba D, Opieka pielęgniarska nad osobami z chorobami układu krążenia, [w:] Pielęgniarstwo internistyczne. Podręcznik dla studiów medycznych, red. D. Talarska, D. Zozulińska-Ziółkiewicz, PZWL, Warszawa 2009, 2010, page Kozłowska-Wojciechowska M, Czynniki żywieniowe..., dz. cyt., page Drozd-Dąbrowska M, Walczak A, Szych Z, Świadomość potrzeby zmiany stylu życia wśród dorosłych szczecinian z nadciśnieniem tętniczym, Family Medicine & Primary Review 2006,t.8,nr3, page Misiuna M, Szcześniewska D, Zachowania zdrowotne mieszkańców Warszawy, Zdrowie Publiczne 2003, t. 113, nr 1/2, page 30.

29 29 science According to the World Health Organization reports, 8.2 million people died from cancer in Neoplasms the state of knowledge among high school students Potempa Magdalena 1 *, Jonczyk Paweł 1, Janerka Michał 1, Kucharzewski Marek 2 1. Student Research Circle at the Faculty of Descriptive and Topographic Anatomy, Medical University of Silesia, Department of Medicine and Dentistry in Zabrze 2. Faculty of Descriptive and Topographic Anatomy, Medical University of Silesia, Department of Medicine and Dentistry in Zabrze #Corresponding author: Potempa Magdalena, Faculty of Descriptive and Topographic Anatomy, Medical University of Silesia, Department of Medicine and Dentistry in Zabrze, ul. Jordana 19, Zabrze, magdalenapotempa@o2.pl RUNNING TITLE KEYWORDS WORD COUNT CONFLICT OF INTERESTS Neoplasms the state of knowledge among high school students neoplasm, high school students, survey, cancer risk factors, cancer screening methods no conflicts of interest ABSTRACT Background: Neoplasms are the second only to cardiovascular cause of mortality worldwide. This outlines neoplastic disease as a real social problem and an object of common interest. The aim of our research is to assess the state of knowledge about the neoplasms in high school students and their awareness of cancer risk. Material and Methods: Authors prepared a questionnaire with 33 single choice questions concerning basic terminology, statistics of neoplasms, cancer risk factors and screening methods. Respondents were 409 students of Silesian high schools, aged 17 to 19. Results: The results were summarized in four paragraphs as mentioned before (terminology, statistics, risk factors, screening). Obtained data were presented as the percentage value the absolute number of answers to the number of respondents in group: male, female, comprehensive, technical-vocational schools and total. Conclusion: High school students are familiar with elementary terms connected with neoplasms apart from cancer definition. There are some famous neoplasms like leukemia or cervical cancer, which are wrongly indicated as most common in Polish population. Our respondents are in general aware of cancer risk factors and screening methods. Educational programs undertaken among students between years of age become a good moment to gain the cancer knowledge and awareness of this disease.

30 science 30 INTRODUCTION According to the World Health Organization (WHO) reports, 8.2 million people died from cancer in 2012, which was 22% of all NCDs (Noncommunicable Diseases), the second only to cardiovascular cause of mortality [1]. In Poland in 2010 over 140,5 thousand people were diagnosed with malignant neoplasms and nearly 93 thousand died. [2] This outlines neoplastic disease as a real social problem, but an object of common interest as well. Numerous government health programs are being implemented to enhance the awareness of cancer risk factors and screening methods. Neoplasms are also a popular topic for the media, which have the role to educate people, especially young, about the early prevention. The main goal of our research is to measure the state of knowledge about the neoplastic diseases in nearly adult people, being now high school students. In this paper authors try to assess, whether educational programs relate their effects, either these effects are really sufficient or not. MATERIAL AND METHODS The questionnaire prepared by the authors consisted of 33 single choice questions, informally assigned to four main groups: basic terminology 12 questions statistics of neoplasms 6 questions cancer risk factors 6 questions screening methods 9 questions The survey was fully anonymous and the participation of students was voluntary. Our research group were 409 students of Silesian high schools, aged 17 to 19. According to the sex there were 116 men and 293 women, and dividing upon the type of school the students attended: 194 students from comprehensive schools and 215 from technical and vocational schools. Students were completing the questionnaire during their school lessons with teacher s consent and presence. Time they have spended on the test closed in 15 minutes. These conditions of carrying out a survey helped in receiving the real student s knowledge about the topic, without the use of other sources like Internet, family, etc. If it was possible, authors attended the classroom while the test was being completed. Directly after finishing the completion, questionnaires were gathered by authors to analyze. The results were summarized using two parameters: The absolute number of individual answers selected by students. The percentage is the ratio of the absolute number of each answer given and the total number of respondents in particular group (male, female, comprehensive school, technical-vocational schools, altogether) represented as a percent value. The second parameter will be used to present the results of the survey. RESULTS For clarity authors divided the results of the study between the four groups of questions, the same as mentioned above. Basic terminology The vast majority of students knows the terms of a neoplasm (88% answers correct), a tumor and malignancy (respectively 87 and 88%). In the question about benign neoplasm were in all 83% answers correct. In the question What is cancer? respondents provide mostly wrong answers. Altogether 71% of students claim, that cancer is the synonym for neoplasm (results for comprehensive and technical -vocational respectively 78% and 64%). The correct answer: cancer is only malignant neoplasm derived from the epithelial tissue which covers and cushions the organism was chosen by one quarter of students, wherein there were 30% of students of technical-vocational schools and 20% from comprehensive schools. 99% surveyed know, that the neoplastic disease can also occur in children. 88% comprehensive schools students and 75% technical-vocational schools students believe, that there is no distinctive symptom, which indicates the beginning of the neoplastic disease in the organism. 57% of students are familiar with the term of alarming symptoms they know, that Alarming symptoms are uncharacteristic symptoms which, if lasting for quite long time, in total could suggest neoplasia. However, 26% of respondents point wrong, that they are unique for neoplastic disease. 49% of men and only 37% of women (40% altogether) correctly list these symptoms. There is an opinion of 43% of total respondents, that alarming symptoms can not be specified, because they are individual for every patient. Only 61% of respondents (75% of comprehensive schools students and 55% from technical-vocational schools) are aware, that melanoma is a malignant neoplasm derived from the pigment cells melanocytes. 16% of respondents still claim, that it is a benign neoplasm. Statistics of neoplasms 71% of students know, that environmental factors are responsible for almost two thirds of the cases of cancer. The correct answer was more often chosen by men (76%) than by women (69%) and more often by comprehensive schools students than by technical-vocational schools students (respectively 75% and 67%). The half of respondents knows, that the neoplasms of the lung are the most common neoplasms in Polish population. This awareness is greater in men: 60% vs. 46% answers correct in women. 35% of total respondents (and 39% of women) mistakenly pointed the leukemia to be the most common neo-

31 31 science Knowledge about neoplasms is a multi-field area. It contains medical knowledge sensu stricto, starting from cell cycle disturbances (both in fetal and postnatal life), full carcinogenesis process and leading to appropriate treatment of cancer. The knowledge of these processes (as well as many others correlated with neoplastic disease) is necessary for doctors and people connected with healthcare. The other areas about cancer, e.g. exposure to significant exogeplasm in Poland. According to the respondents the main cause of cancer mortality in women is cervical cancer (62% answers given). The correct answer breast cancer was chosen by 34% of students. In the question of the most frequent cause of cancer mortality in men, a significant discrepancy is observed: the correct answer the lung cancer was chosen by 42% of respondents (59% of men and 36% of women). The second popular answer was prostate cancer 45% altogether (28% of men and 51% women). 65% of comprehensive schools students and 54% from technical-vocational schools know, that the reportability for screening tests to detect cervical cancer in Polish women amounts to slightly less than one third. In total 60 % of respondents pointed the correct answer. Cancer risk factors 76% of respondents are aware of multifactorial risk of the neoplastic disease, wherein 83% of women and only 56% of men gave the correct answer. The difference between the comprehensive and technical -vocational schools were respectively 86 and 74%. Less than half of respondents (49%) reports, that the cancer risk increases with age in some types of cancer (including 63% of comprehensive schools students and 41% form technical-vocational schools). 24% of respondents claim, that the determination of the cancer risk is impossible. 41% of students correctly points all of listed colon cancer risk factors (obesity, sedentary lifestyle, colon polyps and consumption of large quantities of red meat). This answer ( all correct ) was chosen by 51% of comprehensive schools students and only 31% of technical-vocational schools students. Among the distractors with one alone risk factor was consumption of large quantities of red meat, chosen merely by 6% of respondents. More than half of respondents (51%) know, that smoking 15 cigarettes a day cause 15-fold increase in lung cancer risk. Meanwhile 5% of students (9% of men and 6% of comprehensive schools students vs. 3% of women and 4% of technical-vocational schools students) claim, that is an acceptable daily amount, which is not harmful. At the same time the vast majority, 90% of respondents, indicated smoking as a factor of the greatest influence on lung cancer probability (93% in comprehensive schools, 87% in technical-vocational schools). 61% of respondents know, which risk factors promote the development of melanoma. However, quite much percentage of answers given (22% of women and 32% of students from technical and vocational schools) pointed to the exclusive effect of the frequent use of the solarium. Screening methods 61% of comprehensive schools students and only 41% of technical-vocational schools students properly explains the term of screening test (48% of total respondents). The name and the aim of cytological examination are familiar for 87% of respondents. They correctly associate them with the prevention of cervical cancer, indicate the age range and the interval between successive tests in accordance with the screening program of the National Health Fund (65% altogether). 12% of men claim, that this examination is used for the diagnostic of the lung cancers in advanced stages. 48% of total respondents know, and 52% do not know a person from their entourage, who benefited from the free cytological examination. Only 40% of men know such a person or persons. The mammography is indicated as an essential screening method for breast cancer by 86% of respondents, therein women 87% and men 82%. 46% of men and 42% of women know, that the aim of the mammary gland biopsy is confirming the neoplasm. In general this answer was chosen by 43% of respondents. Other answers, e.g. as the screening test for breast cancer and to diagnose inflammatory diseases were respectively 25% and 27%. 17% of students are aware, that the basic test for detecting the prostate cancer is the peripheral blood PSA concentration test. 37% of total indicate as such a test ultrasound examination of the prostate gland, whereas 35% pointed the urinalysis. 48% of respondents are familiar with the FOB (Fecal Occult Blood) examination as a basic laboratory test in recognition of the colon cancer development risk after the age of 55. This answer was chosen by 56% of comprehensive schools students and 40% form technical-vocational schools. The latter mistakenly indicate the abdominal ultrasound examination as recommended screening for the prevention of colorectal cancer more often than the comprehensive schools students (respectively 21% and 10%). The is less difference in the correct answer ( colonoscopy after the age of 50 every 5 years ; respectively 26% technical-vocational sc., 31% comprehensive sc.). The most of respondents claim, that screening colonoscopy should be performed every year or two. DISCUSSION

32 science 32 nous factors, awareness of screening methods and their meaning in early cancer detection these parts of neoplasms should be known to the vast part of society, in at least superficial grade. This knowledge lets people increase their awareness of cancer and help them understand that only early detection can mean successful treatment outcomes. In the literature there are not plenty of data about general cancer knowledge, its biology and basic cancer terminology. However, in Poland in March and April 2014 there was an extensive study conducted by the foundation Rosa within the campaign called Rakoobrona among high school and middle school students. The total number of students in the study was above The research had a form of a questionnaire concerned on the awareness and basic knowledge about cancer. Only preliminary results of this study are available, but they suggest to be already enough for the first conclusions. 52,2% of students claim that cancer is untreatable and 28,8% of them have opposite opinion. In the scale from 1 to 10 about cancer knowledge, student assess themselves on average as 4,9. In this study there was no question of medical cancer definition; the authors already enclosed a brief definition ( a malignant neoplasm ) in the parenthesis [3]. In our study this question appeared and only 20,1% and 30% (of comprehensive school student and technical-vocational ones respectively) gave the correct answer. Authors suggest that it is highly possible, that in mentioned study, authors deliberately omitted this question, expecting that majority would have answered incorrectly. Our study also indicates that only 9% of students think, that malignant neoplasm can not be cured. In Rakoobrona report 6 out of 10 students claim, that there are possibilities to avoid cancer and 4 out of 10 indicate that prevention is an effective way to overcome the cancer. 94% of students have an opinion that the early detection can affect the following cancer treatment [3]. Ray et. al. [4] have conducted the study about cancer knowledge among people living in West Bengal, India. The total number of respondents was 900. The aim of the study was to estimate associations between response variables, that is knowledge about cancer (symptoms, established risk factors, treatment and follow up regarding cancer disease) and predictor variables that is socio-personal and economic factors of the respondents (age, sex, level of education). A Knowledge Index was developed and used for measurement. General results from the study are that 98.33% of respondents have heard of cancer during their whole life. Only 35% of the respondents were aware of the 7-danger signals as defined by WHO. None of the respondents knew all 7-primary symptoms of cancer and the majority (about 88%) knew only one or two (mainly tumor lumps and ulcers). Authors of this paper claim that ignorance of this symptoms may be one of the major causes of delay in reporting by cancer patients. Our data also confirm this statement and moreover suggest that nearly 43% of respondents can not specify these symptoms and claim that these are individual. In Indian study 58,33% of respondents claim that cancer can be curable in early stages [4]. This is a similar result to the study among Polish students [3]. An interesting study was conducted in 2010 by Kvåle et al. [5]. They tried to obtain an insight into the following case: how nurses cancer knowledge and its influence on patients perceptions can affect the compliance and nursing care. The study took place in the oncology ward in Norway. Study had a from of an interview with the patients. Questions were open and interviewer tried to hold dialogues rather than receive simple answers. Twenty oncological patients aged 40 to 70 were interviewed; interviews were recorded. Findings from the study were mostly consistent. Nurses who had acquired the knowledge about cancer and its treatment, have good technical skills, make the patients feeling more safe and diminish suffering from the disease. Clinical nurses knowledge can also relieve side effects of the treatment and disease s symptoms. What is important, most of the patients were on palliative life-prolonging therapy, and therefore feeling safe and understood by the people taking care of them can be alleviating. Undoubtedly the majority of studies are due to cancer prevention and risk factors and the awareness of them among people. We agree with this attitude because studies explicitly show that earlier diagnosis means better results. Unfortunately, in general practice there are many various symptoms patient reports to the general practitioner, but among many non-serious diseases like infections, indigestion, diet mistakes, medical staff do not think of a in most cases. For some cancers, delayed presentation is due to incorrect physical examination [6]. It can correlate positively with a statement revealed in Rakoobrona report [3]. It had also cast the light on a very significant aspect of oncological patients. Namely, it shows that most of students stigmata oncological patients. They associate them with specific appearance, that is 46,9% of students think that patient suffering from cancer is cachectic, 30% claim that such a patient is bald and 24,5% that they reveal paleness [3]. In our opinion these results just confirm common society approach to cancer as a disease without efficient treatment and rescue. It means that society correlate cancer with some kind of sentence, as there is no more medical help for them. That is why prevalence and verification of awareness and knowledge about it is so important. Just because the topic of screening methods was our main interest during questionnaire preparation. However, looking at our answers concerning statistics of neoplasms, we have a conclusion that there

33 33 science are some medial and famous neoplasms like leukemia or cervical cancer, which were incorrectly pointed as the most common cancers and as a main cause of death in Polish population (35% and 62% respectively). According to Iwanowicz-Palus et al. study [7], media are the main source of knowledge about cervical cancer for 20-25,4% of women. In the study conducted by Baran et al. [8] for women in the age group between 18 and 33 internet was the main source of cervical cancer information. However looking at all age groups, a large number of women admitted to have been informed by gynecologist, midwife, women magazines etc. as well. On the other hand, Rakoobrona report shows that only about half of student (53,4 %) know what cervical cancer really is and just 10,4 % of them gave the right answer about its cause [3]. In authors opinion there are two sides to this coin. The first: it is good for media to speak out some cancer, even they are not the main cause of death, because they develop a needful awareness about each cancer. From the other side, there is just talk about the cancer, as a cancer, that is all. There is still little information about the cause and risk factors. We believe, that women should understand the aim of the cytological examination and the danger of cervical cancer, to participate in screening program. The study shows that only half of respondents know a person who underwent this examination. In our opinion, looking at the cervical cancer prevention it is too less, as it correlates positively with the Polish population frequency of attending to this examination, which is about 33%. Our data ensure that people are aware of this population frequency percent, as they underline that answer. Other study performed in Podkarpackie region among the women, reveals that 61,7% of them having good cancer prevention rules attended the cytology once a year, as well as the half of women with insufficient knowledge. The rest of that group indicated less frequent cytology undergoing or even none [8]. We did not ask the respondents a question about the goal of HPV (Human Papillomavirus) vaccination, but there are certain data showing it. Rakoobrona report reveals that 35% of students know which type of cancer the HPV vaccination can prevent [3]. An interesting Polish study was conducted by Gotlib et al. [9]. The research evaluated effectiveness of educational program about HPV knowledge level. Respondents were high school student in the number of 250. Questionnaire consisted of 14 choice test about HPV. Student were completing it before and after the educational program and then the results were compared. Unfortunately before the test results were unsatisfactory: only 68% of students indicated HPV as a main cause of cervical cancer. Only 53% students pointed an early sex initiation as a risk factor of HPV infection. After the education of the students a number of correct answers increased significantly. On the cited question the right answers increased to 98% and 96% respectively. To sum up, on 12 of 14 questions, of which the questionnaire consisted, indicated a statistically significant increase of the correct answers. One of the newest study from China [10] did similar questionnaire, but respondents were about 1700 women in reproductive age. Results were nearly the same as in previous study. Knowledge before the educational program and after were completely different. It increased from 12-28% before the program to 70-90% after it. Women asked about a will to vaccinate their children before the program, answered in 44% affirmatively. After receiving the education it has increased up to 81% (p<0,001). There are many other data suggesting poor basic society knowledge about the HPV and its increase after education. It is an elementary lore, which can really help particularly the young people [11-15]. The situation comparable in papers is with the breast cancer. There are many researches checking people s knowledge and awareness. Our study shows that mammography as a screening method is nearly known to the students (86% of respondents), but they are not familiar with the goal of the mammary gland biopsy. We suggested more important questions about mammography as the screening method; if women do not attend the mammography, biopsy would not concern them at all. The problem is: they often miss the mammography, which can result in the miss of the beginning of breast cancer development. Therefore certain studies of this field shall be quoted. Andsoy et al. [16] performed a study about Turkish nurses knowledge about breast, cervical and colorectal cancer. Total number of respondents was 226 nurses from the one of Turkish hospital. Mean age of a respondent was ,2% of nurses would like to achieve more information about cancer risk factors. They feel they are lack of it, opposite to the knowledge about a cancer which results present as quite good. An important point during breast cancer talk is the breast self-examination (BSE), so nurses were also asked about it. Result revealed that monthly BSE is done by 10,4% of nurses. More than a half (62,4%) do it whenever they remember, and even 19% do not practice BSE at all. Bad news is that 65% of nurses do not receive gynecological examination unless they have first signs of the disease. Erbil et al. [17] have performed a similar study in Turkey. Their respondents were nursing students and they obtained the results somewhat better than in the previous study. 83.1% of the respondents had a knowledge about breast cancer. BSE was practiced by 70.4% of nursing students and 21.8% of them

34 34 science performed BSE regularly. An anxiety of developing the breast cancer was stimulus for 85% of nursing students to practice BSE. Looking at these results, it should be taken into consideration, that these woman study and learn about it simultaneously, when the questionnaire was performed. Authors do not rule out bigger awareness of cancer both among these young women and lecturers and it probably contributed to have more classes about cancer than years ago. Another study showed BSE among female in Iran, which were not connected with health service. Total number of women taking part in the study was % of women claim they practice BSE and percentage of female, who do not performed BSE was 74.0%. The main reason given for not doing BSE was a lack of knowledge on how to do it (72.1%). Other answers were: forgetfulness (12.3%), fear of finding a mass (8.8%), not necessary (5.2%), and lack of time (2.5%) [18]. Question about BSE was also in the questionnaire performed in Polish Medical School in Otwock. It revealed, that 97% of tested women did not know this procedure. Among 67 respondents, 1 of them did BSE monthly. This period of time proves that it is not done by accident, but with awareness of the breast cancer prevention. After an educational program and a demonstration of how BSE should be done, nearly all women could properly do it. This study shows a substantial lack of BSE acquaintance and a visible evidence, how educational programs can improve it [19]. Our study does not engage in these topics, as our research group was different and both sexes were asked. It is to consider, whether there shall be an additional question for girls about their attendance on gynecological appointments; from the other side, questionnaire should consist of questions for both girls and boys. We suppose that in our study results correlated with BSE would be similar to those mentioned above. Polish study from 2008 conducted by Woźniak [20] presents a level of knowledge about breast cancer symptoms. It consisted of 100 women from a random-choice. According to their answers, main breast cancer symptoms were tumor (35%), nipple leakage (17%), changes in breast look (16%), bigger lymph glands (7%) and breast pain (4%). BSE is not practiced by 48% of respondents. Talking about cancer risk factor, is good to mention the percent of 24 of respondents from our study who claim that cancer risk designation is impossible. In our opinion this percentage is too high. On the other hand, 71% of students know that environmental factors can cause two of three cancer cases. With more respondents, our data would surely be more reliable and detailed in it. We believe, an important question was also the one connected with colon cancer risk factors. It is such a cancer, which is strongly associated with lifestyle and diet habits from the very beginning of one s life. Additionally positive family history and gastrointestinal polyps increase the risk. Our question listed most common factors affecting the development of colon cancer. The correct answer contained all factors mentioned (obesity, sedentary lifestyle, colon polyps and consumption of large quantities of red meat) it was underlined only by 41% of students. Moreover, among respondents who indicated one of the factors, we directed our attention to the only 6% of respondents who correlate eating large amounts of red meat with colon cancer. In our opinion, it is a clear proof of lack of knowledge in primary prevention of this cancer. Furthermore, it has straight significance in increasing incidence of colorectal cancer in Poland, where the consumption of red meat is very common. Overweight and obesity is also a rising problem among European population, and in Poland as well. Children become less and less active, and their eating habits worsen in time. Obesity is now called the 21st century epidemic [21]. This is correlated with numerous biochemical changes, where i.a. a ghrelin hormone (known as the hunger hormone ) is relevant [22]. Study of Can et al. [23] evaluated eating habits among 20-years old Turkish and revealed that their diet habits are not proper at all. Their consumption of vegetable in general diet has a ratio of 36.3%. The same is with fruits, eaten mostly as a raw and vegetables in fried form. Distribution of Knowledge of Cancer Prevention in this study oscillates between 83,9% the highest response ratio for avoidance of excessive amount of alcohol intake and 44% for avoidance from foods preserved by salt-curing, salt pickling or smoking. Study show that adolescents are aware of keeping diet in cancer prevention but their eating habits are unfortunately different than their knowledge in theory. The last but not least point we want to raise in our discussion are smoking habits among young people and their level of knowledge about how huge risk the smoking brings to lung cancer development. The lung cancer is a serious malignant neoplasm with poor prognosis, when diagnosed in advanced stage. It is unfortunately still discovered too late to be curable at all. It is the most common cancer in Polish population. Molecular base of it is very rich as more and more genes are involved in lung carcinogenesis process (at the level of controlling cell cycle, apoptosis, cell differentiation, signaling paths). Some of them can modify treatment and cause resistance to main cytostatic used in lung cancer therapy. Some mutations are characteristic for lung cancer and their detection determinate treatment, like EGFR mutations, particularly in exon 21 [24]. Smoking can additionally accelerate some of mutations and cause new ones. This process can be clinical silent or cause benign

35 science 35 symptoms, completely ignored by patient; after some time, diagnosing routine often shows cancer in high stage. That is why it is very important not to ignore chronic cough, hoarseness or lingering weakness. Sometimes hemoptysis appears only when tumor is completely formed and metastases are present. Looking at our results connected with lung cancer risk factor, we are pleased that vast majority of our respondents are aware of smoking as the main lung cancer risk factor. In Rakoobrona report 94,7% of student confirmed this statement [3]. Krukowska et al. [25] showed similar results about lung cancer knowledge among nursing students. In 2013 Rotter et al. [26] have investigated a study which aim was to evaluate the harmfulness of smoking among high school students. Total number of respondent was 288. The majority of them (95,1%) indicated smoking as a harmful both for passive and active smokers. Main consequences of smoking were according to the respondent the pulmonary diseases and cancer. The others answers were underlined in less cases (heart diseases, pregnancy complications, atherosclerosis, stroke). What is consoling, 83,2% of them try to avoid rooms filled with smoke. Our questionnaire contained also more detailed questions about tobacco. Respondents were asked how smoking fifteen cigarettes a day correlates with the lung cancer and here the more interesting view appears. 51% of people answered well (15-fold increase of lung cancer risk), directly proportional. But the attention shall be focused on the 5% of students giving the answer that 15 cigarettes a day is an acceptable daily amount, which is not harmful. Looking at our number of 409 respondents those 5% determine quite allot. This opinion is a great risk for young people, becoming addicted to tobacco in adolescence and smoking for numerous years as adults. The authors plan in this discussion was to show a problem of cancer, common knowledge about it, the awareness of screening tests and prevention methods. There are rich scientific achievements correlated with this theme. Authors hope to encourage the reader to delve in this problem, so important in the context of young people cancer awareness, as well as their health in general. CONCLUSIONS High school students are familiar with elementary issues about neoplasms, although it should be emphasized, that the word cancer is often misused. Sometimes the misusage occurs even in media like the Internet, television and magazines, which are becoming the main source of knowledge for adolescents. Consequently it can lead to further misinformation of young people in the topic of neoplastic disease. Our data show, that there are some famous neoplasms like leukemia or cervical cancer in Poland: they are being suspected of greater morbidity and mortality than other silent, but being a real problem in Polish population. On the other hand, thanks to media reports and famous neoplasms screening programs of the National Health Fund the awareness of those neoplasms gradually increases. Young people being more familiar to the topic of neoplasms do not fear talking about it, which is very important for social awareness of this health problem. Our respondents are in general aware of cancer risk factors, but the meaning of diet influence on the development of colon cancer requires intensive education. As the comprehensive school students did better in the questionnaire, we suggest that they are on average more aware of cancer risk factors than the students from technical and vocational schools. State of students knowledge generally does not depend on the sex. Students are familiar with basic screening methods for cervical, breast and colorectal cancer. What is intriguing, though increasing number of health programs in the case on the prostate cancer prevention, PSA antigen test is still little recondite. Young men should be educated to acquire good habits in order not to be ashamed to consult with a doctor and do not trivialize the early signs of cancer in adulthood. There were certain schools where various health educational programs (e.g. National Olympics Contest of Healthy Lifestyle Promotion of the Polish Red Cross, Transplantation Day, Melanoma Academy, Deceitful Viral Hepatitis workshops) are regularly conducted. Students results from these schools were in general more valid than the results of the students in whose schools such programs were not run. That emphasizes the meaning and need of health educational programs in school education. High school age, when students begin to take care of health affairs on their own, is in our opinion the best time to develop positive health habits for entire adulthood, so the education as the prevention must not be missed. In general, students treated the survey seriously: they were showing their interest of the research and wrote the test fairly (trying to complete the test on their own, without looking at the classmate s work), with constant level of concentration. Authors claim that further investigations should be carried out and what can be even more important subsequent educational programs of neoplasms prevention ought to be introduced in high schools. ACKNOWLEDGEMENTS The authors would like to thank the Headmasters of following high schools: Stanisław Staszic 2nd Comprehensive Secondary School in Tarnowskie Góry Jan Smoleń 1st Comprehensive Secondary School in Bytom

36 science 36 Fryderyk Chopin Comprehensive Music School of 1st and 2nd degree in Bytom 4th Technical Secondary School in Tarnowskie Góry School of Chemical-Medical and General in Tarnowskie Góry Stanisław Ligoń Vocational Secondary School in Piekary Śląskie With their acquiescence conducting a survey among students had been possible. CITE THIS AS MEDtube Science Dec. 2014; 2(4), BIBLIOGRAPHY Didkowska J, Wojciechowska U. Zachorowania i zgony na nowotwory złośliwe w Polsce. Krajowy Rejestr Nowotworów, Centrum Onkologii - Instytut im. Marii Skłodowskiej - Curie. Available on Access on Ray K, Mandal S. Knowledge about cancer in West Bengal - a pilot survey. Asian Pacific J Cancer Prev, 5: Kvåle K, Bondevik M. Patients perceptions of the importance of nurses knowledge about cancer and its treatment for quality nursing care. Oncology Nursing Forum. 2010; 37 (4): Macleod U, Mitchell ED, Burgess C, Macdonald S, Ramirez AJ. Risk factors for delayed presentation and referral of symptomatic cancer: evidence for common cancers. British Journal of Cancer (2009) 101, S92 S Iwanowicz-Palus G, Adamska-Kuźmicka I, Bień A, Stadnicka G. Wiedza i postawy kobiet wobec profilaktyki raka szyjki macicy. Pielęgniarstwo XXI w. 2010; 32/33: Baran W, Kornacka K, Szela S. Ocena wiedzy kobiet z Podkarpacia na temat profilaktyki raka szyjki macicy. Rzeszów 2013, 3, Gotlib J, Czupryńska E. Ocena wpływu programu edukacyjnego Wybierz Życie Pierwszy Krok na poziom wiedzy uczniów szkół ponadgimnazjalnych na temat wirusa HPV. Med Og Nauk Zdr. 2013; 19(2): Chang IJ, Huang R, He W et al. Effect of an educational intervention on HPV knowledge and vaccine attitudes among urban employed women and female undergraduate students in China: a cross-sectional study. BMC Public Health 2013, 13: Gottvall M, Tyden T, Hoglund A, et al. Knowledge of human papillomavirus among high school students can be increased by an educational intervention. Int J STD&AIDS 2010; 21: Lambert EC. College students knowledge of human papillomavirus and effectiveness of a brief educational intervention. J Am Board Fam. 2001; 14 (3): Dell DL, Chen H, Ahmad F, Stewart DE. Knowledge about human papillomavirus among adolescents. Obstet Gynecol. 2000;96 (5 Pt 1): Hofman R, Schiffers P, Richardus JH et al. Increasing girls knowledge about human papillomavirus vaccination with a pre-test and a national leaflet: a quasi-experimental study. BMC Public Health. 2013, 13: Baer H, Allen S, Braun L. Knowledge of Human Papillomavirus Infection Among Young Adult Men and Women: Implications for Health Education and Research. Journal of Community Health. 2000; 25 (1): Andsoy II, Asiye Gul A. Breast, Cervix and Colorectal Cancer Knowledge among Nurses in Turkey. Asian Pac J Cancer Prev. 2014; 15 (5), Erbil N, Bolukbas N. Health Beliefs and Breast Self-Examination among Female University Nursing Students in Turkey. Asian Pac J Cancer Prev. 2014;15 (16), [Akhtari-Zavare1 M, Ghanbari-Baghestan A, Latiff1 LA, Matinnia N, Hoseini M. Knowledge of Breast Cancer and Breast Self-Examination Practice among Iranian Women in Hamedan, Iran. Asian Pac J Cancer Prev. 2014;15 (16), Mazurkiewicz B, Ochocka-Stępień J, Dmoch-Gajzlerska E. Profilaktyka raka sutka wśród młodzieży na przykładzie medycznej szkoły policealnej. Prophylaxis of breast cancer among young women. Zdrowie i Dobrostan. 2004; 2: Woźniak I. Wiedza o schorzeniach nowotworowych narządów kobiecych. Problemy Pielęgniarstwa 2008; 16 (1, 2): Mikoś M, Mikoś M., Mikoś H, Obara-Moszyńska M, Niedziela M. Nadwaga i otyłość u dzieci i młodzieży. Now Lek. 2010; 79 (5): Jonczyk P, Potempa M, Janerka M, Kucharzewski M. Grelina hormon regulujący energetyczny metabolizm ustroju. Część 1. Synteza, wydzielanie, mechanizm działania, znaczenie kliniczne. Ghrelin hormone which regulates the energy metabolism of the body. Part 1. Synthesis, secretion, mechanism of action, clinical significance. Med metabol. 2014; 18 (3): Can HO, Ceber E, Sogukpinar N, Saydam BK, Otles S, Ozenturk G. Eating habits, knowledge about cancer prevention and the HPLP scale in Turkish adolescents. Asian Pac J Cancer Prev. 2008;9 (4): Potempa M, Jonczyk P, Zalewska-Ziob M. Molekularne podłoże raka płuca. Molecular base of lung cancer. Onkol Prakt Klin. 2014; 10 (4): Krukowska M, Olejniczak D. Ocena wiedzy studentów na temat czynników ryzyka i profilaktyki nowotworów płuc. Medycyna Rodzinna. Wyd. Borgis. 2013; 4: Rotter I, Kemicer-Chmielewska E, Przybylska A. et al. Wiedza na temat szkodliwości nikotynizmu wśród uczniów szkół ponadgimnazjalnych. Medycyna Środowiskowa - Environmental Medicine. 2013; 16 (1):

37 37 science It is estimated that in Poland hypertension diagnosed in 10% of men occurs due to the compulsive drinking of alcohol. Some studies suggest that a dose of 210 g of alcohol consumed regularly, weekly, increases the danger of hypertension by 20% among men and by up to 100% among women. The use of stimulants among patients with diagnosed hypertension Dorota Nalepa 1 *, Marta Czekirda 2, Wojciech Załuska 3, Sylwia Lalik 1 1. Department of Neurology, The Regional Specialist Hospital in Lublin 2. Chair of Development in Nursing, Medical University of Lublin 3. Department of Nephrology, Medical University of Lublin #Corresponding author: Dorota Nalepa, nalepad1@wp.pl RUNNING TITLE KEYWORDS WORD COUNT CONFLICT OF INTERESTS The use of stimulants among patients with diagnosed hypertension hypertension, high blood pressure, stimulants used no conflicts of interest ABSTRACT Purpose of the study: The main objective of the study was to show, if people with high blood pressure are using stimulants in their everyday lives. Material and methods: The research was carried out in The Independent Public Clinical Hospital No. 4 on Jaczewskiego Street in Lublin, from December 2012 until February people aged 24 to 90 were included in the study. The study was based on auditorium survey. In the group of studied patients, more than a half of the respondents (55%) were over 60 years old. 36% of the respondents were between 41 to 60 years old; 9% of the study group was under 40 years old. The Fagerström Nicotine Tolerance Questionnaire and Alcohol Use Disorders Identification Test (AUDIT) was used in the study. Results: Studies have shown that 67% do not smoke tobacco, while in the group of smokers, a moderate nicotine dependence prevails (40%). More than a half of the respondents consumed alcohol (54%), the vast majority of people in this group drinks occasionally (80%). 13% of respondents overuse alcohol, and 7% of the respondents are dependent on alcohol. Conclusions: Patients with hypertension should be educated on changing their lifestyle. To maintain the desired behavior of the patients, the educators should stress the benefits coming from the undertaken actions, work on patients high self-esteem, show them that there is a possibility of change, and encourage them to take action and to seek stimulation from the environment.

38 science 38 INTRODUCTION Hypertension is a cardiovascular disease. It is classified as a chronic disease requiring long-term treatment [1]. According to the guidelines of the Joint National Committee (JNC) VII in 2003, hypertension is defined as a systolic blood pressure greater than or equal to 140 mmhg and diastolic blood pressure greater than or equal to 90 mmhg in those not receiving antihypertensive [1]. Primary hypertension states for approx. 95% of all hypertension cases. The remaining 5% of patients suffer from secondary hypertension [2]. Research from Framingham showed that risk of coronary heart disease, including heart attacks and sudden deaths is twice as high in people with hypertension that in those with normal blood pressure [2]. Chronic alcohol abuse contributes to the development and of every tenth case of hypertension. Alcohol - the relationship between ethanol and hypertension includes: the length and the amount of drinking (exceeding the quantitative threshold of approx. 25g of ethanol increases the incidence of hypertension). Presser effects of drinking are higher in men, the elderly and overweight. It is estimated that in Poland hypertension diagnosed in 10% of men occurs due to the compulsive drinking of alcohol [3]. Some studies suggest that a dose of 210 g of alcohol consumed regularly, weekly, increases the danger of hypertension by 20% among men and by up to 100% among women [4]. The blood pressure increase caused by alcohol appears to involve, inter alia, stimulation of the sympathetic nervous system and the renin angiotensin aldosterone system; raise of the cortisol level in the blood serum; reduction of the degree of insulin sensitivity; sodium potassium transport disorder resulting in intracellular accumulation of sodium and calcium consequently, which together leads to increased peripheral resistance caused by a high voltage smooth muscle [5]. Nicotine also has an adverse effect on the body, especially in patients with hypertension. In smoker person with hypertension there is 3-5 times greater risk of dying from a heart attack or stroke than in non-smoker [6]. Smoking cigarettes increases the pressure for more than 30 minutes, stimulating the adrenergic system [2]. Smoking also causes: an increase in LDL-cholesterol, reduced HDL -cholesterol, increased blood clotting and damage to the vascular endothelium. Currently, it is believed that smoking leads to heart and vascular diseases, accelerating the development of atherosclerosis and resulting in impaired endothelial function. The main harmful substances in the cigarette smoke are nicotine, carbon monoxide, cadmium, and numerous oxidants. Smokers experience disorders of rheological properties of blood, caused by the increased concentration of fibrinogen, increased hematocrit and the severity of the ability of platelets to aggregate. It should be emphasized that antihypertensive treatment in hypertensive smokers is less effective [7]. MATERIAL AND METHODS The research was carried out in The Independent Public Clinical Hospital No. 4 on Jaczewskiego Street in Lublin, from December 2012 until February patients included in the study filled in questionnaires, all of which were accepted for statistical analysis. In the group of studied patients, more than a half of the respondents (55%) were over 60 years old. 36% of the respondents were between 41 to 60 years old; 9% of the study group was under 40 years old. The Tolerance of Fagerström Nicotine Questionnaire and The Alcohol Audit Interview was used in the study. Age of the patients ranged between 24 to 90 years; average age - 61 years. The group characterized by predominance of women, which accounted for just over half of the respondents (55%). The Fagerström Nicotine Tolerance Questionnaire and Alcohol Use Disorders Identification Test (AUDIT) was used in the study. Surveys were distributed personally among randomly selected people diagnosed with hypertension. The collected research material was analyzed using the statistical package STATISTICA for Windows 9.0. THE RESULTS OF THE ASSESSMENT OF THE USE OF STIMU- LANTS Smoking non-smokers constituted a majority the group, that is 67% (Tab. 1, Fig. 1). 30% of the smokers were strongly dependent on nicotine. Similarly, 30% were slightly dependent on nicotine, and 40% are moderately dependent. (Tab. 2, Fig. 2). Alcohol consumption - a little more than half (54%) of respondents consumed alcohol. 13% of the respondents abuse alcohol and 7% of respondents are dependent on alcohol. (Tab. 3a. and 3b., Fig. 4). DISCUSSION Smoking is an important risk factor for cardiovascular disease. Therefore, it is one of the elements of nonpharmacological therapy, including hypertension [8]. To eliminate tobacco consumption, behavioral methods and psychological therapies are applied, both in individual and group therapies. In case of difficulty in giving up the habit, consultation and treatment in specialist clinics is recommended. Nicotine replacement therapy (patches, sublingual tablets, lozenges, chewing gums, nasal sprays, inhalers containing nicotine) should be considered. Most respondents suffering from hypertension do not smoke cigarettes (67%). In the group of smokers, moderate nicotine addiction (40%) predominates. 30% of the smokers were strongly dependent on nicotine. Similarly, 30% were slightly dependent on nicotine, and 40% were moderately dependent Research conducted by the Foundation Health Promotion in 2009, showed that

39 39 science more than 1/3 of Poles (9 million people) smokes. Men accounted for more than 1/3 of the smokers, and women nearly a quarter [8]. The results of the surveys of inhabitants in Szczecin, showed a lower percentage of smokers among people suffering from hypertension (approx. 26%) than in those without this condition (ok.42%) [9]. Excessive alcohol consumption is an important factor in the development of hypertension. Its overuse can cause stroke, which is one of the most feared complications of hypertension [10]. Studies show that limiting alcohol consumption significantly reduces systolic and diastolic blood pressure. It is recommended to limit alcohol intake in patients with hypertension to g of ethanol per day for men, and g ethanol per day in women [11]. Reducing alcohol consumption on average to 76% is associated with a decrease in systolic blood pressure by 3.3 mmhg and diastolic blood pressure of 2.0 mmhg [12]. Among those surveyed, more than half consumed alcohol, mostly occasionally (80%). 13% of the respondents are abuse alcohol, and 7% of respondents are dependent on alcohol. According to a study conducted by CBOS in July 2010, more than 3/4 of adult Poles drink alcohol, 2/3 of which drink from time to time, and at the ninth Pole drink alcohol often. Almost all respondents declare drinking little alcohol (49%) or drinking in the standard amount (47%) [13]. Analyzing the alcohol drinking among patients with hypertension, similar results were presented in a study conducted among 50 patients of the Cardiology Clinic of Silesian Centre for Heart Diseases in Zabrze. Almost half (48%) of respondents declared that they do not drink alcohol or have reduced its consumption [14]. Lifestyle changes can be efficiently implemented through educational activities. These observations seem to argue the merits of carrying out relevant health education, both among patients with hypertension, and among young people. It seems necessary, therefore, to emphasize the importance of alcohol and smoking as factors plaing an important direct and indirect role in the development of cardiovascular disease. in the respondent group according to the Fagerström Test Fig. 3. Distribution of the alcohol consumption re sults in group surveyed by the AUDIT test FIG. 1. FIG. 2. FIG. 3. DISTRIBUTION THE RESULTS OF SMOKERS ACCOR DING TO THE FAGERSTRÖM TEST NON-SMOKING SMOKING DISTRIBUTION OF TOBACCO DEPENDENCE RE SULTS IN THE RESPONDENT GROUP ACCORDING TO THE FAGERSTRÖM TEST DISTRIBUTION OF THE AUDIT RESULTS CONCLUSIONS Analysis of the data allowed us to draw the following conclusions: The vast majority of respondents smoked tobacco, a little over half of the respondents consumed alcohol, mostly as an occasional drinking. Patients with hypertension should be educated on changing their lifestyle. To maintain the desired behavior of the patients, the educators should stress the benefits coming from the undertaken actions, work on patients high self-esteem, show them that there is a possibility of change, and encourage them to take action and to seek stimulation from the environment. LIST OF FIGURES Fig. 1. Distribution the results of smokers according to the Fagerström Test Fig. 2. Distribution of tobacco dependence results NON-DRINKING DRINKING

40 science 40 FIG. 4. DISTRIBUTION OF THE ALCOHOL CONSUMPTION RESULTS IN GROUP SURVEYED BY THE AUDIT TEST Question Points Amount (n) Percentage (%) , , , , , , , , , , , ,12121 LIST OF TABLES Tab. 1. Distribution of the results among smokers according to the Fagerström Test Tab. 2. Distribution of nicotine dependence results in the surveyed group according to the Fagerström Test Tab. 3. Distribution of the AUDIT results Tab. 3a.The distribution of alcohol consumption results in the surveyed group according to the AUDIT test (another question) Tab. 3b. The distribution of alcohol consumption results in the surveyed group according to the AUDIT test total , ,15152 Sum , , , ,03030 TAB. 3. DISTRIBUTION OF THE AUDIT RESULTS Answer Amount (n) Percentage (%) Non drinkers 46 46,00 TAB. 1. DISTRIBUTION OF THE RESULTS AMONG SMO- KERS ACCORDING TO THE FAGERSTRÖM TEST Drinkers 54 54,00 Answer Amount (n) Percentage (%) Non smokers 67 67,00 TAB. 3A. THE DISTRIBUTION OF ALCOHOL CONSUMPTION RESULTS IN THE SURVEYED GROUP ACCORDING TO THE AUDIT TEST (ANOTHER QUESTION) Smokers 33 33,00 Question Points Amount (n) Percentage (%) 0 2 3,70370 TAB. 2. DISTRIBUTION OF NICOTINE DEPENDENCE RESULTS IN THE SURVEYED GROUP ACCORDING TO THE FAGERSTRÖM TEST Question Points Amount (n) Percentage (%) , , , , , , , , , , , , , , , , , , , , , ,06061

41 41 science Question Points Amount (n) Percentage (%) , , , , , , , , , , , , , , , , , , , , ,70370 TAB. 3B. THE DISTRIBUTION OF ALCOHOL CONSUMPTION RESULTS IN THE SURVEYED GROUP ACCORDING TO THE AUDIT TEST TOTAL Question Points Amount (n) Percentage (%) CITE THIS AS MEDtube Science Dec. 2014; 2(4), BIBLIOGRAPHY 1. Przegaliński J, Nadciśnienie tętnicze, [w:] Zarys chorób wewnętrznych dla studentów pielęgniarstwa, red. Daniluk J, Jurkowska G, Wydawnictwo Czelej, Lublin 2005, page Kawecka-Jaszcz K, Kocemba J, Nadciśnienie tętnicze..., dz. cyt., page Fuchs F.D., Chambless L.E., Whelton P.K., Nieto F.J., Heiss G.: Alcohol Consumption and Incidence of Hypertension: The atherosclerosis risk in communities study. Hypertension, 2001, 37 (5), page Głuszek J.: Niefarmakologiczne leczenie pierwotnego nadciśnienia tętniczego uwagi praktyczne.: Family Med. Prim. Care Rev., 2005, 7 (3), page Halawa B, Mazurek W.: Zmiana stylu życia w zapobieganiu i leczeniu nadciśnienia tętniczego. Adv. Clin. Exp. Med. 2004, 13 (5A), page Respondek W, Czynniki prowadzące..., dz. cyt., page Głuszek J.: Niefarmakologiczne leczenie pierwotnego nadciśnienia tętniczego - uwagi praktyczne.: Family Med. Prim. Care Rev., 2005, 7 (3), page Grabska K, Bogdański P, Miejsce leczenia niefarmakologicznego, dz. cyt., page Drozd-Dąbrowska M, Walczak A, Szych Z, Świadomość potrzeby zmiany stylu, dz. cyt., page Kobus G, Jarocka I, Niefarmakologiczne metody..., dz. cyt., page Kosiński P, Dobrowolski P, Kapłon-Cieślicka A, Nadciśnienie tętnicze leczenie, Kardiologia na co Dzień 2008, t. 3, nr 1, page Kozłowska L, Terapia dietetyczna nadciśnienia tętniczego, Essentia Medica 2009, t. 49, nr 2, page Felisiak M, Postawy wobec alkoholu [na:] pl/spiskom.pol/2010/k_116_10.pdf. 14. Krymska B, Przygotowanie pacjentów z nadciśnieniem tętniczym, dz. cyt., page , , , , , ,55556 Total 6 2 3, , , , , , ,85185

42 science 42 INSTRUCTIONS FOR AUTHORS MEDtube Science is an open access journal of MEDtube community and is addressed to all medical professionals doctors, clinicians, scientists who are interested in achievements in basic and clinical medical science. The journal has the international scope. It is published quarterly and exclusively in English. Original articles, reviews, case reports, rapid communications, special articles and letters to the Editor in both basic and clinical medical research are accepted for publication with special respect to manuscripts enriched with multimedia such as video or pictures. REVIEW PROCESS The Editorial Board considers only papers with substantial influence and a new insight in presented research. All authors of manuscript must agree for the publication and the signature of first or corresponding author on the letter to editor is considered that this condition has been fulfilled. Manuscript is first examined by editor-in-chief or Editor and the assigned to three independent reviewers. Manuscripts that are not accepted for reviewing process will be sent back to authors without scientific as well as papers, which are incomplete or not prepared according to instruction for authors within 10 working days. All manuscripts must be prepared in English, and are subject to a rigorous and fair peer-review process. All authors are encouraged to suggest the names of possible reviewers (with addresses), but we reserve the right of final selection. The evaluation process takes up to 3 months. Submitted papers are accepted for publication after a positive opinion of at least two independent reviewers. CONFLICT OF INTERESTS MEDtube Science policy requires that the corresponding or lead author of all manuscripts (on behalf of all authors in the paper should disclose any A) financial interests or arrangements with a company whose product was used in a study or is referred to in a manuscript, B) any financial interests of arrangement with a competing company, C) any direct payment to an any author from any source for the purpose of writing of the assigned manuscript, D) any other financial connections or other situations that might raise the question of bias in the work reported or the conclusions or opinions stated. All those information during peer-review will be kept in confidence but if paper is accepted for publication, all those information must be published in a note following the text of a manuscript. If the manuscript is published, such information must be communicated in a note following the text, before the references. PUBLICATION ETHIC STATEMENT Any infringements of ethical codes, such as plagiarism, unauthorized use of data will be taken very seriously by our editors. The submitted paper should not have been previously published in any form in other journal and must not be currently under consideration for publication elsewhere. COPYRIGHT. COPYRIGHT TRANSFER Upon acceptance, authors transfer copyright to the MEDtube Science. Once an article is accepted for publication in MEDtube Science, the information there is prohibited from reporting by the media until the mail date of the issue in which the article appears. Upon acceptance all published manuscripts become the permanent property of MEDtube Co. Ltd., the Publisher of MEDtube Science, and may not be published elsewhere without written permission from the Publishing Company. Open Access policy of Publisher permits unrestricted use, distribution and reproduction in any medium, provided that the original work is properly cited. DISCLAIMER Publisher and the Editorial Board accept no liability whatsoever for the consequences of any inaccurate of misleading data, opinion or statement placed in articles. Every effort is made to ensure that all data and techniques are presented accurately. Nevertheless, readers are advised that methods and techniques described in MTScience, should only be followed in conjunction with the treatments states-of-the-art in the readers own country. PUBLISHING MODEL AND AUTHORS FEES The submission and peer-review of manuscripts are free of charge. Accepted manuscripts at that moment are also free of charge. CATEGORIES OF ARTICLES Accepted papers are published in the following journal sections: Original article Case Reports Medical Technology presentation of research or review works in areas of medicine and technology such us: medical imaging, diagnostics, computer simulation of health and disease processes, new medical devices etc. Letters to Editor for comments on a recent MTScience articles. Reviews and special reports Meta-analyses PREPARATION OF MANUSCRIPT Guidelines for submission to MEDtube Science are in accordance with: Uniform Requirements for Manuscripts Submitted to Biomedical Journals (N Eng J Med, 1997; 336: ). Text should be one and half spaced with 12-point typeface. Margins: 2.5 cm (1 inch) at top, bottom, right, and left. Authors are encouraged to add ilustrations/ pictures and films to manuscript which could show technical aspects of presented work. Format of films should be: avi or similar and pictures jpg or similar The Editorial Board reserves the privilege to adjust the format of the article. The manuscript should include: Title page with the following information: manuscript full title full names of all authors name of the department and institution in which the work was done affiliations of the authors running titl full name, address, telephone and/or fax number of the author responsible for manuscript preparation key words (3 to 6) address to contact with corresponding author source(s) of support in the form of grants (quote the number of the grant) equipment, drugs etc. Abstract page. Abstract should not exceed 250 words should consist of four paragraphs labeled: Background, Material and Methods, Results, Conclusion. Text. The text of the article should be divided to seven paragraphs labeled: Background, Material and Methods, Results, Discussion, Conclusions, Acknowledgements, References. Background should contain scientific rationale and should briefly

43 43 science describe the aim of the study Material and methods should describe clearly the selection of observational or experimental subjects. Videos, in that section, are very much welcomed. The protocol of procedures, methods of measurements, investigated parameters should be described in detail to allow to reproduce the results. Name and references to the established methods should be given. Methods should be described in detail. The statistical methods should be described in detail to enable verification of the reported results. Information on approval of a Local Ethical Committee should also be enclosed. Results should reasonably present the findings. Videos are very much welcomed. Restrict tables and figures to the number necessary to explain the paper and assess its support. Do not duplicate data in graphs and tables. Discussion should focus on important aspects of the study. Do not duplicate data or other material from other sections (the Background or the Results). Include implications for future research. The discussion should be collated with the results of other investigations especially those quoted in the text. Conclusions should raised from the results of the study. Statements and conclusions, which are not completely supported, should be avoided. Acknowledgements. List all contributors who do not meet the criteria for authorship. Financial and other material support should be disclosed and acknowledged. References must be numbered as they are cited. The style of references is that of Index Medicus. List all authors when there are six or below that number; when there are seven or more, list the first three, then et al. The following is a sample reference: Mangram AJ, Horan TC, Pearson ML, Silver LC, Jarvis WR. Guideline for prevention of surgical site infection. Infect Control Hosp Epidemiol 1999; 20 (4): Avoid using abstracts as references. Tables. Type or print out each table on a separate sheet of paper. Do not submit tables as photographs. Number tables in the order of their first citation in the text, and add a title for each. Figures should be professionally drawn and photographed; freehand or typewritten lettering is unacceptable. Figures should be numbered according to the order in which they have been first cited in the text. Photographs should be color or black & white. Photographs should be numbered according to the order in which they have been first cited in the text. Videos should be in format avi and should be numbered according to the order in which they have been first cited in the text. Abbreviations and Symbols. Try to use only standard abbreviations. All should be explained when first used in text unless it is standard and commonly used. SENDING THE MANUSCRIPT TO THE JOURNAL All manuscripts should be sent by our on line protocol. Only logged user can send manuscript. Details:

44

45