Zapytanie ofertowe. dotyczące zamówienia w ramach projektu: Utworzenie bazy danych immunogenetycznych polskiej populacji MultiGenBank

Wielkość: px
Rozpocząć pokaz od strony:

Download "Zapytanie ofertowe. dotyczące zamówienia w ramach projektu: Utworzenie bazy danych immunogenetycznych polskiej populacji MultiGenBank"


1 Wrocław, dnia r. Zapytanie ofertowe dotyczące zamówienia w ramach projektu: Utworzenie bazy danych immunogenetycznych polskiej populacji MultiGenBank Projekt jest realizowany w ramach Priorytetu 2. Infrastruktura sfery B+R, Działanie 2.3 Inwestycje związane z rozwojem infrastruktury informatycznej nauki, Poddziałanie Projekty w zakresie rozwoju zasobów informacyjnych nauki w postaci cyfrowej współfinansowanego ze środków Unii Europejskiej w ramach Programu Operacyjnego Innowacyjna Gospodarka na lata Zamawiający (Beneficjent): Nazwa: Instytut Immunologii i Terapii Doświadczalnej im. Ludwika Hirszfelda Polskiej Akademii Nauk we Wrocławiu Adres: ul. R. Weigla 12, Wrocław NIP: , Regon: Opis przedmiotu oraz zakres zamówienia: Przedmiotem zamówienia jest opracowanie projektu funkcjonalnego platformy MultiGenBank systemu informatycznego służącego do gromadzenia, przetwarzania i udostępniania danych o polimorfizmach genetycznych, immunogenetycznych oraz mikrobiologicznych, którego użytkownikami będą przedstawiciele przemysłu (głównie farmaceutycznego oraz biotechnologicznego), nauki (ośrodki badawcze, jednostki medyczne) oraz edukacji (wyższe uczelnie) zlokalizowanych na terenie całej Unii Europejskiej i poza jej granicami. Platforma ta ma być zasilana danymi o ustandaryzowanej strukturze i formacie, pochodzącymi z systemów obsługujących stanowiska badawcze w laboratoriach Zamawiającego oraz z innych, zewnętrznych źródeł (głównie będą to wyniki analiz przeprowadzonych za pomocą specjalizowanego, własnościowego lub otwartego oprogramowania). Opracowany projekt ma być podstawą do późniejszej implementacji i wdrożenia platformy MultiGenBank. Dlatego podczas realizacji zamówienia należy postępować zgodnie z wymogami inżynierii oprogramowania, zaś powstająca dokumentacja powinna ujmować wszystkie aspekty funkcjonowania platformy (oferowane funkcje, realizowane procesy, zasady przetwarzania danych, udostępniane i wykorzystywane interfejsy, makiety interfejsu użytkownika, zasady współpracy z innymi systemami, analiza przypadków użycia, architektura logiczna itp.) w stopniu pozwalającym na rozpoczęcie prac implementacyjnych. W razie powstania trudności w interpretacji zapisów projektu funkcjonalnego na etapie implementacji, wykonawca projektu zobowiązany będzie do ich wyjaśnienia na drodze konsultacji.

2 Realizacja zamówienia ma odbywać się we współpracy z ekspertami dziedzinowymi delegowanymi przez Zamawiającego w jego siedzibie. Postęp prac będzie monitorowany przez Zamawiającego w ustalonych terminach (przynajmniej raz na tydzień). Na potrzeby realizacji zamówienia Zamawiający udostępni potrzebne materiały z zachowaniem poufności. Specyfikacja szczegółów zamówienia znajduje się w załącznikach: nr 1 (Założenia ogólne), nr 2 (Moduł immunogenetyczny), nr 3 (Moduł mikrobiologiczny). 3. Rodzaj i opis kryteriów, którymi Zamawiający będzie się kierował przy wyborze oferty, wraz z podaniem znaczenia tych kryteriów i sposobu oceny ofert oraz opis sposobu obliczenia ceny. Przy wyborze oferty Zamawiający będzie się kierował następującymi kryteriami: 1. kryterium: cena do zdobycia max: 80 pkt. 2. kryterium: doświadczenie firmy mierzone liczbą zrealizowanych projektów baz danych dla przemysłu i nauki do zdobycia max: 20 pkt. Wg powyższych kryteriów Zamawiający oceni otrzymane oferty posługując się poniższym wzorem: P OB = C min / C OB x 80 pkt + D OB / D max x 20 pkt. gdzie: P OB liczba punktów przyznanych Wykonawcy, którego oferta jest badana, C min najniższa zaoferowana cena, C OB cena zaoferowana w ofercie badanej, D max największa liczba zrealizowanych projektów baz danych przez oferentów, D OB liczba zrealizowanych projektów przez oferenta w ofercie badanej. Zaokrągleń liczb niecałkowitych punktów przyznanych Wykonawcy dokonuje się zgodnie z regułami matematycznymi. Jako ofertę przyjęta do realizacji uznaję się tę, która uzyskała największą liczbę punktów. W przypadku uzyskania równej maksymalnej liczby punktów jako ofertę do realizacji wybiera się tę, która charakteryzuje się najniższą ceną. Oferta powinna zawierać cenę, którą należy podać w PLN. Oferowana cena powinna zawierać wszystkie koszty związane z realizacją zamówienia. 4. Termin realizacji zamówienia: do r. 5. Miejsce, sposób i termin składania ofert: Oferta może być przekazana pocztą elektroniczną na adres: Oferty można złożyć osobiście w zamkniętej kopercie w siedzibie Zamawiającego lub wysłać pocztą (liczy się data wpływu oferty).

3 Adres: Instytut Immunologii i Terapii Doświadczalnej im. Ludwika Hirszfelda Polskiej Akademii Nauk we Wrocławiu, ul. R. Weigla 12, Wrocław w terminie do dnia: r. do godz. 12:00 Oferty, które wpłyną do siedziby po wyznaczonym terminie składania ofert będą odsyłane bez otwierania. 6. Opis warunków udziału w postępowaniu: 1. Oferta musi być sporządzona w j. polskim. 2. O zamówienie może ubiegać się wykonawca, który wykaże swoje doświadczenie posługując się referencjami potwierdzającymi liczbę zrealizowanych projektów bazodanowych dla przemysłu i nauki. 3. W toku dokonywania oceny złożonych ofert Zamawiający może żądać udzielenia przez Wykonawcę wyjaśnień dotyczących treści złożonej oferty. 7. Rozstrzygniecie postępowania 1. Postępowanie ofertowe zostanie rozstrzygnięte najpóźniej w dniu r. 2. Zamawiający zastrzega sobie prawo do unieważnienia niniejszego postępowania bez podania przyczyny. 8. Sposób udzielania informacji i wyjaśnień: Szczegółowych informacji na temat przedmiotu zamówienia udziela koordynator projektu: Dariusz Wójcik,

4 Załącznik nr 1. Założenia ogólne Głównym celem opracowania projektu funkcjonalnego jest stworzenie kompletnej dokumentacji ujmującej wszystkie aspekty funkcjonowania platformy MultiGenBank. Dokumentacja ta ma być opracowana zgodnie z dobrymi praktykami inżynierii oprogramowania w stopniu pozwalającym na podjęcie prac implementacyjnych i wdrożeniowych. Na każdym etapie prowadzonych prac (specyfikacji modelu konceptualnego, logicznego i fizycznego) kluczowe decyzje projektowe powinny być wypracowywane przez zespoły z udziałem przedstawicieli Zamawiającego. Sama platforma ma pełnić rolę narzędzia programowego pozwalającego na gromadzenie, przetwarzanie oraz udostępnianie danych o polimorfizmach genetycznych, immunogenetycznych oraz mikrobiologicznych użytkownikom wewnętrznym i zewnętrznym za pośrednictwem przeglądarki internetowej. Ponadto powinna udostępniać API (ang. Application Programming Interface) czyli interfejs programistyczny aplikacji, pozwalający na komunikację z innymi systemami informatycznymi oraz rozszerzanie funkcji platformy (zakłada się, iż platformę będzie można rozbudowywać nawet po zakończeniu realizacji projektu, np. przez dokładanie kolejnych modułów i ich udostępnianie w oparciu o rozbudowywalne menu). Platforma ma obsługiwać użytkowników związanych merytorycznie z dwoma dziedzinami nauki: immunogenetyką oraz mikrobiologią. Dlatego w projekcie funkcjonalnym należy wyróżnić dwa specjalizowane obszary: moduł immunogenetyczny oraz moduł mikrobiologiczny. Poza wykorzystaniem tych samych komponentów i mechanizmów platformy (np. z mechanizmów uwierzytelniania i autoryzacji) w założeniach co do implementacji tych modułów należy uwzględnić specyficzność zdefiniowanych w nich funkcji oraz niezależność i autonomiczność objętych nimi obszarów. Założenia co do zakresu funkcji modułu immunogenetycznego oraz mikrobiologicznego opisano, odpowiednio, w załączniku 2 i załączniku 3. Punktem dostępowym do funkcji platformy powinien być dwujęzyczny (j. polski i j.angielski) portal internetowy. Portal ten powinien posiadać elementy o dającej się zarządzać treści (część informacyjna) oraz elementy odpowiedzialne za realizację funkcji modułu immunogenetycznego oraz modułu mikrobiologicznego (część specjalistyczna). Zarządzanie treścią powinno być zrealizowane na zasadach, na jakich działają systemy CMS (ang. Content Management System) pozwalające na pracę w trybie edycji i przeglądania, wykorzystanie szablonów itp. Publikowanie informacji specjalistycznych powinno bazować na mechanizmach pozwalających na dynamiczne generowanie zawartości stron internetowych w oparciu o szablony i zawartość baz danych (na etapie implementacji pożądane będzie uwzględnienie możliwości przetwarzanie skryptów po stronie klienta i po stronie serwera). W architekturze logicznej platformy MultiGenBank powinny zostać zidentyfikowane komponenty zapewniające bezpieczną, niezawodną i efektywne realizację określonych funkcji. W zarysie do zestawu tych komponentów można zaliczyć: moduł bazy danych (centralna część platformy)

5 moduł administracyjny o moduł zarządzania użytkownikami (odpowiedzialny za rejestrację użytkowników, edycję profili, zarządzanie uprawnieniami itp.) o moduł zarządzania treścią (odpowiedzialny za konfigurację portalu i wygląd poszczególnych stron) o moduł konserwacji i utrzymania (odpowiedzialny za archiwizację i jej harmonogramowanie, obsługę eksportu i importu danych itp.) o moduł monitorowania oraz generowania raportów (odpowiedzialny za rejestrowanie zmian w systemie oraz przygotowywanie zestawień) moduł zarządzania danymi (współpracujący z modułem przepływów pracy) o moduł obsługi danych (odpowiedzialny za wprowadzanie danych, zarządzanie danymi oraz publikowanie danych przez użytkowników z zachowaniem uprawnień), o moduł udostępniania danych (odpowiedzialny za przygotowywanie zestawień danych do przeglądania przez użytkowników w trybie offline) o moduł integracji i konwersji danych (odpowiedzialny za zapewnienie interoperacyjność z oprogramowaniem analitycznym oraz zewnętrznymi źródłami danych: usługami sieciowymi, urządzeniami itp.) o moduł bibliograficzny (odpowiedzialny za wiązanie wykazów literatury do danych oraz rejestrowanie innych zależności) moduł przepływów pracy (odpowiedzialny za monitorowanie realizacji sekwencji działań wynikających z łańcuchów zależności prac wykonywanych przez wyznaczonych użytkowników, posiadający mechanizm wersjonowania i powrotów) o moduł wymiany danych z innymi podmiotami (odpowiedzialny za udostępnianie danych zainteresowanym podmiotom w formie umożliwiającej ich analizę przy użyciu oprogramowania zewnętrznego) o moduł obiegu dokumentów (odpowiedzialny za realizację procedur związanych ze standaryzacją, współpracę naukową, zarządzanie wynikami badań i prawami do nich itp.) moduł analiz (odpowiedzialny za uruchamianie narzędzi służących do przeprowadzania analiz na zgromadzonych danych, specyficznych dla określonego typu danych) Projekt funkcjonalny powinien zawierać elementy potrzebne do określenia wymogów sprzętowych na potrzeby projektu technicznego (np. oszacowanie wolumenu przetwarzanych danych, liczby użytkowników) oraz wytyczne do projektu graficznego tworzonego portalu MultiGenBank (makiety interfejsu użytkownika, szablony formularzy). Powyższa lista założeń ma charakter poglądowy. Jej dopracowanie i uściślenie ma nastąpić podczas realizacji projektu funkcjonalnego.

6 Załącznik nr 2 Moduł immunogenetyczny Platforma MultiGenBank ma obsługiwać użytkowników związanych merytorycznie z dwiema dziedzinami nauki: immunogenetyką oraz mikrobiologią. Dlatego w projekcie funkcjonalnym platformy należy uwzględnić istnienie dwóch rozłącznych jej części (działających i zarządzanych niezależnie): modułu immunogenetycznego oraz modułu mikrobiologicznego. Części te, choć specyficzne, powinny wykorzystywać wspólne komponenty i mechanizmy platformy. Zakłada się, że głównym obiektem zainteresowania użytkowników modułu immunogenetycznego będzie przetwarzanie danych immunogenetycznych dotyczących polskiej populacji ludzkiej. Do populacji tej będą należeć zdrowi osobnicy oraz pacjenci z różnymi jednostkami chorobowymi (chorobami autoimmunologicznymi, układu krwiotwórczego, nowotworami itp.), scharakteryzowani pod względem wieku, płci, występowania różnych typów polimorfizmów genetycznych oraz innych atrybutów zgodnie z ogólnoeuropejskimi standardami. Planowane jest długoterminowe pozyskiwanie tych danych z wykorzystaniem systemów obsługujących stanowiska badawcze w laboratoriach Zamawiającego oraz z innych, zewnętrznych źródeł. Dokładny zakres treści bazy danych powinien zostać zdefiniowany podczas prac analitycznych. Moduł immunogenetyczny ma pełnić rolę rejestru referencyjnego. Dlatego powinien działać na zasadach obowiązujących w rejestrach (jak wykorzystanie unikalnych identyfikatorów do gromadzonych rekordów, zastosowanie standardów przy opisie i wymianie danych, monitorowanie oraz rejestracja zmian wraz z ich autorami, zapewnienie trwałych referencji do zasobów, anonimizacja udostępnianych danych itp.). Ponadto moduł immunogenetyczny powinien pełnić rolę aplikacji pozwalającej na przeprowadzanie badań naukowych. Oznacza to, że powinien dostarczać narzędzi do przeprowadzania różnego typu analiz oraz zapewniać możliwość weryfikacji i dyskusji uzyskanych wyników. Przetwarzanie danych w tym kontekście powinno charakteryzować się szerokim spektrum oferowanych opcji, pozwalając na dokonywanie analiz związanych zarówno z określoną grupą genów, jak również z całymi przekrojami dostępnych informacji. Przewiduje się badanie rozkładu alleli i genotypów, przeprowadzanie testów i obliczeń statystycznych (χ2, OR, 95%CI, p, MAF, HWE, LD, częstości haplotypów, gen-gen itp.) i innych. Ponadto zakłada się, że przetwarzanie danych będzie odbywać się wg scenariuszy, polityki uprawnień oraz zasad bezpieczeństwa opracowanych podczas prac analitycznych. Zasady te będą szczególnie istotne przy pracy na własnych bądź współdzielonych danych, zasilaniu modułu nowymi danymi oraz ich udostępnianiu (gdzie mogą pojawić się: konieczność

7 weryfikacji poprawności wprowadzanych danych przed ich udostępnieniem, konieczność monitorowania przepływu danych do i z systemu oraz kontrolowania iteracji wynikających z ich obiegu itp.). Wspomniana wcześniej weryfikacja i dyskusja wyników prac naukowych może odbywać się poprzez odwołania do pozycji literaturowych, przeprowadzanie testów porównawczych itp. Dlatego moduł immunogenetyczny powinien pozwalać na korzystanie z zewnętrznych, referencyjnych źródeł danych. W szczególności powinien umożliwiać budowę grafów zależności między danymi przechowywanymi we własnej bazie danych a danymi zewnętrznymi. Przykładem takich zależności są referencje do pozycji literaturowych, w których wykorzystano określone dane immunogenetyczne lub w jakiś inny sposób odniesiono się do nich. Odwołania do tych pozycji, jak również do innych dziedzinowych narzędzi i serwisów w najprostszym przypadku mogą przyjąć postać hiperlinków do odpowiednich zasobów (np. zasobów serwisów, w bardziej zaawansowanej formie mogą polegać na uruchomieniu mechanizmów integracji (z zewnętrznymi narzędziami i serwisami). Wymienione powyżej założenia mają charakter poglądowy. Nakreślają one jedynie główne ramy oczekiwanych funkcji modułu immunogenetycznego. Podczas opracowywania projektu funkcjonalnego należy zidentyfikować w detalach wszystkie aspekty funkcjonowania tego modułu (na podstawie rozmów z ekspertami dziedzinowymi i dostarczonych materiałów) oraz wpisać je w architekturę logiczną budowanej platformy. Końcowy efekt tych prac, w postaci dokumentu stworzonego zgodnie z dobrymi praktykami inżynierii oprogramowania, powinien pozwolić na podjęcie prac implementacyjnych i wdrożeniowych.

8 Załącznik nr 3 Moduł mikrobiologiczny 1. Uwagi ogólne Wszystkie funkcje bazy mają być dostępne jedynie przez stronę www dla zewnętrznych użytkowników. Użytkownicy mogą być dowolni, jednak przewidujemy konieczność rejestracji przez podanie adresu oraz zabezpieczenia ograniczające działalność automatów przy korzystaniu z bazy i narzędzi. Powinna istnieć możliwość ograniczenia akceptowanych adresów , np. w celu wyeliminowania adresów z ogólnodostępnych serwisów i zawężeniu jedynie do adresów służbowych (związanych z instytucjami naukowymi lub firmami) użytkowników. Szacowana liczba rekordów w bazie będzie wynosiła około Przy tworzeniu bazy danych może być konieczne przetworzenie surowych danych, wyekstrahowanie informacji z innych baz oraz ich zaadaptowanie i wprowadzenie do powstającej bazy, co będzie po stronie wykonawcy. Baza powinna mieć możliwość wprowadzenia i przechowywania sekwencji całych genomów bakteryjnych. 2. Tabela z nagłówkami widoczna dla użytkownika: Wersja angielska Organism name Strain number Genotype Taxonomy Sequence of main markers Strain genotyping Sequence of other markers Results of RAPD and other methods Resistance genes Interesting features Useful enzymes Secondary metabolites Wersja polska Nazwa organizmu Numer szczepu Genotyp Taksonomia Sekwencja głównego markera Genotypowanie szczepu Sekwencje innych markerów Wyniki RAPD i innych metod Geny oporności Interesujące cechy Użyteczne enzymy Wtórne metabolity Pole 1: 3. Charakterystyka tabeli Nazwa naukowa organizmu: rodzaj i gatunek, np. Streptomyces coelicolor. Nazwa musi być taka sama jak w bazie Polish Collection of Microorganisms (PCM): Obie bazy

9 muszą być pod tym względem spójne. Zmiany dokonywane w jednej z baz muszą pociągać zmiany w drugiej bazie. Pole 2: Numer szczepu. w kolekcji PCM, np. PCM-2324, z łączem do odpowiedniego rekordu w bazie PCM - API, standard zapisu JSON (Java Script Object Notification). Z powodów historycznych może być kilka numerów opisujących ten sam mikroorganizm. Pole 3: Informacje o genotypie: wprowadzone mutacje, charakterystyczne plazmidy i geny, według formatu np.: DeltaM15, Delta(lacZYA-argF), U169, reca1, enda1, hsdr17(rk-mk+), supe44, thi-1, gyra96, rela1. Pole 4: Nazwy grup taksonomicznych, np. Bacteria, Actinobacteria, Streptomycetaceae. Nazwa musi być taka sama jak w bazie PCM. Obie bazy muszą być pod tym względem spójne. Zmiany dokonywane w jednej z baz muszą pociągać zmiany w drugiej bazie. Pole 5: Nazwa głównego markera: 16S rrna, ITS-1 lub ITS-2 z łączem do pliku tekstowego z ich sekwencją w formacie FASTA z odpowiednim nagłówkiem: nazwa rodzajowa_nazwa gatunkowa_numer szczepu_nazwa markera. Wszystko czcionką Courier, np.: >Streptomyces_coelicolor_2324_16SrRNA ATCGTAGCTGGAGGAGATGGAGCGTAGCATGCTAGATAGTCTAGCTAGTA ATCGTGATGCATGCATGCTGATGCTAGCTAGCTAGCTAGCTAGCTAGCTA ATGAATGTAGCTAGCTTAGCTGACTGCTGCTGTAGCTGATCGTAGCTGAC Po kliknięciu otworzy się łącze i wyświetli się jego zawartość. Pole 6: Nazwa innych markerów: dnaj, sod A, tuf, rpob, gyrb, elongation factor Tt, F-ATPase beta subunit; 16S-23S rrna spacer; reca; groel, dnak; omp50; choe; hsp65, każdy z łączem: - nazwa nt do pliku tekstowego z ich sekwencją nukleotydową w formacie FASTA z odpowiednim nagłówkiem: nazwa rodzajowa_nazwa gatunkowa_numer szczepu_nazwa markera. Wszystko czcionką Courier, np.: >Streptomyces_coelicolor_2324_dnaJ ATGCTGAGCTAGTACGTCGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAG AATAGATCGTAGCTAGCTAGCTAGCTAGCTAGTCGTCGCTGATCGATCGT AATCGATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT

10 - nazwa aa do pliku tekstowego z ich sekwencją aminokwasową w formacie FASTA z odpowiednim nagłówkiem: nazwa rodzajowa_nazwa gatunkowa_numer szczepu_nazwa markera. Po kliknięciu otworzy się łącze i wyświetli się jego zawartość. W tym polu może być więcej niż jedna nazwa. Zwykle nie więcej niż trzy nazwy. Przykład: dnaj (nt, aa) sod A (nt, aa) tuf (nt, aa) Pole 7: Opis metody w której uzyskuje się dane, ze znacznikiem kontrolującym, że w analizach porównuje się dane uzyskane tą sama metodą. Nazwa Image z łączem do pliku rastrowego zwierającego zdjęcie obrazu elektroforezy, np.: Nazwa Method_description_nr (nr oznacza numer metody w bazie) z łączem do opisu metody genotypowania. Nazwa Method_data_nr (nr oznacza numer metody w bazie) z łączem do pliku tekstowego zwierającego długości sekwencji uzyskanych w wyniku RAPD, posortowanych rosnąco, np.: Po kliknięciu otworzy się łącze i wyświetli się jego zawartość. Przykład: Image Method_description_nr Method_data_nr

11 Pole 8: Nazwa genu związanego z opornością szczepu. Po nazwie genu: - nazwa description z łączem do pełnej nazwy genu, kodowanego produktu i opisu związanego z opornością, - nazwa nt fasta z łączem do pliku tekstowego z ich sekwencją nukleotydową w formacie FASTA z odpowiednim nagłówkiem: nazwa rodzajowa_nazwa gatunkowa_numer szczepu_nazwa genu, - nazwa aa fasta z łączem do pliku tekstowego z ich sekwencją aminokwasową w formacie FASTA z odpowiednim nagłówkiem: nazwa rodzajowa_nazwa gatunkowa_numer szczepu_nazwa genu, - nazwa nt genbank z łączem do pliku z sekwencją nukleotydową w formacie Genbank (gbk), - nazwa aa genbank z łączem do pliku z sekwencją aminokwasową w formacie Genbank (gbk). Po kliknięciu otworzy się łącze i wyświetli się jego zawartość. W tym polu może być więcej niż jedna nazwa i nie wszystkie mogą mieć aktywne łącza. Przykład: gena (description, nt fasta, aa fasta, nt genbank, aa genbank) genb (description, nt fasta, aa fasta, nt genbank, aa genbank) genc (description, nt fasta, aa fasta, nt genbank, aa genbank) Pole 9: Nazwa genu kodującego enzymy użyteczne przemysłowo (w tym enzymy z grzybów użyteczne w biotransformacjach). Po nazwie genu: - nazwa description z łączem do pełnej nazwy genu, kodowanego produktu i opisu związanego z funkcją enzymatyczną, - nazwa nt fasta z łączem do pliku tekstowego z ich sekwencją nukleotydową w formacie FASTA z odpowiednim nagłówkiem: nazwa rodzajowa_nazwa gatunkowa_numer szczepu_nazwa genu, - nazwa aa fasta z łączem do pliku tekstowego z ich sekwencją aminokwasową w formacie FASTA z odpowiednim nagłówkiem: nazwa rodzajowa_nazwa gatunkowa_numer szczepu_nazwa genu, - nazwa nt genbank z łączem do pliku z sekwencją nukleotydową w formacie Genbank (gbk), - nazwa aa genbank z łączem do pliku z sekwencją aminokwasową w formacie Genbank (gbk). Po kliknięciu otworzy się łącze i wyświetli się jego zawartość. W tym polu może być więcej niż jedna nazwa i nie wszystkie mogą mieć aktywne łącza. Przykład: gena (description, nt fasta, aa fasta, nt genbank, aa genbank) genb (description, nt fasta, aa fasta, nt genbank, aa genbank) genc (description, nt fasta, aa fasta, nt genbank, aa genbank) Po wejściu do description mogą w nim znajdować się łącza do produktów umieszczonych w Platformie PCM.

12 Pole 10: Nazwa cluster z łączem do schematu genów, ich produktów z domenami białkowymi i wytwarzanymi lub modyfikowanymi produktami. Długości obiektów graficznych reprezentujące geny (strzałki), produkty (prostokąty) i domeny (prostokąty) są proporcjonalne do ich długości, a odległości między nimi odzwierciedlają względne położenie w sekwencji genomu lub białka. Obiekty będą odpowiednio podpisane i po kliknięciu pojawi się ich opis. Pod domenami będą obiekty graficzne ze wzorami i nazwami metabolitu wtórnego wytwarzanego lub modyfikowanego przez dane domeny. Pod obiektem pierwszej domeny produktu pierwszego genu będzie obiekt reprezentujący substrat reakcji. Po kliknięciu na obiekty substratów i metabolitów zostaną one wyświetlone w powiększeniu. Przykład: Gene A Gene B Gene C Protein A Protein B Protein C Nazwa genu związanego z syntezą metabolitów wtórnych (głównie poliketydów). Po nazwie genu: - nazwa description z łączem do pełnej nazwy genu, kodowanego produktu i opisu związanego z funkcją enzymatyczną, - nazwa nt fasta z łączem do pliku tekstowego z ich sekwencją nukleotydową w formacie FASTA z odpowiednim nagłówkiem: nazwa rodzajowa_nazwa gatunkowa_numer szczepu_nazwa genu, - nazwa aa fasta z łączem do pliku tekstowego z ich sekwencją aminokwasową w formacie FASTA z odpowiednim nagłówkiem: nazwa rodzajowa_nazwa gatunkowa_numer szczepu_nazwa genu, - nazwa nt genbank z łączem do pliku z sekwencją nukleotydową w formacie Genbank (gbk), - nazwa aa genbank z łączem do pliku z sekwencją aminokwasową w formacie Genbank (gbk), - nazwa ostatecznego metabolitu wtórnego wytwarzanego lub modyfikowanego przez dane białko z łączem do pliku rastrowego (lub innego) z jego opisem i wzorem chemicznym. Wzory zapisywane są w formacie SMILES lub innym dla wzorów chemicznych (, Po kliknięciu otworzy się łącze i wyświetli się jego zawartość. W tym polu może być więcej niż jedna nazwa (nawet 49) i nie wszystkie muszą mieć aktywne łącza. Przykład: gena (description, nt fasta, aa fasta, nt genbank, aa genbank, metabolite) genb (description, nt fasta, aa fasta, nt genbank, aa genbank, metabolite) genc (description, nt fasta, aa fasta, nt genbank, aa genbank, metabolite) Geny ułożone są zgodnie z ich kolejnością położenia w genomie i kolejnością przeprowadzania reakcji chemicznych przez ich produkty.

13 Po wejściu do description poza opisem pojawi się wykaz modułów i domen białkowych. Po wejściu do metabolite mogą w nim znajdować się łącza do produktów umieszczonych w Platformie PCM. 4. Operacje na danych zwartych w bazie 1. Baza danych może być przeszukiwana w celu wylistowania rekordów posiadających dane słowa kluczowe występujące w odpowiednich polach tabeli i łączach do nich. Jest możliwość tworzenia zaawansowanych zapytań wykorzystując operatory AND, OR, NOT. 2. W polach (5, 6, 8, 9 i 10) przy łączach do sekwencji występuje pole wyboru z możliwością jego zaznaczenia. W odpowiednim nagłówku tabeli jest dodatkowe pole lub pola (odpowiednio dla typów sekwencji, np. nt fasta, aa fasta, nt genbank, aa genbank) umożliwiające zaznaczenie wszystkich sekwencji w wylistowanych rekordach w danej kolumnie tabeli. Zaznaczone sekwencję mogą zostać pobrane przez użytkownika w formie pliku tekstowego, a na sekwencjach homologicznych (wszystkich sekwencjach z pola 5 i odpowiednich grupach sekwencji z pola 6) mogą zostać wykonane analizy przy pomocy programów wykonujących przyrównania sekwencji (np. Clustal, Mafft, Muscle) oraz tworzących proste drzewa filogenetyczne. Programy będą uruchamiane lokalnie. 3. W polu 7 przy nazwie Method_data_nr występuje pole wyboru z możliwością jego zaznaczenia. W nagłówku tabeli jest dodatkowe łącze umożliwiające wylistowanie wszystkich metod (w formacie Method_nr, gdzie nr to numer metody) występujących w wylistowanych rekordach. Zaznaczenie jednej metody będzie skutkowało wyborem wszystkich pól Method_data_nr dla tej samej zaznaczonej metody w wylistowanych rekordach w kolumnie tabeli. Zaznaczone dane mogą zostać pobrane przez użytkownika w formie pliku tekstowego oraz mogą zostać wykonane dla nich analizy przy pomocy programu GelCompar, GelQuest/ClusterVis lub innych (dane tabelaryczne mogą być również analizowane programem statystycznym, np. w pakiecie R). Program będzie uruchamiany lokalnie. 4. Ma istnieć możliwość poszukiwania sekwencji zawartych w bazie w oparciu o podobieństwo sekwencji przy pomocy lokalnie uruchamianego programu BLAST. Znalezione sekwencje homologiczne mają łącza do swoich odpowiednich rekordów. Podobnie jak w punkcie 2 mogą zostać wykonane na nich analizy przy pomocy programów wykonujących przyrównania sekwencji (np. Clustal, Mafft, Muscle) oraz tworzących proste drzewa filogenetyczne. 5. Z danymi w polu 10 będzie skojarzone narzędzie pozwalające na wybieranie z bazy zestawu genów lub ich fragmentów (modułów i domen białkowych) na podstawie podanego wzoru chemicznego (formacie SMILES lub innym dla wzorów chemicznych) metabolitu wytwarzanego lub modyfikowanego.

Zapytanie ofertowe. dotyczące przeprowadzenia audytu zewnętrznego wydatkowania środków finansowych na naukę w ramach projektu:

Zapytanie ofertowe. dotyczące przeprowadzenia audytu zewnętrznego wydatkowania środków finansowych na naukę w ramach projektu: Wrocław, dnia 12.10.2015r. Zapytanie ofertowe dotyczące przeprowadzenia audytu zewnętrznego wydatkowania środków finansowych na naukę w ramach projektu: Utworzenie bazy danych immunogenetycznych polskiej

Bardziej szczegółowo

Załącznik nr 1. Przykładowe makiety (ang. mockup) projektowanego interfejsu opracowane na etapie projektowania funkcjonalności.

Załącznik nr 1. Przykładowe makiety (ang. mockup) projektowanego interfejsu opracowane na etapie projektowania funkcjonalności. Załącznik nr 1. Przykładowe makiety (ang. mockup) projektowanego interfejsu opracowane na etapie projektowania funkcjonalności. Rys. 1. Makieta strony powitalnej Rys. 2. Makieta okna niezalogowanego użytkownika

Bardziej szczegółowo


OPIS PRZEDMIOTU ZAMÓWIENIA Lubelskie Centrum Transferu Technologii Politechniki Lubelskiej ul. Nadbystrzycka 36, 20-618 Lublin Tel. 81 538 42 70, fax. 81 538 42 67; e-mail: OPIS PRZEDMIOTU ZAMÓWIENIA Do realizacji

Bardziej szczegółowo

Zapytanie ofertowe na Przeprowadzenie audytu zewnętrznego wydatkowania środków finansowych na naukę

Zapytanie ofertowe na Przeprowadzenie audytu zewnętrznego wydatkowania środków finansowych na naukę 22.07.2013 Zapytanie ofertowe na Przeprowadzenie audytu zewnętrznego wydatkowania środków finansowych na naukę w ramach projektu: Utworzenie interoperacyjnej elektronicznej platformy naukowej Polskiej

Bardziej szczegółowo



Bardziej szczegółowo

Deduplikacja danych. Zarządzanie jakością danych podstawowych

Deduplikacja danych. Zarządzanie jakością danych podstawowych Deduplikacja danych Zarządzanie jakością danych podstawowych normalizacja i standaryzacja adresów standaryzacja i walidacja identyfikatorów podstawowa standaryzacja nazw firm deduplikacja danych Deduplication

Bardziej szczegółowo

Zapytanie ofertowe. na wyłonienie dostawcy wartości niematerialnych w zakresie. Wartości Niematerialnych i Prawnych w postaci Systemu Klasy B2B

Zapytanie ofertowe. na wyłonienie dostawcy wartości niematerialnych w zakresie. Wartości Niematerialnych i Prawnych w postaci Systemu Klasy B2B Szerzawy, dnia 01.04.2014r. Zapytanie ofertowe na wyłonienie dostawcy wartości niematerialnych w zakresie Wartości Niematerialnych i Prawnych w postaci Systemu Klasy B2B w ramach realizacji projektu Optymalizacja

Bardziej szczegółowo

ZAPYTANIE OFERTOWE NR 1/2015/POIG82 Program Operacyjny Innowacyjna Gospodarka

ZAPYTANIE OFERTOWE NR 1/2015/POIG82 Program Operacyjny Innowacyjna Gospodarka Polanów, dnia 2 marca 2015 roku MACED sp. z o.o. ul. Bobolicka 18 76-010 Polanów Kraj: Polska Tel. 94-31-88-410 Nr KRS: 0000140490 NIP: 4990403778 REGON: 331367780 ZAPYTANIE OFERTOWE NR 1/2015/POIG82 Program

Bardziej szczegółowo

ZAPYTANIE OFERTOWE. Zamawiający. Przedmiot zapytania ofertowego. Wrocław, dnia 23.03.2015 r.

ZAPYTANIE OFERTOWE. Zamawiający. Przedmiot zapytania ofertowego. Wrocław, dnia 23.03.2015 r. ZAPYTANIE OFERTOWE Wrocław, dnia 23.03.2015 r. W związku z realizacją przez Nova Telecom spółka z ograniczoną odpowiedzialnością, projektu pn.: Wdrożenie zintegrowanego systemu klasy B2B, umożliwiającego

Bardziej szczegółowo

Zapytanie ofertowe na: Zakup wartości niematerialnej i prawnej w postaci nowoczesnego systemu B2B wraz ze szkoleniem z obsługi ww.

Zapytanie ofertowe na: Zakup wartości niematerialnej i prawnej w postaci nowoczesnego systemu B2B wraz ze szkoleniem z obsługi ww. Warszawa, dnia 24.05.2012 r. Zapytanie ofertowe na: Zakup wartości niematerialnej i prawnej w postaci nowoczesnego systemu B2B wraz ze szkoleniem z obsługi ww. systemu Tytuł projektu: Automatyzacja procesów

Bardziej szczegółowo

Zapytanie ofertowe. dotyczące zamówienia na fabrycznie nowe stanowiska komputerowe (3 sztuk) w ramach projektu:

Zapytanie ofertowe. dotyczące zamówienia na fabrycznie nowe stanowiska komputerowe (3 sztuk) w ramach projektu: Wrocław, dnia 15.12.2014 Zapytanie ofertowe dotyczące zamówienia na fabrycznie nowe stanowiska komputerowe (3 sztuk) w ramach projektu: Utworzenie bazy danych immunogenetycznych polskiej populacji MultiGenBank

Bardziej szczegółowo

ZAPYTANIE OFERTOWE 1/2014. W związku z realizacją projektu pn. Wyjście na przeciw trendom wydawniczym XXI wieku poprzez

ZAPYTANIE OFERTOWE 1/2014. W związku z realizacją projektu pn. Wyjście na przeciw trendom wydawniczym XXI wieku poprzez Białystok, dn. 13.02.2014 ZAPYTANIE OFERTOWE 1/2014 I. Zamawiający ILLUMINATIO Łukasz Kierus Żelazna 9/5 15-297 Białystok II. Opis przedmiotu zamówienia W związku z realizacją projektu pn. Wyjście na przeciw

Bardziej szczegółowo

Zamawiający dysponuje szerokim spektrum rozwiązań infrastrukturalnych. Wykonawca uzyska dostęp do infrastruktury w niezbędnym zakresie.

Zamawiający dysponuje szerokim spektrum rozwiązań infrastrukturalnych. Wykonawca uzyska dostęp do infrastruktury w niezbędnym zakresie. Prosimy o precyzyjne wyjaśnienie, co Zamawiający rozumie pod pojęciem bezterminowej i pełnej licencji, wraz z prawem do dysponowania dokumentacją i wprowadzaniem zmian? Na jakich polach eksploatacji ma

Bardziej szczegółowo

ZAPYTANIE OFERTOWE. nr 1/UE/2014. z dnia 7.01.2014 r. w związku z realizacją projektu pn.

ZAPYTANIE OFERTOWE. nr 1/UE/2014. z dnia 7.01.2014 r. w związku z realizacją projektu pn. Projekt współfinansowany ze środków Unii Europejskiej w ramach Europejskiego Funduszu Rozwoju Regionalnego ZAPYTANIE OFERTOWE nr /UE/204 z dnia 7.0.204 r. w związku z realizacją projektu pn. Wdrożenie

Bardziej szczegółowo

Platforma MultiGenBank

Platforma MultiGenBank Platforma MultiGenBank Wersja dokumentu: 2.1 robocza Data wersji dokumentu: 27.02.2015 Opracował: firma UNOLD Comp. Strona 1 z 30 1 Metryka dokumentu 1.1 Historia zmian Data wersji Autor Wersja Opis Uwagi

Bardziej szczegółowo

Zapytanie ofertowe. Niespełnienie któregokolwiek wymagania może skutkować odrzuceniem oferty bez jej rozpatrzenia

Zapytanie ofertowe. Niespełnienie któregokolwiek wymagania może skutkować odrzuceniem oferty bez jej rozpatrzenia Warszawa, 05.07.2013r. Zapytanie ofertowe na wyłonienie wykonawcy/dostawcy 1. Wartości Niematerialnych i Prawnych a) aplikacja B2B w ramach realizacji projektu Wdrożenie aplikacji B2B automatyzującej naszą

Bardziej szczegółowo


1. REJESTRACJA W INTERIM24.PL... 2 2. PANEL UŻYTKOWNIKA ZAWARTOŚĆ... 8 3. UZUPEŁNIENIE PROFILU... 9 Strona1 Platforma została stworzona w ramach projektu Interim management nowość w zarządzaniu wiekiem i firmą współfinansowanego przez Unię Europejską w ramach Europejski Funduszu Społecznego.

Bardziej szczegółowo

OfficeObjects e-forms

OfficeObjects e-forms OfficeObjects e-forms Rodan Development Sp. z o.o. 02-820 Warszawa, ul. Wyczółki 89, tel.: (+48-22) 643 92 08, fax: (+48-22) 643 92 10, Spis treści Wstęp... 3 Łatwość tworzenia i publikacji

Bardziej szczegółowo

Zapytanie ofertowe. w ramach realizacji projektu Zarzadzanie projektami przyszłością firmy Small Business System Damian Lemiech

Zapytanie ofertowe. w ramach realizacji projektu Zarzadzanie projektami przyszłością firmy Small Business System Damian Lemiech .. (otrzymałem dnia, pieczątka, podpis) Ostrów, 10.06.2014r. Zapytanie ofertowe na wyłonienie wykonawcy/dostawcy 1. Wartości Niematerialnych i Prawnych. a) Zaprojektowanie i wykonanie systemu B2B w ramach

Bardziej szczegółowo

Praca w programie dodawanie pisma.

Praca w programie dodawanie pisma. Praca w programie dodawanie pisma. Wybór zakładki z danymi z Currendy (1) (tylko w przypadku włączenia opcji korzystania z danych Currendy). Wyszukanie i wybranie pisma. Po wybraniu wiersza dane z Currendy

Bardziej szczegółowo


WYKONANIE OPROGRAMOWANIA DEDYKOWANEGO Zapytanie ofertowe nr 1/2014 Wrocław, dn. 29.01.2014 Lemitor Ochrona Środowiska Sp. z o. o. ul. Jana Długosza 40, 51-162 Wrocław tel. recepcja: 713252590, fax: 713727902 e-mail: NIP:

Bardziej szczegółowo

Warszawa, dnia 03.03.2014. Zapytanie ofertowe. na wyłonienie wykonawcy/dostawcy w zakresie: 1. Wartości niematerialnych i prawnych

Warszawa, dnia 03.03.2014. Zapytanie ofertowe. na wyłonienie wykonawcy/dostawcy w zakresie: 1. Wartości niematerialnych i prawnych Warszawa, dnia 03.03.2014 Zapytanie ofertowe na wyłonienie wykonawcy/dostawcy w zakresie: 1. Wartości niematerialnych i prawnych a. System klasy B2B wraz z wdrożeniem W ramach realizacji projektu Wdrożenie

Bardziej szczegółowo

Opis przedmiotu zamówienia

Opis przedmiotu zamówienia Załącznik nr 1 do SIWZ Opis przedmiotu zamówienia Świadczenie usług doradztwa eksperckiego w ramach projektu Elektroniczna Platforma Gromadzenia, Analizy i Udostępniania Zasobów Cyfrowych o Zdarzeniach

Bardziej szczegółowo


GŁÓWNE WĄTKI REALIZOWANE W PROJEKCIE GEOPORTAL GŁÓWNE WĄTKI REALIZOWANE W PROJEKCIE GEOPORTAL Realizacja prac w ramach Implementacji Przedmiot prac - prace analityczne, projektowe, wdrożeniowo implementacyjne, dokumentacyjne oraz szkoleniowe, związane

Bardziej szczegółowo

GoBiz System platforma współpracy marektingowej

GoBiz System platforma współpracy marektingowej GoBiz System platforma współpracy marektingowej Spis treści 1. Opis przedmiotu zamówienia... 1 1.1. Definicje... 1 2. Główny cel platformy... 2 3. Główni odbiorcy systemu... 2 4. Przedmiot zamówienia...

Bardziej szczegółowo

Zapytanie ofertowe. BLIKET GRZEGORZ BYLINA ul. Sochaczewska 8B lok. 8 05-840 Brwinów Tel: 508317191, Faks: 227295112 NIP: 5291601562, Regon: 140798009

Zapytanie ofertowe. BLIKET GRZEGORZ BYLINA ul. Sochaczewska 8B lok. 8 05-840 Brwinów Tel: 508317191, Faks: 227295112 NIP: 5291601562, Regon: 140798009 Brwinów, 26.11.2013r. Zapytanie ofertowe na wyłonienie wykonawcy Usługi doradcze i eksperckie a) Opracowanie modelu funkcjonalnego platformy B2B b) Opracowanie projektu technicznego w ramach realizacji

Bardziej szczegółowo


ZAMAWIAJĄCY. CONCEPTO Sp. z o.o. Grodzisk Wielkopolski, dnia 11.02.2013r. ZAMAWIAJĄCY z siedzibą w Grodzisku Wielkopolskim (62-065) przy ul. Szerokiej 10 realizując zamówienie w ramach projektu dofinansowanego z Programu Operacyjnego

Bardziej szczegółowo

Projekt dotyczy stworzenia zintegrowanego, modularnego systemu informatycznego wspomagającego zarządzanie pracownikami i projektami w firmie

Projekt dotyczy stworzenia zintegrowanego, modularnego systemu informatycznego wspomagającego zarządzanie pracownikami i projektami w firmie Projekt dotyczy stworzenia zintegrowanego, modularnego systemu informatycznego wspomagającego zarządzanie pracownikami i projektami w firmie informatycznej. Zadaniem systemu jest rejestracja i przechowywanie

Bardziej szczegółowo

Dodatkowo, w przypadku modułu dotyczącego integracji z systemami partnerów, Wykonawca będzie przeprowadzał testy integracyjne.

Dodatkowo, w przypadku modułu dotyczącego integracji z systemami partnerów, Wykonawca będzie przeprowadzał testy integracyjne. Załącznik nr 1a do Zapytania ofertowego nr POIG.08.02-01/2014 dotyczącego budowy oprogramowania B2B oraz dostawcy sprzętu informatycznego do projektu pn. Budowa systemu B2B integrującego zarządzanie procesami

Bardziej szczegółowo

Wyższa Szkoła Bankowa w Toruniu ul. Młodzieżowa 31a 87-100 Toruń Toruń, dnia 17.04.2014r. ZAPYTANIE OFERTOWE nr 1/NOR/0119/2014

Wyższa Szkoła Bankowa w Toruniu ul. Młodzieżowa 31a 87-100 Toruń Toruń, dnia 17.04.2014r. ZAPYTANIE OFERTOWE nr 1/NOR/0119/2014 Wyższa Szkoła Bankowa w Toruniu ul. Młodzieżowa 31a 87-100 Toruń Toruń, dnia 17.04.2014r. ZAPYTANIE OFERTOWE nr 1/NOR/0119/2014 Zamawiający: Wyższa Szkoła Bankowa w Toruniu z siedzibą

Bardziej szczegółowo


DOTACJE NA INNOWACJE FUNDUSZE EUROPEJSKIE - DLA ROZWOJU INNOWACYJNEJ GOSPODARKI ZAPYTANIE OFERTOWE Nowa Telefonia Sp. o.o. ul. Foksal 18 00-372 Warszawa NIP: 701-029-37-11 REGON: 142888946 ZAPYTANIE OFERTOWE na: Dostawę i wdrożenie dedykowanej, innowacyjnej platformy B2B oraz dostawę sprzętu niezbędnego

Bardziej szczegółowo


PRZEDMIOT ZAMÓWIENIA: Ostrów Wielkopolski, dnia 16.08.2011 Nr Sprawy/01/08/NOBESO/2011 ZAPYTANIE OFERTOWE PRZEDMIOT ZAMÓWIENIA: Zakup kompleksowych usług informatycznych i programistycznych w zakresie działań przygotowawczych

Bardziej szczegółowo

Currenda EPO Instrukcja Konfiguracji. Wersja dokumentu: 1.3

Currenda EPO Instrukcja Konfiguracji. Wersja dokumentu: 1.3 Currenda EPO Instrukcja Konfiguracji Wersja dokumentu: 1.3 Currenda EPO Instrukcja Konfiguracji - wersja dokumentu 1.3-19.08.2014 Spis treści 1 Wstęp... 4 1.1 Cel dokumentu... 4 1.2 Powiązane dokumenty...

Bardziej szczegółowo


DOTACJE NA INNOWACJE INWESTUJEMY W WASZĄ PRZYSZŁOŚĆ Projekt współfinansowany ze środków Unii Europejskiej w ramach działania 8.1 Wspieranie działalności gospodarczej w dziedzinie gospodarki elektronicznej 8. osi priorytetowej. Społeczeństwo informacyjne

Bardziej szczegółowo


POKL.02.03.03-00-007/12-00 Dotyczy wyjaśnienia treści zapytania ofertowego na wybór wykonawcy do opracowania oraz wdrożenia platformy e-learningowej z funkcjonalnościami portalu internetowego w ramach Projektu nr POKL.02.03.03-00-007/12-00

Bardziej szczegółowo

FORMULARZ OFERTOWY. Termin dostarczenia dokumentu 1

FORMULARZ OFERTOWY. Termin dostarczenia dokumentu 1 strona 1 Zał. 1 do zapytania ofertowego FORMULARZ OFERTOWY Opteam S.A. o/lublin ul. Budowlana 30 20-469 Lublin W związku z realizacją projektu pod nazwą,,opracowanie nowoczesnego i zaawansowanego systemu

Bardziej szczegółowo


DOTACJE NA INNOWACJE INWESTUJEMY W WASZĄ PRZYSZŁOŚĆ Projekt współfinansowany ze środków Unii Europejskiej w ramach działania 8.1 Wspieranie działalności gospodarczej w dziedzinie gospodarki elektronicznej 8. osi priorytetowej. Społeczeństwo informacyjne

Bardziej szczegółowo


ZAPROSZENIE DO ZŁOŻENIA OFERTY Nr 1/8.2/2014 Otwock, 12.12.2014r. NANOEMPIRE DAWID SMÓŁKA. ul. Krakowska 16 05-400 Otwock ZAPROSZENIE DO ZŁOŻENIA OFERTY Nr 1/8.2/2014 Mając na uwadze obowiązki wynikające ze stosowania zasad uczciwej konkurencji,

Bardziej szczegółowo

ZAPYTANIE OFERTOWE. Elektroniczna platforma danych B2B usprawniająca procesy biznesowe pomiędzy firmą AGRO-PARTNER a partnerami handlowymi

ZAPYTANIE OFERTOWE. Elektroniczna platforma danych B2B usprawniająca procesy biznesowe pomiędzy firmą AGRO-PARTNER a partnerami handlowymi Gorzyce Wielkie, dnia 03.12.2012 r. Nr Sprawy: 01/12/AGRO-PARTNER/2012 ZAPYTANIE OFERTOWE Przedmiot zamówienia stanowi: Zakup kompleksowych usług informatycznych i programistycznych w zakresie działań

Bardziej szczegółowo

Katedra Inżynierii Oprogramowania Tematy prac dyplomowych inżynierskich STUDIA NIESTACJONARNE (ZAOCZNE)

Katedra Inżynierii Oprogramowania Tematy prac dyplomowych inżynierskich STUDIA NIESTACJONARNE (ZAOCZNE) Katedra Inżynierii Oprogramowania Tematy prac dyplomowych inżynierskich STUDIA NIESTACJONARNE (ZAOCZNE) Temat projektu/pracy dr inż. Wojciech Waloszek Grupowy system wymiany wiadomości. Zaprojektowanie

Bardziej szczegółowo

Zapytanie ofertowe nr ZO/13-030/2013/1 na realizację projektu system usług B2B.

Zapytanie ofertowe nr ZO/13-030/2013/1 na realizację projektu system usług B2B. Zapytanie ofertowe nr ZO/13-030/2013/1 na realizację projektu system usług B2B. Projekt realizowany w ramach Działania 8.2 Programu Operacyjnego Innowacyjna Gospodarka Wspieranie wdrażania

Bardziej szczegółowo

I. Interfejs użytkownika.

I. Interfejs użytkownika. Ćwiczenia z użytkowania systemu MFG/PRO 1 I. Interfejs użytkownika. MFG/PRO w wersji eb2 umożliwia wybór użytkownikowi jednego z trzech dostępnych interfejsów graficznych: a) tekstowego (wybór z menu:

Bardziej szczegółowo

Zapytanie ofertowe nr 1/11/2013 na wykonanie dedykowanego oprogramowania

Zapytanie ofertowe nr 1/11/2013 na wykonanie dedykowanego oprogramowania Zapytanie ofertowe nr 1/11/2013 na wykonanie dedykowanego oprogramowania 1. Zamawiający FC MANAGEMENT Spółka z o.o. ul. Łętowskiego 20, 40-648 Katowice NIP: 243261956, REGON: 9542743110, KRS: 0000462256

Bardziej szczegółowo

Poznań, dzień 10.02.2014. Zapytanie ofertowe

Poznań, dzień 10.02.2014. Zapytanie ofertowe Poznań, dzień 0.0.0 Zapytanie ofertowe Beneficjent: Tech-Net Spółka z ograniczoną odpowiedzialnością Program: Program Operacyjny Innowacyjna Gospodarka Działanie: 8. Wspieranie wdrażania elektronicznego

Bardziej szczegółowo

zaprasza do składania ofert w odpowiedzi na: ZAPYTANIE OFERTOWE nr E2 / 02

zaprasza do składania ofert w odpowiedzi na: ZAPYTANIE OFERTOWE nr E2 / 02 Warszawa, dnia 16.10.2014 r. zaprasza do składania ofert w odpowiedzi na: ZAPYTANIE OFERTOWE nr E2 / 02 Dotyczy umowy o dofinansowanie nr UDA-POIG.08.02.00-14-092/14-00 zawartej w dniu 25.06.2014 roku

Bardziej szczegółowo

którego nie stosuje się przepisów ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych na:

którego nie stosuje się przepisów ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych na: GŁÓWNY URZĄD GEODEZJI I KARTOGRAFII Warszawa, 2 października 2015 r. DEPARTAMENT NADZORU, KONTROLI I ORGANIZACJI SŁUŻBY GEODEZYJNEJ I KARTOGRAFICZNEJ NG-KiSZ.2611.6.2015 Do wszystkich Wykonawców Dotyczy:

Bardziej szczegółowo

ZAPYTANIE OFERTOWE NA. Kompleksowe usługi informatyczne

ZAPYTANIE OFERTOWE NA. Kompleksowe usługi informatyczne Rzeszów, dn 07.05.2012r. DREAM/POIG/ZO/3/12 ZAPYTANIE OFERTOWE NA Kompleksowe usługi informatyczne DREAM/POIG/ZO/3/12 Szacunkowa wartość zamówienia: powyżej 14 000 euro W związku z realizacją projektu

Bardziej szczegółowo

ZAPYTANIE OFERTOWE. z dnia 20 grudnia 2013r.

ZAPYTANIE OFERTOWE. z dnia 20 grudnia 2013r. Projekt współfinansowany ze środków Unii Europejskiej w ramach Europejskiego Funduszu Rozwoju Regionalnego ZAPYTANIE OFERTOWE z dnia 20 grudnia 2013r. w związku z realizacją projektu pn. Wdrożenie systemu

Bardziej szczegółowo


Rozdział 3. ROZWÓJ APLIKACJI CENTRALNEJ Załącznik nr 2 do umowy nr 11/DI/PN/2013 PROCEDURA UTRZYMANIA I ROZWOJU APLIKACJI CENTRALNEJ Rozdział 1. WPROWADZENIE Celem niniejszego dokumentu jest sprecyzowanie procedury zarządzania realizacją umowy

Bardziej szczegółowo

System INTEGRYB jako zintegrowane repozytorium danych umożliwiające zaawansowaną analitykę badawczą

System INTEGRYB jako zintegrowane repozytorium danych umożliwiające zaawansowaną analitykę badawczą System INTEGRYB jako zintegrowane repozytorium danych umożliwiające zaawansowaną analitykę badawczą Lena Szymanek 1, Jacek Seń 1, Krzysztof Skibicki 2, Sławomir Szydłowski 2, Andrzej Kunicki 1 1 Morski

Bardziej szczegółowo

ZAPYTANIE OFERTOWE. Wdrożenie systemu B2B w celu automatyzacji procesów biznesowych zachodzącymi między Wnioskodawcą a partnerami biznesowymi

ZAPYTANIE OFERTOWE. Wdrożenie systemu B2B w celu automatyzacji procesów biznesowych zachodzącymi między Wnioskodawcą a partnerami biznesowymi Wrocław, 28 sierpnia 2014 r. ZAPYTANIE OFERTOWE KIEZA MARCIN MARCIN KIEZA PRO - CHEMIA PPH z siedzibą w Marcinkowicach przy ulicy Letnia 8a (55-200, Oława I) realizując projekt pt. Wdrożenie systemu B2B

Bardziej szczegółowo


ZAPYTANIE OFERTOWE nr 01/2014 Warszawa, dnia 13.06.2014 r. ZAPYTANIE OFERTOWE nr 01/2014 na nabycie wartości niematerialnych i prawnych, usług informatycznych i technicznych oraz szkoleń specjalistycznych Dotyczy projektu realizowanego

Bardziej szczegółowo

ZAPYTANIE OFERTOWE. I. Nazwa i adres zamawiającego. NZOZ Zawidawie sp. z o.o. ul. Wejherowska 28 54-239 Wrocław

ZAPYTANIE OFERTOWE. I. Nazwa i adres zamawiającego. NZOZ Zawidawie sp. z o.o. ul. Wejherowska 28 54-239 Wrocław ZAPYTANIE OFERTOWE I. Nazwa i adres zamawiającego. NZOZ Zawidawie sp. z o.o. ul. Wejherowska 28 54-239 Wrocław II. Tytuł realizowanego Projektu. Zamawiający oświadcza, że niniejsze zapytanie ofertowe jest

Bardziej szczegółowo

Załącznik Nr 1. Istotne warunki zamówienia do przetargu nieograniczonego na wykonanie pakietu usług programistycznych

Załącznik Nr 1. Istotne warunki zamówienia do przetargu nieograniczonego na wykonanie pakietu usług programistycznych Załącznik Nr 1 Do pisma IMP PAN ZDN/1234/2007 z 2007-06-19 o ogłoszeniu przetargu nieograniczonego na pakiet usług programistycznych, których wartość nie przekracza progu, od którego obowiązuje prawo

Bardziej szczegółowo

ZAPYTANIE OFERTOWE. 1. Przedmiot zakupu - realizacja następujących działań z kategorii DOR do II Etapu Projektu:

ZAPYTANIE OFERTOWE. 1. Przedmiot zakupu - realizacja następujących działań z kategorii DOR do II Etapu Projektu: Kielce, dnia 22.04.2015 roku Nettelekom GK Sp. z o.o. ul. Poleska 44 lok. 13 25-325 Kielce Projekt współfinansowany przez Unię Europejską z Europejskiego Funduszu Rozwoju Regionalnego w ramach Programu

Bardziej szczegółowo



Bardziej szczegółowo

epuap Opis standardowych elementów epuap

epuap Opis standardowych elementów epuap epuap Opis standardowych elementów epuap Projekt współfinansowany ze środków Europejskiego Funduszu Rozwoju Regionalnego w ramach Programu Operacyjnego Innowacyjna Gospodarka SPIS TREŚCI SPIS TREŚCI...

Bardziej szczegółowo


DOTACJE NA INNOWACJE INWESTUJEMY W WASZĄ PRZYSZŁOŚĆ Mrągowo, dn. 21.01.2014 r Szanowni Państwo! Firma AdamS H. Pędzich z siedzibą w Mrągowie ul. Giżycka 5, producent okien i drzwi, na potrzeby realizacji projektu Wdrożenie systemu do zarządzania produkcją

Bardziej szczegółowo

ZAPYTANIE OFERTOWE na: Dostawę i wdrożenie rozwiązań systemu informatycznego Integracja B2B

ZAPYTANIE OFERTOWE na: Dostawę i wdrożenie rozwiązań systemu informatycznego Integracja B2B LTC Sp. z o.o. ul. Narutowicza 2 98-300 Wieluń NIP 827-000-78-03 REGON 005267185 ZAPYTANIE OFERTOWE na: Dostawę i Zapytanie ofertowe obejmuje: Zakup usług o charakterze analizy przedwdrożeniowej Zakup

Bardziej szczegółowo



Bardziej szczegółowo

firmy produkty intranet handel B2B projekty raporty notatki

firmy produkty intranet handel B2B projekty raporty notatki firmy mail intranet produkty DOKUMENTY handel raporty B2B projekty notatki serwis zadania Dlaczego warto wybrać Pakiet ITCube? Najczęściej wybierany polski CRM Pakiet ITCube jest wykorzystywany przez ponad

Bardziej szczegółowo


RELACYJNE BAZY DANYCH RELACYJNE BAZY DANYCH Aleksander Łuczyk Bielsko-Biała, 15 kwiecień 2015 r. Ludzie używają baz danych każdego dnia. Książka telefoniczna, zbiór wizytówek przypiętych nad biurkiem, encyklopedia czy chociażby

Bardziej szczegółowo



Bardziej szczegółowo

Propozycja standaryzacji usługi lokalizacji adresu

Propozycja standaryzacji usługi lokalizacji adresu dr inż. Waldemar Izdebski 1,2 mgr inż. Andrzej Bielasty 2 Propozycja standaryzacji usługi lokalizacji adresu Numery adresowe są jednym z najprostszych elementów danych przestrzennych. Niemniej jednak są

Bardziej szczegółowo

Zapytanie ofertowe. Warszawa, 18.06.2015 r.

Zapytanie ofertowe. Warszawa, 18.06.2015 r. Zapytanie ofertowe dotyczące wprowadzania, przez osoby fizyczne bądź osoby fizyczne prowadzące działalność gospodarczą, danych w bazie CRM, na potrzeby realizacji projektu Wzornictwo Biznes - Zysk w okresie

Bardziej szczegółowo


ZAPYTANIE OFERTOWE PRZEDMIOT ZAMÓWIENIA: Warszawa, 01.08.2013 Nr Sprawy: 01/08/STADENT/2013 ZAPYTANIE OFERTOWE PRZEDMIOT ZAMÓWIENIA: Zakup kompleksowych usług informatycznych i technicznych, wartości niematerialnych i prawnych, nowych środków

Bardziej szczegółowo

zaprasza do składania ofert w odpowiedzi na: ZAPYTANIE OFERTOWE nr E2 / 02

zaprasza do składania ofert w odpowiedzi na: ZAPYTANIE OFERTOWE nr E2 / 02 Warszawa, dnia 15.12.2014 r. zaprasza do składania ofert w odpowiedzi na: ZAPYTANIE OFERTOWE nr E2 / 02 Dotyczy umowy o dofinansowanie nr UDA-POIG.08.02.00-14-086/14-00 zawartej w dniu 27.06.2014 roku

Bardziej szczegółowo

Wyższa Szkoła Filologiczna we Wrocławiu, ul. Sienkiewicza 32, 50 335 Wrocław NIP: 898 19 89 485, tel. 71 328 14 14,

Wyższa Szkoła Filologiczna we Wrocławiu, ul. Sienkiewicza 32, 50 335 Wrocław NIP: 898 19 89 485, tel. 71 328 14 14, Wyższa Szkoła Filologiczna we Wrocławiu, ul. Sienkiewicza 32, 50 335 Wrocław NIP: 898 19 89 485, tel. 71 328 14 14, ZAPYTANIE OFERTOWE NR 1/11.06.2015/RPU2 I. Tryb postępowania Postępowanie

Bardziej szczegółowo

Załącznik nr 1. Specyfikacja techniczna portalu internetowego Łódź, 15.10.2012 r.

Załącznik nr 1. Specyfikacja techniczna portalu internetowego Łódź, 15.10.2012 r. Załącznik nr 1. Specyfikacja techniczna portalu internetowego Łódź, 15.10.2012 r. Stworzenie platformy internetowej na potrzeby projektu. 1 Wykonanie portalu internetowego na potrzeby e-usługi, obejmującego

Bardziej szczegółowo

na zakup usługi badawczej

na zakup usługi badawczej Łódź, dn. 08.09.2015r. Zapytanie ofertowe nr 1/OF/2015 na zakup usługi badawczej w ramach projektu,, Bakteriofagowy preparat do leczenia zapalenia wymienia u krów wywołanego bakteriami antybiotykopornymi

Bardziej szczegółowo


DOTACJE NA INNOWACJE Strzyżów, 29-05-2013 Ogłoszenie o zamówieniu kompleksowego wdrożenia systemu B2B do współpracy handlowej pomiędzy firmą Triton a Partnerami Zamawiający: TRITON S.C. Marcin Bosek, Janusz Rokita ul. Słowackiego

Bardziej szczegółowo

ZAPYTANIE OFERTOWE. Dotacje na Innowacje

ZAPYTANIE OFERTOWE. Dotacje na Innowacje Kościelna Wieś, dnia 19.06.2012 r. Nr Sprawy: 01/06/PAKOS/2012 ZAPYTANIE OFERTOWE Przedmiot zamówienia stanowi: Zakup kompleksowych usług informatycznych i programistycznych w zakresie działań przygotowawczych

Bardziej szczegółowo

Sposób tworzenia tabeli przestawnej pokażę na przykładzie listy krajów z podstawowymi informacjami o nich.

Sposób tworzenia tabeli przestawnej pokażę na przykładzie listy krajów z podstawowymi informacjami o nich. Tabele przestawne Tabela przestawna to narzędzie służące do tworzenia dynamicznych podsumowań list utworzonych w Excelu lub pobranych z zewnętrznych baz danych. Raporty tabeli przestawnej pozwalają na

Bardziej szczegółowo

Opis wymagań i program szkoleń dla użytkowników i administratorów

Opis wymagań i program szkoleń dla użytkowników i administratorów Załącznik nr 3 do OPZ Opis wymagań i program szkoleń dla użytkowników i administratorów Spis treści Wprowadzenie...2 1. Typ i zakres szkoleń...2 2. Grupy użytkowników...2 3. Warunki ogólne szkoleń...3

Bardziej szczegółowo


SZCZEGÓŁOWY OPIS PRZEDMIOTU ZAMÓWIENIA SZCZEGÓŁOWY OPIS PRZEDMIOTU ZAMÓWIENIA 1) ZAMAWIAJĄCY PIOMAR Sp. z o.o. ul. Światowida 16 45-325 Opole 2) TRYB UDZIELENIA ZAMÓWIENIA W niniejszym zamówieniu nie mają zastosowania przepisy ustawy Prawo

Bardziej szczegółowo

TWÓJ BIZNES. Nasz Obieg Dokumentów

TWÓJ BIZNES. Nasz Obieg Dokumentów 1 Innowacyjny System Elektronicznego Obiegu Dokumentów i Spraw opracowany przez firmę WASKO S.A., na podstawie wieloletnich doświadczeń zdobytych na rynku systemów teleinformatycznych. TWÓJ BIZNES Nasz

Bardziej szczegółowo Zmiany w Błyskawiczny eksport danych PLANOWANIE ZAJĘĆ, REZERWOWANIE SAL I ZASOBÓW Zmiany w Błyskawiczny eksport danych PLANOWANIE ZAJĘĆ, REZERWOWANIE SAL I ZASOBÓW Zmiany w Błyskawiczny eksport danych... 1 Jak wyeksportować dane... 1 Eksportowanie planu studiów, zajęć, statystyk i danych słownikowych... 2 Dostosowywanie wyników eksportu... 4 Filtrowanie

Bardziej szczegółowo

Opis przedmiotu zamówienia

Opis przedmiotu zamówienia Załącznik nr 1 do SIWZ Opis przedmiotu zamówienia Przedmiotem zamówienia jest usługa opracowania dokumentów standaryzujących tworzenie Elektronicznej Dokumentacji Medycznej wraz z aktualizacją transformaty

Bardziej szczegółowo

DOTACJE NA INNOWACJE. Inwestujemy w waszą przyszłość. Zapytanie ofertowe

DOTACJE NA INNOWACJE. Inwestujemy w waszą przyszłość. Zapytanie ofertowe Nitrotek Sp. z o.o. ul. Krynicka 40/7 50-555 Wrocław Wrocław, dnia 07.01.2014 r. Zapytanie ofertowe W związku z realizacją projektu Wdrożenie nowoczesnego systemu B2B automatyzującego współpracę Nitrotek

Bardziej szczegółowo

PHICS - Polish Harbours Information & Control System Dokumentacja użytkownika System weryfikacji autentyczności polskich dokumentów marynarzy

PHICS - Polish Harbours Information & Control System Dokumentacja użytkownika System weryfikacji autentyczności polskich dokumentów marynarzy PHICS - Polish Harbours Information & Control System Dokumentacja użytkownika System weryfikacji autentyczności polskich dokumentów marynarzy Zielona Góra, kwiecień 2014 DOKUMENTACJA ZMIAN: Lp. Wersja

Bardziej szczegółowo

Zapytanie ofertowe na opracowanie programu komputerowego i aplikacji internetowej z zakresu badań ewaluacyjnych w szkole

Zapytanie ofertowe na opracowanie programu komputerowego i aplikacji internetowej z zakresu badań ewaluacyjnych w szkole Zabrze, 09.05.2013 Zapytanie ofertowe na opracowanie programu komputerowego i aplikacji internetowej z zakresu badań ewaluacyjnych w szkole Firma Pro-Publico realizująca w partnerstwie z Gimnazjum nr 20

Bardziej szczegółowo

- znajomości podstawowych protokołów sieciowych (h[p(s), smtp, imap, samba)

- znajomości podstawowych protokołów sieciowych (h[p(s), smtp, imap, samba) - - - KONKURS ARCHITEKT SYSTEMOWY KONSULTANT SYSTEMOWY - PROGRAMISTA INŻYNIER WSPARCIA TECHNICZNEGO dotyczy: Umowa o dofinansowanie POIG.01.04.00-12- 093/12 Nr zamówienia: NM TT/5/03/2013 Data zapytania:

Bardziej szczegółowo


DOTACJE NA INNOWACJE Rzeszów, 02.05.2012 Ogłoszenie o zamówieniu na analizę przedwdrożeniową i usługi doradcze Zamawiający: Przedsiębiorstwo Produkcyjno Usługowo Handlowe M.A.M. Marek Wróblewski ul. Gen. Leopolda Okulickiego

Bardziej szczegółowo


ZAPYTANIE OFERTOWE NR 1/POIR/2015 ZAPYTANIE OFERTOWE NR 1/POIR/2015 dotyczące wyboru podwykonawcy, któremu zostanie zlecona część prac merytorycznych projektu. Usługa badawcza jest planowana w ramach projektu polegającego na opracowaniu

Bardziej szczegółowo

Opis znaczenia kryterium. Lp. Nazwa kryterium Opis kryterium. 1. Wnioskodawca przeprowadził inwentaryzację zasobów nauki objętych projektem.

Opis znaczenia kryterium. Lp. Nazwa kryterium Opis kryterium. 1. Wnioskodawca przeprowadził inwentaryzację zasobów nauki objętych projektem. Kryteria merytoryczne wyboru projektów dla poddziałania 2.3.1 Cyfrowe udostępnianie informacji sektora publicznego (ISP) ze źródeł administracyjnych oraz zasobów nauki Programu Operacyjnego Polska Cyfrowa

Bardziej szczegółowo

Barcinek, 04.08.2014 (miejsce i data)

Barcinek, 04.08.2014 (miejsce i data) Barcinek, 04.08.2014 (miejsce i data) Zapytanie ofertowe dotyczące projektu realizowanego w ramach Regionalnego Programu Operacyjnego dla województwa Dolnośląskiego na lata 2007-2013 Priorytet 1 Wzrost

Bardziej szczegółowo


WYJAŚNIENIA NR 2 TREŚCI SIWZ CPI-ZZP-2244-40-495/13 Warszawa, dnia 24 stycznia 2013 roku Wykonawcy, którzy pobrali SIWZ w postępowaniu nr 40-CPI-ZZP-2244/12 Działając na podstawie art. 38 ust. 1a, ust. 2 i ust. 4 w zw. z art. 12a

Bardziej szczegółowo

Tworzenie bazy danych na przykładzie Access

Tworzenie bazy danych na przykładzie Access Tworzenie bazy danych na przykładzie Access Tworzenie tabeli Kwerendy (zapytania) Selekcja Projekcja Złączenie Relacja 1 Relacja 2 Tworzenie kwedend w widoku projektu Wybór tabeli (tabel) źródłowych Wybieramy

Bardziej szczegółowo

Zapytanie ofertowe nr 6/HR/126/12/13

Zapytanie ofertowe nr 6/HR/126/12/13 Toruń, dnia 16.01.2013 Wyższa Szkoła Bankowa w Toruniu ul. Młodzieżowa 31a 87-100 Toruń Zapytanie ofertowe nr 6/HR/126/12/13 1. Zamawiający: Wyższa Szkoła Bankowa w Toruniu z siedzibą przy ul. Młodzieżowej

Bardziej szczegółowo


OPIS i SPECYFIKACJA TECHNICZNA OPIS i SPECYFIKACJA TECHNICZNA Dotyczy Konkursu ofert numer 1/POIG 8.2/2013 WdroŜenie internetowego systemu klasy B2B do automatyzacji procesów biznesowych oraz koordynacji działań z partnerami w firmie

Bardziej szczegółowo

Zapytanie ofertowe nr 01/12/2013

Zapytanie ofertowe nr 01/12/2013 nr 01/12/2013 Zakup i wdrożenie systemu B2B a także integracja wszystkich elementów systemu B2B oraz szkolenie specjalistyczne Warszawa, 20.11.2013 Działanie POIG 8.2 Veriti sp. z o.o. ul. Koszycka 8 01-446

Bardziej szczegółowo


ZAPYTANIE OFERTOWE nr 02/NADAJE/2014 ZAPYTANIE OFERTOWE nr 02/NADAJE/2014 [Dotyczy umowy o dofinansowanie: UDA-POIG.08.02.00-02-023/14-00] W związku z realizacją projektu pt.: Wdrożenie innowacyjnego systemu B2B automatyzującego procesy zdalnej

Bardziej szczegółowo

I Przedmiot Zamówienia:

I Przedmiot Zamówienia: Nitrotek Sp. z o.o. ul. Krynicka 40/7 50-555 Wrocław DOTACJE NA INNOWACJE. Inwestujemy w waszą przyszłość. Wrocław, dnia 07.05.2013 r. Zapytanie ofertowe W związku z realizacją projektu Wdrożenie nowoczesnego

Bardziej szczegółowo

Opis znaczenia kryterium. Lp. Nazwa kryterium Opis kryterium

Opis znaczenia kryterium. Lp. Nazwa kryterium Opis kryterium Kryteria merytoryczne wyboru projektów dla poddziałania 2.3.2 Cyfrowe udostępnienie zasobów kultury Programu Operacyjnego Polska Cyfrowa na lata 2014-2020 Typ projektu Cyfrowe udostępnienie zasobów kultury

Bardziej szczegółowo

ZAPYTANIE OFERTOWE. Wsparcie projektów celowych

ZAPYTANIE OFERTOWE. Wsparcie projektów celowych ZAPYTANIE OFERTOWE Wsparcie projektów celowych Wrocław, dnia 01 października 2011 r. Zwracamy się z prośbą o przedstawienie oferty handlowej na zakup systemu zarządzania procesami w ramach Działania 1.4

Bardziej szczegółowo



Bardziej szczegółowo


POIG.05.02.00-00-001/14 Zapytanie ofertowe dotyczące: zaprojektowania, instalacji, wdrożenia oraz obsługi technicznej portalu projektu Wzornictwo Biznes Zysk nr umowy o dofinansowanie POIG.05.02.00-00-001/14 Warszawa, 11.07.2014

Bardziej szczegółowo

Zakres wymagań dotyczących Dokumentacji Systemu

Zakres wymagań dotyczących Dokumentacji Systemu Załącznik nr 2 do Umowy nr CUI/.../.../.../2014 z dnia r. Zakres wymagań dotyczących Dokumentacji Systemu 1. Uwagi i wymagania ogólne 1. Dokumentacja musi zostać dostarczona w wersji elektronicznej edytowalnej

Bardziej szczegółowo

Plan. Wprowadzenie. Co to jest APEX? Wprowadzenie. Administracja obszarem roboczym

Plan. Wprowadzenie. Co to jest APEX? Wprowadzenie. Administracja obszarem roboczym 1 Wprowadzenie do środowiska Oracle APEX, obszary robocze, użytkownicy Wprowadzenie Plan Administracja obszarem roboczym 2 Wprowadzenie Co to jest APEX? Co to jest APEX? Architektura Środowisko Oracle

Bardziej szczegółowo

Zapytanie ofertowe nr 1/POIG 8.2/2013

Zapytanie ofertowe nr 1/POIG 8.2/2013 Świecie, 02.12.2013r. Zapytanie ofertowe nr 1/POIG 8.2/2013 Zamawiający: Drukarnia MW Wieczorek Mirosław Ul. Gen. J. Hallera 7G, 86-100 Świecie NIP: 5591391666, REGON: 093072292 Tel. 525256081, Fax. 525256081

Bardziej szczegółowo