PRACE ORYGINALNE. komory serca (LVH). Spoœród genów kandydatów warunkuj¹cych ryzyko. rozwoju nadciœnienia têtniczego. Zale na

Wielkość: px
Rozpocząć pokaz od strony:

Download "PRACE ORYGINALNE. komory serca (LVH). Spoœród genów kandydatów warunkuj¹cych ryzyko. rozwoju nadciœnienia têtniczego. Zale na"

Transkrypt

1 PRACE ORYGINALNE Beata KIEÆ-WILK 1 Agnieszka OLSZANECKA 2 Magdalena MIKO AJCZYK 3 Kalina KAWECKA-JASZCZ 2 Rola polimorfizmu M235T (c.704c>t) genu dla angiotensynogenu oraz A724A (c.2171g>a) genu dla SERCA2a w etiopatogenezie przerostu miêœnia lewej komory serca w pierwotnym nadciœnieniu têtniczym Role of the M235T (c.704c>t) polymorphism of angiotensynogen gene as well as A724A (c.2171g>a) polymorphism of SERCA2a gene in ethiopathogenesis of left ventricular hypertrophy in essential hypertension 1 Katedra i Klinika Chorób Metabolicznych, CM UJ, Kraków Kierownik Katedry i Kliniki Chorób Metabolicznych CM UJ: Prof. dr hab. med. Maciej Ma³ecki 2 I Klinika Kardiologii i Nadciœnienia Têtniczego, CM UJ Kraków Kierownik I Kliniki Kardiologii i Nadciœnienia Têtniczego, CM UJ: Prof. dr hab. med. Kalina Kawecka Jaszcz 3 Katedra Biochemii Klinicznej CM UJ, Kraków Kierownik Katedry Biochemii Klinicznej CM UJ: prof. dr hab. med. Aldona Dembiñska-Kieæ Dodatkowe s³owa kluczowe: angiotensynogen jony wapnia LVH nadciœnienie têtnicze polimorfizm SERCA Additional key words: angiotensynogen calcium ions LVH essential hypertension polymorphism SERCA Adres do korespondencji: Dr n. med Beata Kieæ-Wilk Katedra i Klinika Chorób Metabolicznych CM UJ Kraków, ul Kopernika 15 Tel.: Jedn¹ z najczêstszych zmian narz¹dowych w przebiegu nadciœnienia têtniczego jest przerost miêœnia lewej komory serca (LVH). Spoœród genów kandydatów warunkuj¹cych ryzyko rozwoju nadciœnienia têtniczego i LVH, wykazano promuj¹cy, ale niedecyduj¹cy, udzia³ polimorfizmu (c.704c>t) genu angiotensynogenu (). Wzrost stê enia jonów wapnia w cytoplazmie komórek miêœniowych mo e stanowiæ jeden z czynników w patomechanizmie rozwoju nadciœnienia têtniczego. Zale na od ATP pompa jonowa SERCA2a reguluje stê enie jonów wapnia w cytoplazmie. Mutacje w obrêbie genu, koduj¹cego bia³ko SERCA2a, s¹ zwi¹zane ze zwiêkszeniem stê enia jonów wapnia w kardiomiocytach. Celem badania by³o oszacowanie czêstoœci wystêpowania polimorfizmu M235T (c.704c>t), poszukiwanie nowych mutacji w genu oraz porównanie czêstoœci ich wystêpowania u pacjentów z nadciœnieniem têtniczym (z lub bez LVH) w stosunku do grupy kontrolnej. W badaniu wziê³o udzia³ 157 osób. Na podstawie wyniku badania echokardiograficznego uczestnicy zostali podzieleni na podgrupy: pacjenci z nadciœnieniem têtniczym (NT) i LVH oraz pacjenci z NT bez LVH. Grupê kontroln¹ stanowi³o 50-ciu zdrowych ochotników dobranych pod wzglêdem wieku i parametrów antropometrycznych. W badaniu czêstoœæ homozygot CC polimorfizmu M235T (c.704c>t) genu by³a najwiêksza w grupie z nadciœnieniem têtniczym i LVH, w porównaniu z pacjentami z NT bez LVH (p=0,67) oraz z grup¹ kontroln¹ (p=0,64). Wartoœæ LVMI by³a najwy - sza w grupie nosicieli CC stosunku do homozygot TT (p=0,33), oraz heterozygot CT (p=0,66). Zarówno u homozygot TT jak u nosicieli allelu T stwierdzono wy sze wartoœci ciœnienia têt- Left ventricle hypertrophy (LVH) is main organ complication developing in the course of primary hypertension. Among 'candidates genes' related with development of hypertension as well as LVH; the promoting, but not crucial, influence of (c.704c>t) angiotensinogen () gene was found. The elevated calcium ions concentration in the cytosol of muscle cells, might be one of the element in the ethiopatomechanism of essential hypertension development. The ATP-related ions pomp - SERCA2A regulates the intracellular calcium concentration. Mutations in the gene coding the SERCA2A protein, has been associated with elevated calcium level in cardiomyocytes. The aim of the study was to analyze frequency of the M235T (c.704c>t) gene polymorphism. The new mutations in the gene was searched for in hypertensive patients, independently to the LVH presence in compare to the control group. 157 people participated in the study. Based on the echo-cardiographic examination participants were divided into subgroups: patients with essential hypertension (NT) and patients with NT and LVH. 50 healthy volunteers served as the control group. The frequency of the CC homozygotes, of the M235T (c.704c>t) gene polymorphism, was the highest in the patients with essential hypertension and LVH in compare with patients without LVH (p=0.67) and control group (p=0.64). The value of the LVMI was the highest in CC carriers in compare to homozygotes TT (p=0.33) and CT group (p=0.66). In homozygotes TT as well as in the carriers of allel T, the elevated blood pressures value was detected. In the exon 15 of ATPA2A gene the new polymorphism A724A (C.2171G>A) was found. Only the pres- Przegl¹d Lekarski 2010 / 67 / 3 151

2 niczego krwi. W eksonie 15 genu wykryto obecnoœæ nowego polimorfizmu A724A (C.2171G>A). W badanej grupie wykazano obecnoœæ jedynie homozygot GG i heterozygot GA. Obecnoœæ genotypu GA by³a istotnie wiêksza w grupie kontrolnej w stosunku do grupy z nadciœnieniem têtniczym bez przerostu (p=0,04) oraz grupy z NT i LVH (p=0,05). U nosicieli genotypu GA stwierdzono ni sze wartoœci ciœnienia têtniczego w pomiarach w gabinecie lekarskim oraz w ABPM. Wartoœci LVM oraz LVMI by³y ni sze w grupie zmutowanego genotypu GA w stosunku do grupy GG (p=0,107 dla LVM; p=0,154 dla LVMI). Wyniki sugeruj¹ ochraniaj¹ce dzia³anie polimorfizmu c.2171g>a genu przeciw rozwojowi nadciœnienia i jego powik³ania w postaci LVH. Wydaje siê równie, e polimorfizm c.704c>t genu nie odgrywa decyduj¹cej roli w rozwoju NT. ence of GG and heterozygotes GA was detected in analyzed group. The frequency of GA genotype was significantly higher in control group vs patients with essential hypertension with (p=0.05)/or without LVH (p=0.04). The GA carriers had lower blood pressures values measured in doctor office as well as using ABPM method. The LVM as well as LVMI values were lower in group with mutated genotype GA in compare to GG group (p=0.107 for LVM; p=0.154 for LVMI). Results suggest a protective role of the c.2171g>a polymorphism of the gene against the hypertension as well as LVH development. It seems also that c.704c>t polymorphism of gene does not play crucial role in the essential hypertension development. Wstêp W ci¹gu ostatnich lat opublikowano badania o powi¹zaniu wielu genów z pierwotnym (samoistnym) nadciœnieniem têtniczym, które uwarunkowane jest dzia³aniem produktów okreœlonych genów tzw. genów kandydatów [22]. Dopiero jednak ³¹czny wp³yw zarówno czynników genetycznych i czynników œrodowiskowych prowadzi do podwy szenia ciœnienia têtniczego [9]. Jedn¹ z najczêœciej obserwowanych zmian narz¹dowych w przebiegu NT jest przerost miêœnia lewej komory serca (left ventricular hypetrophy - LVH). Stanowi on wynik odpowiedzi kompensacyjnej serca na wzrost obci¹ enia nastêpczego, aktywacjê uk³adu wspó³czulnego i uk³adu renina-angiotensyna-aldosteron (RAA) [3]. Ten pocz¹tkowo adaptacyjny proces, po przekroczeniu krytycznej masy lewej komory, staje siê niezale nym czynnikiem ryzyka powik³añ sercowo-naczyniowych, rozwoju niewydolnoœci serca czy nag³ej œmierci sercowej [9]. Badania kliniczne wykaza³y zwi¹zek pomiêdzy LVH a 24-godzinn¹ automatyczn¹ rejestracj¹ ciœnienia têtniczego krwi (ABPM, ambulatory blood pressure monitoring) [4]. Ze wzglêdu na œcis³¹ wspó³pracê elementów enzymatyczno-hormonalnego, uk³ad renina-angiotensyna-aldosteron (RAAS, renin-angiotensin-aldosteron system) rozpatruje siê jako jeden funkcjonalny system. RAAS wp³ywa nie tylko na gospodarkê wodno-elektrolitow¹, napiêcie œcian naczyñ, czy regulacjê uk³adu sympatycznego, odgrywa tak e rolê w procesie przebudowy œcian naczyñ i miêœnia serca [15,23]. Ju w 1992 pojawi³y siê doniesienia dotycz¹ce zwi¹zku angiotensynogenu z patogenez¹ nadciœnienia têtniczego [16]. Tanimoto i wsp. stworzyli myszy pozbawione genu ( -/-), u których skurczowe ciœnienie têtnicze by³o ni sze w porównaniu z grup¹ kontroln¹ [10]. Kolejny model zwierz¹t transgeniczych, ze zwielokrotnion¹ kopi¹ genu ukaza³, e proporcjonalnie do wzrostu poziomu we krwi, wzrasta³a wartoœæ skurczowego ciœnienia krwi [35]. Obecnie znanych jest kilka mutacji w obrêbie genu, dla których wykazano zwi¹zek z nadciœnieniem têtniczym [22]. W metaanalizie wykonanej przez Kato i wsp podsumowano udzia³ ró nych polimorfizmów genu w patogenezie nadciœnienia têtniczego w populacji japoñskiej [18]. Badanie to potwierdzi³o œcis³y zwi¹zek wystêpowania polimorfizmu M235T z równoleg³¹ substytucj¹ G(-6)A w promotorze tego genu. Jeunemaitre i wsp. odkryli natomiast, e substytucja metioniny w pozycji 235 ³añcucha polipeptydowego angiotensynogenu przez treoninê (Met235Thr lub M235T) stanowi genetyczn¹ predyspozycjê do nadciœnienia, co prawdopodobnie wi¹ e siê z wy szym (o 20-30%) stê eniem ATG w osoczu u nosicieli T235, co wynika z jego sprzê- enia z polimorfizmem w promotorze genu [17,18]. Wydaje siê równie, e istotny wp³yw polimorfizmu M235T mo na stwierdziæ u przedstawicieli niektórych ras [18,34,37]. Jednak nie wszystkie wyniki zdaj¹ siê potwierdzaæ rolê polimorfizmu M235T w patomechanizmie nadciœnienia têtniczego i LVH. Obserwacje prowadzone w populacji kaukaskiej nie wykaza³y zwi¹zku pomiêdzy polimorfizmem M235T a nadciœnieniem têtniczym [12,21,30]. Coraz czêœciej podkreœla siê bardzo du ¹ ró nicê pomiêdzy grupami etnicznymi; potwierdzaj¹c m.in. znacznie wy sz¹ czêstoœæ polimorfizmu M235T w populacji japoñskiej w porównaniu z ras¹ kaukask¹ (0,75 vs 0,36) [11]. Jony wapnia pe³ni¹ podstawow¹ rolê w pobudzaniu i regulacji skurczu komórek w tym miêœnia sercowego [20]. Gradient stê- eñ przez b³onê komórkow¹ i b³onê retikulum endoplazmatycznego oraz normalizacja poziomu jonów wapnia w cytoplazmie jest utrzymywany przez pompy wapniowe zale ne od ATP takie jak, Na + /K + ATPaza, wymiennik Na + /Ca 2+ oraz Ca 2+ ATPaza - zlokalizowana w b³onie siateczki œródplazmatycznej (SERCA) [13]. Jony wapnia odgrywaj¹ rolê wtórnych przekaÿników, uczestnicz¹ w procesach fizjologicznych, takich jak regulacja wzrostu czy apoptozy komórek, jak i w etiologii rozwoju zmian patologicznych jak przerost miêœnia serca [13,20]. Bia³ko SERCA zbudowane jest z 10-ciu domen przezb³onowych i charakteryzuje siê ewolucyjnie konserwatywn¹ budow¹ [32]. Badania nad funkcj¹ pompy SERCA wykaza³y, e zarówno wystêpuj¹ce w przyrodzie jak i sztucznie wywo³ane mutacje w obrêbie rejonu koduj¹cego pêtlê cytoplazmatyczn¹ L6 7 (pomiêdzy heliksami M6 i M7) powoduje zaburzenie transportu jonów wapnia przez to bia³ko [24]. Mutacja wiod¹ca do zmian w sekwencji aminokwasowej SERCA Asp813Asn/Asp818Asn powodowa³a spadek aktywnoœci ATP-azowej bia³ka, podczas gdy zdolnoœæ wi¹zania jonów wapnia przez SERCA by³a niezmieniona [7,29]. Obecnoœæ zarówno tej mutacji jak i substytucji Pro811Asn, Pro812Asn, Pro820Asn, Pro821Asn warunkowa³ spadek wydolnoœci reakcji gdzie fosforylacji jak i defosforylacji bia³ka SERCA przy udziale ATP, co by³o zwi¹zane z zahamowaniem transportu jonów wapnia [29]. Badania na zwierzêtach transgenicznych udowodni³y, e do prze ycia niezbêdny jest przynajmniej jeden funkcjonalny allel genu [27]. Dalsze obserwacje wykaza³y zmniejszon¹ ekspresjê genu, mierzon¹ jako poziom mrna, w sercach zwierz¹t doœwiadczalnych z kardiomiopati¹ rozstrzeniow¹ [25]. W modelu myszy transgenicznych z obni on¹ iloœci¹ SER- CA2a (SERCA2A+/-) stwierdzono zaburzon¹ relaksacjê lewej komory, jej w³óknienie oraz przerost koncentryczny [36]. W tym samym modelu mysim (SERCA2A +/-) stwierdzono równie bardziej nasilony i znacznie szybciej postêpuj¹cy rozwój niewydolnoœci miêœnia serca, powstaj¹cej w wyniku przeci¹ enia nastêpczego, w porównaniu z grup¹ kontroln¹ myszek Wild type [36]. Obserwacje kliniczne potwierdzi³y rolê SERCA2a w patogenezie zmian w zawale miêœnia serca, kardiomiopatii oraz niewydolnoœci serca. U pacjentów z kardiomiopati¹, jak i z przewlek³¹ niewydolnoœci¹ serca stwierdzano istotne obni enie iloœci bia³ka SERCA2a w kardiomiocytach, co powodowa³o przeci¹ enie komórek jonami Ca 2+ i zaburzenie funkcji miêœnia serca [1,20,28]. U zwierz¹t z wyindukowanym nadciœnieniem, które rozwinê³y LVH, w kardiomiocytach przeros³ego serca po okresie krótkiego wzrostu iloœci SERCA2a obserwowano nastêpowy spadek poziomu tego bia³ka w komórkach [33]. Dodatkowym dowodem roli SERCA2a w patogenezie LVH rozwijaj¹cym siê w trakcie NT jest wykazanie, u zwierz¹t z nadekspresj¹ pompy SERCA2a (czyli o wy szej efektywnoœci transportu Ca 2+ ), zahamowania rozwoju LVH wyniku wynikaj¹cego z przeci¹ enia ciœnieniowego lewej komory w porównaniu z grup¹ kontroln¹ [26]. Celem pracy by³o oszacowanie czêstoœci wystêpowania polimorfizmu M235T (c.704c>t) genu u pacjentów z NT z 152 Przegl¹d Lekarski 2010 / 67 / 3 B. Kieæ-Wilk i wsp.

3 przerostem lewej komory, bez przerostu lewej komory serca oraz w grupie kontrolnej z prawid³owym ciœnieniem têtniczym. Poszukiwanie mutacji w obrêbie genu dla transportera Ca 2+ - SERCA2a i ocena czêstoœci wystêpowania nowo-wykrytych mutacji w obrêbie genu w badanych grupach. Rycina 1 Polimorfizm M235T genu w badaniu Real-Time PCR przy u yciu sond TaqMan. The picture of M235T polymorphism of gene detection using real-time PCR and TaqMan sonds. Rycina 2 Wartoœci ciœnienia skurczowego i rozkurczowego w pomiarach gabinetowych u nosicieli polimorfizmu M235T genu. Wynik stanowi œredni¹ z pomiarów ± SD u wszystkich nosicieli danego genotypu. The value of systolic and diastolic blood pressure, measured in doctor office, in M235T polymorphism of gene carriers. Presented results are mean of all measurements ± SD. Materia³ i metody Pacjenci: Z przebadanych wstêpnie 202 osób do badañ zakwalifikowano 157 uczestników. Byli to mieszkañcy Województwa Ma³opolskiego (z Krakowa i najbli szych okolic). Zakwalifikowane do badania osoby na podstawie wyników badania echokardiograficznego zosta³y podzielone na trzy grupy: grupa z pierwotnym nadciœnieniem têtniczym bez przerostu lewej komory serca (NT LVH (-)), grupa z pierwotnym nadciœnieniem têtniczym oraz przerostem lewej komory serca (NT LVH (+)), grupa kontrolna (osoby zdrowe-bez nadciœnienia i przerostu lewej komory serca) (K). Protokó³ badania zosta³ zaakceptowany przez Komisjê Bioetyczn¹ Uniwersytetu Jagielloñskiego (nr zgody KBET/329/B/2002). Wszyscy uczestnicy otrzymali informacjê o schemacie badania i wyrazili dobrowoln¹, pisemn¹ zgodê na udzia³ w programie. Pomiarów ciœnienia têtniczego dokonano sfigmomanometrem rtêciowym, zgodnie z wytycznymi PTNT; do badania w³¹czono pacjentów z nadciœnieniem têtniczym rozpoznanym i leczonym przez 5-10 lat. 24-godzinn¹ automatyczn¹ rejestracjê ciœnienia têtniczego krwi (ambulatory blood pressure monitoring - ABPM) wykonano z zastosowaniem aparatu SpaceLabs (Redmond, WA, USA). Oceniano œrednie wartoœci ciœnienia têtniczego oraz jego zmiennoœæ oko³odobow¹. U wszystkich uczestników zosta³o wykonane badanie echokardiograficzne M-mode i 2D dla oceny morfologii lewej komory serca, przy pomocy aparatu Hewlett- Packard, Sonos-5500, g³owic¹ o czêstotliwoœci 2.5 MHz. Analizowano parametry strukturalne takie jak: wymiar póÿnorozkurczowy lewej komory (LVIDd), wymiar póÿnoskurczowy lewej komory (LVIDs), gruboœæ tylnej œciany w rozkurczu (PWd), gruboœæ przegrody miêdzykomorowej w rozkurczu (IVSd), gruboœæ tylnej œciany w skurczu (PWs), gruboœæ przegrody miêdzykomorowej w skurczu (IVSs). Masê lewej komory (LVM) obliczano na podstawie formu³y zaproponowanej przez Devereux i wsp.[6] i indeksowano do powierzchni cia³a (BSV) obliczaj¹c wskaÿnik masy lewej komory (LVMI, left ventricular mass index), który w badaniach pos³u y³ do rozpoznawania przerostu miêœnia lewej komory serca (>110 g/m 2 dla kobiet, 125 g/m2 u mê czyzn). Funkcjê rozkurczow¹ lewej komory oceniano przy u yciu badania dopplerowskiego nap³ywu mitralnego. Upoœledzenie relaksacji lewej komory definiowano jako zmniejszenie maksymalnej prêdkoœci nap³ywu w okresie wczesnego rozkurczu (fala E) przy równoczesnym wzroœcie maksymalnej prêdkoœci w czasie skurczu przedsionka (fala A). Oznaczano równie czas deceleracji fali E (dece) oraz czas rozkurczu izowolumetrycznego (IVRT). Do oznaczeñ genetycznych u yto genomowego DNA uzyskanego z leukocytów krwi obwodowej (DNA Isolation Mini Kit, Qiagen). Badanie polimorfizmu M235T (c.704c>t) genu dla angiotensyno genu Polimorfizm ten genotypowano metod¹ PCR w czasie rzeczywistym (Real-Time PCR) z zastosowaniem pary swoistych sond hybrydyzacyjnych typu TaqMan (TaqMan MGB probes, AppliedBiosystem) i aparatu Opticon II (MJ Research) (rycina 1). Do przeprowadzenia reakcji PCR zaprojektowano (za pomoc¹ programu Primer Express Software v2.0, Applications- Based Primer Design Software), startery obejmuj¹ce ekson 2 (miejsce wystêpowania polimorfizmu M235T) -F:GGCTGTGACAGGATGGAAGAC, -R: AGGACGTAGGTGTTGAAAGC oraz odpowiednie sondy typu TaqMan z przy³¹czonymi barwnikami fluorescencyjnymi: -C: 5'-VIC-CCTGACGGGAGCC- MGB/Quencher-3', -T:5'-FAM-CCCTGATGG- GAGCC-MGB/Quencher-3'. Do przeprowadzenia reakcji PCR w czasie rzeczywistym u ywano standardowego protoko³u (QuantiTectProbe PCR, Qiagen). Otrzymane wyniki opracowano programem Opticon Monitor software (MJ Research) stanowi¹cym oryginalne wyposa enie aparatu Opticon II MJ Research. Analiza eksonów 15, 16 i 18 genu Spoœród 21 eksonów genu do dok³adnej analizy wybrano eksony koduj¹ce domeny bezpoœrednio zwi¹zane z transportem jonów wapnia: eksony 16 i 18 - koduj¹ce domeny wi¹ ¹ce jony wapnia oraz ekson 15 koduj¹cy domenê odpowiedzialn¹ za aktywnoœæ ATP-azy (dostarczenie energii do zmiany konformacji bia³ka podczas aktywacji procesu transportu jonów wapnia). Analizê wykonywano metod¹ sekwencjonowania (ABI Prism Genetic Analyzer-3100; PE Biosystems). Reakcjê PCR wykonano zdodnie ze standardowym protoko³em (Taq PCR CoreKit, Qiagen). Zastosowano specyficzne dla ka dego eksonu startery: (SERCA) ex15-f:gcc- TAGGGGTATGAATGTGG, (SERCA) ex15-r: AGA- ACTGGGCTCCATGACC, (SERCA) ex16-f:ccaga- CATTTGGGCTCT, (SERCA) ex16-r:ggg- CATCTCTGTCTTTTGCT, (SERCA) ex18-f: GAGC- CTGGACTTGGGAAATA, (SERCA) ex18-r: CTGG- CCACCATGCTC. Po oczyszczeniu produktów PCR u yto QIAquick PCR Purification kit (Qiagen) i przeprowadzano w³aœciw¹ reakcjê sekwencjonowania (Terminator cycle sequencing kit, Applied Biosystems). Rozdzia³ nukleotydów i analizê sekwencji wykonywano przy u yciu 16-kapilarnego aparatu ABI Prism Genetic Analyzer- 3100; PE Biosystems. Analizy statystyczne prowadzono za pomoc¹ programu STATISTICA 6.0 PL. Zgodnoœæ rozk³adu analizowanych zmiennych iloœciowych z rozk³adem normalnym sprawdzono za pomoc¹ testu Shapiro-Wilk'a. W przypadku braku normalnoœci rozk³adu zastosowano testy nieparametryczne. Porównania dwóch grup badanych przeprowadzono za pomoc¹ testu t -Studenta lub w przypadku braku normalnoœci za pomoc¹ testu U Manna- Whitneya. Do analizy trzech grup stosowano jednoczynnikow¹ analizê wariancji (ANOVA) lub (w przypadku braku normalnoœci) test Kruskala-Wallisa. Po uzyskaniu istotnego statystycznie wyniku kontynuowano analizê wykorzystuj¹c testy post-hoc (np. test Tukeya HSD). Dla zmiennych jakoœciowych u yto testu chi-kwadrat. Powi¹zanie analizowanych zmiennych oceniono przy pomocy analizy regresji prostej lub wielorakiej. Za istotne statystycznie przyjêto wyniki, dla których wartoœæ p<0,05. Przegl¹d Lekarski 2010 / 67 / 3 153

4 Wyniki Badane grupy osób nie ró ni³y siê istotnie pod wzglêdem liczby kobiet i mê czyzn (K:M 52%:48%, p=0,832). Œrednia wieku badanych wynosi³a 52,33 ±1,22 lat. Podczas kwalifikacji do badania zwracano szczególn¹ uwagê na farmakoterapiê nadciœnienia têtniczego. Dalsze analizy nie wykaza³y istotnej ró nicy w farmakoterapii pomiêdzy badanymi grupami pacjentów. Badanymi genotypami w przypadku polimorfizmu M235T (c.704 C>T) genu by³y: CC - uwa any za niezmutowany, prawid³owy genotyp (Wild type), heterozygoty CT oraz homozygoty TT - forma zmutowana wi¹zana z ryzykiem rozwoju nadciœnienia têtniczego, czy procesem remodelingu œcian naczyñ i serca [10]. Nie stwierdzono istotnych ró nic pomiêdzy analizowanymi grupami genotypowymi. W analizie z podzia³em badanych osób na trzy grupy: K, NT LVH(-) i NT LVH (+), nie stwierdzono istotnych ró nic w rozk³adzie genotypu M235T genu (p=0,293). Czêstoœæ homozygot CC by³a najwiêksza w grupie z NT LVH (+) w porównaniu z grup¹ NT LVH(-) (p=0,679) oraz z grup¹ kontroln¹ (p=0,645). Najwiêkszy, nie istotny statystycznie, odsetek heterozygot CT stwierdzono natomiast w grupie kontrolnej. Homozygoty TT najliczniej wystêpowa³y w grupie z nadciœnieniem têtniczym bez LVH w porównaniu z grup¹ z LVH (p=0,532) oraz grup¹ kontroln¹ (p=0,495). W analizie pomiarów ciœnienia têtniczego stwierdzono najwy sze wartoœci ciœnienia têtniczego krwi u nosicieli genotypu TT zarówno w stosunku do grupy CT (p=0,178 dla RRs i p=0,095 dla RRr) jak i do grupy CC (p=0,165 dla RRs i p=0,034 dla RRr) (rycina 2). Nie wykazano istotnych ró nic zarówno ciœnienia skurczowego jak i rozkurczowego z ca³ej doby, jak z nocy oraz dnia, u nosicieli genotypów genu. Analiza wyników pomiarów gruboœci œcian, wymiarów, oraz kurczliwoœci lewej komory serca nie wykaza³a istotnych ró nic miêdzy badanym grupami nosicieli genotypu (p=0,630). Zaobserwowano jednak tendencjê do wy szych wartoœci LVM u homozygot CC w porównaniu z heterozygotami CT jak i nosicielami TT. LVM osi¹gnê³a najwiêksz¹ wartoœæ w grupie CC w porównaniu z grup¹ CT (p=0,09) jak i homozygotami TT (p=0,117). Nie wykazano równie istotnej statystycznie ró nicy pomiêdzy badanymi grupami genotypowymi rozwa aj¹c wartoœæ indeksu LVMI. LVMI by³ najwy szy w grupie nosicieli CC w stosunku do homozygot TT (p=0,331) jak i grupy CT (p=0,111). Wartoœæ LVMI, w przeciwieñstwie do masy lewej komory, by³a wy sza u homozygot TT w stosunku do heterozygot CT (p=0,662) (rycina 3) W analizie parametrów relaksacji lewej komory serca nie stwierdzono istotnych ró - nic pomiêdzy grupami genotypowymi (p=0,078) W wykonanym badaniu analizy sekwencji DNA, wybranych trzech eksonów koduj¹cych domeny bezpoœrednio zwi¹zane z transportem jonów wapnia (Ca 2+ ), genu nie stwierdzono adnych zmian w sekwencji zarówno eksonu 16 jak i eksonu18 u wszystkich przedstawicieli badanych trzech grup. Analiza sekwencji eksonu 15, Rycina 3 Rozk³ad wartoœci LVMI w zale noœci od genotypu polimorfizmu M235T genu. Wynik stanowi œredni¹ z pomiarów ± SD u wszystkich nosicieli danego genotypu. The LVMI value in M235T polymorphism of gene carriers. Presented results are mean of all measurements, in genotype groups, ± SD. Rycina 4 Rozk³ad wartoœci wskaÿnika masy lewej komory serca u nosicieli genotypu genu. Wynik stanowi œredni¹ z pomiarów ± SD u wszystkich nosicieli danego genotypu. The value of left ventricular mass index in carriers of gene polymorphism. Presented results are mean of all measurements, in genotype groups, ± SD. Rycina 5 Wp³yw allelu C i T genu i genotypu na LVMI. Influence of C and T alleles of M235T polymorphism of gene and genotype of gene, on LVMI value. 154 Przegl¹d Lekarski 2010 / 67 / 3 B. Kieæ-Wilk i wsp.

5 Tabela I Wp³yw genotypów genów i na parametry lewej komory serca. The influence of and genes on the left ventricle parameters. Parametr IVSd (mm) LVIDd (mm) vlvm (g) LVMI(g/m2) Czynnik p Parametr 0,224 wykaza³a istnienie nowego, polimorfizmu polegaj¹cego na zamianie guaniny w adeninê w pozycji 2171 (c.2171g>a) genu [19]. Analiza genotypów GG i GA (nie wykazano obecnoœci homozygot AA) genu w trzech badanych grupach wykaza³a istotne ró nice w ich czêstoœci wystêpowania (p=0,048). Czêstoœæ genotypów ró ni³a siê w obrêbie grupy kontrolnej w stosunku do grupy z nadciœnieniem têtniczym bez LVH (p=0,04) oraz grupy z NT i LVH (p=0,05). Heterozygoty GA najczêœciej wystêpowa³y w grupie kontrolnej w porównaniu z grup¹ z nadciœnieniem têtniczym bez przerostu LK (p=0,374) oraz z grup¹ z NT i LVH (p=0,420). Genotyp GG natomiast by³ najczêœciej stwierdzany w grupie z nadciœnieniem têtniczym bez przerostu lewej komory serca w stosunku do grupy z NT i LVH (p=0,923) czy grupy kontrolnej (p=0,374). Wartoœci ciœnienia têtniczego porównano w grupach homozygot GG i heterozygot GA polimorfizmu genu i nie stwierdzono istotnych ró nic w analizowanych parametrach pomiêdzy grupami genotypowymi (p=0,367 dla RRs oraz p=0,439 dla RRr). Na uwagê zas³uguje fakt e u heterozygot GA obserwowano tendencjê do ni - szych wartoœci zarówno ciœnienia skurczowego, œrednio o 4,1 mmhg, jak i ciœnienia rozkurczowego o ok. 2,7 mmhg w porównaniu z nosicielami genotypu GG. Równoczeœnie analiza pomiarów uzyskanych w badaniu ABPM u pacjentów z genotypem GG obserwowano tendencjê do wy szych wartoœci ciœnienia têtniczego krwi. Z przeprowadzonej analizy wynika, e protekcyjna rola wykrytego polimorfizmu ujawnia siê g³ównie w przypadku skurczowego ciœnienia krwi. Analiza parametrów badania echokardiograficznego nie wykaza³a istotnych ró nic pomiêdzy grupami (p=0,653). Zwraca natomiast uwagê fakt wiêkszych œrednich wartoœci gruboœci œcian lewej komory serca w grupie niezmutowanego genotypu GG w stosunku do grupy GA. Równoczeœnie dalsze analizy wykaza³y e œrednie wartoœci LVM jak i LVMI by³y ni sze, choæ nieistotnie, w grupie nosicieli zmutowanego genotypu GA polimorfizmu A724A (c.2171g>a) genu Czynnik PWd (mm) w stosunku do grupy GG (p=0,107 dla LVM, p=0,154 dla LVMI); (rycina 4) Nie stwierdzono istotnych ró nic pomiêdzy badanymi grupami genotypowymi (GG i GA) (p=0,203) w badaniu dopplerowskim gdzie oceniano funkcjê rozkurczow¹ lewej komory serca. Przeprowadzono analizê wariancji wieloczynnikowej sprawdzaj¹c wp³yw samych polimorfizmów na parametry gruboœci œciany lewej komory serca. Analiza wykaza³a istotny wp³yw genotypu na wszystkie oznaczone parametry gruboœci œciany lewej komory (tabela I). Genotyp wp³ywa³ istotnie na wyliczone wskaÿniki przebudowy i przerostu lewej komory serca jak: LVM i LVMI (p= zarówno dla LVMI i LVMI) przy braku wp³ywu genotypu (p=0,353 dla LVM i p=0,341 dla LVMI) (tabela I). Dalsza analiza wp³ywu genotypu oraz alleli C lub T genu na parametry gruboœci œcian lewej komory serca wykaza³a istotny wp³yw obydwu polimorfizmów. Wp³yw genotypu jak i alleli by³ równie istotny na obliczane parametry przebudowy i przerostu lewej komory serca takie jak LVM (p= dla i ) jak i LVMI (p= dla jak i ). Na rycinie 5 przedstawiono wp³yw alleli C i T genu i genotypu na LVMI. U nosicieli GA polimorfizmu A724A (c.2171g>a) genu obserwowano ni sze wartoœci LVMI zarówno u nosiciel allelu T jak i C polimorfizmu M235T (c.704c>t) genu. Tendencja ta by³a szczególnie silnie wyra ona u heterozygot GA polimorfizmu i nosicieli allelu T polimorfizmu (rycina 5). p 0,150 * 0,212 * 0,209 0,1984 0,123 0 EF (%) * 0,227 * 0,207 0,047 0,154 0,152 BSA(m 2 ) * 0,043 * 0,200 0,341 * 0,304 Dyskusja Problem nadciœnienia têtniczego jest tematem wielu prac badawczych zarówno klinicznych jak i doœwiadczalnych [22]. Jedn¹ z podstawowych strategii stosowanych w celu okreœlenia genetycznej predyspozycji do rozwoju pierwotnego nadciœnienia têtniczego jest tzw. badanie zwi¹zku ( association study lub case-control study ) oparte na porównaniu czêstoœci wystêpowania okreœlonych alleli danego genu kandydata w grupie niespokrewnionych chorych z nadciœnieniem ( cases ) i grupie kontrolnej osób bez nadciœnienia ( control ) [2]. Metodê tak¹ zastosowano równie w przedstawionej pracy porównuj¹c czêstoœæ wystêpowania polimorfizmu M235T (c.704c>t) genu oraz polimorfizmu Ala724Ala (c.2171g>a) genu u osób z nadciœnieniem têtniczym a grup¹ kontroln¹. Nale y pamiêtaæ, e lista genów kandydatów warunkuj¹cych predyspozycjê do rozwoju NT i jego powik³añ jest d³uga i niezamkniêta. W odniesieniu do wiêkszoœci genów kandydatów, rozpatrywanych osobno, istniej¹ prace podaj¹ce w w¹tpliwoœæ ich zwi¹zek z patogenez¹ NT [2,12,22,30]. Brak potwierdzenia zwi¹zku nie stanowi jednak dowodu na brak tego powi¹zania. Na wyniki badania oprócz liczebnoœci badanych grup, wp³ywaj¹ bowiem ró ne czynniki zak³ócaj¹ce (jak zmiennoœæ etniczna grup badanych, czêstoœæ wystêpowania danego allelu w populacji, czy ró norodnoœæ badanej populacji). W przeprowadzonych badaniach nie wykazano istotnego zwi¹zku pomiêdzy polimorfizmem M235T genu a nadciœnieniem têtniczym, czy przerostem miêœnia lewej komory serca, co jest zgodne z wczeœniejszymi doniesieniami [12,21,30]. Nie bez znaczenie wydaje siê jednak obserwowana tendencja do wy szych wartoœci ciœnienia têtniczego zarówno u homozygot TT jak i u wszystkich nosicieli allelu T. Obserwowana tendencja zaznacza³a siê szczególnie w gabinetowych pomiarach ciœnienia têtniczego, a nie by³a ju tak silnie wyra ona w badaniu ABPM. Na podstawie otrzymanych wyników mo na wnioskowaæ, e polimorfizm M235T (c.704c>t) genu wydaje siê nie odgrywaæ decyduj¹cej roli w uwarunkowaniu rozwoju nadciœnienia têtniczego krwi u pacjentów z rejonu Ma³opolski. Metaanaliza badaj¹ca rolê znanych, polimorfizmów genu w patogenezie nadciœnienia têtniczego potwierdzi³a œcis³y zwi¹zek wystêpowania polimorfizmu M235T z substytucj¹ G(-6)A w promotorze tego genu [37]. Dalsze badania wykaza³y równie, e polimorfizm M235T (c.704c>t) nie determinuje bezpoœrednio stê enia ATG w osoczu [30]. Przemawia to za mo liw¹ rol¹ tego polimorfizmu w patogenezie NT, jednak e w okreœlonych warunkach. Dodatkowo uzyskane wyniki nie potwierdzi³y jednoznacznie roli polimorfizmu M235T genu w rozwoju LVH. Nie stwierdzono zale noœci pomiêdzy nosicielstwem allelu T a rozwojem LVH. Co wiêcej obserwowano wy sze wartoœci parametrów gruboœci œcian lewej komory, jak i wystandaryzowanych wskaÿników jej masy u nosicieli allelu C. Nale y jednak pamiêtaæ, e korelacja polimorfizmu M235T genu z ryzykiem rozwoju NT i LVH wykazana w populacji japoñskiej czy chiñskiej nie zosta³a potwierdzona m.in. w populacji angielskiej czy afroamerykañskiej [11, 12,21,30] i coraz czêœciej podkreœla siê bardzo du ¹ ró nicê pomiêdzy badanymi grupami etnicznymi. Równoczeœnie kolejnym mo liwym wyt³umaczeniem otrzymanych wyników jest koniecznoœæ opisanego we wczeœniejszych pracach, wspó³wystêpowania dwóch polimorfizmów genu : badanego M235T (c.704c>t) oraz zmiany w obrêbie promotora genu G(-6)A [18]. Obserwacje klinicz- Przegl¹d Lekarski 2010 / 67 / 3 155

6 ne wykaza³y, e dopiero analiza wspó³wystêpowania obu tych polimorfizmów t³umaczy zwiêkszone ryzyko rozwoju NT i jego powik³añ narz¹dowych[16,18]. Prezentowana praca zajmowa³a siê poszukiwaniem nowych mutacji w obrêbie eksonów, genu, koduj¹cych domeny bezpoœrednio zwi¹zane z transportem jonów wapnia u pacjentów z nadciœnieniem, powik³anym lub nie LVH. W trakcie analiz wykryto obecnoœæ nowej mutacji A724A (c.2171g>a) w genie. Sekwencja koduj¹ca obejmowa³a domenê zwi¹zana z aktywnoœci¹ ATP-azow¹, najbardziej konserwatywn¹ ewolucyjnie czêœci¹ bia³ka SERCA [19,20]. U nosicieli polimorfizmu A724A (c.2171g>a) genu stwierdzano istotnie obni on¹ czêstoœæ rozwoju nadciœnienia têtniczego. Heterozygotyczni nosiciele GA charakteryzowali siê ni szymi wartoœciami ciœnienia têtniczego zarówno w pomiarach gabinetowych jak i w ABPM. Dodatkowo ochronne dzia³anie wykrytego polimorfizmu eksonu 15 genu by³o wyraÿnie zaznaczone w przypadku procesu remodelingu w przebiegu nadciœnienia têtniczego. Czêstoœæ heterozygot GA by³a wyraÿnie ni sza w grupie z LVH w porównaniu z homozygotami GG. U nosicieli genotypu GA obserwowano tendencjê do ni szych wartoœci parametrów LVM oraz LVMI w stosunku do grupy GG. Os³aniaj¹ce dzia³anie polimorfizmu A724A (c.2171g>a) genu jest dodatkowo tym dziwniejsze bardziej zastanawiaj¹ce, e nie zmienia on sekwencji aminokwasowej bia³ka SERCA2a, a przez to polimorfizm ten nie powinien bezpoœrednio wp³ywaæ na funkcjê transportera. Wyt³umaczeniem tego zjawiska mo e byæ np. wystêpowanie tego polimorfizmu z inn¹ mutacj¹, zlokalizowan¹ w innej czêœci genu. Polimorfizm A724A (c.2171g>a) mo e wystêpowaæ jako mutacja z³o ona (haplotyp), podobnie jak by³o to stwierdzone w przypadku polimorfizmu M235T (c.704c>t) i G(-6)A genu [18]. Mo liwe, e polimorfizm A724A (c.2171g>a) genu ³¹czy siê z niezbadan¹ w tej pracy, mutacj¹ zlokalizowan¹ w promotorze genu b¹dÿ te zlokalizowana jest w obrêbie intronów tego genu. Potwierdzono bowiem, e mutacje w niekoduj¹cej czêœci genu równie istotnie wp³ywaj¹ na funkcjê bia³ka [14]. Uzyskane wyniki pracy nie mog¹ daæ jednoznacznej odpowiedzi, co do genetycznych uwarunkowañ ryzyka rozwoju nadciœnienia têtniczego czy jego powik³añ zwi¹zanych z przebudow¹ narz¹dow¹. O tym jak z³o ona jest patogeneza NT jako choroby wielogenowej œwiadcz¹ badania, które od kilku ju lat podejmuj¹ próby ³¹cznej analizy równoczesnego wp³ywu wielu polimorfizmów na podatnoœæ rozwoju przerostu lewej komory serca w przebiegu NT [2,5,22] Przeprowadzone badania mog¹ przyczyniæ siê do wykrycia swoistego uk³adu alleli genów kandydatów zwiêkszaj¹cych ryzyko rozwoju nadciœnienia têtniczego, lub jego powik³añ zw³aszcza w aspekcie oddzia³ywania gen-gen czy œrodowisko-gen, co udowadniaj¹ badania asocjacyjne GWA (genom associacion study) [9]. Przedstawione badania zwracaj¹ uwagê na rolê regulatorów SERCA2a, (np. fosfolambanu) w przebudowie œcian naczyñ i miêœnia serca [20]. Stworzenie zestawu polimorfizmów genów kandydatów mo e staæ siê w przysz³oœci podstaw¹ do opracowania przesiewowych, genetycznych testów diagnostycznych umo liwiaj¹cych okreœlenie indywidualnego ryzyka chorego, co wp³ywa³oby na wczesne wdro enie postêpowania prewencyjnego lub zintensyfikowanie terapii prewencyjnej uwzglêdniaj¹cej oddzia³ywanie œrodowisko-gen-gen-fenotyp. Piœmiennictwo 1. Barrans J.D., Allen P.D., Stamatiou D., Dzau V.J., Liew C.C.: Global gene expression profiling of endstage dilated cardiomyopathy using a human cardiovascular-based cdna microarray. Am. J. Pathol. 2002, 160, Binder A.: A review of the genetics of essential hypertension. Curr. Opin. Cardiol. 2007, 22, Buikema H.: Essential hypertension and left ventricular hypertrophy in cardiovascular disease: beyond overactivity of the renin-angiotensin-aldosterone-sodium system. J. Hypertens. 2003, 21, Cuspidi C., Michev I., Meani S., Valerio C. et al.: Non-dipper treated hypertensive patients do not have increased cardiac structural alterations. Cardiovasc. Ultrasound. 2003, 1,1. 5. Deschepper C.F., Boutin-Ganache I., Zahabi A., Jiang Z.: In search of cardiovascular candidate genes: interactions between phenotypes and genotypes. Hypertension 2002, 39, Devereux R.B., Casale P.N., Hammond I.W. et al.: Echocardiographic detection of pressure-overload left ventricular hypertrophy: effect of criteria and patient population. J. Clin. Hypertens. 1987,3, Falson P., Menguy T., Corre F., Bouneau L. et al.: The cytoplasmic loop between putative transmembrane segments 6 and 7 in sarcoplasmic reticulum Ca2+-ATPase binds Ca 2+ and is functionally important. J. Biol. Chem. 1997, 272, Franks P.W.: Identifying genes for primary hypertension: methodological limitations and gene-environment interactions. J. Hum. Hypertens. 2009, 23, Frayling T.M.: Genome-wide association studies provide new insights into type 2 diabetes aetiology. Nat. Rev. Genet. 20, 8, Gaddam K.K., Verma A., Thompson M. et al.: Hypertension and cardiac failure in its various forms. Med. Clin. North Am. 2009, 93, Hata A.: Role of angiotensinogen in the genetics of essential hypertension. Life Sci. 1995, 57, Hingorani A.D., Sharma P., Jia H. et al.: Blood pressure and the M235T polymorphism of the angiotensinogen gene. Hypertension 1996, 28, Hovnanian A.: SERCA pumps and human diseases. Subcell. Biochem. 2007, 45, Hur D.J., Raymond G.V., Kahler S.G. et al.: A novel MGP mutation in a consanguineous family: review of the clinical and molecular characteristics of Keutel syndrome. Am. J. Med. Genet. A. 2005,135, Jansen P.M., Danser A.H., Imholz B.P., van den Meiracker A.H.: Aldosterone-receptor antagonism in hypertension. J.Hypertens. 2009,27, Jeunemaitre X., Inoue I., Williams C. et al.: Haplotypes of angiotensinogen in essential hypertension. Am. J. Hum. Genet. 1997, 60, Jeunemaitre X., Soubrier F., Kotelevtsev Y.V. et al.: Molecular basis of human hypertension: role of angiotensinogen. Cell. 1992, 71, Kato N., Sugiyama T., Morita H., Kurihara H. et al.: Angiotensinogen gene and essential hypertension in the Japanese: extensive association study and meta-analysis on six reported studies. J. Hypertens. 1999, 17, Kiec-Wilk B., Dembinska-Kiec A., Olszanecka A. et al.: A724A polymorphism of sarco(endo)plasmic reticulum Ca2+-ATPase 2 (SERCA2) in hypertensive patients. Clin. Chem. Lab. Med. 2007, 45, Kieæ-Wilk B., Petkow-Dimitrow P., Kwaœniak M., Dembiñska-Kieæ A.: Role of impaired calcium homeostasis in the development of cardiac hypertrophy. Kardiol. Pol. 2009, 67, Larson N., Hutchinson R., Boerwinkle E.: Lack of association of 3 functional gene variants with hypertension in African Americans. Hypertension 2000, 35, Lee W.K., Padmanabhan S., Dominiczak A.F.: Genetics of hypertension: from experimental models to clinical applications. J. Hum. Hypertens. 2000,14, Mahmud A., Feely J.: Arterial stiffness and the reninangiotensin-aldosterone system. Renin. Angiotensin. Aldosterone. Syst. 2004,5, Menguy T., Corre F., Bouneau L. et al.: The cytoplasmic loop located between transmembrane segments 6 and 7 controls activation by Ca2+ of sarcoplasmic reticulum Ca2+-ATPase. J. Biol. Chem. 1998, 273, Minamisawa S., Hoshijima M., Chu G. et al.: Chronic phospholamban-sarcoplasmic reticulum calcium ATPase interaction is the critical calcium cycling defect in dilated cardiomyopathy. Cell. 1999,99, Nakayama H., Otsu K., Yamaguchi O. et al.: Cardiac-specific overexpression of a high Ca2+ affinity mutant of SERCA2a attenuates in vivo pressure overload cardiac hypertrophy. FASEB. J. 2003,17, Periasamy M., Reed T.D., Liu L.H., Ji. Y. et al.: Impaired cardiac performance in heterozygous mice with a null mutation in the sarco(endo)plasmic reticulum Ca 2+ -ATPase isoform 2 (SERCA2) gene. J. Biol. Chem. 1999,274, Pieske B., Maier L.S., Schmidt-Schweda S.: Sarcoplasmic reticulum Ca2+ load in human heart failure. Basic. Res. Cardiol. 2002,97,I Schultz Jel J., Glascock B.J., Witt S.A. et al.: Periasamy M. Accelerated onset of heart failure in mice during pressure overload with chronically decreased SERCA2 calcium pump activity. Am. J. Physiol. Heart. Circ. Physiol. 2004, 286, H Shlyakhto E.V., Shwartz E.I., Nefedova Y.B. et al.: Lack of association of the renin-angiotensin system genes polymorphisms and left ventricular hypertrophy in hypertension. Blood. Press. 2001,10, Smithies O., Kim H.S.: Targeted gene duplication and disruption for analyzing quantitative genetic traits in mice. Proc. Natl. Acad. Sci. USA. 1994, 91, Sweadner K.J., Donnet C.: Structural similarities of Na,K-ATPase and SERCA, the Ca(2+)-ATPase of the sarcoplasmic reticulum. Biochem. J. 2001, 356, Takeuchi K., Nagashima M., Itoh K., Minagawa M. et al.: Improving glucose metabolism and/or sarcoplasmic reticulum Ca 2+ -ATPase function is warranted for immature pressure overload hypertrophied myocardium. Jpn. Circ. J. 2001, 65, Tang W., Devereux R.B., Rao D.C., Oberman A. et al.: Associations between angiotensinogen gene variants and left ventricular mass and function in the HyperGEN study. Am. Heart. J. 2002, 143, Tanimoto K., Sugiyama F., Goto Y. et al.: Angiotensinogen-deficient mice with hypotension. J. Biol. Chem. 1994, 269, Ver Heyen M., Heymans S., Antoons G. et al.: Replacement of the muscle-specific sarcoplasmic reticulum Ca(2+)-ATPase isoform SERCA2a by the nonmuscle SERCA2b homologue causes mild concentric hypertrophy and impairs contraction-relaxation of the heart. Circ. Res. 2001, Wang A.Y., Chan J.C., Wang M. et al.: Cardiac hypertrophy and remodeling in relation to ACE and angiotensinogen genes genotypes in Chinese dialysis patients. Kidney. Int. 2003, 63, Przegl¹d Lekarski 2010 / 67 / 3 B. Kieæ-Wilk i wsp.

Zmodyfikowane wg Kadowaki T in.: J Clin Invest. 2006;116(7):1784-92

Zmodyfikowane wg Kadowaki T in.: J Clin Invest. 2006;116(7):1784-92 Magdalena Szopa Związek pomiędzy polimorfizmami w genie adiponektyny a wybranymi wyznacznikami zespołu metabolicznego ROZPRAWA DOKTORSKA Promotor: Prof. zw. dr hab. med. Aldona Dembińska-Kieć Kierownik

Bardziej szczegółowo

4. OCENA JAKOŒCI POWIETRZA W AGLOMERACJI GDAÑSKIEJ

4. OCENA JAKOŒCI POWIETRZA W AGLOMERACJI GDAÑSKIEJ 4. OCENA JAKOŒCI POWIETRZA 4.1. Ocena jakoœci powietrza w odniesieniu do norm dyspozycyjnych O jakoœci powietrza na danym obszarze decyduje œredni poziom stê eñ zanieczyszczeñ w okresie doby, sezonu, roku.

Bardziej szczegółowo

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków.

Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Zmienność genu UDP-glukuronozylotransferazy 1A1 a hiperbilirubinemia noworodków. Katarzyna Mazur-Kominek Współautorzy Tomasz Romanowski, Krzysztof P. Bielawski, Bogumiła Kiełbratowska, Magdalena Słomińska-

Bardziej szczegółowo

TEST dla stanowisk robotniczych sprawdzający wiedzę z zakresu bhp

TEST dla stanowisk robotniczych sprawdzający wiedzę z zakresu bhp TEST dla stanowisk robotniczych sprawdzający wiedzę z zakresu bhp 1. Informacja o pracownikach wyznaczonych do udzielania pierwszej pomocy oraz o pracownikach wyznaczonych do wykonywania działań w zakresie

Bardziej szczegółowo

CZĘSTOŚĆ WYSTĘPOWANIA WAD KOŃCZYN DOLNYCH U DZIECI I MŁODZIEŻY A FREQUENCY APPEARANCE DEFECTS OF LEGS BY CHILDREN AND ADOLESCENT

CZĘSTOŚĆ WYSTĘPOWANIA WAD KOŃCZYN DOLNYCH U DZIECI I MŁODZIEŻY A FREQUENCY APPEARANCE DEFECTS OF LEGS BY CHILDREN AND ADOLESCENT Zeszyty Naukowe Wyższej Szkoły Pedagogiki i Administracji w Poznaniu Nr 3 2007 Grażyna Szypuła, Magdalena Rusin Bielski Szkolny Ośrodek Gimnastyki Korekcyjno-Kompensacyjnej im. R. Liszki w Bielsku-Białej

Bardziej szczegółowo

Techniki korekcyjne wykorzystywane w metodzie kinesiotapingu

Techniki korekcyjne wykorzystywane w metodzie kinesiotapingu Techniki korekcyjne wykorzystywane w metodzie kinesiotapingu Jak ju wspomniano, kinesiotaping mo e byç stosowany jako osobna metoda terapeutyczna, jak równie mo e stanowiç uzupe nienie innych metod fizjoterapeutycznych.

Bardziej szczegółowo

Koszty obciążenia społeczeństwa. Ewa Oćwieja Marta Ryczko Koło Naukowe Ekonomiki Zdrowia IZP UJ CM 2012

Koszty obciążenia społeczeństwa. Ewa Oćwieja Marta Ryczko Koło Naukowe Ekonomiki Zdrowia IZP UJ CM 2012 Koszty obciążenia społeczeństwa chorobami układu krążenia. Ewa Oćwieja Marta Ryczko Koło Naukowe Ekonomiki Zdrowia IZP UJ CM 2012 Badania kosztów chorób (COI Costof illnessstudies) Ekonomiczny ciężar choroby;

Bardziej szczegółowo

TABELA ZGODNOŚCI. W aktualnym stanie prawnym pracodawca, który przez okres 36 miesięcy zatrudni osoby. l. Pornoc na rekompensatę dodatkowych

TABELA ZGODNOŚCI. W aktualnym stanie prawnym pracodawca, który przez okres 36 miesięcy zatrudni osoby. l. Pornoc na rekompensatę dodatkowych -...~.. TABELA ZGODNOŚCI Rozporządzenie Komisji (UE) nr 651/2014 z dnia 17 czerwca 2014 r. uznające niektóre rodzaje pomocy za zgodne z rynkiem wewnętrznym w zastosowaniu art. 107 i 108 Traktatu (Dz. Urz.

Bardziej szczegółowo

Test BRCA1. BRCA1 testing

Test BRCA1. BRCA1 testing Test BRCA1 BRCA1 testing 2 Streszczenie Za najczęstszą przyczynę występowania wysokiej, genetycznie uwarunkowanej predyspozycji do rozwoju raka piersi i/lub jajnika w Polsce uznaje się nosicielstwo trzech

Bardziej szczegółowo

Migotanie przedsionków problemem wieku podeszłego. Umiarawiać czy nie w tej populacji? Zbigniew Kalarus

Migotanie przedsionków problemem wieku podeszłego. Umiarawiać czy nie w tej populacji? Zbigniew Kalarus Migotanie przedsionków problemem wieku podeszłego. Umiarawiać czy nie w tej populacji? Zbigniew Kalarus Katedra Kardiologii, Wrodzonych Wad Serca i Elektroterapii Śląskie Centrum Chorób Serca w Zabrzu

Bardziej szczegółowo

Prezentacja dotycząca sytuacji kobiet w regionie Kalabria (Włochy)

Prezentacja dotycząca sytuacji kobiet w regionie Kalabria (Włochy) Prezentacja dotycząca sytuacji kobiet w regionie Kalabria (Włochy) Położone w głębi lądu obszary Kalabrii znacznie się wyludniają. Zjawisko to dotyczy całego regionu. Do lat 50. XX wieku przyrost naturalny

Bardziej szczegółowo

Urząd Miasta Bielsko-Biała - um.bielsko.pl Wygenerowano: 2016-06-30/02:29:36. Wpływ promieni słonecznych na zdrowie człowieka

Urząd Miasta Bielsko-Biała - um.bielsko.pl Wygenerowano: 2016-06-30/02:29:36. Wpływ promieni słonecznych na zdrowie człowieka Wpływ promieni słonecznych na zdrowie człowieka Światło słoneczne jest niezbędne do trwania życia na Ziemi. Dostarcza energii do fotosyntezy roślinom co pomaga w wytwarzaniu tlenu niezbędnego do życia.

Bardziej szczegółowo

PRAWA ZACHOWANIA. Podstawowe terminy. Cia a tworz ce uk ad mechaniczny oddzia ywuj mi dzy sob i z cia ami nie nale cymi do uk adu za pomoc

PRAWA ZACHOWANIA. Podstawowe terminy. Cia a tworz ce uk ad mechaniczny oddzia ywuj mi dzy sob i z cia ami nie nale cymi do uk adu za pomoc PRAWA ZACHOWANIA Podstawowe terminy Cia a tworz ce uk ad mechaniczny oddzia ywuj mi dzy sob i z cia ami nie nale cymi do uk adu za pomoc a) si wewn trznych - si dzia aj cych na dane cia o ze strony innych

Bardziej szczegółowo

SPIS TREŒCI. Przedmowa przewodnicz¹cego Rady Naukowej Czasopisma Aptekarskiego... 21

SPIS TREŒCI. Przedmowa przewodnicz¹cego Rady Naukowej Czasopisma Aptekarskiego... 21 SPIS TREŒCI Przedmowa przewodnicz¹cego Rady Naukowej Czasopisma Aptekarskiego........................... 21 Przedmowa sekretarza Naczelnej Rady Aptekarskiej przedstawiciela NRA w EuroPharm Forum................

Bardziej szczegółowo

I. INFORMACJA O KOMITECIE AUDYTU. Podstawa prawna dzialania Komitetu Audytu

I. INFORMACJA O KOMITECIE AUDYTU. Podstawa prawna dzialania Komitetu Audytu w Przewodniczący Jan Robert Halina Podsekretarz Sprawozdanie z realizacji zadań Komitetu Audytu dla dzialów administracja publiczna, informatyzacja, łączność, wyznania religijne oraz mniejszości narodowej

Bardziej szczegółowo

PROCEDURA OCENY RYZYKA ZAWODOWEGO. w Urzędzie Gminy Mściwojów

PROCEDURA OCENY RYZYKA ZAWODOWEGO. w Urzędzie Gminy Mściwojów I. Postanowienia ogólne 1.Cel PROCEDURA OCENY RYZYKA ZAWODOWEGO w Urzędzie Gminy Mściwojów Przeprowadzenie oceny ryzyka zawodowego ma na celu: Załącznik A Zarządzenia oceny ryzyka zawodowego monitorowanie

Bardziej szczegółowo

REGULAMIN WSPARCIA FINANSOWEGO CZŁONKÓW. OIPiP BĘDĄCYCH PRZEDSTAWICIELAMI USTAWOWYMI DZIECKA NIEPEŁNOSPRAWNEGO LUB PRZEWLEKLE CHOREGO

REGULAMIN WSPARCIA FINANSOWEGO CZŁONKÓW. OIPiP BĘDĄCYCH PRZEDSTAWICIELAMI USTAWOWYMI DZIECKA NIEPEŁNOSPRAWNEGO LUB PRZEWLEKLE CHOREGO Załącznik nr 1 do Uchwały Okręgowej Rady Pielęgniarek i Położnych w Opolu Nr 786/VI/2014 z dnia 29.09.2014 r. REGULAMIN WSPARCIA FINANSOWEGO CZŁONKÓW OIPiP BĘDĄCYCH PRZEDSTAWICIELAMI USTAWOWYMI DZIECKA

Bardziej szczegółowo

Steelmate - System wspomagaj¹cy parkowanie z oœmioma czujnikami

Steelmate - System wspomagaj¹cy parkowanie z oœmioma czujnikami Steelmate - System wspomagaj¹cy parkowanie z oœmioma czujnikami Cechy: Kolorowy i intuicyjny wyœwietlacz LCD Czujnik wysokiej jakoœci Inteligentne rozpoznawanie przeszkód Przedni i tylni system wykrywania

Bardziej szczegółowo

Badania wieloośrodkowe w pielęgniarstwie Registered Nurse Forcasting Prognozowanie pielęgniarstwa. Planowanie zasobów ludzkich w pielęgniarstwie

Badania wieloośrodkowe w pielęgniarstwie Registered Nurse Forcasting Prognozowanie pielęgniarstwa. Planowanie zasobów ludzkich w pielęgniarstwie Badania wieloośrodkowe w pielęgniarstwie Registered Nurse Forcasting Prognozowanie pielęgniarstwa. Planowanie zasobów ludzkich w pielęgniarstwie Maria Kózka Zakład Pielęgniarstwa Klinicznego Wydział Nauk

Bardziej szczegółowo

Postanowienia ogólne. Usługodawcy oraz prawa do Witryn internetowych lub Aplikacji internetowych

Postanowienia ogólne. Usługodawcy oraz prawa do Witryn internetowych lub Aplikacji internetowych Wyciąg z Uchwały Rady Badania nr 455 z 21 listopada 2012 --------------------------------------------------------------------------------------------------------------- Uchwała o poszerzeniu możliwości

Bardziej szczegółowo

Bojszowy, dnia 22.02.2010r. Znak sprawy: GZOZ/P1/2010 WYJAŚNIENIE TREŚCI SIWZ

Bojszowy, dnia 22.02.2010r. Znak sprawy: GZOZ/P1/2010 WYJAŚNIENIE TREŚCI SIWZ Bojszowy, dnia 22.02.2010r. Znak sprawy: GZOZ/P1/2010 WYJAŚNIENIE TREŚCI SIWZ Dotyczy: przetargu nieograniczonego na Zakup wraz z dostawą i instalacją aparatu USG dla potrzeb Gminnego Zakładu Opieki Zdrowotnej

Bardziej szczegółowo

Zestawienie wartości dostępnej mocy przyłączeniowej źródeł w sieci RWE Stoen Operator o napięciu znamionowym powyżej 1 kv

Zestawienie wartości dostępnej mocy przyłączeniowej źródeł w sieci RWE Stoen Operator o napięciu znamionowym powyżej 1 kv Zestawienie wartości dostępnej mocy przyłączeniowej źródeł w sieci RWE Stoen Operator o napięciu znamionowym powyżej 1 kv stan na: lipiec 2016 r. RWE Stoen Operator Sp. z o.o. 28/06/2016 STRONA 1 Podstawa

Bardziej szczegółowo

PRAWA AUTORSKIE ZASTRZEŻONE. Kraków, listopad 2010 r

PRAWA AUTORSKIE ZASTRZEŻONE. Kraków, listopad 2010 r Projekt ochrony przeciwhałasowej i ochrony przed drganiami i wibracjami Małopolskiego entrum Biotechnologii Kampusu 0 lecia Odnowienia Uniwersytetu Jagiellońskiego w Krakowie przy ulicy Gronostajowej 7.

Bardziej szczegółowo

Badanie Kobiety na kierowniczych stanowiskach Polska i świat wyniki

Badanie Kobiety na kierowniczych stanowiskach Polska i świat wyniki Badanie Kobiety na kierowniczych stanowiskach i świat wyniki Badanie Manpower Kobiety na kierowniczych stanowiskach zostało przeprowadzone w lipcu 2008 r. w celu poznania opinii dotyczących kobiet pełniących

Bardziej szczegółowo

Jacek Mrzyg³ód, Tomasz Rostkowski* Rozwi¹zania systemowe zarz¹dzania kapita³em ludzkim (zkl) w bran y energetycznej

Jacek Mrzyg³ód, Tomasz Rostkowski* Rozwi¹zania systemowe zarz¹dzania kapita³em ludzkim (zkl) w bran y energetycznej Komunikaty 99 Jacek Mrzyg³ód, Tomasz Rostkowski* Rozwi¹zania systemowe zarz¹dzania kapita³em ludzkim (zkl) w bran y energetycznej Artyku³ przedstawi skrócony raport z wyników badania popularnoœci rozwi¹zañ

Bardziej szczegółowo

Smart Beta Święty Graal indeksów giełdowych?

Smart Beta Święty Graal indeksów giełdowych? Smart Beta Święty Graal indeksów giełdowych? Agenda Smart Beta w Polsce Strategie heurystyczne i optymalizacyjne Strategie fundamentalne Portfel losowy 2 Agenda Smart Beta w Polsce Strategie heurystyczne

Bardziej szczegółowo

INSTRUKCJA BHP PRZY RECZNYCH PRACACH TRANSPORTOWYCH DLA PRACOWNIKÓW KUCHENKI ODDZIAŁOWEJ.

INSTRUKCJA BHP PRZY RECZNYCH PRACACH TRANSPORTOWYCH DLA PRACOWNIKÓW KUCHENKI ODDZIAŁOWEJ. INSTRUKCJA BHP PRZY RECZNYCH PRACACH TRANSPORTOWYCH DLA PRACOWNIKÓW KUCHENKI ODDZIAŁOWEJ. I. UWAGI OGÓLNE. 1. Dostarczanie posiłków, ich przechowywanie i dystrybucja musza odbywać się w warunkach zapewniających

Bardziej szczegółowo

LABORATORIUM TECHNOLOGII NAPRAW WERYFIKACJA TULEJI CYLINDROWYCH SILNIKA SPALINOWEGO

LABORATORIUM TECHNOLOGII NAPRAW WERYFIKACJA TULEJI CYLINDROWYCH SILNIKA SPALINOWEGO LABORATORIUM TECHNOLOGII NAPRAW WERYFIKACJA TULEJI CYLINDROWYCH SILNIKA SPALINOWEGO 2 1. Cel ćwiczenia : Dokonać pomiaru zuŝycia tulei cylindrowej (cylindra) W wyniku opanowania treści ćwiczenia student

Bardziej szczegółowo

Młodzieńcze spondyloartropatie/zapalenie stawów z towarzyszącym zapaleniem przyczepów ścięgnistych (mspa-era)

Młodzieńcze spondyloartropatie/zapalenie stawów z towarzyszącym zapaleniem przyczepów ścięgnistych (mspa-era) www.printo.it/pediatric-rheumatology/pl/intro Młodzieńcze spondyloartropatie/zapalenie stawów z towarzyszącym zapaleniem przyczepów ścięgnistych (mspa-era) Wersja 2016 1. CZYM SĄ MŁODZIEŃCZE SPONDYLOARTROPATIE/MŁODZIEŃCZE

Bardziej szczegółowo

HAŚKO I SOLIŃSKA SPÓŁKA PARTNERSKA ADWOKATÓW ul. Nowa 2a lok. 15, 50-082 Wrocław tel. (71) 330 55 55 fax (71) 345 51 11 e-mail: kancelaria@mhbs.

HAŚKO I SOLIŃSKA SPÓŁKA PARTNERSKA ADWOKATÓW ul. Nowa 2a lok. 15, 50-082 Wrocław tel. (71) 330 55 55 fax (71) 345 51 11 e-mail: kancelaria@mhbs. HAŚKO I SOLIŃSKA SPÓŁKA PARTNERSKA ADWOKATÓW ul. Nowa 2a lok. 15, 50-082 Wrocław tel. (71) 330 55 55 fax (71) 345 51 11 e-mail: kancelaria@mhbs.pl Wrocław, dnia 22.06.2015 r. OPINIA przedmiot data Praktyczne

Bardziej szczegółowo

PILNE Informacje dotyczące bezpieczeństwa Aparat ultrasonograficzny AFFINITI 70 firmy Philips

PILNE Informacje dotyczące bezpieczeństwa Aparat ultrasonograficzny AFFINITI 70 firmy Philips Strona 1 z 5 Szanowni Państwo! W aparatach ultrasonograficznych AFFINITI 70 firmy Philips wykryto usterkę, która może stanowić potencjalne zagrożenie dla pacjentów lub użytkowników. Niniejsze informacje

Bardziej szczegółowo

Urząd Miasta Bielsko-Biała - um.bielsko.pl Wygenerowano: 2016-06-17/10:16:18

Urząd Miasta Bielsko-Biała - um.bielsko.pl Wygenerowano: 2016-06-17/10:16:18 Europejski Dzień Prostaty obchodzony jest od 2006 roku z inicjatywy Europejskiego Towarzystwa Urologicznego. Jego celem jest zwiększenie społecznej świadomości na temat chorób gruczołu krokowego. Gruczoł

Bardziej szczegółowo

SYSTEM FINANSOWANIA NIERUCHOMOŚCI MIESZKANIOWYCH W POLSCE

SYSTEM FINANSOWANIA NIERUCHOMOŚCI MIESZKANIOWYCH W POLSCE SYSTEM FINANSOWANIA NIERUCHOMOŚCI MIESZKANIOWYCH W POLSCE Wstęp Rozdział 1 przedstawia istotę mieszkania jako dobra ekonomicznego oraz jego rolę i funkcje na obecnym etapie rozwoju społecznego i ekonomicznego.

Bardziej szczegółowo

Rekompensowanie pracy w godzinach nadliczbowych

Rekompensowanie pracy w godzinach nadliczbowych Rekompensowanie pracy w godzinach nadliczbowych PRACA W GODZINACH NADLICZBOWYCH ART. 151 1 K.P. Praca wykonywana ponad obowiązujące pracownika normy czasu pracy, a także praca wykonywana ponad przedłużony

Bardziej szczegółowo

Szczegółowe wyjaśnienia dotyczące definicji MŚP i związanych z nią dylematów

Szczegółowe wyjaśnienia dotyczące definicji MŚP i związanych z nią dylematów 1 Autor: Aneta Para Szczegółowe wyjaśnienia dotyczące definicji MŚP i związanych z nią dylematów Jak powiedział Günter Verheugen Członek Komisji Europejskiej, Komisarz ds. przedsiębiorstw i przemysłu Mikroprzedsiębiorstwa

Bardziej szczegółowo

Ustawienie wózka w pojeździe komunikacji miejskiej - badania. Prawidłowe ustawienie

Ustawienie wózka w pojeździe komunikacji miejskiej - badania. Prawidłowe ustawienie Ustawienie wózka w pojeździe komunikacji miejskiej - badania Przodem do kierunku jazdy? Bokiem? Tyłem? Jak ustawić wózek, aby w razie awaryjnego hamowania dziecko było jak najbardziej bezpieczne? Na te

Bardziej szczegółowo

Materiał i metody. Wyniki

Materiał i metody. Wyniki Abstract in Polish Wprowadzenie Selen jest pierwiastkiem śladowym niezbędnym do prawidłowego funkcjonowania organizmu. Selen jest wbudowywany do białek w postaci selenocysteiny tworząc selenobiałka (selenoproteiny).

Bardziej szczegółowo

STATUT KOŁA NAUKOWEGO PRAWA MEDYCZNEGO. Rozdział I. Postanowienia ogólne

STATUT KOŁA NAUKOWEGO PRAWA MEDYCZNEGO. Rozdział I. Postanowienia ogólne STATUT KOŁA NAUKOWEGO PRAWA MEDYCZNEGO Rozdział I. Postanowienia ogólne 1 Koło Naukowe Prawa Medycznego, zwane dalej Kołem, jest dobrowolną organizacją studencką. Funkcjonuje na Wydziale Prawa i Administracji

Bardziej szczegółowo

ZAKRES OBOWIĄZKÓW I UPRAWNIEŃ PRACODAWCY, PRACOWNIKÓW ORAZ POSZCZEGÓLNYCH JEDNOSTEK ORGANIZACYJNYCH ZAKŁADU PRACY

ZAKRES OBOWIĄZKÓW I UPRAWNIEŃ PRACODAWCY, PRACOWNIKÓW ORAZ POSZCZEGÓLNYCH JEDNOSTEK ORGANIZACYJNYCH ZAKŁADU PRACY ZAKRES OBOWIĄZKÓW I UPRAWNIEŃ PRACODAWCY, PRACOWNIKÓW ORAZ POSZCZEGÓLNYCH JEDNOSTEK ORGANIZACYJNYCH ZAKŁADU PRACY Szkolenia bhp w firmie szkolenie wstępne ogólne 8 Obowiązki pracodawcy Podstawowy obowiązek

Bardziej szczegółowo

Zmiany pozycji techniki

Zmiany pozycji techniki ROZDZIAŁ 3 Zmiany pozycji techniki Jak zmieniać pozycje chorego w łóżku W celu zapewnienia choremu komfortu oraz w celu zapobieżenia odleżynom konieczne jest m.in. stosowanie zmian pozycji ciała chorego

Bardziej szczegółowo

Harmonogramowanie projektów Zarządzanie czasem

Harmonogramowanie projektów Zarządzanie czasem Harmonogramowanie projektów Zarządzanie czasem Zarządzanie czasem TOMASZ ŁUKASZEWSKI INSTYTUT INFORMATYKI W ZARZĄDZANIU Zarządzanie czasem w projekcie /49 Czas w zarządzaniu projektami 1. Pojęcie zarządzania

Bardziej szczegółowo

3.3.3 Py³ PM10. Tabela 3.3.3.1 Py³ PM10 - stê enia œrednioroczne i œredniookresowe

3.3.3 Py³ PM10. Tabela 3.3.3.1 Py³ PM10 - stê enia œrednioroczne i œredniookresowe Wyniki pomiarów z sieci ARMAAG Fundacja ARMAAG Raport 1999 3.3.3 Py³ PM10 Py³ PM10 mierzony by³ w stacjach ARMAAG dwiema metodami: metod¹ radiometryczn¹ analizatorem firmy Eberline i metod¹ wagow¹, py³omierzem

Bardziej szczegółowo

KLAUZULE ARBITRAŻOWE

KLAUZULE ARBITRAŻOWE KLAUZULE ARBITRAŻOWE KLAUZULE arbitrażowe ICC Zalecane jest, aby strony chcące w swych kontraktach zawrzeć odniesienie do arbitrażu ICC, skorzystały ze standardowych klauzul, wskazanych poniżej. Standardowa

Bardziej szczegółowo

INSTRUKCJA SERWISOWA. Wprowadzenie nowego filtra paliwa PN 874060 w silnikach ROTAX typ 912 is oraz 912 is Sport OPCJONALNY

INSTRUKCJA SERWISOWA. Wprowadzenie nowego filtra paliwa PN 874060 w silnikach ROTAX typ 912 is oraz 912 is Sport OPCJONALNY Wprowadzenie nowego filtra paliwa PN 874060 w silnikach ROTAX typ 912 is oraz 912 is Sport ATA System: Układ paliwowy OPCJONALNY 1) Zastosowanie Aby osiągnąć zadowalające efekty, procedury zawarte w niniejszym

Bardziej szczegółowo

Skuteczność i regeneracja 48h albo zwrot pieniędzy

Skuteczność i regeneracja 48h albo zwrot pieniędzy REGULAMIN AKCJI PROMOCYJNEJ Skuteczność i regeneracja 48h albo zwrot pieniędzy 1. ORGANIZATOR, CZAS TRWANIA AKCJI PROMOCYJNEJ, PROGRAM AKCJI 1.1 Organizatorem akcji promocyjnej prowadzonej pod nazwą Skuteczność

Bardziej szczegółowo

INSTYTUCJE WYMIARU SPRAWIEDLIWOŚCI WARSZAWA, LIPIEC 2000

INSTYTUCJE WYMIARU SPRAWIEDLIWOŚCI WARSZAWA, LIPIEC 2000 CBOS CENTRUM BADANIA OPINII SPOŁECZNEJ SEKRETARIAT OŚRODEK INFORMACJI 629-35 - 69, 628-37 - 04 693-58 - 95, 625-76 - 23 UL. ŻURAWIA 4A, SKR. PT.24 00-503 W A R S Z A W A TELEFAX 629-40 - 89 INTERNET http://www.cbos.pl

Bardziej szczegółowo

OPIS PRZEDMIOTU ZAMÓWIENIA DO ZAPYTANIA KE1/POIG 8.2/13

OPIS PRZEDMIOTU ZAMÓWIENIA DO ZAPYTANIA KE1/POIG 8.2/13 Zapytanie ofertowe - Działanie PO IG 8.2 Warszawa, dnia 13.12.2013 r. OPIS PRZEDMIOTU ZAMÓWIENIA DO ZAPYTANIA KE1/POIG 8.2/13 ISTOTNE INFORMACJE O PROJEKCIE: Celem projektu "Wdrożenie zintegrowanego systemu

Bardziej szczegółowo

na dostawę licencji na oprogramowanie przeznaczone do prowadzenia zaawansowanej analizy statystycznej

na dostawę licencji na oprogramowanie przeznaczone do prowadzenia zaawansowanej analizy statystycznej Warszawa, dnia 16.10.2015r. ZAPYTANIE OFERTOWE na dostawę licencji na oprogramowanie przeznaczone do prowadzenia zaawansowanej analizy statystycznej Do niniejszego postępowania nie mają zastosowania przepisy

Bardziej szczegółowo

warsztató OMNM ar n medk oafał ptaszewskii mgr goanna tieczorekjmowiertowskai mgr Agnieszka jarkiewicz

warsztató OMNM ar n medk oafał ptaszewskii mgr goanna tieczorekjmowiertowskai mgr Agnieszka jarkiewicz warsztató OMNM ar n medk oafał ptaszewskii mgr goanna tieczorekjmowiertowskai mgr Agnieszka jarkiewicz } Pacjent w badaniu klinicznym a NFZ } Kalkulacja kosztów } Współpraca z zespołem badawczym jak tworzyć

Bardziej szczegółowo

Wsparcie wykorzystania OZE w ramach RPO WL 2014-2020

Wsparcie wykorzystania OZE w ramach RPO WL 2014-2020 Wsparcie wykorzystania OZE w ramach RPO WL 2014-2020 Zarys finansowania RPO WL 2014-2020 Na realizację Regionalnego Programu Operacyjnego Województwa Lubelskiego na lata 2014-2020 przeznaczono łączną kwotę

Bardziej szczegółowo

U S T A W A. z dnia. o zmianie ustawy o ułatwieniu zatrudnienia absolwentom szkół. Art. 1.

U S T A W A. z dnia. o zmianie ustawy o ułatwieniu zatrudnienia absolwentom szkół. Art. 1. P r o j e k t z dnia U S T A W A o zmianie ustawy o ułatwieniu zatrudnienia absolwentom szkół. Art. 1. W ustawie z dnia 18 września 2001 r. o ułatwieniu zatrudnienia absolwentom szkół (Dz.U. Nr 122, poz.

Bardziej szczegółowo

Regulamin Zarządu Pogórzańskiego Stowarzyszenia Rozwoju

Regulamin Zarządu Pogórzańskiego Stowarzyszenia Rozwoju Regulamin Zarządu Pogórzańskiego Stowarzyszenia Rozwoju Art.1. 1. Zarząd Pogórzańskiego Stowarzyszenia Rozwoju, zwanego dalej Stowarzyszeniem, składa się z Prezesa, dwóch Wiceprezesów, Skarbnika, Sekretarza

Bardziej szczegółowo

VADEMECUM. Rehabilitacja. Rehabilitacja w warunkach ambulatoryjnych. Rehabilitacja w warunkach domowych

VADEMECUM. Rehabilitacja. Rehabilitacja w warunkach ambulatoryjnych. Rehabilitacja w warunkach domowych Rehabilitacja Rehabilitacja to kompleksowe post powanie, które ma na celu przywrócenie pe nej lub mo liwej do osi gni cia sprawno ci zycznej i psychicznej, zdolno ci do pracy i zarobkowania oraz zdolno

Bardziej szczegółowo

DTR.ZL-24-08 APLISENS PRODUKCJA PRZETWORNIKÓW CIŚNIENIA I APARATURY POMIAROWEJ INSTRUKCJA OBSŁUGI (DOKUMENTACJA TECHNICZNO-RUCHOWA)

DTR.ZL-24-08 APLISENS PRODUKCJA PRZETWORNIKÓW CIŚNIENIA I APARATURY POMIAROWEJ INSTRUKCJA OBSŁUGI (DOKUMENTACJA TECHNICZNO-RUCHOWA) DTR.ZL-24-08 APLISENS PRODUKCJA PRZETWORNIKÓW CIŚNIENIA I APARATURY POMIAROWEJ INSTRUKCJA OBSŁUGI (DOKUMENTACJA TECHNICZNO-RUCHOWA) ZASILACZ SIECIOWY TYPU ZL-24-08 WARSZAWA, KWIECIEŃ 2008. APLISENS S.A.,

Bardziej szczegółowo

Szczegółowy opis zamówienia

Szczegółowy opis zamówienia ZFE-II.042.2. 24.2015 Szczegółowy opis zamówienia I. Zasady przeprowadzenia procedury zamówienia 1. Zamówienie realizowane jest na podstawie art.70 1 i 70 3 70 5 Kodeksu Cywilnego ( Dz. U. z 2014 r. poz.

Bardziej szczegółowo

PROTOKÓŁ. Kontrolę przeprowadzono w dniach : 24, 25, 31.05. 2005 roku oraz 10. 06. 2005 roku,

PROTOKÓŁ. Kontrolę przeprowadzono w dniach : 24, 25, 31.05. 2005 roku oraz 10. 06. 2005 roku, PROTOKÓŁ z kontroli w Warsztatach Terapii Zajęciowej Polskiego Stowarzyszenia na Rzecz Osób z Upośledzeniem Umysłowym Koło w Słupsku przeprowadzonej przez Głównego Specjalistę Wydziału Audytu i Kontroli

Bardziej szczegółowo

Zapytanie ofertowe nr 3

Zapytanie ofertowe nr 3 I. ZAMAWIAJĄCY STUDIUM JĘZYKÓW OBCYCH M. WAWRZONEK I SPÓŁKA s.c. ul. Kopernika 2 90-509 Łódź NIP: 727-104-57-16, REGON: 470944478 Zapytanie ofertowe nr 3 II. OPIS PRZEDMIOTU ZAMÓWIENIA Przedmiotem zamówienia

Bardziej szczegółowo

Wprowadzenie nowego pracownika. wydanie 1. ISBN 978-83-255-0049-8. Autor: Justyna Tyborowska. Redakcja: Joanna Tyszkiewicz

Wprowadzenie nowego pracownika. wydanie 1. ISBN 978-83-255-0049-8. Autor: Justyna Tyborowska. Redakcja: Joanna Tyszkiewicz Wprowadzenie nowego pracownika wydanie 1. ISBN 978-83-255-0049-8 Autor: Justyna Tyborowska Redakcja: Joanna Tyszkiewicz Wydawnictwo C.H. Beck Ul. Gen. Zajączka 9, 01-518 Warszawa Tel. (022) 311 22 22 Faks

Bardziej szczegółowo

EGZEMPLARZ ARCHIWALNY WZORU UŻYTKOWEGO (12,OPIS OCHRONNY. (19) PL di)62974 B62D 57/02 (2006.01) Dudek Piotr, Włocławek, PL

EGZEMPLARZ ARCHIWALNY WZORU UŻYTKOWEGO (12,OPIS OCHRONNY. (19) PL di)62974 B62D 57/02 (2006.01) Dudek Piotr, Włocławek, PL EGZEMPLARZ ARCHIWALNY RZECZPOSPOLITA POLSKA Urząd Patentowy Rzeczypospolitej Polskiej (12,OPIS OCHRONNY WZORU UŻYTKOWEGO (21) Numer zgłoszenia: 114126 (22) Data zgłoszenia: 11.06.2003 (19) PL di)62974

Bardziej szczegółowo

CD-W00-00-0 Przetwornik stężenia CO 2 do montażu naściennego. Cechy i Korzyści. Rysunek 1: Przetwornik stężenia CO 2 do montażu naściennego

CD-W00-00-0 Przetwornik stężenia CO 2 do montażu naściennego. Cechy i Korzyści. Rysunek 1: Przetwornik stężenia CO 2 do montażu naściennego Karta informacyjna wyrobu CD-W00 Data wydania 06 2001 CD-W00-00-0 Przetwornik stężenia CO 2 do montażu naściennego W prowadzenie Johson Controls posiada w swojej ofercie pełną linię przetworników przekształcających

Bardziej szczegółowo

Rudniki, dnia 10.02.2016 r. Zamawiający: PPHU Drewnostyl Zenon Błaszak Rudniki 5 64-330 Opalenica NIP 788-000-22-12 ZAPYTANIE OFERTOWE

Rudniki, dnia 10.02.2016 r. Zamawiający: PPHU Drewnostyl Zenon Błaszak Rudniki 5 64-330 Opalenica NIP 788-000-22-12 ZAPYTANIE OFERTOWE Zamawiający: Rudniki, dnia 10.02.2016 r. PPHU Drewnostyl Zenon Błaszak Rudniki 5 64-330 Opalenica NIP 788-000-22-12 ZAPYTANIE OFERTOWE W związku z planowaną realizacją projektu pn. Rozwój działalności

Bardziej szczegółowo

Strategia rozwoju sieci dróg rowerowych w Łodzi w latach 2015-2020+

Strategia rozwoju sieci dróg rowerowych w Łodzi w latach 2015-2020+ Strategia rozwoju sieci dróg rowerowych w Łodzi w latach 2015-2020+ Projekt: wersja β do konsultacji społecznych Opracowanie: Zarząd Dróg i Transportu w Łodzi Ul. Piotrkowska 175 90-447 Łódź Spis treści

Bardziej szczegółowo

Sprawa numer: BAK.WZP.230.2.2015.34 Warszawa, dnia 27 lipca 2015 r. ZAPROSZENIE DO SKŁADANIA OFERT

Sprawa numer: BAK.WZP.230.2.2015.34 Warszawa, dnia 27 lipca 2015 r. ZAPROSZENIE DO SKŁADANIA OFERT Sprawa numer: BAK.WZP.230.2.2015.34 Warszawa, dnia 27 lipca 2015 r. ZAPROSZENIE DO SKŁADANIA OFERT 1. Zamawiający: Skarb Państwa - Urząd Komunikacji Elektronicznej ul. Kasprzaka 18/20 01-211 Warszawa 2.

Bardziej szczegółowo

XVIII ORDYNATORSKIE ZAKOPIAÑSKIE DNI KARDIOLOGICZNE 10-13 paÿdziernika 2013 CZWARTEK 10.10.2013

XVIII ORDYNATORSKIE ZAKOPIAÑSKIE DNI KARDIOLOGICZNE 10-13 paÿdziernika 2013 CZWARTEK 10.10.2013 2 CZWARTEK 10.10.2013 18.00-20.30 Sala A - Sala im. Józefa Pi³sudskiego, poziom 2 Powitanie Uczestników XVIII Ordynatorskich Zakopiañskich Dni Kardiologicznych - kilka s³ów o Podyplomowej Szkole Kardiologicznej

Bardziej szczegółowo

Sprawozdanie z działalności Rady Nadzorczej TESGAS S.A. w 2008 roku.

Sprawozdanie z działalności Rady Nadzorczej TESGAS S.A. w 2008 roku. Sprawozdanie z działalności Rady Nadzorczej TESGAS S.A. w 2008 roku. Rada Nadzorcza zgodnie z treścią Statutu Spółki składa się od 5 do 9 Członków powoływanych przez Walne Zgromadzenie w głosowaniu tajnym.

Bardziej szczegółowo

Dr inż. Andrzej Tatarek. Siłownie cieplne

Dr inż. Andrzej Tatarek. Siłownie cieplne Dr inż. Andrzej Tatarek Siłownie cieplne 1 Wykład 3 Sposoby podwyższania sprawności elektrowni 2 Zwiększenie sprawności Metody zwiększenia sprawności elektrowni: 1. podnoszenie temperatury i ciśnienia

Bardziej szczegółowo

Wymagania z zakresu ocen oddziaływania na środowisko przy realizacji i likwidacji farm wiatrowych

Wymagania z zakresu ocen oddziaływania na środowisko przy realizacji i likwidacji farm wiatrowych Wymagania z zakresu ocen oddziaływania na środowisko przy realizacji i likwidacji farm wiatrowych Andrzej Dziura Zastępca Generalnego Dyrektora Ochrony Środowiska Przedsięwzięcia wymagające oceny oddziaływania

Bardziej szczegółowo

Zapytanie ofertowe dotyczące wyboru wykonawcy (biegłego rewidenta) usługi polegającej na przeprowadzeniu kompleksowego badania sprawozdań finansowych

Zapytanie ofertowe dotyczące wyboru wykonawcy (biegłego rewidenta) usługi polegającej na przeprowadzeniu kompleksowego badania sprawozdań finansowych Zapytanie ofertowe dotyczące wyboru wykonawcy (biegłego rewidenta) usługi polegającej na przeprowadzeniu kompleksowego badania sprawozdań finansowych Data publikacji 2016-04-29 Rodzaj zamówienia Tryb zamówienia

Bardziej szczegółowo

BEZPIECZE STWO PRACY Z LASERAMI

BEZPIECZE STWO PRACY Z LASERAMI BEZPIECZE STWO PRACY Z LASERAMI Szkodliwe dzia anie promieniowania laserowego dotyczy oczu oraz skóry cz owieka, przy czym najbardziej zagro one s oczy. Ze wzgl du na kierunkowo wi zki zagro enie promieniowaniem

Bardziej szczegółowo

Przygotowały: Magdalena Golińska Ewa Karaś

Przygotowały: Magdalena Golińska Ewa Karaś Przygotowały: Magdalena Golińska Ewa Karaś Druk: Drukarnia VIVA Copyright by Infornext.pl ISBN: 978-83-61722-03-8 Wydane przez Infornext Sp. z o.o. ul. Okopowa 58/72 01 042 Warszawa www.wieszjak.pl Od

Bardziej szczegółowo

USTAWA. z dnia 29 sierpnia 1997 r. Ordynacja podatkowa. Dz. U. z 2015 r. poz. 613 1

USTAWA. z dnia 29 sierpnia 1997 r. Ordynacja podatkowa. Dz. U. z 2015 r. poz. 613 1 USTAWA z dnia 29 sierpnia 1997 r. Ordynacja podatkowa Dz. U. z 2015 r. poz. 613 1 (wybrane artykuły regulujące przepisy o cenach transferowych) Dział IIa Porozumienia w sprawach ustalenia cen transakcyjnych

Bardziej szczegółowo

Podstawowe pojęcia: Populacja. Populacja skończona zawiera skończoną liczbę jednostek statystycznych

Podstawowe pojęcia: Populacja. Populacja skończona zawiera skończoną liczbę jednostek statystycznych Podstawowe pojęcia: Badanie statystyczne - zespół czynności zmierzających do uzyskania za pomocą metod statystycznych informacji charakteryzujących interesującą nas zbiorowość (populację generalną) Populacja

Bardziej szczegółowo

Satysfakcja pracowników 2006

Satysfakcja pracowników 2006 Satysfakcja pracowników 2006 Raport z badania ilościowego Listopad 2006r. www.iibr.pl 1 Spis treści Cel i sposób realizacji badania...... 3 Podsumowanie wyników... 4 Wyniki badania... 7 1. Ogólny poziom

Bardziej szczegółowo

Działania wdrażane przez SW PROW 2014-2020 Departament Programów Rozwoju Obszarów Wiejskich

Działania wdrażane przez SW PROW 2014-2020 Departament Programów Rozwoju Obszarów Wiejskich Działania wdrażane przez SW PROW 2014-2020 Departament Programów Rozwoju Obszarów Wiejskich Kościerzyna, 25 września 2015 Działanie: Inwestycje w środki trwałe/ scalanie gruntów Beneficjent: Starosta Koszty

Bardziej szczegółowo

Bezpieczna dzielnica - bezpieczny mieszkaniec

Bezpieczna dzielnica - bezpieczny mieszkaniec Bezpieczna dzielnica - bezpieczny mieszkaniec Program realizowany w ramach Miejskiego Programu Zapobiegania Przestępczości oraz Ochrony Bezpieczeństwa Obywateli i Porządku Publicznego. Miejski Program

Bardziej szczegółowo

Wykres 1. Płeć respondentów. Źródło: opracowanie własne. Wykres 2. Wiek respondentów.

Wykres 1. Płeć respondentów. Źródło: opracowanie własne. Wykres 2. Wiek respondentów. Ogółem w szkoleniach wzięły udział 92 osoby, które wypełniły krótką ankietę mającą na celu poznanie ich opinii dotyczących formy szkolenia, osób prowadzących, a także przydatności przekazywanych informacji.

Bardziej szczegółowo

WNIOSEK o dofinansowanie ze środków PFRON projektów w ramach programu pn. Program wyrównywania róŝnić między regionami

WNIOSEK o dofinansowanie ze środków PFRON projektów w ramach programu pn. Program wyrównywania róŝnić między regionami Załącznik nr 3 do Procedur Wniosek złoŝono w...pfron w dniu... Nr sprawy: Wypełnia PFRON WNIOSEK o dofinansowanie ze środków PFRON projektów w ramach programu pn. Program wyrównywania róŝnić między regionami

Bardziej szczegółowo

UCHWAŁA NR 1 Nadzwyczajnego Walnego Zgromadzenia Spółki ABS Investment S.A. z siedzibą w Bielsku-Białej z dnia 28 lutego 2013 roku

UCHWAŁA NR 1 Nadzwyczajnego Walnego Zgromadzenia Spółki ABS Investment S.A. z siedzibą w Bielsku-Białej z dnia 28 lutego 2013 roku UCHWAŁA NR 1 w sprawie: wyboru Przewodniczącego Walnego Zgromadzenia Działając na podstawie art. 409 1 kodeksu spółek handlowych oraz 32 ust. 1 Statutu Spółki Nadzwyczajne Walne Zgromadzenie Spółki ABS

Bardziej szczegółowo

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV

Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Ćwiczenie 3. Amplifikacja genu ccr5 Homo sapiens wykrywanie delecji Δ32pz warunkującej oporność na wirusa HIV Cel ćwiczenia Określenie podatności na zakażenie wirusem HIV poprzez detekcję homo lub heterozygotyczności

Bardziej szczegółowo

Krótka informacja o instytucjonalnej obs³udze rynku pracy

Krótka informacja o instytucjonalnej obs³udze rynku pracy Agnieszka Miler Departament Rynku Pracy Ministerstwo Gospodarki, Pracy i Polityki Spo³ecznej Krótka informacja o instytucjonalnej obs³udze rynku pracy W 2000 roku, zosta³o wprowadzone rozporz¹dzeniem Prezesa

Bardziej szczegółowo

Ogólna charakterystyka kontraktów terminowych

Ogólna charakterystyka kontraktów terminowych Jesteś tu: Bossa.pl Kurs giełdowy - Część 10 Ogólna charakterystyka kontraktów terminowych Kontrakt terminowy jest umową pomiędzy dwiema stronami, z których jedna zobowiązuje się do nabycia a druga do

Bardziej szczegółowo

Audyt SEO. Elementy oraz proces przygotowania audytu. strona

Audyt SEO. Elementy oraz proces przygotowania audytu. strona Audyt SEO Elementy oraz proces przygotowania audytu 1 Spis treści Kim jesteśmy? 3 Czym jest audyt SEO 4 Główne elementy audytu 5 Kwestie techniczne 6 Słowa kluczowe 7 Optymalizacja kodu strony 8 Optymalizacja

Bardziej szczegółowo

Stowarzyszenie Lokalna Grupa Działania EUROGALICJA Regulamin Rady

Stowarzyszenie Lokalna Grupa Działania EUROGALICJA Regulamin Rady Stowarzyszenie Lokalna Grupa Działania EUROGALICJA Regulamin Rady Rozdział I Postanowienia ogólne 1 1. Rada Stowarzyszenia Lokalna Grupa Działania Eurogalicja, zwana dalej Radą, działa na podstawie: Ustawy

Bardziej szczegółowo

Ocena skuteczności preparatów miejscowo znieczulających skórę w redukcji bólu w trakcie pobierania krwi u dzieci badanie z randomizacją

Ocena skuteczności preparatów miejscowo znieczulających skórę w redukcji bólu w trakcie pobierania krwi u dzieci badanie z randomizacją 234 Ocena skuteczności preparatów miejscowo znieczulających skórę w redukcji bólu w trakcie pobierania krwi u dzieci badanie z randomizacją The effectiveness of local anesthetics in the reduction of needle

Bardziej szczegółowo

Roczne zeznanie podatkowe 2015

Roczne zeznanie podatkowe 2015 skatteetaten.no Informacje dla pracowników zagranicznych Roczne zeznanie podatkowe 2015 W niniejszej broszurze znajdziesz skrócony opis tych pozycji w zeznaniu podatkowym, które dotyczą pracowników zagranicznych

Bardziej szczegółowo

MIÊDZYNARODOWY STANDARD REWIZJI FINANSOWEJ 520 PROCEDURY ANALITYCZNE SPIS TREŒCI

MIÊDZYNARODOWY STANDARD REWIZJI FINANSOWEJ 520 PROCEDURY ANALITYCZNE SPIS TREŒCI MIÊDZYNARODOWY STANDARD REWIZJI FINANSOWEJ 520 PROCEDURY ANALITYCZNE (Stosuje siê przy badaniu sprawozdañ finansowych sporz¹dzonych za okresy rozpoczynaj¹ce siê 15 grudnia 2009 r. i póÿniej) Wprowadzenie

Bardziej szczegółowo

Tematy prac licencjackich w Zakładzie Fizjologii Zwierząt

Tematy prac licencjackich w Zakładzie Fizjologii Zwierząt Tematy prac licencjackich w Zakładzie Fizjologii Zwierząt Zegar biologiczny Ekspresja genów i białek zegara Rytmy komórkowe Rytmy fizjologiczne Rytmy behawioralne Lokalizacja neuroprzekźników w układzie

Bardziej szczegółowo

Badania skuteczności działania filtrów piaskowych o przepływie pionowym z dodatkiem węgla aktywowanego w przydomowych oczyszczalniach ścieków

Badania skuteczności działania filtrów piaskowych o przepływie pionowym z dodatkiem węgla aktywowanego w przydomowych oczyszczalniach ścieków Uniwersytet Rolniczy im. Hugona Kołł łłątaja w Krakowie, Wydział Inżynierii Środowiska i Geodezji Katedra Inżynierii Sanitarnej i Gospodarki Wodnej K r z y s z t o f C h m i e l o w s k i Badania skuteczności

Bardziej szczegółowo

Wyznaczanie współczynnika sprężystości sprężyn i ich układów

Wyznaczanie współczynnika sprężystości sprężyn i ich układów Ćwiczenie 63 Wyznaczanie współczynnika sprężystości sprężyn i ich układów 63.1. Zasada ćwiczenia W ćwiczeniu określa się współczynnik sprężystości pojedynczych sprężyn i ich układów, mierząc wydłużenie

Bardziej szczegółowo

I. Charakterystyka przedsiębiorstwa

I. Charakterystyka przedsiębiorstwa I. Charakterystyka przedsiębiorstwa Firma odzieżowa jest spółką cywilną zajmującą się produkcją odzieży i prowadzeniem handlu hurtowego w całym kraju. Jej siedziba znajduje się w Chorzowie, a punkty sprzedaży

Bardziej szczegółowo

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA

INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH W CHOROBIE HUNTINGTONA XX Międzynarodowa konferencja Polskie Stowarzyszenie Choroby Huntingtona Warszawa, 17-18- 19 kwietnia 2015 r. Metody badań i leczenie choroby Huntingtona - aktualności INTERPRETACJA WYNIKÓW BADAŃ MOLEKULARNYCH

Bardziej szczegółowo

WZÓR SKARGI EUROPEJSKI TRYBUNAŁ PRAW CZŁOWIEKA. Rada Europy. Strasburg, Francja SKARGA. na podstawie Artykułu 34 Europejskiej Konwencji Praw Człowieka

WZÓR SKARGI EUROPEJSKI TRYBUNAŁ PRAW CZŁOWIEKA. Rada Europy. Strasburg, Francja SKARGA. na podstawie Artykułu 34 Europejskiej Konwencji Praw Człowieka WZÓR SKARGI EUROPEJSKI TRYBUNAŁ PRAW CZŁOWIEKA Rada Europy Strasburg, Francja SKARGA na podstawie Artykułu 34 Europejskiej Konwencji Praw Człowieka oraz Artykułu 45-47 Regulaminu Trybunału 1 Adres pocztowy

Bardziej szczegółowo

Twierdzenie Bayesa. Indukowane Reguły Decyzyjne Jakub Kuliński Nr albumu: 53623

Twierdzenie Bayesa. Indukowane Reguły Decyzyjne Jakub Kuliński Nr albumu: 53623 Twierdzenie Bayesa Indukowane Reguły Decyzyjne Jakub Kuliński Nr albumu: 53623 Niniejszy skrypt ma na celu usystematyzowanie i uporządkowanie podstawowej wiedzy na temat twierdzenia Bayesa i jego zastosowaniu

Bardziej szczegółowo

MIÊDZYNARODOWY STANDARD REWIZJI FINANSOWEJ 610 KORZYSTANIE Z WYNIKÓW PRACY AUDYTORÓW SPIS TREŒCI

MIÊDZYNARODOWY STANDARD REWIZJI FINANSOWEJ 610 KORZYSTANIE Z WYNIKÓW PRACY AUDYTORÓW SPIS TREŒCI MIÊDZYNARODOWY STANDARD REWIZJI FINANSOWEJ 610 KORZYSTANIE Z WYNIKÓW PRACY AUDYTORÓW WEWNÊTRZNYCH Wprowadzenie (Stosuje siê przy badaniu sprawozdañ finansowych sporz¹dzonych za okresy rozpoczynaj¹ce siê

Bardziej szczegółowo

Przykłady oszczędności energii w aplikacjach napędowych

Przykłady oszczędności energii w aplikacjach napędowych Przykłady oszczędności energii w aplikacjach napędowych Doradca Techniczny: Roman Dziaduch Rev 5058-CO900C Oszczędności energetyczne dla pomp i wentylatorów z użyciem przemienników PowerFlex Rev 5058-CO900C

Bardziej szczegółowo

Regały i szafki REGAŁY I SZAFKI PRZEMYSŁOWE

Regały i szafki REGAŁY I SZAFKI PRZEMYSŁOWE Regały i szafki REGAŁY I SZAFKI PRZEMYSŁOWE R i szafki pozwalają utrzymać porządek w miejscu pracy. W naszej ofercie znajduje się szeroka gama produktów. Poszczególne serie przedstawione są na kolejnych

Bardziej szczegółowo

Odpowiedzi na pytania zadane do zapytania ofertowego nr EFS/2012/05/01

Odpowiedzi na pytania zadane do zapytania ofertowego nr EFS/2012/05/01 Odpowiedzi na pytania zadane do zapytania ofertowego nr EFS/2012/05/01 1 Pytanie nr 1: Czy oferta powinna zawierać informację o ewentualnych podwykonawcach usług czy też obowiązek uzyskania od Państwa

Bardziej szczegółowo

Zaproszenie do projektu. Warszawa Lokalnie

Zaproszenie do projektu. Warszawa Lokalnie Zaproszenie do projektu Warszawa Lokalnie CO WYDARZY SI W SZKOŁACH? 2 Lekcje wychowawcze Na temat możliwo ci, jakie stoją przed mieszańcami a dotyczą podejmowania oddolnych, lokalnych, sąsiedzkich działań.

Bardziej szczegółowo